- Email: [email protected]
The complete mitochondrial genome of Pseudoterranova azarasi and comparative analysis with other anisakid nematodes
Infection, Genetics and Evolution xxx (2015) xxx–xxx
Contents lists available at ScienceDirect
Infection, Genetics and Evolution journal homepage: www.elsevier.com/locate/meegid
The complete mitochondrial genome of Pseudoterranova azarasi and comparative analysis with other anisakid nematodes Shan-Shan Liu a,b, Guo-Hua Liu b,⇑, Xing-Quan Zhu b, Ya-Biao Weng a,⇑ a
College of Veterinary Medicine, South China Agricultural University, Guangzhou, Guangdong Province 510642, PR China State Key Laboratory of Veterinary Etiological Biology, Key Laboratory of Veterinary Parasitology of Gansu Province, Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences, Lanzhou, Gansu Province 730046, PR China b
a r t i c l e
i n f o
Article history: Received 1 April 2015 Received in revised form 15 May 2015 Accepted 16 May 2015 Available online xxxx Keywords: Anisakid nematodes Mitochondrial genome Genetics Phylogenetic analyses
a b s t r a c t Anisakiasis/anisakidosis caused by anisakid nematodes is an emerging infectious disease that can cause a wide range of clinical syndromes and are difficult to diagnose and treat in humans. In spite of their significance as pathogens, the systematics, genetics, epidemiology and biology of these parasites remain poorly understood. In the present study, we sequenced the complete mitochondrial (mt) genome of Pseudoterranova azarasi, which is one of the most important zoonotic anisakid parasites. The circular mt genome is 13,954 bp in size and encodes of 36 genes, including 12 protein-coding, 2 ribosomal RNA and 22 transfer RNA genes. The mt gene order of P. azarasi is the same as those of Ascaris spp. (Ascarididae), Toxocara spp. (Toxocaridae) and Anisakis simplex (Anisakidae), but distinct from those of Ascaridia spp. (Ascaridiidae) and Cucullanus robustus (Cucullanidae). Phylogenetic analyses based on concatenated amino acid sequences of 12 protein-coding genes by Bayesian inference (BI) showed that Pseudoterranova were more closely related to Anisakis than they were to Contracaecum with strong a posterior probability support. This mt genome provides a novel genetic markers for exploring cryptic/sibling species and host affiliations, and should have implications for the diagnosis, prevention and control of anisakidosis in humans. Ó 2015 Published by Elsevier B.V.
1. Introduction Anisakid nematodes infect a wide range of invertebrates and vertebrates with a cosmopolitan distribution. Human anisakiasis/ anisakidosis caused by the members of genura Anisakis, Contracaecum and Pseudoterranova is an emerging infectious disease that can be associated with mild to severe gastrointestinal disease and allergic responses (Audicana and Kennedy, 2008; Pravettoni et al., 2012). Humans are infected by eating raw or undercooked marine fish with third-stage larva (L3). Given the hot popularity of consuming raw or undercooked fish (e.g., sushi and sashimi), it is possible that anisakidosis is increasing and it is under diagnosed due to limited diagnostic test (Shamsi, 2014). Unfortunately, to date, no effective drug are available, and treatment only relies on surgery. The accurate identification and differentiation of anisakid nematodes has important implications for studying their systematics, genetics, epidemiology and biology. Recently, although ⇑ Corresponding authors. E-mail addresses: [email protected] (G.-H. Liu), [email protected] (Y.-B. Weng).
morphological features have been used to identify adults and some L3 of anisakid nematodes to type or species levels (Mattiucci et al., 2005), these criteria are sometimes insufficient for specific identification and differentiation of anisakid nematodes, particularly at the larval stages (Mattiucci and Nascetti, 2008). Various DNA techniques have provided powerful complementary tools to overcome the limitations of morphological approach, which have often been used to distinguish species from one another (Ondrejicka et al., 2014). The internal transcribed spacers (ITS) of nuclear ribosomal DNA (rDNA) region (Garbin et al., 2013; Pekmezci et al., 2014) and mitochondrial (mt) DNA (mtDNA) (Lin et al., 2013; Quiazon et al., 2013) have been used as genetic markers for studying genetic variation in anisakid nematodes, including some cryptic/sibling species. However, some studies have emphasized that it is better to use the complete mt genome datasets for the exploring cryptic/sibling species of anisakid nematodes (Mattiucci and Nascetti, 2008). In spite of the availability of advanced sequencing and bioinformatic methods, there is still relatively limited knowledge about complete mt genomes of many anisakid nematodes of socio-economic importance. In the family Anisakidae, to date, the complete mt genomes have been reported for only four species (Kim et al., 2006; Lin et al., 2012; Mohandas et al., 2014), and in
http://dx.doi.org/10.1016/j.meegid.2015.05.018 1567-1348/Ó 2015 Published by Elsevier B.V.
Please cite this article in press as: Liu, S.-S., et al. The complete mitochondrial genome of Pseudoterranova azarasi and comparative analysis with other anisakid nematodes. Infect. Genet. Evol. (2015), http://dx.doi.org/10.1016/j.meegid.2015.05.018
2
S.-S. Liu et al. / Infection, Genetics and Evolution xxx (2015) xxx–xxx
the genus Pseudoterranova (an important etiological agents for zoonotic human anisakidosis), no information is available about the complete mt genome datasets. The objectives of the present study were (i) to determine the complete mt genome of Pseudoterranova azarasi, which is one of the most important anisakid parasites, (ii) to compare this mt sequence with those of other anisakid nematodes, (iii) and to re-examine phylogenetic relationships among the infraorder Ascaridomorpha using the protein-coding amino acid sequences. 2. Materials and methods 2.1. Parasites and DNA extraction The adult worm of P. azarasi was obtained from gastrointestinal tract of Eumetopias jubata (Steller’s sea lion) in Iwanai, Japan. This specimen was washed in physiological saline, identified morphologically to species according to existing keys and descriptions (Skrjabin et al., 1991), fixed in 70% (v/v) ethanol and stored at 20 °C until use. Total genomic DNA was isolated from this specimen using sodium dodecyl sulfate/proteinase K treatment, followed by spin-column purification (WizardÒ SV Genomic DNA Purification System, Promega). The molecular identity of this specimen was then verified by PCR using previously reported primers (Zhu et al., 2002) and sequenced directly. 2.2. PCR amplification and sequencing A fragment of the cox1, nad1, nad4, cytb and rrnL was amplified by PCR with primers described in Table 1 (Bowles et al., 1995; Hu et al., 2007; Cao et al., 2005, 2006), respectively, and the amplicons directly sequenced. Based on the partial cox1, nad1, nad4, cytb and rrnL sequences, five pairs of primers (Table 1) were designed in the conserved regions to amplify the complete mt genome by PCR as
Table 1 Sequences of primers for amplifying mitochondrial DNA regions from Pseudoterranova azarasi. Primer
Sequence (50 to 30 )
Amplified sequences
References
JB3
TTTTTTGGGCATCCTGAGGTTTAT
cox1
JB4.5
TAAAGAAAGAACATAATGAAAATG
cox1
MH21F
TCAAATGTTTTTTAAAGACTTAGG
rrnL
MH22R
CAAGATAAACAATTCTATCTCAC
rrnL
CZH1
TATGAGCGTCATTTATTRGG
nad1
CZH2
TATCATAACGAAAACGAGG
nad1
CZH3
GCGGCTTTTTGTTCTATGCC
nad4
CZH4
ATATGAGTAACAGAAGAATAA
nad4
CF CR N1-F Cb1-R Cb-2F N4-2R N4-3F C1-3R C1-4F Rl-4R Rl-5F N1-5R
TATTATACTAATGATGGTGCTTCT AACATTGACCCAACCAACT AGGGGAATATGGAGCTTTGTT AAAAACTCATCTGGGCTCATACTA AGTCATGTTAAGTTGGTTGG AAAGTCAAAATAAACCCTC TTGTTGGCTGGTTTGTTATTGA ATTCTTAAAATAGCATACACCATCC GGTTTGACGGGAGTTGTT GCTACCTTAATGTCCTCACGCTA CGGAGTTAACAGAAAATCATGTC AGCACCTACTATTCCGTACTTAG
cytb cytb nad1 to cytb nad1 to cytb cytb to nad4 cytb to nad4 nad4 to cox1 nad4 to cox1 cox1 to rrnL cox1 to rrnL rrnL to nad1 rrnL to nad1
Bowles et al. (1995) Bowles et al. (1995) Hu et al. (2007) Hu et al. (2007) Cao et al. (2005) Cao et al. (2005) Cao et al. (2006) Cao et al. (2006) This study This study This study This study This study This study This study This study This study This study This study This study
five overlapping amplicons from the genomic DNA. PCR reactions (25 ll) were performed in 2 mM MgCl2, 0.2 mM each of dNTPs, 2.5 ll 10 rTaq buffer, 2.5 lM of each primer, 1.25 U rTaq polymerase (Takara), and 1 ll of DNA sample in a thermocycler (BioRad) under the following conditions: 94 °C for 5 min (initial denaturation), then 94 °C for 30 s (denaturation), 45–55 °C for 30 s (annealing), and 72 °C for 2–4 min (extension) for 35 cycles, followed by 72 °C for 10 min (final extension). One microliter (5–10 ng) of genomic DNA was added to each PCR reaction. Samples without genomic DNA (no-DNA controls) were included in each amplification run, and in no case were amplicons detected in the no-DNA controls (not shown). Each amplicon (5 ll) was examined by (1%) agarose gel electrophoresis to validate amplification efficiency. PCR products were sent to Sangon company (Shanghai, China) for sequencing using a primer walking strategy (Hu et al., 2007). 2.3. Sequence analyses Sequences were assembled manually and aligned against the complete mt genome sequences of Anisakis simplex s.l. (Kim et al., 2006) available using the computer program MAFFT 7.122 (Katoh and Standley, 2013) to identify gene boundaries. Translation initiation and translation termination codons were identified based on comparison with those of reported previously (Kim et al., 2006; Mohandas et al., 2014). For analyzing tRNA genes, putative secondary structures of 22 tRNA genes were identified using tRNAscan-SE (Lowe and Eddy, 1997), or by recognizing potential secondary structures and anticodon sequences by eye, and two rRNA genes were predicted by comparison with those of reported previously (Kim et al., 2006; Mohandas et al., 2014). 2.4. Phylogenetic analyses The amino acid sequences conceptually translated from individual genes of the mt genome of P. azarasi were concatenated. Selected for comparison were concatenated amino acid sequences predicted from published mt genomes of key ascaridoid nematodes representing the Ascaridomorpha, including the superfamily Ascaridoidea [Ascaris suum (Liu et al., 2012), A. simplex (Kim et al., 2006), Baylisascaris ailuri, Baylisascaris schroederi, Baylisascaris transfuga (Xie et al., 2011a), Baylisascaris procyonis (Xie et al., 2011b), Contracaecum rudolphii B (Lin et al., 2012), Toxocara canis, Toxocara cati, Toxocara malaysiensis (Li et al., 2008b), Toxascaris leonina (Liu et al., 2014a), Parascaris univalens (Jabbar et al., 2014), A. simplex s.s., Contracaecum osculatum s.s. (Mohandas et al., 2014)] and the superfamily Heterakoidea (Ascaridia galli, Ascaridia columbae and Ascaridia sp. (Liu et al., 2013), and the superfamily Seuratoidea (Cucullanus robustus (Park et al., 2011), using Dirofilaria immitis as an outgroup (Tamura et al., 2007). All amino acid sequences were aligned using MAFFT 7.122, and ambiguously aligned regions were excluded using Gblocks online server (http://molevol.cmima.csic.es/castresana/ Gblocks_server.html) with the default parameters (Talavera and Castresana, 2007) using the options for a less stringent selection, and then subjected to phylogenetic analysis using Bayesian inference (BI). BI was conducted with four independent Markov chains run for 1,000,000 metropolis-coupled MCMC generations, sampling a tree every 100 generations in MrBayes3.1.1 (Ronquist and Huelsenbeck, 2003). The first 25% (2500) trees were omitted as burn-in and the remaining trees were used to calculate Bayesian posterior probabilities (BPP). The analysis was performed until the potential scale reduction factor (PSRF) approached 1 and the average standard deviation of split frequencies was less than 0.01. Phylograms were drawn using the program FigTree v.1.4 (Rambaut, 2012).
