- Email: [email protected]
The complete mitochondrial genome of the endangered Apollo butterfly, Parnassius apollo (Lepidoptera: Papilionidae) and its comparison to other Papilionidae species
Journal of Asia-Pacific Entomology 17 (2014) 663–671
Contents lists available at ScienceDirect
Journal of Asia-Pacific Entomology journal homepage: www.elsevier.com/locate/jape
The complete mitochondrial genome of the endangered Apollo butterfly, Parnassius apollo (Lepidoptera: Papilionidae) and its comparison to other Papilionidae species Yan-hong Chen a, Dun-yuan Huang a,b,c, Yun-liang Wang a, Chao-dong Zhu b, Jia-sheng Hao a,⁎ a b c
Laboratory of Molecular Evolution and Biodiversity, College of Life Sciences, Anhui Normal University, Wuhu, PR China Institute of Zoology, Chinese Academy of Sciences, Beijing, PR China College of Forestry, Jiangxi Environmental Engineering Vocational College, Ganzhou, PR China
a r t i c l e
i n f o
Article history: Received 19 December 2013 Revised 8 April 2014 Accepted 6 June 2014 Available online 14 June 2014 Keywords: Parnassiinae Parnassius apollo Mitochondrial genome tRNA-like sequence Intergenic spacer
a b s t r a c t The Apollo butterfly, Parnassius apollo is a representative species of the butterfly subfamily Parnassiinae. This charming species is one of the most endangered butterfly species in the world. In this study, we sequenced its complete mitochondrial genome (mitogenome), with the aim of accumulating genetic information for further studies of population genetics and mitogenome evolution in the Papilionidae. The 15,404-bp long mitogenome harbors a typical set of 37 genes and is the largest butterfly mitogenome determined, except for Papilio maraho (16,094 bp). Like many other sequenced lepidopteran species, one tRNA Trp -like and one tRNA Leu (UUR)-like sequences were detected in the AT-rich region. A total of 164 bp of non-coding sequences are dispersed in 14 regions throughout the genome. The longest intergenic spacer (68 bp) is located between tRNA Ser(AGN) and tRNA Glu, and is the largest spacer at this location among Papilionidae species. This spacer may have resulted from an 8-fold repetition of a TTTCTTCT motif or a 4-fold repetition of a CTTTATTT motif. © 2014 Korean Society of Applied Entomology, Taiwan Entomological Society and Malaysian Plant Protection Society. Published by Elsevier B.V. All rights reserved.
Introduction The Apollo butterfly, Parnassius apollo is distributed mainly in the mountainous areas of Europe and northwest of China. This beautiful and charming species is one of the largest Parnassius butterfly species, with a wingspan of about 70 mm (Carter, 2000). Its adults are decorated with large black eye-spots on the forewings and red eye-spots on the hind wings. The size and color of the striking eye-spots can change as their habitats vary, and a variety of subspecies have evolved in different areas. Mainly owing to the overcollection, habitat loss, the destruction of its host plant (Sedum and Sempervivum species) and climate change, the Apollo butterfly is now becoming endangered in some of its habitats (Collins and Morris, 1985). It consequently has been assessed as vulnerable (VU) in Appendix II in CITES (Collins and Morris, 1985; Still, 1996) and IUCN Red List (Gimenez, 1996), as well as listed as Grade-II protected by the Chinese government. The typical insect mitochondrial genome (mitogenome) has a circular structure about 15–16 kb long, and contains 37 genes, ⁎ Corresponding author at: No.1, EastBeijing Road, Wuhu, Anhui Province, China.
including 13 protein coding genes (PCGs), 22 transfer RNA (tRNA) genes, 2 ribosome RNA (rRNA) genes and a non-coding region (i.e., the control region or the AT-rich region) (Wolstenholme, 1992; Boore, 1999). In view of its maternal inheritance and strict orthology, the lack of recombination and an accelerated evolutionary rate compared to nuclear genome, mitogenome has become popular in comparative and evolutionary genomics, molecular evolution, phylogenetics, and population genetics (Nardi et al., 2003, 2005; Simon et al., 2006; Cameron, 2014). Up to the present, 45 complete or nearly complete mitogenome sequences of true butterflies (superfamily: Papilionoidea) have been reported including 8 species from the family Papilionidae. Within the subfamily Parnassiinae, there are two complete mitogenome sequences (Kim et al., 2009; Ji et al., 2012). Thus, more mitogenomic data of representative species, especially of endangered species, are very important for the studies of Papilionoidae phylogeny and ecology. In this study, the complete mitogenome sequence of P. apollo was determined using the long PCR and the conserved primer walking methods, and the sequence was analyzed to determine gene arrangement, nucleotide composition and secondary
http://dx.doi.org/10.1016/j.aspen.2014.06.002 1226-8615/© 2014 Korean Society of Applied Entomology, Taiwan Entomological Society and Malaysian Plant Protection Society. Published by Elsevier B.V. All rights reserved.
