- Email: [email protected]
The comparison of BLyS-binding peptides from phage display library and computer-aided design on BLyS–TACI interaction
International Immunopharmacology 24 (2015) 219–223
Contents lists available at ScienceDirect
International Immunopharmacology journal homepage: www.elsevier.com/locate/intimp
The comparison of BLyS-binding peptides from phage display library and computer-aided design on BLyS–TACI interaction Yacong Zhao a,1, Xiafei Hao a,1, Jiannan Feng b, Beifen Shen b, Jing Wei a,⁎, Jian Sun a,⁎ a b
Department of Molecular and Cellular Pharmacology, School of Pharmaceutical Science and Technology, Tianjin University, Tianjin 300072, PR China Institute of Basic Medical Sciences, Beijing 100850, PR China
a r t i c l e
i n f o
Article history: Received 13 July 2014 Received in revised form 30 November 2014 Accepted 9 December 2014 Available online 19 December 2014 Keywords: BLyS BLyS antagonists Peptibody Computer-aided design Autoimmune diseases
a b s t r a c t BLyS antagonists have become the therapeutic reagents in the treatment of autoimmune disorders. BLyS binding peptides and their Fc fusion proteins may be alternative BLyS antagonists in such application. In this study, the activity of BLyS binding peptide 814 obtained from phage display library and peptide TA designed by computer-aided modeling on the interaction of BLyS–TACI was compared. In addition, to maintain the spatial conformation and stability of the peptides, human IgG1 Fc fragment was fused to peptides 814 and TA to form peptide-Fc fusion proteins, steady and innovative peptibodies. The prokaryotic expression plasmids pET30a814-Fc and pET30a-TA-Fc for these peptibodies were acquired by genetic engineering, and confirmed by DNA sequencing. After the right plasmids were transformed into Escherichia coli BL21 (DE3), the fusion proteins were expressed and purified by protein A affinity column. As a result of competitive ELISA, peptides 814 and TA at 100 μg/ml displayed 52.2% and 28.6% inhibition on the interaction of TACI-Fc with BLyS respectively. Moreover, 814-Fc and TA-Fc fusion proteins could bind to BLyS in a dosage-dependent manner as TACI-Fc did, and displayed 54.7% and 26.1% inhibition on the interaction of TACI-Fc-Myc with BLyS at 100 μg/ml respectively. So 814-Fc and TA-Fc proteins had the similar bioactivity as the peptides did. Furthermore, compared with TA-Fc, 814-Fc showed two-fold inhibition effect on BLyS binding to TACI, suggesting that 814-Fc could inhibit BLyS bioactivity significantly and might serve as a potential antagonist to treat autoimmune diseases associated with BLyS overexpression. © 2014 Elsevier B.V. All rights reserved.
1. Introduction In the pathogenesis studies of autoimmune diseases, a tumor necrosis factor (TNF) family member, named B lymphocyte stimulator (BLyS), has become a vital therapeutic target. BLyS, also referred to as B cellactivating factor belonging to the TNF family (BAFF), or TNF and apoptosis ligand-related leukocyte-expressed ligand 1 (TALL-1), is expressed by monocytes, macrophages and dendritic cells [1–3]. It is also released as a soluble form from cell membranes. Three transmembrane proteins: B cell maturation antigen (BCMA), transmembrane activator and calcium modulator and cyclophilin ligand interactor (TACI) and BAFF receptor (BAFF-R or BR3), which are expressed primarily on B cells are three BLyS receptors. Through binding to specific BLyS receptors, BLyS transmits signals and plays as an essential survival factor to regulate B-cell proliferation, maturation and homeostasis [4,5]. BLyS transgenic mice with increasing BLyS level had develop systemic lupus erythematosus
⁎ Corresponding authors at: Department of Molecular and Cellular Pharmacology, School of Pharmaceutical Science and Technology, Tianjin University, 92 Weijin Road, Nankai District, Tianjin 300072, PR China. Tel.: +86 22 87401943; fax: +86 22 27892025. E-mail addresses: [email protected] (J. Wei), [email protected] (J. Sun). 1 Co-first authors.
http://dx.doi.org/10.1016/j.intimp.2014.12.013 1567-5769/© 2014 Elsevier B.V. All rights reserved.
like symptoms. Equally, excessive BLyS serum production has been observed in the patients suffering from autoimmune diseases, such as Sjogren's syndrome (SS), systemic lupus erythematosus (SLE) and rheumatoid arthritis (RA) [6,7]. As a consequence, BLyS-targeting therapy is the excellent strategy of treating B cell related autoimmune diseases [8–10]. Currently, various BLyS antagonists, including anti-BLyS monoclonal antibody and soluble BAFF receptor-IgG1 Fc fusion protein, have been testified to have broad application prospects [11–13]. Benlysta (Belimumab), a monoclonal antibody against human BLyS protein, was the first drug authorized by America Food and Drug Administration to treat SLE patients in the past 50 years [14,15]. Belimumab has a positive effect on preventing the exacerbation of the disease and improving the symptoms in the Phase III clinical study [11]. Compared with large molecular BLyS antagonists above, peptide has unique superiorities to be a novel BLyS inhibitor in physical and chemical properties. AMG623 developed by Anthera Pharmaceuticals (Hayward, USA), is a BLyS binding peptide fused with human IgG1 Fc and used as a BLyS antagonist under the clinical trial currently [16]. BLyS binding peptides are usually obtained by phage display, which is a well-established technology for identification of peptide binders to a variety of proteins [16,17]. Since the crystal structures of BLyS and
220
Y. Zhao et al. / International Immunopharmacology 24 (2015) 219–223
its receptors are known, it is possible to design BLyS antagonist peptides by computer-aided drug design (CADD) [18,19]. In this study, the activity of BLyS binding peptides from phage display library and computeraided modeling was compared. Peptide 814 reported by Fleming TJ's study, was identified from phage library and bound to BLyS with affinity and selectivity [17]. Peptide TA, a BLyS binding peptide, was designed by the computer-aided modeling based on the structural characteristics and interacting mode of TACI–BLyS complex. In order to study the feasibility of peptides 814 and TA as BLyS antagonist, the peptides were fused to human IgG1 Fc fragment to form peptibodies. The activity of peptides, as well as peptibodies was analyzed. 2. Materials and methods 2.1. Reagents Recombinant proteins human IgG1 Fc, TACI-Fc, TACI-Fc-Myc, TA-Fc and human BLyS were previously prepared in the laboratory [18–20]. Peptide 814 (ANWYDPLTKLWL), TA (DTSKLASTGYSSDPY) and an irrelevant peptide NP (DIDFLIEEIERLGQDL) were synthesized by China Peptides Co., Ltd. (Shanghai, China). DNA polymerase, T4 DNA ligase, restriction endonucleases EcoRI, HindIII, and NdeI were purchased from Takara (Dalian, China). Primer synthesis and DNA sequencing were accomplished by Life Technologies (Shanghai, China). Plasmid extraction kit and Gel extraction kit were purchased from Promega (Madison, USA). Peroxidase-Conjugated Goat Anti-Human IgG (H + L), Myc tag antibodies and Peroxidase-Conjugated AffiniPure Goat AntiMouse IgG (H + L) were purchased from ZSGB-Bio (Beijing, China). Kana antibiotics, Isopropyl β-D-1-Thiogalactopyranoside (IPTG) and 3,3′,5,5′-Tetramethylbenzidine (TMB) were from Sigma (Colorado, USA). 