Please cite this article in press as: Liu, S.-S., et al. The complete mitochondrial genome of Pseudoterranova azarasi and comparative analysis with other anisakid nematodes. Infect. Genet. Evol. (2015), http://dx.doi.org/10.1016/j.meegid.2015.05.018
3
S.-S. Liu et al. / Infection, Genetics and Evolution xxx (2015) xxx–xxx
3. Results and discussion 3.1. General features of the mt genome of P. azarasi
Fig. 1. Arrangement of the mitochondrial genome of Pseudoterranova azarasi. Gene scaling is only approximate. All genes have standard nomenclature including the 22 tRNA genes, which are designated by the one-letter code for the corresponding amino acid, with numerals differentiating each of the two leucine- and serinespecifying tRNAs (L1 and L2 for codon families CUN and UUR, respectively; S1 and S2 for codon families AGN and UCN, respectively). ‘‘NCL’’ refers to a large noncoding region, and ‘‘NCR’’ refers to a small non-coding region.
The complete mt genome of P. azarasi was 13,954 bp in size (Fig. 1). The sequences have been deposited in GenBank under the accession number KR052144. This circular mt genome is typical of other chromadorea nematode mt genomes, including 12 protein-coding genes (cox1-3, nad1-6, nad4L, cytb and atp6), 22 transfer RNA genes, two ribosomal RNA genes and two non-coding regions (Table 2). All genes are transcribed in the same direction. The nucleotide composition of the entire mt genome of P. azarasi is: A = 3112 (22.3%), T = 6755 (48.4%), G = 2742 (19.7%) and C = 1345 (9.6%), and its A + T content was 70.7%, in accordance with mt genomes of other Ascaridomorpha nematodes sequenced to date (Kim et al., 2006; Li et al., 2008a) (Table 3). AT- and GC-skews of the whole mt genome were calculated for P. azarasi and other anisakid nematodes (Table 4). The composition of the P. azarasi mt genome sequence was strongly skewed away from A, in favor of T (AT skew = 0.37), and the GC skew was 0.34 (Table 4), consistent with those of other Ascaridomorpha nematodes. The mt genome of P. azarasi contains 69 bp of intergenic sequences which spread over 18 locations, ranging from 1 to 10 bp in size. The longest intergenic regions are located between the nad4L and tRNA-Trp genes. Previous studies clearly indicated that the intergenic regions of mt genome of metazoans contains signals for transcription initiation and replication (Cantatore and Attardi, 1980; Goddard and Wolstenholme, 1980).
Table 2 Organization of Pseudoterranova azarasi mitochondrial genome. Genes
Positions and lengths (bp)
Start/stop codons
nad1 atp6 tRNA-Lys (K) tRNA-LeuUUR (L2) tRNA-SerAGN (S1) nad2 tRNA-Ile (I) tRNA-Arg (R) tRNA-Gln (Q) tRNA-Phe (F) cytb tRNA-LeuCUN (L1) cox3 tRNA-Thr (T) nad4 Non-coding region (NCR) cox1 tRNA-Cys (C) tRNA-Met (M) tRNA-Asp (D) tRNA-Gly (G) cox2 tRNA-His (H) rrnL nad3 nad5 tRNA-Ala (A) tRNA-Pro (P) tRNA-Val (V) nad6 nad4L tRNA-Trp (W) tRNA-Glu (E) rrnS tRNA-serUCN (S2) Non-coding region (NCL) tRNA-Asn (N) tRNA-Tyr (Y)
1–873 (873) 881–1480 (600) 1487–1549 (63) 1557–1611 (55) 1612–1663 (52) 1664–2509 (846) 2512–2573 (62) 2574–2631 (58) 2632–2686 (55) 2691–2748 (58) 2749–3850 (1102) 3851–3905 (55) 3906–4671 (766) 4672–4725 (54) 4726–5955 (1230) 5956–6077 (122) 6078–7653 (1576) 7654–7709 (56) 7711–7770 (60) 7775–7833 (59) 7839–7894 (56) 7895–8595 (701) 8596–8651 (56) 8657–9613 (957) 9616–9951 (336) 9960–11541 (1582) 11544–11599 (56) 11601–11655 (55) 11660–11714 (55) 11715–12149 (435) 12151–12382 (232) 12383–12440 (58) 12449–12508 (60) 12509–13210 (702) 13215–13268 (54) 13269–13831 (563) 13832–13889 (58) 13896–13954 (59)
TTG/TAG TTG/TAA
Anticodons
TTT TAA TCT TTG/TAA GAT ACG TTG GAA ATA/T TAG TTG/T TGT TTG/TAG TTG/T GCA CAT GTC TCC TTG/TA GTG TTG/TAA ATT/T TGC TGG TAC TGG/TAA ATT/T TCA TTC TGA GTT GTA
Intergenic 0 +7 +6 +7 0 0 +2 0 0 +4 0 0 0 0 0 0 0 0 +1 +4 +5 0 0 +5 +2 +2 +1 +4 0 +1 0 +8 0 +4 0 0 +6 0
Please cite this article in press as: Liu, S.-S., et al. The complete mitochondrial genome of Pseudoterranova azarasi and comparative analysis with other anisakid nematodes. Infect. Genet. Evol. (2015), http://dx.doi.org/10.1016/j.meegid.2015.05.018
4
S.-S. Liu et al. / Infection, Genetics and Evolution xxx (2015) xxx–xxx
Table 3 Comparison of A + T content (%) of the AT region, protein-coding and rRNA genes of mitochondrial genomes of Anisakidae species. Gene or region
Paz
CrB
Asi
Asim
Cos
atp6 cox1 cox2 cox3 cytb nad1 nad2 nad3 nad4 nad4L nad5 nad6 rrnS rrnL AT-region EmtG
69.5 65 67 68.8 67.5 68.3 73.9 72.9 70.2 76.7 70.9 74.7 70.7 75.2 81.2 70.7
67.5 64.7 66.7 65.8 68.8 68.5 73.3 73.5 67.5 78.5 72.1 73.8 69.4 75.1 89.2 70.5
70.7 66.1 67 66.3 67.9 68.2 73.3 75.3 69.9 76.7 72.1 71.3 71.2 76.1 87.2 71.2
70.7 66.1 67 66.3 67.9 68.2 73.3 75.3 70 76.8 72.1 71.3 72 76.1 87.2 71.2
71.7 65.1 65.4 67.1 66.6 67 74.8 74.7 68.9 77.4 71.5 77 71 76 75.2 70.2
3.4. Non-coding regions The majority of metazoan mtDNA sequences contain two non-coding regions of significant size difference, the long non-coding regions (NCL) and the short non-coding regions (NCR). For the P. azarasi, the longer non-coding region (NCL) is located between the tRNA-SerUCN and tRNA-Asn, and the shorter one (NCR) is located between genes nad4 and cox1. Their sizes are 563 bp (NCL) and 122 bp (NCR) (Table 3). The A + T contents of the NCL and NCR are 81.0% and 81.2%, respectively (Table 3), which is consistent with those of other anisakid nematodes (Kim et al., 2006; Lin et al., 2012; Mohandas et al., 2014). 3.5. Sequences comparisons and phylogenetic analyses
Paz: Pseudoterranova azarasi; CrB: Contracaecum rudolphii B; Asi: Anisakis simplex s.l.; Asim: Anisakis simplex s.s; Cos: Contracaecum osculatum s.s; EmtG: entire mitochondrial genome.
3.2. Protein-coding genes The mt genome of the P. azarasi encodes 12 protein-coding genes. A total of 3,418 amino acids are encoded by the P. azarasi mt genome. In this mt genome, 2 genes (nad5 and nad4L) start with ATT, 9 genes (nad1, atp6, nad2, cox3, nad4, cox1, cox2, nad3 and nad6) use TTG and 1 gene (cytb) use ATA as start codon, respectively (Table 2). All genes have complete termination codon except for cytb, cox1, cox2, cox3, nad5 and nad4L which use abbreviated stop codon TA or T, and 4 genes (nad2, nad3, nad6 and atp6) use TAA and 2 genes (nad1 and nad4) use TAG as termination codon (Table 2). P. azarasi mt genome were inferred to end with an abbreviated stop codon, such as T and TA, which is consistent with the arrangement in the mt genomes of other anisakid nematodes (Kim et al., 2006; Lin et al., 2012). To explain the abbreviated stop codon in most of the reading frames, it is hypothesized that the after transcription and processing, mRNAs ending in T or TA are converted to TAA by polyadenylation (Ojala et al., 1981).