664
Y. Chen et al. / Journal of Asia-Pacific Entomology 17 (2014) 663–671
Fig. 1. Circular map of the mitochondrial genome of Parnassius apollo. The abbreviations for the genes are as follows: COI, COII, and COIII refer to the cytochrome oxidase subunits, CytB refers to cytochrome B, ATP6 and ATP8 refer to subunits 6 and 8 of F0 ATPase, and ND1-6 refers to components of NADH dehydrogenase. tRNAs are indicated by the IUPAC-IUB single letter amino acid codes, while L1, L2, S1, and S2 denote tRNALeu(CUN), tRNALeu(UUR), tRNASer(AGN) and tRNASer(UCN), respectively. Gene names that are not underlined indicate transcription on the majority strand whereas underlines indicate transcription on the minority strand. The P. apollo mitogenome was sequenced by 6 short fragments (SF1-SF6) and 7 long fragments (LF1-LF7) as templates, shown as single lines within a circle.
Table 1 List of primers used to amplify and sequence the mitogenome of Parnassius apollo. Fragment name Short fragments SF1 SF2 SF3 SF4 SF5 SF6 Long fragments LF1 LF2 LF3 LF4 LF5 LF6 LF7 a b c d e f g
Primer name
Directione
Sequence(5′–3′)
Nucleotide positionf
Mismatchg
Annealing temperature(°C)
ND2-Fa ND2-Ra k698b k807b COIII-Fa COIII-Ra ND5-Fc ND5-Rc REVCB2Hd REVCBJd lrRNA-Fa lrRNA-Ra
F R F R F R F R F R F R
CGTTCATTTCTATTTCAGC ACACCACCTATTGTTCCTA TACAATTTATCGCCTAAACTTCAGCC TGAAAATGAGCTACAACATAATA ATCTCAATGATGACGAGAT CAAATCCAAAATGGTGAGTA AAAACTTCCAGAAAATAATCTC TTGCTTTATCTACTTTAAGACA TGAGGACAAATATCATTTTGAGGW ACTGGTCGAGCTCCAATTCATGT TACGCTGTCATCCCTAA AAGTCTAATCTGCCCAC
298–316 718–736 1699–1721 2548–2570 4859–4878 5386–5405 6786–6807 7261–7282 10895–10918 11498–11520 12976–12992 13,337–13,353
2 1 3 0 1 3 5 1 1 3 1 0
47.3
ND2-COI-Fa ND2-COI-Ra COI-COIII-Fa COI-COIII-Ra COIII-ND5-Fa COIII-ND5-Ra ND5-CytB-Fc ND5-CytB-Rc CytB-lrRNA-Fa CytB-lrRNA-Ra lrRNA-srRNA-Fa lrRNA-srRNA-Ra srRNA-ND2-Fa srRNA-ND2-Ra
F R F R F R F R F R F R F R
CCCTTTCATTTCTGATTCC ACTGTTCGTCCTGTTCCT TCACAAGAAAGTGGAAAA TCTCTCATCGTAAGCCT GCTGATAGTATTTATGGTTC TTGTATGTGCTGGAGTT AATTATACCAGCACATAT TTATCGACTGCAAATC TCCTGCTAACCCTTTAGTCA GAGTATTTTGTTGGGGT CTGGGGTCTTCTCGTCT GCAATAAGTTGGCGGTA GAAACACTTTCCAGTACCT CTAAACCAATTCAACATCC
564–582 1803–1820 2212–2229 4929–4945 5263–5282 7152–7168 7149–7166 10992–11007 11263–11282 13082–13098 13158–13174 14495–14511 14139–14157 330–348
1 2 0 3 0 1 3 2 3 0 2 3 0 1
51.1
Primers newly designed for this genome. Primers from Caterino and Sperling (1999). Primers from Zhao et al. (2013). Primers from Simmon and Weller (2001). F and R, forward and reverse direction of transcription. Nucleotide positions are with respective to Parnassius apollo mitogenome. Mismatches are with respective to P. apollo mitogenome.