2.2. The design of peptide TA According to the spatial structure of BLyS–TACI complexes, in the basis of rational determination of key position domain in BLyS–TACI mutual recognition, BLyS peptide binders were selected by computer high-throughput virtual screening. The amino acids were connected to construct a peptide possessing the desired structural and electrostatic properties complementary with the active pocket of the BLyS protein. Molecular docking was performed for the potential affinity evaluations of the designed peptides. One of the optimal BLyS binding peptides, named TA, would be further applied to experiments. 2.3. Competitive ELISA assay of peptides 814 and TA Human BLyS protein was diluted with 0.1 M sodium carbonate buffer (pH 9.6) to a final concentration of 10 μg/ml. ELISA plate was coated with 50 μl of BLyS at 4 °C for 18 h. Washed with 0.05% PBST buffer (0.01 M PB, 0.15 M NaCl and 0.05% Tween 20, pH 7.4) three times, each plate was blocked with 150 μl of 5% skim milk in 0.05% PBST buffer at 37 °C for 2 h. 50 μl of peptide 814 or TA at different concentrations (0, 10, 50 and 100 μg/ml), containing 5 μg/ml of TACI-Fc protein, was added to wells of plates coated with BLyS and incubated at 37 °C for 1 h. NP, an irrelevant peptide, was used as a negative control. After washing the plates with 0.05% PBST buffer three times, 50 μl of 1:5000 diluted Peroxidase-Conjugated Goat Anti-Human IgG antibody was added and incubated at 37 °C for 1 h. Washed with 0.05% PBST buffer three times, 50 μl of color developing agent was added to each well (0.4 mM TMB and 8.5 mM H2O2) and placed in the dark at 37 °C for 9 min. The reactions were stopped by adding 50 μl of 1 M H2SO4. The OD was measured by an ELISA reader at A450. With the following formula, the inhibition ratio of TACI-Fc binding to BLyS by peptides was calculated: %Inhibition ratio ¼ ATACI Fc –ATACI Fcþinhibitor =ATACI Fc 100%:
2.4. Construction and expression of 814-Fc and TA-Fc fusion gene Based on the sequences of peptides 814 and TA, DNA primers encoding 814 and TA were designed and synthesized by Life Technologies (Shanghai, China). The primer sequences of peptide 814 were: 5′TATGGCTAACTGGTATGACCCGCTGACCAAACTGTGGCTGGGTGGAGGTG GA TCTG-3′ (56 bp) and 5′-AATTCAGATCCACCTCCACCCAGCCACAGTTT GGTCAGCGGTCATA CCAGTTAGCCA-3′ (57 bp) with the sticking end of NdeI at the 5′-end and sticking end of EcoRI at the 3′-end respectively. The primer sequences of peptide TA were: 5′-TATGGACACCTCTAAG CTC GCTTCTACCGGCTACTCTTCTGACCCGTACGGTGGAGGTGGATCTG-3′ (65 bp) and 5′-AATT CAGATCCACCTCCACCGTACGGGTCAGAAGAGTA GCCGGTAGAAGCGAGCTTAGAGGTG TCCA-3′(67 bp) with the sticking end of NdeI at the 5′-end and sticking end of EcoRI at the 3′-end respectively. 20 μl of each primer (16 pmol/μl) was mixed in a 1.5 ml EP tube and incubated in 100 °C water for 3 min. After cooling to room temperature gradually, double-stranded DNA was detected by 2% agarose gel electrophoresis. Human IgG1 Fc DNA fragment was obtained by PCR, and digested by HindIII and EcoRI. Then it was ligated with 814 or TA DNA fragment into a pET30a vector, which had previously been digested by HindIII and NdeI. The ligation mixture was transformed into JM109, the positive clones on Kana plate were analyzed by colony PCR, restriction enzyme digestion and confirmed by DNA sequencing. The correct recombinant plasmids were transformed into Escherichia coli BL21 (DE3), induced with IPTG at different temperatures and analyzed by SDS-PAGE. The transformants with high expression of fusion proteins were inoculated in LB + Kana medium overnight at 37 °C. When the medium OD was 0.5, IPTG was added to 0.5 mM. After 16 h of induced cultivation at 16 °C, the bacterium was centrifuged at 8000 r/min for 10 min and kept in PBS. After freeze and thaw about three times, the cells were broken by ultrasonication in ice bath. After centrifugation at 12,000 r/min for 10 min, the supernatant was collected and its pH was adjusted to 8. The supernatant was loaded to a protein A affinity column. The bound protein was eluted by citric acid (pH 3.0) and dialyzed by PBS (pH 8.0) overnight. The purified protein was analyzed by SDS-PAGE. 2.5. ELISA analysis of 814-Fc and TA-Fc fusion proteins Human protein BLyS was coated on the ELISA plates and blocked as described before. 50 μl of 814-Fc and TA-Fc fusion proteins at different concentrations (0, 6.25, 12.5, 25, 50 and 100 μg/ml) was added into plates coated with BLyS and incubated at 37 °C for 1 h. Human IgG1 Fc and TACI-Fc proteins were used as negative and positive controls respectively. The subsequent experimental procedures were pursued as described before. With the following formula, the binding ratio of fusion proteins binding to BLyS was calculated: %Binding ratio ¼ Afusion
protein –A Fc
=ðATACI Fc –A Fc Þ 100%:
Competitive ELISA assay was used to detect the inhibitory activity of peptibodies. The saturated concentration of TACI-Fc-Myc binding to BLyS was determined at 2 μg/ml. Human protein BLyS was coated and blocked on the ELISA plates as 2.2. 50 μl of 814-Fc and TA-Fc fusion proteins at different concentrations (0, 10, 25, 50, and 100 μg/ml), containing 2 μg/ml of TACI-Fc-Myc protein, was added into plates coated with BLyS and incubated at 37 °C for 1 h. Human IgG1 Fc and TACI-Fc proteins were used as negative and positive controls respectively. After washing the plates with 0.05% PBST buffer three times, 50 μl of 1:1000 diluted anti-Myc tag antibody was added and incubated at 37 °C for 1 h. After washing the plates with 0.05% PBST buffer three times, 50 μl of 1:5000 diluted Peroxidase-Conjugated Goat Anti-Mouse IgG antibody was added and incubated at 37 °C for 1 h. The color developing procedures were pursued as described before. With the following formula, the
Y. Zhao et al. / International Immunopharmacology 24 (2015) 219–223
221
inhibition ratio of TACI-Fc-Myc binding to BLyS by peptibodies was calculated: %Inhibition ratio ¼ ATACI FcMyc –ATACI FcMycþinhibitor =ATACI FcMyc 100%: In addition, TA and 814 competitively binding to BLyS were analyzed. BLyS was coated and blocked on the ELISA plates as 2.2.50 μl of peptide 814 or TA at different concentrations (0, 10, 50 and 100 μg/ml), containing 25 μg/ml of 814-Fc protein, was added to wells of plates coated with BLyS and incubated at 37 °C for 1 h. NP was used as a negative control. The subsequent experimental procedures were pursued as 2.2. With the following formula, the inhibition ratio of 814-Fc binding to BLyS by peptides was calculated: %Inhibition ratio ¼ A814 Fc‐ –A814 Fcþpeptide =A814 Fc 100%: 3. Results
Fig. 2. Inhibition of TACI-Fc binding to BLyS by peptides 814 and TA. Different concentrations of peptides 814 and TA mixed with TACI-Fc (final concentration was 5 μg/ml) were added to plates coated with 10 μg/ml BLyS. Peptide NP was used as a negative control. After washing, the bound TACI-Fc was detected with Peroxidase-Conjugated Goat AntiHuman IgG antibody. Represented data were represented as mean ± standard deviations.