3.3. Transfer RNA genes and ribosomal RNA genes A total of 22 tRNA sequences (ranging from 52 to 63 nucleotides in length) were identified in the P. azarasi mt genome. Their predicted secondary structures (not shown) are similar to those of other anisakid nematodes (Kim et al., 2006; Lin et al., 2012). The P. azarasi rrnL gene is located between tRNA-His and nad3, and rrnS gene is located between tRNA-Glu and tRNA-SerUCN. The length of the rrnL gene is 957 bp and rrnS gene is 702 bp (Table 2). The A + T contents of the rrnL and rrnS genes are 75.2% and 70.7%, respectively (Table 3). The result is consistent with those of other anisakid nematodes (Kim et al., 2006; Lin et al., 2012; Mohandas et al., 2014).
Pairwise comparisons in the amino acid sequences inferred from individual protein-coding genes between the mt genomes of P. azarasi and other anisakid nematodes (Table 5). The amino acid sequence similarities in individual inferred proteins ranged from 65.0% (CYTB) to 97.4% (NAD4L) among them. Based on identity, NAD4L was the most conserved protein, whereas CYTB were the least conserved (Table 5). Phylogenetic analyses of P. azarasi with related nematodes of the Ascaridomorpha were performed by BI based on concatenated mitochondrial amino acid sequences of 12 protein-coding genes (Fig. 2). The families Ascarididae, Toxocaridae, Anisakidae and Ascaridiidae were four monophyletic with strong support in current analysis, and Anisakidae is more closely related to the Ascarididae and Toxocaridae rather than the Ascaridiidae. These results were consistent with those of previous studies (Liu et al., 2014a; Lin et al., 2012). Our data also confirm that Pseudoterranova were more closely related to Anisakis than they were to Contracaecum with strong a Bpp = 1.0 support. 3.6. Significance and implications Although much attention has been paid to soil-transmitted nematodes as pathogens because they have a devastating, Table 5 Differences (%) in mitochondrial amino acid sequences between Pseudoterranova azarasi and other Anisakidae nematodes. Gene or region
CrB
Asi
Asim
Cos
atp6 cox1 cox2 cox3 cytb nad1 nad2 nad3 nad4 nad4L nad5 nad6
87.9 93.9 91.4 91.4 65.8 87.9 73 81.1 78.5 90.9 80.1 77.1
92 94.7 94.8 93.3 82.6 95.9 94 87.4 91 97.4 93.4 90.3
92 96.2 95.3 94.5 82.4 95.5 93.6 87.4 91 97.4 93.4 90.3
87.9 93.5 91.8 88.6 65 89.7 76.5 82.9 76 93.5 83.3 81.2
CrB: Contracaecum rudolphii B; Asi: Anisakis simplex s.l.; Asim: Anisakis simplex s.s.; Cos: Contracaecum osculatum s.s.
Table 4 Composition and skewness in the mitochondrial genomes of Anisakidae nematodes. Species
Size (bp)
A%
T%
G%
C%
AT skewness
GC skewness
Pseudoterranova azarasi Anisakis simplex s.l. Anisakis simplex s.s. Contracaecum osculatum s.s. Contracaecum rudolphii B
13,954 13,916 13,926 13,823 14,022
22.3 22.9 22.6 22.7 22.8
48.4 48.3 48.2 47.5 47.7
19.7 19.0 17.4 19.8 19.6
9.6 9.8 9.8 10 9.9
0.37 0.36 0.36 0.35 0.35
0.34 0.32 0.28 0.33 0.33
Please cite this article in press as: Liu, S.-S., et al. The complete mitochondrial genome of Pseudoterranova azarasi and comparative analysis with other anisakid nematodes. Infect. Genet. Evol. (2015), http://dx.doi.org/10.1016/j.meegid.2015.05.018
S.-S. Liu et al. / Infection, Genetics and Evolution xxx (2015) xxx–xxx
5
Fig. 2. Inferred phylogenetic relationships among representative infraorder Ascaridomorpha nematodes based on concatenated amino acid sequences of 12 protein-coding genes utilizing Bayesian inference, using Dirofilaria immitis as outgroup.
long-term adverse impact on human health worldwide (Bethony et al., 2006), anisakid nematodes that cause chronic disease, such as members of the genus Pseudoterranova, have been seriously neglected (Hochberg et al., 2010). There is considerable significance employing mtDNA markers to investigate the genetic variation of Pseudoterranova populations, particularly at the larval stages or cryptic/sibling species because morphological features of Pseudoterranova species is still scarce (Hernández-Orts et al., 2013). The Pseudoterranova decipiens species complex consists of at least 5 sibling species (genetically but not morphologically distinguishable): P. decipiens, P. azarasi, Pseudoterranova cattani, Pseudoterranova krabbei and Pseudoterranova bulbosa (Paggi et al., 1991, 2000). mtDNA is proposed to be maternally inherited, and it may be the best choice for applications sequence within a species to search for potential cryptic/cryptic/sibling species of nematodes (Blouin, 2002). The complete mt genome of P. azarasi here might allow to identify and differentiate of these cryptic/sibling nematodes based on specific PCR. In addition, in the present study, the characterization of the mt genome of P. azarasi provides a foundation for the improved diagnosis of human anisakidosis using molecular methods. Due to the vague symptoms and limited diagnostic tests, there raises the questions to the extent of hidden cases of anisakidosis around the world (Shamsi, 2014). Molecular tools, using genetic markers in mt genes, would been developed to support clinical diagnosis and to assist in undertaking molecular epidemiological investigations of P. azarasi. Mt genome sequences may provide reliable genetic markers in examining taxonomic status of helminths, particularly when protein-coding gene sequences are used as markers in comparative analyses (Park et al., 2011; Liu et al., 2013, 2014a, 2014b, 2015; Yang et al., 2015). Therefore, in the present study, the characterization of the mt genome of P. azarasi also stimulates a reassessment of the systematic relationships of anisakid nematodes (Anisakidae) within the Ascaridomorpha using mt genomic datasets. Over the years, there has been considerable argument about the systematics of members of the Ascaridomorpha (including Anisakidae, Ascarididae, Ascaridiidae, Cucullanidae and Toxocaridae). Phylogenetic relationships among anisakid nematodes have been inferred in the past based on sequences of nuclear small subunit (SSU) rRNA gene (Nadler et al., 2005), but no information is
available about phylogenetic relationships of anisakid nematodes from mt genomes due to limited data. To date, mt genomes of many lineages of anisakid nematodes are still underrepresented or not represented. Therefore, expanding taxon sampling is necessary for future phylogenetic studies of Ascaridomorpha using mt genomic datasets. In conclusion, the present study determined the complete mtDNA data of P. azarasi and compared with that of other anisakid nematodes. Phylogenetic analyses showed that Pseudoterranova spp. were more closely related to Anisakis than they were to Contracaecum. The mt genome sequences of P. azarasi provides novel genetic markers for exploring cryptic/sibling species and host affiliations, and should have implications for the diagnosis, prevention and control of anisakidosis in humans. Acknowledgements This work was supported, in part, by the International Science & Technology Cooperation Program of China (Grant No. 2013DFA31840) and the Science Fund for Creative Research Groups of Gansu Province (Grant No. 1210RJIA006) to XQZ. References Audicana, M.T., Kennedy, M.W., 2008. Anisakis simplex: from obscure infectious worm to inducer of immune hypersensitivity. Clin. Microbiol. Rev. 21, 360–379. Bethony, J., Brooker, S., Albonico, M., Geiger, S.M., Loukas, A., Diemert, D., Hotez, P.J., 2006. Soil-transmitted helminth infections: ascariasis, trichuriasis, and hookworm. Lancet 367, 1521–1532. Blouin, M.S., 2002. Molecular prospecting for cryptic species of nematodes: mitochondrial DNA versus internal transcribed spacer. Int. J. Parasitol. 32, 527–531. Bowles, J., Blair, D., McManus, D.P., 1995. A molecular phylogene of the genus Echinococcus. Parasitology 110, 317–328. Cantatore, P., Attardi, G., 1980. Mapping of nascent light and heavy strand transcripts on the physical map of HeLa cell mitochondrial DNA. Nucleic Acids Res. 8, 2605–2626. Cao, Z., Lin, R.Q., Wu, S.Q., Song, H.Q., Li, M.W., He, F., Zhu, X.Q., 2006. Sequence polymorphisms in mitochondrial nad4 gene between members of the Pseudoterranova decipiens complex. Chin. J. Vet. Med. 3, 7–9, In Chinese. Cao, Z., Weng, Y.B., Lin, R.Q., Li, M.W., Zou, F.C., He, F., Zhu, X.Q., 2005. Polymorphisms in mitochondrial rrnL and cox1 genes within and between members of Pseudoterranova decipiens complex. Chin. J. Vet. Sci. 25, 600–603 (in Chinese).