3.1. Peptide TA inserted the binding pockets of BLyS In the methods of computer high-throughput virtual screening and molecular docking, TA, an outstanding BLyS binding peptide (sequence: DTSKLASTGYSSDPY) was picked out. TA bound to the cleft formed by two BLyS chains (A chain, the primary chain and B chain, the secondary chain). Fig. 1 illustrated that the residues 4KLAST8 of TA were deeply inserted into a hydrophobic pocket involving T64, L70, R90, I92, P123 and R124 of the primary BLyS and L99 of the secondary BLyS. 3.2. Peptides 814 and TA inhibited BLyS–TACI interaction As shown in Fig. 2, peptide 814 significantly inhibited 52.2% and 34.9% of the interaction of TACI-Fc with BLyS at 100 μg/ml and 50 μg/ml respectively (p b 0.01 and p b 0.05). Peptide TA at 100 μg/ml and
Fig. 1. A close view of the binding interaction of BLyS with TA. Green: TA; yellow: A chain, the primary BLyS chain; blue: B chain, the secondary BLyS chain; red line: hydrogen bond. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
50 μg/ml displayed 28.6% and 20.8% inhibition respectively (p b 0.05), which is nearly half effect of 814. With the increasing concentration of peptides, the inhibitory activity of peptides was augmented. In contrary, NP had no inhibiting effect on BLyS–TACI interaction even at high concentration.
3.3. Construction and purification of 814-Fc and TA-Fc fusion proteins The DNA fragment encoding the peptide acquired by primer annealing was ligated with human IgG1 Fc DNA fragment into a pET30a vector. The results of colony PCR and restriction enzyme digestion showed that the three fragments were ligated successfully. DNA sequencing further verified that the 814-Fc and TA-Fc fusion genes were right. Then, the fusion genes were expressed in the E. coli prokaryotic expression system. 0.5 mM IPTG and 16 °C were an optimal condition to increase the output of soluble form and decrease the inclusion body of fusion proteins. The purified proteins were about 31 kDa in size, as theoretically predicted, and its purity was over 90% (Fig. 3). We could acquire about 1 mg of fusion protein from 2 l culture medium.
Fig. 3. Reduced SDS-PAGE analysis of purified 814-Fc and TA-Fc fusion proteins. Lane 1: TA-Fc; Lane 2: 814-Fc.
222
Y. Zhao et al. / International Immunopharmacology 24 (2015) 219–223
3.4. 814-Fc and TA-Fc fusion proteins could bind BLyS and inhibit BLyS– TACI interaction The BLyS binding activity of peptibodies was tested by conventional ELISA assay. As shown in Fig. 4, both 814-Fc and TA-Fc fusion proteins could bind to BLyS in a dosage-dependent manner. Compared to 86.9% and 52.3% binding ratios at 100 and 50 μg/ml respectively by TA-Fc, 814-Fc had a higher affinity for BLyS with 96.6% and 72.3% binding ratios at 100 and 50 μg/ml respectively. In addition, human IgG1 Fc protein could not bind to BLyS, demonstrating that 814-Fc or TA-Fc bound to BLyS specifically. The inhibitory activity of peptibodies was detected by competitive ELISA assay. As shown in Fig. 5, both 814-Fc and TA-Fc fusion proteins could inhibit BLyS–TACI interaction in a dosage-dependent manner. Above all, at 100 and 50 μg/ml with 54.7% and 32.0% inhibition ratios respectively (p b 0.05), 814-Fc behaved two-fold of inhibition effect than TA-Fc did. The inhibiting effect of positive control TACI-Fc at 100 μg/ml was 1.6-fold of 814-Fc or 3.3-fold of TA-Fc at the same concentration. Meanwhile, the inhibition ratios of fusion proteins were similar with those of peptides, suggesting that human IgG1 Fc fragment fused to peptides maintained peptide stability and bioactivity and had no negative effect on the inhibitory activity of peptides. In addition, human IgG1 Fc protein had no inhibiting effect, implying that the inhibiting effect of 814-Fc or TA-Fc was specific. 3.5. TA and 814 have different binding orientations As shown in Fig. 6, only peptide 814 displayed strong inhibiting activity on the interaction 814-Fc with BLyS in a dosage-dependent manner (p b 0.05), suggesting that 814 peptide and 814-Fc protein have the same binding sites with BLyS and 814 binding to BLyS was significant. On the contrary, peptide TA had no inhibiting effect on the interaction 814-Fc with BLyS even at high concentration, indicating that TA and 814 have different binding orientations with BLyS. 4. Discussion At present, BAFF blocking reagents consisting of BAFF receptor fusion proteins and specific human monoclonal antibodies are being developed by several companies for B-cell-mediated autoimmune diseases therapy. Clinical trials with TACI-Ig are implemented by ZymoGenetics/Serono in the treatment of systemic lupus erythematosus, rheumatoid arthritis and B cell malignancies [9,10]. Benlysta (Belimumab) by Human Genome
Fig. 4. 814-Fc and TA-Fc fusion protein could bind with BLyS well. Different concentrations of 814-Fc and TA-Fc fusion proteins were added to the plates coated with 10 μg/ml BLyS. Human IgG1 Fc and TACI-Fc proteins were used as negative and positive controls respectively. After washing, the bound proteins were detected with Peroxidase-Conjugated Goat Anti-Human IgG antibody. Represented data were represented as mean ± standard deviations.
Fig. 5. Inhibition of TACI-Fc-Myc binding to BLyS by 814-Fc and TA-Fc fusion proteins. Different concentrations of 814-Fc and TA-Fc fusion proteins mixed with TACI-Fc-Myc (final concentration was 2 μg/ml) were added to the plates coated with 10 μg/ml BLyS. Human IgG1 Fc and TACI-Fc proteins were used as negative and positive controls respectively. After washing, the bound proteins were detected with anti-Myc tag antibody and Peroxidase-Conjugated Goat Anti-Mouse IgG antibody. Represented data were represented as mean ± standard deviations.
Sciences, a monoclonal antibody against soluble BLyS, provided sufficient achievements to alleviate SLE disease symptom in Phase III clinical trials [11]. Other than these large molecular BLyS inhibitors, peptide binders have the advantage of low immunogenicity, strong permeability and simple production. AMG623, a BLyS-binding peptide, was one peptide studied to evaluate the function of BLyS-binding peptide on murine models with autoimmune diseases. Treatment with AMG623 reduced the B-cell number in mice and prevented the development of mice lupus and arthritis [16]. Phage libraries could display peptides with appropriate configuration to bind nature proteins [21–23]. Through using immobilized targeted protein, specific binding peptides can be identified from phage libraries in a screening process. Peptide 814 was selected from BLyS affinity maturation library (BAML) by phage display technique, and a potential BLyS inhibitor. BAML is a second generation phage display library selected and constructed from naive phage display library. It can make 100-fold improvement in binding affinity than BLyS-binding peptides selected from the naive phage library [17]. In this study, 814 showed two-fold inhibitory capacity than TA designed
Fig. 6. Inhibition of 814-Fc binding to BLyS by peptides 814 and TA. Different concentrations of peptides 814 and TA mixed with 814-Fc (final concentration was 25 μg/ml) were added to plates coated with 10 μg/ml BLyS. Peptide NP was used as a negative control. After washing, the bound 814-Fc was detected with Peroxidase-Conjugated Goat Anti-Human IgG antibody. Represented data were represented as mean ± standard deviations.