Please cite this article in press as: Liu, S.-S., et al. The complete mitochondrial genome of Pseudoterranova azarasi and comparative analysis with other anisakid nematodes. Infect. Genet. Evol. (2015), http://dx.doi.org/10.1016/j.meegid.2015.05.018
6
S.-S. Liu et al. / Infection, Genetics and Evolution xxx (2015) xxx–xxx
Garbin, L.E., Mattiucci, S., Paoletti, M., Diaz, J.I., Nascetti, G., Navone, G.T., 2013. Molecular identification and larval morphological description of Contracaecum pelagicum (Nematoda: Anisakidae) from the anchovy Engraulis anchoita (Engraulidae) and fish-eating birds from the Argentine North Patagonian Sea. Parasitol. Int. 62, 309–319. Goddard, J.M., Wolstenholme, D.R., 1980. Origin and direction of replication in mitochondrial DNA molecules from the genus Drosophila. Nucleic Acids Res. 8, 741–757. Hernández-Orts, J.S., Aznar, F.J., Blasco-Costa, I., García, N.A., Víllora-Montero, M., Crespo, E.A., Raga, J.A., Montero, F.E., 2013. Description, microhabitat selection and infection patterns of sealworm larvae (Pseudoterranova decipiens species complex, nematoda: ascaridoidea) in fishes from Patagonia, Argentina, Parasit. Vectors 29, 252. Hochberg, N.S., Hamer, D.H., Hughes, J.M., Wilson, M.E., 2010. Anisakidosis: perils of the deep. Clin. Infect. Dis. 51, 806–812. Hu, M., Jex, A.R., Campbell, B.E., Gasser, R.B., 2007. Long PCR amplification of the entire mitochondrial genome from individual helminths for direct sequencing. Nat. Protoc. 10, 2339–2344. Jabbar, A., Littlewood, D.T., Mohandas, N., Briscoe, A.G., Foster, P.G., Muller, F., von Samson-Himmelstjerna, G., Jex, A.R., Gasser, R.B., 2014. The mitochondrial genome of Parascaris univalens – implications for a forgotten parasite, Parasit. Vectors 7, 428. Katoh, K., Standley, D.M., 2013. MAFFT multiple sequence alignment software version 7: improvements in performance and usability. Mol. Biol. Evol. 30, 772– 780. Kim, K.H., Eoma, K.S., Park, J.K., 2006. The complete mitochondrial genome of Anisakis simplex (Ascaridida: Nematoda) and phylogenetic implications. Int. J. Parasitol. 36, 319–328. Li, M.W., Lin, R.Q., Song, H.Q., Sani, R.A., Wu, X.Y., Zhu, X.Q., 2008a. Electrophoretic analysis of sequence variability in three mitochondrial DNA regions for ascaridoid parasites of human and animal health significance. Electrophoresis 29, 2912–2917. Li, M.W., Lin, R.Q., Song, H.Q., Wu, X.Y., Zhu, X.Q., 2008b. The complete mitochondrial genomes for three Toxocara species of human and animal health significance. BMC Genomics 9, 224. Lin, R.Q., Liu, G.H., Zhang, Y., D’Amelio, S., Zhou, D.H., Yuan, Z.G., Zou, F.C., Song, H.Q., Zhu, X.Q., 2012. Contracaecum rudolphii B: gene content, arrangement and composition of its complete mitochondrial genome compared with Anisakis simplex s.l. Exp. Parasitol. 130, 135–140. Lin, R.Q., Liu, G.H., D’Amelio, S., Zhang, Y., Song, H.Q., Weng, Y.B., Zou, F.C., Zhu, X.Q., 2013. Sequence variation in four mitochondrial genes among sibling species within Contracaecum rudolphii sensu lato. Mol. Cell. Probes 27, 145–148. Liu, G.H., Wu, C.Y., Song, H.Q., Wei, S.J., Xu, M.J., Lin, R.Q., Zhao, G.H., Huang, S.Y., Zhu, X.Q., 2012. Comparative analyses of the complete mitochondrial genomes of Ascaris lumbricoides and Ascaris suum from humans and pigs. Gene 492, 110– 116. Liu, G.H., Shao, R., Li, J.Y., Zhou, D.H., Li, H., Zhu, X.Q., 2013. The complete mitochondrial genomes of three parasitic nematodes of birds: a unique gene order and insights into nematode phylogeny. BMC Genomics 14, 414. Liu, G.H., Zhou, D.H., Zhao, L., Xiong, R.C., Liang, J.Y., Zhu, X.Q., 2014a. The complete mitochondrial genome of Toxascaris leonina: comparison with other closely related species and phylogenetic implications. Infect. Genet. Evol. 21, 329–333. Liu, G.H., Yan, H.B., Otranto, D., Wang, X.Y., Zhao, G.H., Jia, W.Z., Zhu, X.Q., 2014b. Dicrocoelium chinensis and Dicrocoelium dendriticum (Trematoda: Digenea) are distinct lancet fluke species based on mitochondrial and nuclear ribosomal DNA sequences. Mol. Phylogenet. Evol. 79, 325–331. Liu, G.H., Jia, Y.Q., Wang, Y.N., Zhao, G.H., Zhu, X.Q., 2015. The complete mitochondrial genome of the gullet worm Gongylonema pulchrum: gene content, arrangement, composition and phylogenetic implications, Parasit. Vectors 8, 697. Lowe, T.M., Eddy, S.R., 1997. TRNAscan – SE: a program for improved detection of transfer RNA genes in genomic sequence. Nucleic Acids Res. 25, 955–964. Mattiucci, S., Nascetti, G., 2008. Advances and trends in the molecular systematics of anisakid nematodes, with implications for their evolutionary ecology and host-parasite co-evolutionary processes. Adv. Parasitol. 66, 47–148.
Mattiucci, S., Nascetti, G., Dailey, M., Webb, S.C., Barros, N.B., Cianchi, R., Bullini, L., 2005. Evidence for a new species of Anisakis Dujardin, 1845: morphological description and genetic relationships between congeners (Nematoda: Anisakidae). Syst. Parasitol. 61, 157–171. Mohandas, N., Jabbar, A., Podolska, M., Zhu, X.Q., Littlewood, D.T.J., Jex, A.R., Gasser, R.B., 2014. Mitochondrial genomes of Anisakis simplex and Contracaecum osculatum (sensu stricto) –comparisons with selected nematodes. Infect. Genet. Evol. 21, 452–462. Nadler, S.A., D’Amelio, S., Dailey, M.D., Paggi, L., Siu, S., Sakanari, J.A., 2005. Molecular phylogenetics and diagnosis of Anisakis, Pseudoterranova, and Contracaecum from northern Pacific marine mammals. J. Parasitol. 91, 1413– 1429. Ojala, D., Montoya, J., Attardi, G., 1981. TRNA punctuation model of RNA processing in human mitochondria. Nature 290, 470–474. Ondrejicka, D.A., Locke, S.A., Morey, K., Borisenko, A.V., Hanner, R.H., 2014. Status and prospects of DNA barcoding in medically important parasites and vectors. Trends Parasitol. 30, 582–591. Paggi, L., Nascetti, G., Cianchi, R., Orecchia, P., Mattiucci, S., D’Amelio, S., Berland, B., Bratte, Y.J., Smith, J.W., Bullini, L., 1991. Genetic evidence for three species within Pseudoterranova decipiens (Nematoda, Ascaridida, Ascaridoidea) in the North Atlantic and Norwegian and Barents Seas. Int. J. Parasitol. 21, 195–212. Paggi, L., Mattiucci, S., Gibson, D.I., Berland, B., Nascetti, G., Cianchi, R., Bullini, L., 2000. Pseudoterranova decipiens species A and B (Nematoda, Ascaridoidea): nomenclatural designation, morphological diagnostic characters and genetic markers. Syst. Parasitol. 45, 185–197. Park, J.K., Sultana, T., Lee, S.H., Kang, S., Kim, H.K., Min, G.S., Eom, K.S., Nadler, S.A., 2011. Monophyly of clade III nematodes is not supported by phylogenetic analysis of complete mitochondrial genome sequences. BMC Genomics 12, 392. Pekmezci, G.Z., Onuk, E.E., Bolukbas, C.S., Yardimci, B., Gurler, A.T., Acici, M., Umur, S., 2014. Molecular identification of Anisakis species (Nematoda: Anisakidae) from marine fishes collected in Turkish waters. Vet. Parasitol. 201, 82–94. Pravettoni, V., Primavesi, L., Piantanida, M., 2012. Anisakis simplex: current knowledge. Eur. Ann. Allergy Clin. Immunol. 44, 150–156. Quiazon, K.M., Santos, M.D., Yoshinaga, T., 2013. Anisakis species (Nematoda: Anisakidae) of Dwarf Sperm Whale Kogia sima (Owen, 1866) stranded off the Pacific coast of southern Philippine archipelago. Vet. Parasitol. 197, 221–230. Rambaut, A., 2012. FigTree, a graphical viewer of phylogenetic trees. Available from http://tree.bio.ed.ac.uk/software/figtree. Ronquist, F., Huelsenbeck, J.P., 2003. MrBayes 3: bayesian phylogenetic inference under mixed models. Bioinformatics 19, 1572–1574. Shamsi, S., 2014. Recent advances in our knowledge of Australian anisakid nematodes. Int. J. Parasitol. Parasite Wildl. 3, 178–187. Skrjabin, K.I., Shikhobalova, N.P., Mozgovoi, A.A., 1991. Oxyurata and Ascaridata. In: Skrjabin, K.I. (Ed.), Key to Parasitic Nematodes, vol. II. Amerind Publishing Co., Pvt. Ltd., New Delhi. Talavera, G., Castresana, J., 2007. Improvement of phylogenies after removing divergent and ambiguously aligned blocks from protein sequence alignments. Syst. Biol. 56, 564–577. Tamura, K., Dudley, J., Nei, M., Kumar, S., 2007. MEGA4: molecular evolutionary genetics analysis (MEGA) software version 4.0. Mol. Biol. Evol. 24, 1596–1599. Xie, Y., Zhang, Z., Niu, L., Wang, Q., Wang, C., Lan, J., Deng, J., Fu, Y., Nie, H., Yan, N., Yang, D., Hao, G., Gu, X., Wang, S., Peng, X., Yang, G., 2011a. The mitochondrial genome of Baylisascaris procyonis. PLoS ONE 6, e27066. Xie, Y., Zhang, Z., Wang, C., Lan, J., Li, Y., Chen, Z., Fu, Y., Nie, H., Yan, N., Gu, X., Wang, S., Peng, X., Yang, G., 2011b. Complete mitochondrial genomes of Baylisascaris schroederi, Baylisascaris ailuri and Baylisascaris transfuga from giant panda, red panda and polar bear. Gene 482, 59–67. Yang, X., Gasser, R.B., Koehler, A.V., Wang, L., Zhu, K., Chen, L., Feng, H., Hu, M., Fang, R., 2015. Mitochondrial genome of Hypoderaeum conoideum-comparison with selected trematodes, Parasit. Vectors 8, 720. Zhu, X.Q., Beveridge, I., Berger, L., Barton, D., Gasser, R.B., 2002. Single-strand conformation polymorphism-based analysis reveals genetic variation within Spirometraerinacei (Cestoda: Pseudophyllidea) from Australia. Mol. Cell. Probes 16, 159–165.
Please cite this article in press as: Liu, S.-S., et al. The complete mitochondrial genome of Pseudoterranova azarasi and comparative analysis with other anisakid nematodes. Infect. Genet. Evol. (2015), http://dx.doi.org/10.1016/j.meegid.2015.05.018
Contents lists available at ScienceDirect
Infection, Genetics and Evolution journal homepage: www.elsevier.com/locate/meegid
The complete mitochondrial genome of Pseudoterranova azarasi and comparative analysis with other anisakid nematodes Shan-Shan Liu a,b, Guo-Hua Liu b,⇑, Xing-Quan Zhu b, Ya-Biao Weng a,⇑ a
College of Veterinary Medicine, South China Agricultural University, Guangzhou, Guangdong Province 510642, PR China State Key Laboratory of Veterinary Etiological Biology, Key Laboratory of Veterinary Parasitology of Gansu Province, Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences, Lanzhou, Gansu Province 730046, PR China b
a r t i c l e
i n f o
Article history: Received 1 April 2015 Received in revised form 15 May 2015 Accepted 16 May 2015 Available online xxxx Keywords: Anisakid nematodes Mitochondrial genome Genetics Phylogenetic analyses
a b s t r a c t Anisakiasis/anisakidosis caused by anisakid nematodes is an emerging infectious disease that can cause a wide range of clinical syndromes and are difficult to diagnose and treat in humans. In spite of their significance as pathogens, the systematics, genetics, epidemiology and biology of these parasites remain poorly understood. In the present study, we sequenced the complete mitochondrial (mt) genome of Pseudoterranova azarasi, which is one of the most important zoonotic anisakid parasites. The circular mt genome is 13,954 bp in size and encodes of 36 genes, including 12 protein-coding, 2 ribosomal RNA and 22 transfer RNA genes. The mt gene order of P. azarasi is the same as those of Ascaris spp. (Ascarididae), Toxocara spp. (Toxocaridae) and Anisakis simplex (Anisakidae), but distinct from those of Ascaridia spp. (Ascaridiidae) and Cucullanus robustus (Cucullanidae). Phylogenetic analyses based on concatenated amino acid sequences of 12 protein-coding genes by Bayesian inference (BI) showed that Pseudoterranova were more closely related to Anisakis than they were to Contracaecum with strong a posterior probability support. This mt genome provides a novel genetic markers for exploring cryptic/sibling species and host affiliations, and should have implications for the diagnosis, prevention and control of anisakidosis in humans. Ó 2015 Published by Elsevier B.V.
1. Introduction Anisakid nematodes infect a wide range of invertebrates and vertebrates with a cosmopolitan distribution. Human anisakiasis/ anisakidosis caused by the members of genura Anisakis, Contracaecum and Pseudoterranova is an emerging infectious disease that can be associated with mild to severe gastrointestinal disease and allergic responses (Audicana and Kennedy, 2008; Pravettoni et al., 2012). Humans are infected by eating raw or undercooked marine fish with third-stage larva (L3). Given the hot popularity of consuming raw or undercooked fish (e.g., sushi and sashimi), it is possible that anisakidosis is increasing and it is under diagnosed due to limited diagnostic test (Shamsi, 2014). Unfortunately, to date, no effective drug are available, and treatment only relies on surgery. The accurate identification and differentiation of anisakid nematodes has important implications for studying their systematics, genetics, epidemiology and biology. Recently, although ⇑ Corresponding authors. E-mail addresses: [email protected] (G.-H. Liu), [email protected] (Y.-B. Weng).
morphological features have been used to identify adults and some L3 of anisakid nematodes to type or species levels (Mattiucci et al., 2005), these criteria are sometimes insufficient for specific identification and differentiation of anisakid nematodes, particularly at the larval stages (Mattiucci and Nascetti, 2008). Various DNA techniques have provided powerful complementary tools to overcome the limitations of morphological approach, which have often been used to distinguish species from one another (Ondrejicka et al., 2014). The internal transcribed spacers (ITS) of nuclear ribosomal DNA (rDNA) region (Garbin et al., 2013; Pekmezci et al., 2014) and mitochondrial (mt) DNA (mtDNA) (Lin et al., 2013; Quiazon et al., 2013) have been used as genetic markers for studying genetic variation in anisakid nematodes, including some cryptic/sibling species. However, some studies have emphasized that it is better to use the complete mt genome datasets for the exploring cryptic/sibling species of anisakid nematodes (Mattiucci and Nascetti, 2008). In spite of the availability of advanced sequencing and bioinformatic methods, there is still relatively limited knowledge about complete mt genomes of many anisakid nematodes of socio-economic importance. In the family Anisakidae, to date, the complete mt genomes have been reported for only four species (Kim et al., 2006; Lin et al., 2012; Mohandas et al., 2014), and in
http://dx.doi.org/10.1016/j.meegid.2015.05.018 1567-1348/Ó 2015 Published by Elsevier B.V.
Please cite this article in press as: Liu, S.-S., et al. The complete mitochondrial genome of Pseudoterranova azarasi and comparative analysis with other anisakid nematodes. Infect. Genet. Evol. (2015), http://dx.doi.org/10.1016/j.meegid.2015.05.018
2
S.-S. Liu et al. / Infection, Genetics and Evolution xxx (2015) xxx–xxx
the genus Pseudoterranova (an important etiological agents for zoonotic human anisakidosis), no information is available about the complete mt genome datasets. The objectives of the present study were (i) to determine the complete mt genome of Pseudoterranova azarasi, which is one of the most important anisakid parasites, (ii) to compare this mt sequence with those of other anisakid nematodes, (iii) and to re-examine phylogenetic relationships among the infraorder Ascaridomorpha using the protein-coding amino acid sequences. 2. Materials and methods 2.1. Parasites and DNA extraction The adult worm of P. azarasi was obtained from gastrointestinal tract of Eumetopias jubata (Steller’s sea lion) in Iwanai, Japan. This specimen was washed in physiological saline, identified morphologically to species according to existing keys and descriptions (Skrjabin et al., 1991), fixed in 70% (v/v) ethanol and stored at 20 °C until use. Total genomic DNA was isolated from this specimen using sodium dodecyl sulfate/proteinase K treatment, followed by spin-column purification (WizardÒ SV Genomic DNA Purification System, Promega). The molecular identity of this specimen was then verified by PCR using previously reported primers (Zhu et al., 2002) and sequenced directly. 2.2. PCR amplification and sequencing A fragment of the cox1, nad1, nad4, cytb and rrnL was amplified by PCR with primers described in Table 1 (Bowles et al., 1995; Hu et al., 2007; Cao et al., 2005, 2006), respectively, and the amplicons directly sequenced. Based on the partial cox1, nad1, nad4, cytb and rrnL sequences, five pairs of primers (Table 1) were designed in the conserved regions to amplify the complete mt genome by PCR as
Table 1 Sequences of primers for amplifying mitochondrial DNA regions from Pseudoterranova azarasi. Primer
Sequence (50 to 30 )
Amplified sequences
References
JB3
TTTTTTGGGCATCCTGAGGTTTAT
cox1
JB4.5
TAAAGAAAGAACATAATGAAAATG
cox1
MH21F
TCAAATGTTTTTTAAAGACTTAGG
rrnL
MH22R
CAAGATAAACAATTCTATCTCAC
rrnL
CZH1
TATGAGCGTCATTTATTRGG
nad1
CZH2
TATCATAACGAAAACGAGG
nad1
CZH3
GCGGCTTTTTGTTCTATGCC
nad4
CZH4
ATATGAGTAACAGAAGAATAA
nad4
CF CR N1-F Cb1-R Cb-2F N4-2R N4-3F C1-3R C1-4F Rl-4R Rl-5F N1-5R
TATTATACTAATGATGGTGCTTCT AACATTGACCCAACCAACT AGGGGAATATGGAGCTTTGTT AAAAACTCATCTGGGCTCATACTA AGTCATGTTAAGTTGGTTGG AAAGTCAAAATAAACCCTC TTGTTGGCTGGTTTGTTATTGA ATTCTTAAAATAGCATACACCATCC GGTTTGACGGGAGTTGTT GCTACCTTAATGTCCTCACGCTA CGGAGTTAACAGAAAATCATGTC AGCACCTACTATTCCGTACTTAG
cytb cytb nad1 to cytb nad1 to cytb cytb to nad4 cytb to nad4 nad4 to cox1 nad4 to cox1 cox1 to rrnL cox1 to rrnL rrnL to nad1 rrnL to nad1
Bowles et al. (1995) Bowles et al. (1995) Hu et al. (2007) Hu et al. (2007) Cao et al. (2005) Cao et al. (2005) Cao et al. (2006) Cao et al. (2006) This study This study This study This study This study This study This study This study This study This study This study This study
five overlapping amplicons from the genomic DNA. PCR reactions (25 ll) were performed in 2 mM MgCl2, 0.2 mM each of dNTPs, 2.5 ll 10 rTaq buffer, 2.5 lM of each primer, 1.25 U rTaq polymerase (Takara), and 1 ll of DNA sample in a thermocycler (BioRad) under the following conditions: 94 °C for 5 min (initial denaturation), then 94 °C for 30 s (denaturation), 45–55 °C for 30 s (annealing), and 72 °C for 2–4 min (extension) for 35 cycles, followed by 72 °C for 10 min (final extension). One microliter (5–10 ng) of genomic DNA was added to each PCR reaction. Samples without genomic DNA (no-DNA controls) were included in each amplification run, and in no case were amplicons detected in the no-DNA controls (not shown). Each amplicon (5 ll) was examined by (1%) agarose gel electrophoresis to validate amplification efficiency. PCR products were sent to Sangon company (Shanghai, China) for sequencing using a primer walking strategy (Hu et al., 2007). 2.3. Sequence analyses Sequences were assembled manually and aligned against the complete mt genome sequences of Anisakis simplex s.l. (Kim et al., 2006) available using the computer program MAFFT 7.122 (Katoh and Standley, 2013) to identify gene boundaries. Translation initiation and translation termination codons were identified based on comparison with those of reported previously (Kim et al., 2006; Mohandas et al., 2014). For analyzing tRNA genes, putative secondary structures of 22 tRNA genes were identified using tRNAscan-SE (Lowe and Eddy, 1997), or by recognizing potential secondary structures and anticodon sequences by eye, and two rRNA genes were predicted by comparison with those of reported previously (Kim et al., 2006; Mohandas et al., 2014). 2.4. Phylogenetic analyses The amino acid sequences conceptually translated from individual genes of the mt genome of P. azarasi were concatenated. Selected for comparison were concatenated amino acid sequences predicted from published mt genomes of key ascaridoid nematodes representing the Ascaridomorpha, including the superfamily Ascaridoidea [Ascaris suum (Liu et al., 2012), A. simplex (Kim et al., 2006), Baylisascaris ailuri, Baylisascaris schroederi, Baylisascaris transfuga (Xie et al., 2011a), Baylisascaris procyonis (Xie et al., 2011b), Contracaecum rudolphii B (Lin et al., 2012), Toxocara canis, Toxocara cati, Toxocara malaysiensis (Li et al., 2008b), Toxascaris leonina (Liu et al., 2014a), Parascaris univalens (Jabbar et al., 2014), A. simplex s.s., Contracaecum osculatum s.s. (Mohandas et al., 2014)] and the superfamily Heterakoidea (Ascaridia galli, Ascaridia columbae and Ascaridia sp. (Liu et al., 2013), and the superfamily Seuratoidea (Cucullanus robustus (Park et al., 2011), using Dirofilaria immitis as an outgroup (Tamura et al., 2007). All amino acid sequences were aligned using MAFFT 7.122, and ambiguously aligned regions were excluded using Gblocks online server (http://molevol.cmima.csic.es/castresana/ Gblocks_server.html) with the default parameters (Talavera and Castresana, 2007) using the options for a less stringent selection, and then subjected to phylogenetic analysis using Bayesian inference (BI). BI was conducted with four independent Markov chains run for 1,000,000 metropolis-coupled MCMC generations, sampling a tree every 100 generations in MrBayes3.1.1 (Ronquist and Huelsenbeck, 2003). The first 25% (2500) trees were omitted as burn-in and the remaining trees were used to calculate Bayesian posterior probabilities (BPP). The analysis was performed until the potential scale reduction factor (PSRF) approached 1 and the average standard deviation of split frequencies was less than 0.01. Phylograms were drawn using the program FigTree v.1.4 (Rambaut, 2012).