Y. Zhao et al. / International Immunopharmacology 24 (2015) 219–223
by CADD. The higher affinity of 814 was due to the differences of the binding pockets of 814-BLyS and TA-BLyS, and 814-BLyS binding sites seem to be more crucial for BLyS binding. These data suggested that BAML may be enriched in BLyS antagonists of more excellent biological affinity than CADD did. In addition, peptibody 814-Fc at 100 μg/ml and 50 μg/ml displayed 54.7% and 32.0% inhibition of BLyS–TACI interaction as peptide 814 did, indicating that peptide fused with human IgG1 Fc fragment not only overcame their drawbacks of instability and inefficiency, but also maintained their inhibitory activity. However, the secondary structure and binding orientation of peptide binders obtained by molecular simulation may be inconsistent with their true states. Therefore, the peptides with higher activity by CADD may be not efficient in biological analysis. In our study, a few peptides were tested biologically at one time. So if we analyze a large number of peptides designed by CADD at one time using high throughput (HTP) techniques to screen BLyS-binding peptides, we may have a chance to obtain higher effective peptides. In addition, peptide 219 (a BLyS-binding peptide from naive phage library) [17] and peptibody 219-Fc fusion protein were also analyzed, but they both displayed little inhibitory effect on BLyS/TACI interaction (unpublished data). Similarly, BLyS-binding peptide TA from CADD has a better binding affinity than BLyS-binding peptide 219 selected from the naive phage library, suggesting that both BLyS affinity maturation library and CADD can be used to obtain BLyS-binding peptides. In conclusion, peptides 814 and TA, as well as peptibodies 814-Fc and TA-Fc could inhibit the interaction of TACI with BLyS significantly, which might serve as promising antagonists to treat autoimmune diseases associated with BLyS overexpression. Authors' contributions J. Sun, Y. Zhao, J. Feng, and B. Shen conceived and designed the experiments; Y. Zhao, X. Hao, and J. Wei performed the experiments; J. Sun, Y. Zhao, and J. Wei analyzed the data; Y. Zhao, J. Sun and J. Wei wrote the paper; all the authors have read and approved the final manuscript to be published. Acknowledgments This study was supported by the National Natural Science Foundation of China (Grant No. 81273308). References [1] Moore PA, Belvedere O, Orr A, Pieri K, LaFleur DW, Feng P, et al. BLyS: member of the tumor necrosis factor family and B lymphocyte stimulator. Science 1999;286:260–3.
223
[2] Schneider P, MacKay F, Steiner V, Hofmann K, Bodmer JL, Holler N, et al. BAFF, a novel ligand of the tumor necrosis factor family, stimulates B cell growth. J Exp Med 1999;189:1747–56. [3] Shu HB, Hu WH, Johnson H. TALL-1 is a novel member of the TNF family that is down-regulated by mitogens. J Leukoc Biol 1999;65:680–3. [4] Gross JA, Johnston J, Mudri S, Enselman R, Dillon SR, Madden K, et al. TACI and BCMA are receptors for a TNF homologue implicated in B-cell autoimmune disease. Nature 2000;404:995–9. [5] Thompson JS, Bixler SA, Qian F, Vora K, Scott ML, Cachero TG, et al. BAFF-R, a newly identified TNF receptor that specifically interacts with BAFF. Science 2001;293: 2108–11. [6] Cheema GS, Roschke V, Hilbert DM, Stohl W. Elevated serum B lymphocyte stimulator levels in patients with systemic immune-based rheumatic diseases. Arthrit Rheum 2001;44:1313–9. [7] Groom J, Kalled SL, Cutler AH, Olson C, Woodcock SA, Schneider P, et al. Association of BAFF/BLyS overexpression and altered B cell differentiation with Sjögren's syndrome. J Clin Invest 2002;109:59–68. [8] Mackay F, Silveira PA, Brink R. B cells and the BAFF/APRIL axis: fast-forward on autoimmunity and signaling. Curr Opin Immunol 2007;19:327–36. [9] Sun J, Lin Z, Feng J, Li Y, Shen B. BAFF-targeting therapy, a promising strategy for treating autoimmune diseases. Eur J Pharm 2008;597:1–5. [10] Sutherland AP, Mackay F, Mackay CR. Targeting BAFF: immunomodulation for autoimmune diseases and lymphomas. Pharmacol Ther 2006;112:774–86. [11] Furie R, Petri M, Zamani O, Cervera R, Wallace DJ, Tegzová D, et al. A phase III, randomized, placebo-controlled study of belimumab, a monoclonal antibody that inhibits B lymphocyte stimulator, in patients with systemic lupus erythematosus. Arthritis Rheum 2011;63:3918–30. [12] Pelletier M, Thompson JS, Qian F, Bixler SA, Gong D, Cachero T, et al. Comparison of soluble decoy IgG fusion proteins of BAFF-R and BCMA as antagonists for BAFF. J Biol Chem 2003;278:33127–33. [13] Ramanujam M, Bethunaickan R, Huang W, Tao H, Madaio MP, Davidson A. Selective blockade of BAFF for the prevention and treatment of systemic lupus erythematosus nephritis in NZM2410 mice. Arthrit Rheum 2010;62:1457–68. [14] Jin X, Ding C. Belimumab—an anti-BLyS human monoclonal antibody for rheumatoid arthritis. Expert Opin Biol Ther 2013;13:315–22. [15] Stohl WH, David M. The discovery and development of belimumab: the anti-BLySlupus connection. Nat Biotechnol 2012;30:69–77. [16] Hsu H, Khare SD, Lee F, Miner K, Hu YL, Stolina M, et al. A novel modality of BAFFspecific inhibitor AMG623 peptibody reduces B-cell number and improves outcomes in murine models of autoimmune disease. Clin Exp Rheumatol 2012;30: 197–201. [17] Fleming TJ, Sachdeva M, Delic M, Beltzer J, Wescott CR, Devlin M, et al. Discovery of high-affinity peptide binders to BLyS by phage display. J Mol Recognit 2005;18: 94–102. [18] Sun J, Feng JN, Li Y, Shen B. A novel BLyS antagonist peptide designed based on the 3-D complex structure of BCMA and BLyS. Biochem Biophys Res Commun 2006;346: 1158–62. [19] Tian Y, Zhu YF, Wu Z, Feng JN, Li Y, Shen BF, et al. An optimized B lymphocyte stimulator (BLyS) antagonist peptide inhibits the interaction of BLyS with BCMA. Biotechnol Lett 2013;35:523–8. [20] Ji LJ, Bai W, Chai L, Sun J. Construction and prokaryotic expression of TACI-Fc fusion protein. Biotechnol 2013;23:28–32 (in Chinese). [21] Banta S, Dooley K, Shur O. Replacing antibodies: engineering new binding proteins. Annu Rev Biomed Eng 2013;15:93–113. [22] Hamzeh-Mivehroud M, Alizadeh AA, Morris MB, Church WB, Dastmalchi S. Phage display as a technology delivering on the promise of peptide drug discovery. Drug Discov Today 2013;18:1144–57. [23] Ladner RC, Sato AK, Gorzelany J, de Souza M. Phage display-derived peptides as therapeutic alternatives to antibodies. Drug Discov Today 2004;9:525–9.