Please cite this article in press as: Liu, S.-S., et al. The complete mitochondrial genome of Pseudoterranova azarasi and comparative analysis with other anisakid nematodes. Infect. Genet. Evol. (2015), http://dx.doi.org/10.1016/j.meegid.2015.05.018
3
S.-S. Liu et al. / Infection, Genetics and Evolution xxx (2015) xxx–xxx
3. Results and discussion 3.1. General features of the mt genome of P. azarasi
Fig. 1. Arrangement of the mitochondrial genome of Pseudoterranova azarasi. Gene scaling is only approximate. All genes have standard nomenclature including the 22 tRNA genes, which are designated by the one-letter code for the corresponding amino acid, with numerals differentiating each of the two leucine- and serinespecifying tRNAs (L1 and L2 for codon families CUN and UUR, respectively; S1 and S2 for codon families AGN and UCN, respectively). ‘‘NCL’’ refers to a large noncoding region, and ‘‘NCR’’ refers to a small non-coding region.
The complete mt genome of P. azarasi was 13,954 bp in size (Fig. 1). The sequences have been deposited in GenBank under the accession number KR052144. This circular mt genome is typical of other chromadorea nematode mt genomes, including 12 protein-coding genes (cox1-3, nad1-6, nad4L, cytb and atp6), 22 transfer RNA genes, two ribosomal RNA genes and two non-coding regions (Table 2). All genes are transcribed in the same direction. The nucleotide composition of the entire mt genome of P. azarasi is: A = 3112 (22.3%), T = 6755 (48.4%), G = 2742 (19.7%) and C = 1345 (9.6%), and its A + T content was 70.7%, in accordance with mt genomes of other Ascaridomorpha nematodes sequenced to date (Kim et al., 2006; Li et al., 2008a) (Table 3). AT- and GC-skews of the whole mt genome were calculated for P. azarasi and other anisakid nematodes (Table 4). The composition of the P. azarasi mt genome sequence was strongly skewed away from A, in favor of T (AT skew = 0.37), and the GC skew was 0.34 (Table 4), consistent with those of other Ascaridomorpha nematodes. The mt genome of P. azarasi contains 69 bp of intergenic sequences which spread over 18 locations, ranging from 1 to 10 bp in size. The longest intergenic regions are located between the nad4L and tRNA-Trp genes. Previous studies clearly indicated that the intergenic regions of mt genome of metazoans contains signals for transcription initiation and replication (Cantatore and Attardi, 1980; Goddard and Wolstenholme, 1980).
Table 2 Organization of Pseudoterranova azarasi mitochondrial genome. Genes
Positions and lengths (bp)
Start/stop codons
nad1 atp6 tRNA-Lys (K) tRNA-LeuUUR (L2) tRNA-SerAGN (S1) nad2 tRNA-Ile (I) tRNA-Arg (R) tRNA-Gln (Q) tRNA-Phe (F) cytb tRNA-LeuCUN (L1) cox3 tRNA-Thr (T) nad4 Non-coding region (NCR) cox1 tRNA-Cys (C) tRNA-Met (M) tRNA-Asp (D) tRNA-Gly (G) cox2 tRNA-His (H) rrnL nad3 nad5 tRNA-Ala (A) tRNA-Pro (P) tRNA-Val (V) nad6 nad4L tRNA-Trp (W) tRNA-Glu (E) rrnS tRNA-serUCN (S2) Non-coding region (NCL) tRNA-Asn (N) tRNA-Tyr (Y)
1–873 (873) 881–1480 (600) 1487–1549 (63) 1557–1611 (55) 1612–1663 (52) 1664–2509 (846) 2512–2573 (62) 2574–2631 (58) 2632–2686 (55) 2691–2748 (58) 2749–3850 (1102) 3851–3905 (55) 3906–4671 (766) 4672–4725 (54) 4726–5955 (1230) 5956–6077 (122) 6078–7653 (1576) 7654–7709 (56) 7711–7770 (60) 7775–7833 (59) 7839–7894 (56) 7895–8595 (701) 8596–8651 (56) 8657–9613 (957) 9616–9951 (336) 9960–11541 (1582) 11544–11599 (56) 11601–11655 (55) 11660–11714 (55) 11715–12149 (435) 12151–12382 (232) 12383–12440 (58) 12449–12508 (60) 12509–13210 (702) 13215–13268 (54) 13269–13831 (563) 13832–13889 (58) 13896–13954 (59)
TTG/TAG TTG/TAA
Anticodons
TTT TAA TCT TTG/TAA GAT ACG TTG GAA ATA/T TAG TTG/T TGT TTG/TAG TTG/T GCA CAT GTC TCC TTG/TA GTG TTG/TAA ATT/T TGC TGG TAC TGG/TAA ATT/T TCA TTC TGA GTT GTA
Intergenic 0 +7 +6 +7 0 0 +2 0 0 +4 0 0 0 0 0 0 0 0 +1 +4 +5 0 0 +5 +2 +2 +1 +4 0 +1 0 +8 0 +4 0 0 +6 0
Please cite this article in press as: Liu, S.-S., et al. The complete mitochondrial genome of Pseudoterranova azarasi and comparative analysis with other anisakid nematodes. Infect. Genet. Evol. (2015), http://dx.doi.org/10.1016/j.meegid.2015.05.018
4
S.-S. Liu et al. / Infection, Genetics and Evolution xxx (2015) xxx–xxx
Table 3 Comparison of A + T content (%) of the AT region, protein-coding and rRNA genes of mitochondrial genomes of Anisakidae species. Gene or region
Paz
CrB
Asi
Asim
Cos
atp6 cox1 cox2 cox3 cytb nad1 nad2 nad3 nad4 nad4L nad5 nad6 rrnS rrnL AT-region EmtG
69.5 65 67 68.8 67.5 68.3 73.9 72.9 70.2 76.7 70.9 74.7 70.7 75.2 81.2 70.7
67.5 64.7 66.7 65.8 68.8 68.5 73.3 73.5 67.5 78.5 72.1 73.8 69.4 75.1 89.2 70.5
70.7 66.1 67 66.3 67.9 68.2 73.3 75.3 69.9 76.7 72.1 71.3 71.2 76.1 87.2 71.2
70.7 66.1 67 66.3 67.9 68.2 73.3 75.3 70 76.8 72.1 71.3 72 76.1 87.2 71.2
71.7 65.1 65.4 67.1 66.6 67 74.8 74.7 68.9 77.4 71.5 77 71 76 75.2 70.2
3.4. Non-coding regions The majority of metazoan mtDNA sequences contain two non-coding regions of significant size difference, the long non-coding regions (NCL) and the short non-coding regions (NCR). For the P. azarasi, the longer non-coding region (NCL) is located between the tRNA-SerUCN and tRNA-Asn, and the shorter one (NCR) is located between genes nad4 and cox1. Their sizes are 563 bp (NCL) and 122 bp (NCR) (Table 3). The A + T contents of the NCL and NCR are 81.0% and 81.2%, respectively (Table 3), which is consistent with those of other anisakid nematodes (Kim et al., 2006; Lin et al., 2012; Mohandas et al., 2014). 3.5. Sequences comparisons and phylogenetic analyses
Paz: Pseudoterranova azarasi; CrB: Contracaecum rudolphii B; Asi: Anisakis simplex s.l.; Asim: Anisakis simplex s.s; Cos: Contracaecum osculatum s.s; EmtG: entire mitochondrial genome.
3.2. Protein-coding genes The mt genome of the P. azarasi encodes 12 protein-coding genes. A total of 3,418 amino acids are encoded by the P. azarasi mt genome. In this mt genome, 2 genes (nad5 and nad4L) start with ATT, 9 genes (nad1, atp6, nad2, cox3, nad4, cox1, cox2, nad3 and nad6) use TTG and 1 gene (cytb) use ATA as start codon, respectively (Table 2). All genes have complete termination codon except for cytb, cox1, cox2, cox3, nad5 and nad4L which use abbreviated stop codon TA or T, and 4 genes (nad2, nad3, nad6 and atp6) use TAA and 2 genes (nad1 and nad4) use TAG as termination codon (Table 2). P. azarasi mt genome were inferred to end with an abbreviated stop codon, such as T and TA, which is consistent with the arrangement in the mt genomes of other anisakid nematodes (Kim et al., 2006; Lin et al., 2012). To explain the abbreviated stop codon in most of the reading frames, it is hypothesized that the after transcription and processing, mRNAs ending in T or TA are converted to TAA by polyadenylation (Ojala et al., 1981).
3.3. Transfer RNA genes and ribosomal RNA genes A total of 22 tRNA sequences (ranging from 52 to 63 nucleotides in length) were identified in the P. azarasi mt genome. Their predicted secondary structures (not shown) are similar to those of other anisakid nematodes (Kim et al., 2006; Lin et al., 2012). The P. azarasi rrnL gene is located between tRNA-His and nad3, and rrnS gene is located between tRNA-Glu and tRNA-SerUCN. The length of the rrnL gene is 957 bp and rrnS gene is 702 bp (Table 2). The A + T contents of the rrnL and rrnS genes are 75.2% and 70.7%, respectively (Table 3). The result is consistent with those of other anisakid nematodes (Kim et al., 2006; Lin et al., 2012; Mohandas et al., 2014).
Pairwise comparisons in the amino acid sequences inferred from individual protein-coding genes between the mt genomes of P. azarasi and other anisakid nematodes (Table 5). The amino acid sequence similarities in individual inferred proteins ranged from 65.0% (CYTB) to 97.4% (NAD4L) among them. Based on identity, NAD4L was the most conserved protein, whereas CYTB were the least conserved (Table 5). Phylogenetic analyses of P. azarasi with related nematodes of the Ascaridomorpha were performed by BI based on concatenated mitochondrial amino acid sequences of 12 protein-coding genes (Fig. 2). The families Ascarididae, Toxocaridae, Anisakidae and Ascaridiidae were four monophyletic with strong support in current analysis, and Anisakidae is more closely related to the Ascarididae and Toxocaridae rather than the Ascaridiidae. These results were consistent with those of previous studies (Liu et al., 2014a; Lin et al., 2012). Our data also confirm that Pseudoterranova were more closely related to Anisakis than they were to Contracaecum with strong a Bpp = 1.0 support. 3.6. Significance and implications Although much attention has been paid to soil-transmitted nematodes as pathogens because they have a devastating, Table 5 Differences (%) in mitochondrial amino acid sequences between Pseudoterranova azarasi and other Anisakidae nematodes. Gene or region
CrB
Asi
Asim
Cos
atp6 cox1 cox2 cox3 cytb nad1 nad2 nad3 nad4 nad4L nad5 nad6
87.9 93.9 91.4 91.4 65.8 87.9 73 81.1 78.5 90.9 80.1 77.1
92 94.7 94.8 93.3 82.6 95.9 94 87.4 91 97.4 93.4 90.3
92 96.2 95.3 94.5 82.4 95.5 93.6 87.4 91 97.4 93.4 90.3
87.9 93.5 91.8 88.6 65 89.7 76.5 82.9 76 93.5 83.3 81.2
CrB: Contracaecum rudolphii B; Asi: Anisakis simplex s.l.; Asim: Anisakis simplex s.s.; Cos: Contracaecum osculatum s.s.
Table 4 Composition and skewness in the mitochondrial genomes of Anisakidae nematodes. Species
Size (bp)
A%
T%
G%
C%
AT skewness
GC skewness
Pseudoterranova azarasi Anisakis simplex s.l. Anisakis simplex s.s. Contracaecum osculatum s.s. Contracaecum rudolphii B
13,954 13,916 13,926 13,823 14,022
22.3 22.9 22.6 22.7 22.8
48.4 48.3 48.2 47.5 47.7
19.7 19.0 17.4 19.8 19.6
9.6 9.8 9.8 10 9.9
0.37 0.36 0.36 0.35 0.35
0.34 0.32 0.28 0.33 0.33
Please cite this article in press as: Liu, S.-S., et al. The complete mitochondrial genome of Pseudoterranova azarasi and comparative analysis with other anisakid nematodes. Infect. Genet. Evol. (2015), http://dx.doi.org/10.1016/j.meegid.2015.05.018
S.-S. Liu et al. / Infection, Genetics and Evolution xxx (2015) xxx–xxx
5
Fig. 2. Inferred phylogenetic relationships among representative infraorder Ascaridomorpha nematodes based on concatenated amino acid sequences of 12 protein-coding genes utilizing Bayesian inference, using Dirofilaria immitis as outgroup.
long-term adverse impact on human health worldwide (Bethony et al., 2006), anisakid nematodes that cause chronic disease, such as members of the genus Pseudoterranova, have been seriously neglected (Hochberg et al., 2010). There is considerable significance employing mtDNA markers to investigate the genetic variation of Pseudoterranova populations, particularly at the larval stages or cryptic/sibling species because morphological features of Pseudoterranova species is still scarce (Hernández-Orts et al., 2013). The Pseudoterranova decipiens species complex consists of at least 5 sibling species (genetically but not morphologically distinguishable): P. decipiens, P. azarasi, Pseudoterranova cattani, Pseudoterranova krabbei and Pseudoterranova bulbosa (Paggi et al., 1991, 2000). mtDNA is proposed to be maternally inherited, and it may be the best choice for applications sequence within a species to search for potential cryptic/cryptic/sibling species of nematodes (Blouin, 2002). The complete mt genome of P. azarasi here might allow to identify and differentiate of these cryptic/sibling nematodes based on specific PCR. In addition, in the present study, the characterization of the mt genome of P. azarasi provides a foundation for the improved diagnosis of human anisakidosis using molecular methods. Due to the vague symptoms and limited diagnostic tests, there raises the questions to the extent of hidden cases of anisakidosis around the world (Shamsi, 2014). Molecular tools, using genetic markers in mt genes, would been developed to support clinical diagnosis and to assist in undertaking molecular epidemiological investigations of P. azarasi. Mt genome sequences may provide reliable genetic markers in examining taxonomic status of helminths, particularly when protein-coding gene sequences are used as markers in comparative analyses (Park et al., 2011; Liu et al., 2013, 2014a, 2014b, 2015; Yang et al., 2015). Therefore, in the present study, the characterization of the mt genome of P. azarasi also stimulates a reassessment of the systematic relationships of anisakid nematodes (Anisakidae) within the Ascaridomorpha using mt genomic datasets. Over the years, there has been considerable argument about the systematics of members of the Ascaridomorpha (including Anisakidae, Ascarididae, Ascaridiidae, Cucullanidae and Toxocaridae). Phylogenetic relationships among anisakid nematodes have been inferred in the past based on sequences of nuclear small subunit (SSU) rRNA gene (Nadler et al., 2005), but no information is
available about phylogenetic relationships of anisakid nematodes from mt genomes due to limited data. To date, mt genomes of many lineages of anisakid nematodes are still underrepresented or not represented. Therefore, expanding taxon sampling is necessary for future phylogenetic studies of Ascaridomorpha using mt genomic datasets. In conclusion, the present study determined the complete mtDNA data of P. azarasi and compared with that of other anisakid nematodes. Phylogenetic analyses showed that Pseudoterranova spp. were more closely related to Anisakis than they were to Contracaecum. The mt genome sequences of P. azarasi provides novel genetic markers for exploring cryptic/sibling species and host affiliations, and should have implications for the diagnosis, prevention and control of anisakidosis in humans. Acknowledgements This work was supported, in part, by the International Science & Technology Cooperation Program of China (Grant No. 2013DFA31840) and the Science Fund for Creative Research Groups of Gansu Province (Grant No. 1210RJIA006) to XQZ. References Audicana, M.T., Kennedy, M.W., 2008. Anisakis simplex: from obscure infectious worm to inducer of immune hypersensitivity. Clin. Microbiol. Rev. 21, 360–379. Bethony, J., Brooker, S., Albonico, M., Geiger, S.M., Loukas, A., Diemert, D., Hotez, P.J., 2006. Soil-transmitted helminth infections: ascariasis, trichuriasis, and hookworm. Lancet 367, 1521–1532. Blouin, M.S., 2002. Molecular prospecting for cryptic species of nematodes: mitochondrial DNA versus internal transcribed spacer. Int. J. Parasitol. 32, 527–531. Bowles, J., Blair, D., McManus, D.P., 1995. A molecular phylogene of the genus Echinococcus. Parasitology 110, 317–328. Cantatore, P., Attardi, G., 1980. Mapping of nascent light and heavy strand transcripts on the physical map of HeLa cell mitochondrial DNA. Nucleic Acids Res. 8, 2605–2626. Cao, Z., Lin, R.Q., Wu, S.Q., Song, H.Q., Li, M.W., He, F., Zhu, X.Q., 2006. Sequence polymorphisms in mitochondrial nad4 gene between members of the Pseudoterranova decipiens complex. Chin. J. Vet. Med. 3, 7–9, In Chinese. Cao, Z., Weng, Y.B., Lin, R.Q., Li, M.W., Zou, F.C., He, F., Zhu, X.Q., 2005. Polymorphisms in mitochondrial rrnL and cox1 genes within and between members of Pseudoterranova decipiens complex. Chin. J. Vet. Sci. 25, 600–603 (in Chinese).