Contents lists available at ScienceDirect
International Immunopharmacology journal homepage: www.elsevier.com/locate/intimp
The comparison of BLyS-binding peptides from phage display library and computer-aided design on BLyS–TACI interaction Yacong Zhao a,1, Xiafei Hao a,1, Jiannan Feng b, Beifen Shen b, Jing Wei a,⁎, Jian Sun a,⁎ a b
Department of Molecular and Cellular Pharmacology, School of Pharmaceutical Science and Technology, Tianjin University, Tianjin 300072, PR China Institute of Basic Medical Sciences, Beijing 100850, PR China
a r t i c l e
i n f o
Article history: Received 13 July 2014 Received in revised form 30 November 2014 Accepted 9 December 2014 Available online 19 December 2014 Keywords: BLyS BLyS antagonists Peptibody Computer-aided design Autoimmune diseases
a b s t r a c t BLyS antagonists have become the therapeutic reagents in the treatment of autoimmune disorders. BLyS binding peptides and their Fc fusion proteins may be alternative BLyS antagonists in such application. In this study, the activity of BLyS binding peptide 814 obtained from phage display library and peptide TA designed by computer-aided modeling on the interaction of BLyS–TACI was compared. In addition, to maintain the spatial conformation and stability of the peptides, human IgG1 Fc fragment was fused to peptides 814 and TA to form peptide-Fc fusion proteins, steady and innovative peptibodies. The prokaryotic expression plasmids pET30a814-Fc and pET30a-TA-Fc for these peptibodies were acquired by genetic engineering, and confirmed by DNA sequencing. After the right plasmids were transformed into Escherichia coli BL21 (DE3), the fusion proteins were expressed and purified by protein A affinity column. As a result of competitive ELISA, peptides 814 and TA at 100 μg/ml displayed 52.2% and 28.6% inhibition on the interaction of TACI-Fc with BLyS respectively. Moreover, 814-Fc and TA-Fc fusion proteins could bind to BLyS in a dosage-dependent manner as TACI-Fc did, and displayed 54.7% and 26.1% inhibition on the interaction of TACI-Fc-Myc with BLyS at 100 μg/ml respectively. So 814-Fc and TA-Fc proteins had the similar bioactivity as the peptides did. Furthermore, compared with TA-Fc, 814-Fc showed two-fold inhibition effect on BLyS binding to TACI, suggesting that 814-Fc could inhibit BLyS bioactivity significantly and might serve as a potential antagonist to treat autoimmune diseases associated with BLyS overexpression. © 2014 Elsevier B.V. All rights reserved.
1. Introduction In the pathogenesis studies of autoimmune diseases, a tumor necrosis factor (TNF) family member, named B lymphocyte stimulator (BLyS), has become a vital therapeutic target. BLyS, also referred to as B cellactivating factor belonging to the TNF family (BAFF), or TNF and apoptosis ligand-related leukocyte-expressed ligand 1 (TALL-1), is expressed by monocytes, macrophages and dendritic cells [1–3]. It is also released as a soluble form from cell membranes. Three transmembrane proteins: B cell maturation antigen (BCMA), transmembrane activator and calcium modulator and cyclophilin ligand interactor (TACI) and BAFF receptor (BAFF-R or BR3), which are expressed primarily on B cells are three BLyS receptors. Through binding to specific BLyS receptors, BLyS transmits signals and plays as an essential survival factor to regulate B-cell proliferation, maturation and homeostasis [4,5]. BLyS transgenic mice with increasing BLyS level had develop systemic lupus erythematosus
⁎ Corresponding authors at: Department of Molecular and Cellular Pharmacology, School of Pharmaceutical Science and Technology, Tianjin University, 92 Weijin Road, Nankai District, Tianjin 300072, PR China. Tel.: +86 22 87401943; fax: +86 22 27892025. E-mail addresses: [email protected] (J. Wei), [email protected] (J. Sun). 1 Co-first authors.
http://dx.doi.org/10.1016/j.intimp.2014.12.013 1567-5769/© 2014 Elsevier B.V. All rights reserved.
like symptoms. Equally, excessive BLyS serum production has been observed in the patients suffering from autoimmune diseases, such as Sjogren's syndrome (SS), systemic lupus erythematosus (SLE) and rheumatoid arthritis (RA) [6,7]. As a consequence, BLyS-targeting therapy is the excellent strategy of treating B cell related autoimmune diseases [8–10]. Currently, various BLyS antagonists, including anti-BLyS monoclonal antibody and soluble BAFF receptor-IgG1 Fc fusion protein, have been testified to have broad application prospects [11–13]. Benlysta (Belimumab), a monoclonal antibody against human BLyS protein, was the first drug authorized by America Food and Drug Administration to treat SLE patients in the past 50 years [14,15]. Belimumab has a positive effect on preventing the exacerbation of the disease and improving the symptoms in the Phase III clinical study [11]. Compared with large molecular BLyS antagonists above, peptide has unique superiorities to be a novel BLyS inhibitor in physical and chemical properties. AMG623 developed by Anthera Pharmaceuticals (Hayward, USA), is a BLyS binding peptide fused with human IgG1 Fc and used as a BLyS antagonist under the clinical trial currently [16]. BLyS binding peptides are usually obtained by phage display, which is a well-established technology for identification of peptide binders to a variety of proteins [16,17]. Since the crystal structures of BLyS and
220
Y. Zhao et al. / International Immunopharmacology 24 (2015) 219–223
its receptors are known, it is possible to design BLyS antagonist peptides by computer-aided drug design (CADD) [18,19]. In this study, the activity of BLyS binding peptides from phage display library and computeraided modeling was compared. Peptide 814 reported by Fleming TJ's study, was identified from phage library and bound to BLyS with affinity and selectivity [17]. Peptide TA, a BLyS binding peptide, was designed by the computer-aided modeling based on the structural characteristics and interacting mode of TACI–BLyS complex. In order to study the feasibility of peptides 814 and TA as BLyS antagonist, the peptides were fused to human IgG1 Fc fragment to form peptibodies. The activity of peptides, as well as peptibodies was analyzed. 2. Materials and methods 2.1. Reagents Recombinant proteins human IgG1 Fc, TACI-Fc, TACI-Fc-Myc, TA-Fc and human BLyS were previously prepared in the laboratory [18–20]. Peptide 814 (ANWYDPLTKLWL), TA (DTSKLASTGYSSDPY) and an irrelevant peptide NP (DIDFLIEEIERLGQDL) were synthesized by China Peptides Co., Ltd. (Shanghai, China). DNA polymerase, T4 DNA ligase, restriction endonucleases EcoRI, HindIII, and NdeI were purchased from Takara (Dalian, China). Primer synthesis and DNA sequencing were accomplished by Life Technologies (Shanghai, China). Plasmid extraction kit and Gel extraction kit were purchased from Promega (Madison, USA). Peroxidase-Conjugated Goat Anti-Human IgG (H + L), Myc tag antibodies and Peroxidase-Conjugated AffiniPure Goat AntiMouse IgG (H + L) were purchased from ZSGB-Bio (Beijing, China). Kana antibiotics, Isopropyl β-D-1-Thiogalactopyranoside (IPTG) and 3,3′,5,5′-Tetramethylbenzidine (TMB) were from Sigma (Colorado, USA). 