Please cite this article in press as: Liu, S.-S., et al. The complete mitochondrial genome of Pseudoterranova azarasi and comparative analysis with other anisakid nematodes. Infect. Genet. Evol. (2015), http://dx.doi.org/10.1016/j.meegid.2015.05.018
6
S.-S. Liu et al. / Infection, Genetics and Evolution xxx (2015) xxx–xxx
Garbin, L.E., Mattiucci, S., Paoletti, M., Diaz, J.I., Nascetti, G., Navone, G.T., 2013. Molecular identification and larval morphological description of Contracaecum pelagicum (Nematoda: Anisakidae) from the anchovy Engraulis anchoita (Engraulidae) and fish-eating birds from the Argentine North Patagonian Sea. Parasitol. Int. 62, 309–319. Goddard, J.M., Wolstenholme, D.R., 1980. Origin and direction of replication in mitochondrial DNA molecules from the genus Drosophila. Nucleic Acids Res. 8, 741–757. Hernández-Orts, J.S., Aznar, F.J., Blasco-Costa, I., García, N.A., Víllora-Montero, M., Crespo, E.A., Raga, J.A., Montero, F.E., 2013. Description, microhabitat selection and infection patterns of sealworm larvae (Pseudoterranova decipiens species complex, nematoda: ascaridoidea) in fishes from Patagonia, Argentina, Parasit. Vectors 29, 252. Hochberg, N.S., Hamer, D.H., Hughes, J.M., Wilson, M.E., 2010. Anisakidosis: perils of the deep. Clin. Infect. Dis. 51, 806–812. Hu, M., Jex, A.R., Campbell, B.E., Gasser, R.B., 2007. Long PCR amplification of the entire mitochondrial genome from individual helminths for direct sequencing. Nat. Protoc. 10, 2339–2344. Jabbar, A., Littlewood, D.T., Mohandas, N., Briscoe, A.G., Foster, P.G., Muller, F., von Samson-Himmelstjerna, G., Jex, A.R., Gasser, R.B., 2014. The mitochondrial genome of Parascaris univalens – implications for a forgotten parasite, Parasit. Vectors 7, 428. Katoh, K., Standley, D.M., 2013. MAFFT multiple sequence alignment software version 7: improvements in performance and usability. Mol. Biol. Evol. 30, 772– 780. Kim, K.H., Eoma, K.S., Park, J.K., 2006. The complete mitochondrial genome of Anisakis simplex (Ascaridida: Nematoda) and phylogenetic implications. Int. J. Parasitol. 36, 319–328. Li, M.W., Lin, R.Q., Song, H.Q., Sani, R.A., Wu, X.Y., Zhu, X.Q., 2008a. Electrophoretic analysis of sequence variability in three mitochondrial DNA regions for ascaridoid parasites of human and animal health significance. Electrophoresis 29, 2912–2917. Li, M.W., Lin, R.Q., Song, H.Q., Wu, X.Y., Zhu, X.Q., 2008b. The complete mitochondrial genomes for three Toxocara species of human and animal health significance. BMC Genomics 9, 224. Lin, R.Q., Liu, G.H., Zhang, Y., D’Amelio, S., Zhou, D.H., Yuan, Z.G., Zou, F.C., Song, H.Q., Zhu, X.Q., 2012. Contracaecum rudolphii B: gene content, arrangement and composition of its complete mitochondrial genome compared with Anisakis simplex s.l. Exp. Parasitol. 130, 135–140. Lin, R.Q., Liu, G.H., D’Amelio, S., Zhang, Y., Song, H.Q., Weng, Y.B., Zou, F.C., Zhu, X.Q., 2013. Sequence variation in four mitochondrial genes among sibling species within Contracaecum rudolphii sensu lato. Mol. Cell. Probes 27, 145–148. Liu, G.H., Wu, C.Y., Song, H.Q., Wei, S.J., Xu, M.J., Lin, R.Q., Zhao, G.H., Huang, S.Y., Zhu, X.Q., 2012. Comparative analyses of the complete mitochondrial genomes of Ascaris lumbricoides and Ascaris suum from humans and pigs. Gene 492, 110– 116. Liu, G.H., Shao, R., Li, J.Y., Zhou, D.H., Li, H., Zhu, X.Q., 2013. The complete mitochondrial genomes of three parasitic nematodes of birds: a unique gene order and insights into nematode phylogeny. BMC Genomics 14, 414. Liu, G.H., Zhou, D.H., Zhao, L., Xiong, R.C., Liang, J.Y., Zhu, X.Q., 2014a. The complete mitochondrial genome of Toxascaris leonina: comparison with other closely related species and phylogenetic implications. Infect. Genet. Evol. 21, 329–333. Liu, G.H., Yan, H.B., Otranto, D., Wang, X.Y., Zhao, G.H., Jia, W.Z., Zhu, X.Q., 2014b. Dicrocoelium chinensis and Dicrocoelium dendriticum (Trematoda: Digenea) are distinct lancet fluke species based on mitochondrial and nuclear ribosomal DNA sequences. Mol. Phylogenet. Evol. 79, 325–331. Liu, G.H., Jia, Y.Q., Wang, Y.N., Zhao, G.H., Zhu, X.Q., 2015. The complete mitochondrial genome of the gullet worm Gongylonema pulchrum: gene content, arrangement, composition and phylogenetic implications, Parasit. Vectors 8, 697. Lowe, T.M., Eddy, S.R., 1997. TRNAscan – SE: a program for improved detection of transfer RNA genes in genomic sequence. Nucleic Acids Res. 25, 955–964. Mattiucci, S., Nascetti, G., 2008. Advances and trends in the molecular systematics of anisakid nematodes, with implications for their evolutionary ecology and host-parasite co-evolutionary processes. Adv. Parasitol. 66, 47–148.
Mattiucci, S., Nascetti, G., Dailey, M., Webb, S.C., Barros, N.B., Cianchi, R., Bullini, L., 2005. Evidence for a new species of Anisakis Dujardin, 1845: morphological description and genetic relationships between congeners (Nematoda: Anisakidae). Syst. Parasitol. 61, 157–171. Mohandas, N., Jabbar, A., Podolska, M., Zhu, X.Q., Littlewood, D.T.J., Jex, A.R., Gasser, R.B., 2014. Mitochondrial genomes of Anisakis simplex and Contracaecum osculatum (sensu stricto) –comparisons with selected nematodes. Infect. Genet. Evol. 21, 452–462. Nadler, S.A., D’Amelio, S., Dailey, M.D., Paggi, L., Siu, S., Sakanari, J.A., 2005. Molecular phylogenetics and diagnosis of Anisakis, Pseudoterranova, and Contracaecum from northern Pacific marine mammals. J. Parasitol. 91, 1413– 1429. Ojala, D., Montoya, J., Attardi, G., 1981. TRNA punctuation model of RNA processing in human mitochondria. Nature 290, 470–474. Ondrejicka, D.A., Locke, S.A., Morey, K., Borisenko, A.V., Hanner, R.H., 2014. Status and prospects of DNA barcoding in medically important parasites and vectors. Trends Parasitol. 30, 582–591. Paggi, L., Nascetti, G., Cianchi, R., Orecchia, P., Mattiucci, S., D’Amelio, S., Berland, B., Bratte, Y.J., Smith, J.W., Bullini, L., 1991. Genetic evidence for three species within Pseudoterranova decipiens (Nematoda, Ascaridida, Ascaridoidea) in the North Atlantic and Norwegian and Barents Seas. Int. J. Parasitol. 21, 195–212. Paggi, L., Mattiucci, S., Gibson, D.I., Berland, B., Nascetti, G., Cianchi, R., Bullini, L., 2000. Pseudoterranova decipiens species A and B (Nematoda, Ascaridoidea): nomenclatural designation, morphological diagnostic characters and genetic markers. Syst. Parasitol. 45, 185–197. Park, J.K., Sultana, T., Lee, S.H., Kang, S., Kim, H.K., Min, G.S., Eom, K.S., Nadler, S.A., 2011. Monophyly of clade III nematodes is not supported by phylogenetic analysis of complete mitochondrial genome sequences. BMC Genomics 12, 392. Pekmezci, G.Z., Onuk, E.E., Bolukbas, C.S., Yardimci, B., Gurler, A.T., Acici, M., Umur, S., 2014. Molecular identification of Anisakis species (Nematoda: Anisakidae) from marine fishes collected in Turkish waters. Vet. Parasitol. 201, 82–94. Pravettoni, V., Primavesi, L., Piantanida, M., 2012. Anisakis simplex: current knowledge. Eur. Ann. Allergy Clin. Immunol. 44, 150–156. Quiazon, K.M., Santos, M.D., Yoshinaga, T., 2013. Anisakis species (Nematoda: Anisakidae) of Dwarf Sperm Whale Kogia sima (Owen, 1866) stranded off the Pacific coast of southern Philippine archipelago. Vet. Parasitol. 197, 221–230. Rambaut, A., 2012. FigTree, a graphical viewer of phylogenetic trees. Available from http://tree.bio.ed.ac.uk/software/figtree. Ronquist, F., Huelsenbeck, J.P., 2003. MrBayes 3: bayesian phylogenetic inference under mixed models. Bioinformatics 19, 1572–1574. Shamsi, S., 2014. Recent advances in our knowledge of Australian anisakid nematodes. Int. J. Parasitol. Parasite Wildl. 3, 178–187. Skrjabin, K.I., Shikhobalova, N.P., Mozgovoi, A.A., 1991. Oxyurata and Ascaridata. In: Skrjabin, K.I. (Ed.), Key to Parasitic Nematodes, vol. II. Amerind Publishing Co., Pvt. Ltd., New Delhi. Talavera, G., Castresana, J., 2007. Improvement of phylogenies after removing divergent and ambiguously aligned blocks from protein sequence alignments. Syst. Biol. 56, 564–577. Tamura, K., Dudley, J., Nei, M., Kumar, S., 2007. MEGA4: molecular evolutionary genetics analysis (MEGA) software version 4.0. Mol. Biol. Evol. 24, 1596–1599. Xie, Y., Zhang, Z., Niu, L., Wang, Q., Wang, C., Lan, J., Deng, J., Fu, Y., Nie, H., Yan, N., Yang, D., Hao, G., Gu, X., Wang, S., Peng, X., Yang, G., 2011a. The mitochondrial genome of Baylisascaris procyonis. PLoS ONE 6, e27066. Xie, Y., Zhang, Z., Wang, C., Lan, J., Li, Y., Chen, Z., Fu, Y., Nie, H., Yan, N., Gu, X., Wang, S., Peng, X., Yang, G., 2011b. Complete mitochondrial genomes of Baylisascaris schroederi, Baylisascaris ailuri and Baylisascaris transfuga from giant panda, red panda and polar bear. Gene 482, 59–67. Yang, X., Gasser, R.B., Koehler, A.V., Wang, L., Zhu, K., Chen, L., Feng, H., Hu, M., Fang, R., 2015. Mitochondrial genome of Hypoderaeum conoideum-comparison with selected trematodes, Parasit. Vectors 8, 720. Zhu, X.Q., Beveridge, I., Berger, L., Barton, D., Gasser, R.B., 2002. Single-strand conformation polymorphism-based analysis reveals genetic variation within Spirometraerinacei (Cestoda: Pseudophyllidea) from Australia. Mol. Cell. Probes 16, 159–165.
Please cite this article in press as: Liu, S.-S., et al. The complete mitochondrial genome of Pseudoterranova azarasi and comparative analysis with other anisakid nematodes. Infect. Genet. Evol. (2015), http://dx.doi.org/10.1016/j.meegid.2015.05.018