2.2. The design of peptide TA According to the spatial structure of BLyS–TACI complexes, in the basis of rational determination of key position domain in BLyS–TACI mutual recognition, BLyS peptide binders were selected by computer high-throughput virtual screening. The amino acids were connected to construct a peptide possessing the desired structural and electrostatic properties complementary with the active pocket of the BLyS protein. Molecular docking was performed for the potential affinity evaluations of the designed peptides. One of the optimal BLyS binding peptides, named TA, would be further applied to experiments. 2.3. Competitive ELISA assay of peptides 814 and TA Human BLyS protein was diluted with 0.1 M sodium carbonate buffer (pH 9.6) to a final concentration of 10 μg/ml. ELISA plate was coated with 50 μl of BLyS at 4 °C for 18 h. Washed with 0.05% PBST buffer (0.01 M PB, 0.15 M NaCl and 0.05% Tween 20, pH 7.4) three times, each plate was blocked with 150 μl of 5% skim milk in 0.05% PBST buffer at 37 °C for 2 h. 50 μl of peptide 814 or TA at different concentrations (0, 10, 50 and 100 μg/ml), containing 5 μg/ml of TACI-Fc protein, was added to wells of plates coated with BLyS and incubated at 37 °C for 1 h. NP, an irrelevant peptide, was used as a negative control. After washing the plates with 0.05% PBST buffer three times, 50 μl of 1:5000 diluted Peroxidase-Conjugated Goat Anti-Human IgG antibody was added and incubated at 37 °C for 1 h. Washed with 0.05% PBST buffer three times, 50 μl of color developing agent was added to each well (0.4 mM TMB and 8.5 mM H2O2) and placed in the dark at 37 °C for 9 min. The reactions were stopped by adding 50 μl of 1 M H2SO4. The OD was measured by an ELISA reader at A450. With the following formula, the inhibition ratio of TACI-Fc binding to BLyS by peptides was calculated: %Inhibition ratio ¼ ATACI Fc –ATACI Fcþinhibitor =ATACI Fc 100%:
2.4. Construction and expression of 814-Fc and TA-Fc fusion gene Based on the sequences of peptides 814 and TA, DNA primers encoding 814 and TA were designed and synthesized by Life Technologies (Shanghai, China). The primer sequences of peptide 814 were: 5′TATGGCTAACTGGTATGACCCGCTGACCAAACTGTGGCTGGGTGGAGGTG GA TCTG-3′ (56 bp) and 5′-AATTCAGATCCACCTCCACCCAGCCACAGTTT GGTCAGCGGTCATA CCAGTTAGCCA-3′ (57 bp) with the sticking end of NdeI at the 5′-end and sticking end of EcoRI at the 3′-end respectively. The primer sequences of peptide TA were: 5′-TATGGACACCTCTAAG CTC GCTTCTACCGGCTACTCTTCTGACCCGTACGGTGGAGGTGGATCTG-3′ (65 bp) and 5′-AATT CAGATCCACCTCCACCGTACGGGTCAGAAGAGTA GCCGGTAGAAGCGAGCTTAGAGGTG TCCA-3′(67 bp) with the sticking end of NdeI at the 5′-end and sticking end of EcoRI at the 3′-end respectively. 20 μl of each primer (16 pmol/μl) was mixed in a 1.5 ml EP tube and incubated in 100 °C water for 3 min. After cooling to room temperature gradually, double-stranded DNA was detected by 2% agarose gel electrophoresis. Human IgG1 Fc DNA fragment was obtained by PCR, and digested by HindIII and EcoRI. Then it was ligated with 814 or TA DNA fragment into a pET30a vector, which had previously been digested by HindIII and NdeI. The ligation mixture was transformed into JM109, the positive clones on Kana plate were analyzed by colony PCR, restriction enzyme digestion and confirmed by DNA sequencing. The correct recombinant plasmids were transformed into Escherichia coli BL21 (DE3), induced with IPTG at different temperatures and analyzed by SDS-PAGE. The transformants with high expression of fusion proteins were inoculated in LB + Kana medium overnight at 37 °C. When the medium OD was 0.5, IPTG was added to 0.5 mM. After 16 h of induced cultivation at 16 °C, the bacterium was centrifuged at 8000 r/min for 10 min and kept in PBS. After freeze and thaw about three times, the cells were broken by ultrasonication in ice bath. After centrifugation at 12,000 r/min for 10 min, the supernatant was collected and its pH was adjusted to 8. The supernatant was loaded to a protein A affinity column. The bound protein was eluted by citric acid (pH 3.0) and dialyzed by PBS (pH 8.0) overnight. The purified protein was analyzed by SDS-PAGE. 2.5. ELISA analysis of 814-Fc and TA-Fc fusion proteins Human protein BLyS was coated on the ELISA plates and blocked as described before. 50 μl of 814-Fc and TA-Fc fusion proteins at different concentrations (0, 6.25, 12.5, 25, 50 and 100 μg/ml) was added into plates coated with BLyS and incubated at 37 °C for 1 h. Human IgG1 Fc and TACI-Fc proteins were used as negative and positive controls respectively. The subsequent experimental procedures were pursued as described before. With the following formula, the binding ratio of fusion proteins binding to BLyS was calculated: %Binding ratio ¼ Afusion
protein –A Fc
=ðATACI Fc –A Fc Þ 100%:
Competitive ELISA assay was used to detect the inhibitory activity of peptibodies. The saturated concentration of TACI-Fc-Myc binding to BLyS was determined at 2 μg/ml. Human protein BLyS was coated and blocked on the ELISA plates as 2.2. 50 μl of 814-Fc and TA-Fc fusion proteins at different concentrations (0, 10, 25, 50, and 100 μg/ml), containing 2 μg/ml of TACI-Fc-Myc protein, was added into plates coated with BLyS and incubated at 37 °C for 1 h. Human IgG1 Fc and TACI-Fc proteins were used as negative and positive controls respectively. After washing the plates with 0.05% PBST buffer three times, 50 μl of 1:1000 diluted anti-Myc tag antibody was added and incubated at 37 °C for 1 h. After washing the plates with 0.05% PBST buffer three times, 50 μl of 1:5000 diluted Peroxidase-Conjugated Goat Anti-Mouse IgG antibody was added and incubated at 37 °C for 1 h. The color developing procedures were pursued as described before. With the following formula, the
Y. Zhao et al. / International Immunopharmacology 24 (2015) 219–223
221
inhibition ratio of TACI-Fc-Myc binding to BLyS by peptibodies was calculated: %Inhibition ratio ¼ ATACI FcMyc –ATACI FcMycþinhibitor =ATACI FcMyc 100%: In addition, TA and 814 competitively binding to BLyS were analyzed. BLyS was coated and blocked on the ELISA plates as 2.2.50 μl of peptide 814 or TA at different concentrations (0, 10, 50 and 100 μg/ml), containing 25 μg/ml of 814-Fc protein, was added to wells of plates coated with BLyS and incubated at 37 °C for 1 h. NP was used as a negative control. The subsequent experimental procedures were pursued as 2.2. With the following formula, the inhibition ratio of 814-Fc binding to BLyS by peptides was calculated: %Inhibition ratio ¼ A814 Fc‐ –A814 Fcþpeptide =A814 Fc 100%: 3. Results
Fig. 2. Inhibition of TACI-Fc binding to BLyS by peptides 814 and TA. Different concentrations of peptides 814 and TA mixed with TACI-Fc (final concentration was 5 μg/ml) were added to plates coated with 10 μg/ml BLyS. Peptide NP was used as a negative control. After washing, the bound TACI-Fc was detected with Peroxidase-Conjugated Goat AntiHuman IgG antibody. Represented data were represented as mean ± standard deviations.
3.1. Peptide TA inserted the binding pockets of BLyS In the methods of computer high-throughput virtual screening and molecular docking, TA, an outstanding BLyS binding peptide (sequence: DTSKLASTGYSSDPY) was picked out. TA bound to the cleft formed by two BLyS chains (A chain, the primary chain and B chain, the secondary chain). Fig. 1 illustrated that the residues 4KLAST8 of TA were deeply inserted into a hydrophobic pocket involving T64, L70, R90, I92, P123 and R124 of the primary BLyS and L99 of the secondary BLyS. 3.2. Peptides 814 and TA inhibited BLyS–TACI interaction As shown in Fig. 2, peptide 814 significantly inhibited 52.2% and 34.9% of the interaction of TACI-Fc with BLyS at 100 μg/ml and 50 μg/ml respectively (p b 0.01 and p b 0.05). Peptide TA at 100 μg/ml and
Fig. 1. A close view of the binding interaction of BLyS with TA. Green: TA; yellow: A chain, the primary BLyS chain; blue: B chain, the secondary BLyS chain; red line: hydrogen bond. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
50 μg/ml displayed 28.6% and 20.8% inhibition respectively (p b 0.05), which is nearly half effect of 814. With the increasing concentration of peptides, the inhibitory activity of peptides was augmented. In contrary, NP had no inhibiting effect on BLyS–TACI interaction even at high concentration.
3.3. Construction and purification of 814-Fc and TA-Fc fusion proteins The DNA fragment encoding the peptide acquired by primer annealing was ligated with human IgG1 Fc DNA fragment into a pET30a vector. The results of colony PCR and restriction enzyme digestion showed that the three fragments were ligated successfully. DNA sequencing further verified that the 814-Fc and TA-Fc fusion genes were right. Then, the fusion genes were expressed in the E. coli prokaryotic expression system. 0.5 mM IPTG and 16 °C were an optimal condition to increase the output of soluble form and decrease the inclusion body of fusion proteins. The purified proteins were about 31 kDa in size, as theoretically predicted, and its purity was over 90% (Fig. 3). We could acquire about 1 mg of fusion protein from 2 l culture medium.
Fig. 3. Reduced SDS-PAGE analysis of purified 814-Fc and TA-Fc fusion proteins. Lane 1: TA-Fc; Lane 2: 814-Fc.
222
Y. Zhao et al. / International Immunopharmacology 24 (2015) 219–223
3.4. 814-Fc and TA-Fc fusion proteins could bind BLyS and inhibit BLyS– TACI interaction The BLyS binding activity of peptibodies was tested by conventional ELISA assay. As shown in Fig. 4, both 814-Fc and TA-Fc fusion proteins could bind to BLyS in a dosage-dependent manner. Compared to 86.9% and 52.3% binding ratios at 100 and 50 μg/ml respectively by TA-Fc, 814-Fc had a higher affinity for BLyS with 96.6% and 72.3% binding ratios at 100 and 50 μg/ml respectively. In addition, human IgG1 Fc protein could not bind to BLyS, demonstrating that 814-Fc or TA-Fc bound to BLyS specifically. The inhibitory activity of peptibodies was detected by competitive ELISA assay. As shown in Fig. 5, both 814-Fc and TA-Fc fusion proteins could inhibit BLyS–TACI interaction in a dosage-dependent manner. Above all, at 100 and 50 μg/ml with 54.7% and 32.0% inhibition ratios respectively (p b 0.05), 814-Fc behaved two-fold of inhibition effect than TA-Fc did. The inhibiting effect of positive control TACI-Fc at 100 μg/ml was 1.6-fold of 814-Fc or 3.3-fold of TA-Fc at the same concentration. Meanwhile, the inhibition ratios of fusion proteins were similar with those of peptides, suggesting that human IgG1 Fc fragment fused to peptides maintained peptide stability and bioactivity and had no negative effect on the inhibitory activity of peptides. In addition, human IgG1 Fc protein had no inhibiting effect, implying that the inhibiting effect of 814-Fc or TA-Fc was specific. 3.5. TA and 814 have different binding orientations As shown in Fig. 6, only peptide 814 displayed strong inhibiting activity on the interaction 814-Fc with BLyS in a dosage-dependent manner (p b 0.05), suggesting that 814 peptide and 814-Fc protein have the same binding sites with BLyS and 814 binding to BLyS was significant. On the contrary, peptide TA had no inhibiting effect on the interaction 814-Fc with BLyS even at high concentration, indicating that TA and 814 have different binding orientations with BLyS. 4. Discussion At present, BAFF blocking reagents consisting of BAFF receptor fusion proteins and specific human monoclonal antibodies are being developed by several companies for B-cell-mediated autoimmune diseases therapy. Clinical trials with TACI-Ig are implemented by ZymoGenetics/Serono in the treatment of systemic lupus erythematosus, rheumatoid arthritis and B cell malignancies [9,10]. Benlysta (Belimumab) by Human Genome
Fig. 4. 814-Fc and TA-Fc fusion protein could bind with BLyS well. Different concentrations of 814-Fc and TA-Fc fusion proteins were added to the plates coated with 10 μg/ml BLyS. Human IgG1 Fc and TACI-Fc proteins were used as negative and positive controls respectively. After washing, the bound proteins were detected with Peroxidase-Conjugated Goat Anti-Human IgG antibody. Represented data were represented as mean ± standard deviations.
Fig. 5. Inhibition of TACI-Fc-Myc binding to BLyS by 814-Fc and TA-Fc fusion proteins. Different concentrations of 814-Fc and TA-Fc fusion proteins mixed with TACI-Fc-Myc (final concentration was 2 μg/ml) were added to the plates coated with 10 μg/ml BLyS. Human IgG1 Fc and TACI-Fc proteins were used as negative and positive controls respectively. After washing, the bound proteins were detected with anti-Myc tag antibody and Peroxidase-Conjugated Goat Anti-Mouse IgG antibody. Represented data were represented as mean ± standard deviations.
Sciences, a monoclonal antibody against soluble BLyS, provided sufficient achievements to alleviate SLE disease symptom in Phase III clinical trials [11]. Other than these large molecular BLyS inhibitors, peptide binders have the advantage of low immunogenicity, strong permeability and simple production. AMG623, a BLyS-binding peptide, was one peptide studied to evaluate the function of BLyS-binding peptide on murine models with autoimmune diseases. Treatment with AMG623 reduced the B-cell number in mice and prevented the development of mice lupus and arthritis [16]. Phage libraries could display peptides with appropriate configuration to bind nature proteins [21–23]. Through using immobilized targeted protein, specific binding peptides can be identified from phage libraries in a screening process. Peptide 814 was selected from BLyS affinity maturation library (BAML) by phage display technique, and a potential BLyS inhibitor. BAML is a second generation phage display library selected and constructed from naive phage display library. It can make 100-fold improvement in binding affinity than BLyS-binding peptides selected from the naive phage library [17]. In this study, 814 showed two-fold inhibitory capacity than TA designed
Fig. 6. Inhibition of 814-Fc binding to BLyS by peptides 814 and TA. Different concentrations of peptides 814 and TA mixed with 814-Fc (final concentration was 25 μg/ml) were added to plates coated with 10 μg/ml BLyS. Peptide NP was used as a negative control. After washing, the bound 814-Fc was detected with Peroxidase-Conjugated Goat Anti-Human IgG antibody. Represented data were represented as mean ± standard deviations.
Y. Zhao et al. / International Immunopharmacology 24 (2015) 219–223
by CADD. The higher affinity of 814 was due to the differences of the binding pockets of 814-BLyS and TA-BLyS, and 814-BLyS binding sites seem to be more crucial for BLyS binding. These data suggested that BAML may be enriched in BLyS antagonists of more excellent biological affinity than CADD did. In addition, peptibody 814-Fc at 100 μg/ml and 50 μg/ml displayed 54.7% and 32.0% inhibition of BLyS–TACI interaction as peptide 814 did, indicating that peptide fused with human IgG1 Fc fragment not only overcame their drawbacks of instability and inefficiency, but also maintained their inhibitory activity. However, the secondary structure and binding orientation of peptide binders obtained by molecular simulation may be inconsistent with their true states. Therefore, the peptides with higher activity by CADD may be not efficient in biological analysis. In our study, a few peptides were tested biologically at one time. So if we analyze a large number of peptides designed by CADD at one time using high throughput (HTP) techniques to screen BLyS-binding peptides, we may have a chance to obtain higher effective peptides. In addition, peptide 219 (a BLyS-binding peptide from naive phage library) [17] and peptibody 219-Fc fusion protein were also analyzed, but they both displayed little inhibitory effect on BLyS/TACI interaction (unpublished data). Similarly, BLyS-binding peptide TA from CADD has a better binding affinity than BLyS-binding peptide 219 selected from the naive phage library, suggesting that both BLyS affinity maturation library and CADD can be used to obtain BLyS-binding peptides. In conclusion, peptides 814 and TA, as well as peptibodies 814-Fc and TA-Fc could inhibit the interaction of TACI with BLyS significantly, which might serve as promising antagonists to treat autoimmune diseases associated with BLyS overexpression. Authors' contributions J. Sun, Y. Zhao, J. Feng, and B. Shen conceived and designed the experiments; Y. Zhao, X. Hao, and J. Wei performed the experiments; J. Sun, Y. Zhao, and J. Wei analyzed the data; Y. Zhao, J. Sun and J. Wei wrote the paper; all the authors have read and approved the final manuscript to be published. Acknowledgments This study was supported by the National Natural Science Foundation of China (Grant No. 81273308). References [1] Moore PA, Belvedere O, Orr A, Pieri K, LaFleur DW, Feng P, et al. BLyS: member of the tumor necrosis factor family and B lymphocyte stimulator. Science 1999;286:260–3.
223
[2] Schneider P, MacKay F, Steiner V, Hofmann K, Bodmer JL, Holler N, et al. BAFF, a novel ligand of the tumor necrosis factor family, stimulates B cell growth. J Exp Med 1999;189:1747–56. [3] Shu HB, Hu WH, Johnson H. TALL-1 is a novel member of the TNF family that is down-regulated by mitogens. J Leukoc Biol 1999;65:680–3. [4] Gross JA, Johnston J, Mudri S, Enselman R, Dillon SR, Madden K, et al. TACI and BCMA are receptors for a TNF homologue implicated in B-cell autoimmune disease. Nature 2000;404:995–9. [5] Thompson JS, Bixler SA, Qian F, Vora K, Scott ML, Cachero TG, et al. BAFF-R, a newly identified TNF receptor that specifically interacts with BAFF. Science 2001;293: 2108–11. [6] Cheema GS, Roschke V, Hilbert DM, Stohl W. Elevated serum B lymphocyte stimulator levels in patients with systemic immune-based rheumatic diseases. Arthrit Rheum 2001;44:1313–9. [7] Groom J, Kalled SL, Cutler AH, Olson C, Woodcock SA, Schneider P, et al. Association of BAFF/BLyS overexpression and altered B cell differentiation with Sjögren's syndrome. J Clin Invest 2002;109:59–68. [8] Mackay F, Silveira PA, Brink R. B cells and the BAFF/APRIL axis: fast-forward on autoimmunity and signaling. Curr Opin Immunol 2007;19:327–36. [9] Sun J, Lin Z, Feng J, Li Y, Shen B. BAFF-targeting therapy, a promising strategy for treating autoimmune diseases. Eur J Pharm 2008;597:1–5. [10] Sutherland AP, Mackay F, Mackay CR. Targeting BAFF: immunomodulation for autoimmune diseases and lymphomas. Pharmacol Ther 2006;112:774–86. [11] Furie R, Petri M, Zamani O, Cervera R, Wallace DJ, Tegzová D, et al. A phase III, randomized, placebo-controlled study of belimumab, a monoclonal antibody that inhibits B lymphocyte stimulator, in patients with systemic lupus erythematosus. Arthritis Rheum 2011;63:3918–30. [12] Pelletier M, Thompson JS, Qian F, Bixler SA, Gong D, Cachero T, et al. Comparison of soluble decoy IgG fusion proteins of BAFF-R and BCMA as antagonists for BAFF. J Biol Chem 2003;278:33127–33. [13] Ramanujam M, Bethunaickan R, Huang W, Tao H, Madaio MP, Davidson A. Selective blockade of BAFF for the prevention and treatment of systemic lupus erythematosus nephritis in NZM2410 mice. Arthrit Rheum 2010;62:1457–68. [14] Jin X, Ding C. Belimumab—an anti-BLyS human monoclonal antibody for rheumatoid arthritis. Expert Opin Biol Ther 2013;13:315–22. [15] Stohl WH, David M. The discovery and development of belimumab: the anti-BLySlupus connection. Nat Biotechnol 2012;30:69–77. [16] Hsu H, Khare SD, Lee F, Miner K, Hu YL, Stolina M, et al. A novel modality of BAFFspecific inhibitor AMG623 peptibody reduces B-cell number and improves outcomes in murine models of autoimmune disease. Clin Exp Rheumatol 2012;30: 197–201. [17] Fleming TJ, Sachdeva M, Delic M, Beltzer J, Wescott CR, Devlin M, et al. Discovery of high-affinity peptide binders to BLyS by phage display. J Mol Recognit 2005;18: 94–102. [18] Sun J, Feng JN, Li Y, Shen B. A novel BLyS antagonist peptide designed based on the 3-D complex structure of BCMA and BLyS. Biochem Biophys Res Commun 2006;346: 1158–62. [19] Tian Y, Zhu YF, Wu Z, Feng JN, Li Y, Shen BF, et al. An optimized B lymphocyte stimulator (BLyS) antagonist peptide inhibits the interaction of BLyS with BCMA. Biotechnol Lett 2013;35:523–8. [20] Ji LJ, Bai W, Chai L, Sun J. Construction and prokaryotic expression of TACI-Fc fusion protein. Biotechnol 2013;23:28–32 (in Chinese). [21] Banta S, Dooley K, Shur O. Replacing antibodies: engineering new binding proteins. Annu Rev Biomed Eng 2013;15:93–113. [22] Hamzeh-Mivehroud M, Alizadeh AA, Morris MB, Church WB, Dastmalchi S. Phage display as a technology delivering on the promise of peptide drug discovery. Drug Discov Today 2013;18:1144–57. [23] Ladner RC, Sato AK, Gorzelany J, de Souza M. Phage display-derived peptides as therapeutic alternatives to antibodies. Drug Discov Today 2004;9:525–9.