46.9 46.8 46.5 45.0 47.5
47.2 47.7 47.1 49.2 51.6 49.7
Y. Chen et al. / Journal of Asia-Pacific Entomology 17 (2014) 663–671
665
Table 2 Organization of the Parnassius apollo mitogenome. Gene
Direction
Position
Size(bp)
Intergenic length
Anticodon
Start codon
Stop codon
tRNAMet tRNAlle tRNAGln ND2 tRNATrp tRNACys tRNATyr COI tRNALeu (UUR) COII tRNALys tRNAAsp ATP8 ATP6 COIII tRNAGly ND3 tRNAAla tRNAArg tRNAAsn tRNASer(AGN) tRNAGlu tRNAPhe ND5 tRNAHis ND4 ND4L tRNAThr tRNAPro ND6 CytB tRNASer(UCN) ND1 tRNALeu(CUN) lrRNA tRNAVal srRNA AT-rich region
F F R F F R R F F F F F F F F F F F F F F F R R R R R F R F F F R R R R R
1–69 70–133 131–199 240–1253 1253–1318 1311–1376 1381–1444 1447–2977 2978–3044 3045–3726 3727–3797 3797–3863 3864–4025 4019–4696 4696–5484 5488–5554 5555–5908 5908–5973 5973–6038 6039–6105 6109–6169 6238–6303 6302–6367 6369–8102 8103–8167 8167–9507 9507–9797 9800–9866 9867–9931 9934–10464 10481–11629 11631–11697 11714–12652 12654–12722 12723–14064 14065–14129 14130–14900 14901–15404
69 64 69 1014 66 66 64 1531 67 682 71 67 162 678 789 67 354 66 66 67 61 66 66 1734 65 1341 291 67 65 531 1149 67 939 69 1342 65 771 504
0 0 −3 40 −1 −8 4 2 0 0 0 −1 0 –7 –1 3 0 −1 –1 0 3 68 −2 1 0 −1 5 2 0 2 16 1 16 1 0 0 0 0
33–35 CAT 99–101 GAT 167–169 TTG – 1283–1285 TCA 1345–1347 GCA 1412–1414 GTA – 3008–3010 TAA – 3757–3759 CTT 3828–3830 GTC – – – 5518–5520 TCC – 5938–5940 TGC 6002–6004 TCG 6069–6071 GTT 6030–6032 GCT 6269–6271 TTC 6333–6335 GAA – 8135–8137 GTG – – 9832–9834 TGT 9989–9991 TGG – – 11660–11662 TGA – 12690–12692 TAG – 14097–14099 TAC – –
– – – ATT – – – CGA – ATG – – ATT ATG ATG – ATT – – – – – – ATT – ATG ATG – – ATC ATG – ATG – – – – –
– – – TAA – – – T-tRNA – T-tRNA – – TAA TAA TAA – TAA – – – – – – TAA – TAA TAA – – TAA TAA – TAG – – – – –
F = forward; R = reverse.
structures, with the aim of providing key molecular data for the studies of its population genetics, conservation biology, molecular ecology, historical biogeography, etc. Furthermore, the mitogenome sequence was compared with those of other Papilionidae species available, to improve our understanding of molecular evolution within the Papilionidae mitogenomes.
Materials and methods Sample collection and DNA extraction An adult individual of P. apollo was collected in Mountain Tianshan, Xinjiang Province, China in July 2012. After collection,
Fig. 2. Sequences of two relatively large intergenic spacers. (A) Alignment of the spacer sequence located between tRNAGln and ND2 gene, and the neighboring partial ND2 gene of Parnassius apollo. Asterisks indicate consensus sequences in the alignment between the spacer sequence and the ND2 gene. Sequence homology is shown on the right side of the alignment. (B) The intergenic spacer sequence detected between the tRNASer(AGN) and tRNAGlu of P. apollo (68 bp), and the alignment of repeat sequences detected within the intergenic spacer sequence. The nucleotide position is indicated at the beginning and end sites of the sequence.
Y. Chen et al. / Journal of Asia-Pacific Entomology 17 (2014) 663–671
This study Kim et al. (2009) Ji et al. (2012)
PCR amplification and sequence determining
2113 2117 2097
84.5 84.4 83.9
504 504 408
93.8 93.7 94.1
KF746065 FJ871125 HQ259122
To sequence the full-length mitogenome of P. apollo, 13 pairs of primers for the amplification of 6 short fragments and 7 long fragments were used (Fig. 1). Three short fragments (SF2, SF4, SF5) and one long fragment (LF4) were amplified using universal PCR primers from Caterino and Sperling (1999), Simmons and Weller (2001), and Zhao et al. (2013). Other primers including the AT-rich region were designed by the multiple sequence alignments of the known mitochondrial sequences of the lepidopteran species, using Clustal X 1.83 (Thompson et al., 1997) and Primer Premier 5.0 software (Singh et al., 1998) (Table 1). Short-fragment PCR was implemented using Taq DNA polymerase (Takara Bio, Otsu, shiga, Japan) and each PCR reaction was performed in 50 μL mixture (10 × Buffer 6.0 μL, 2.5 mmol/L MgCl2 8.0 μL, 0.2 μg/μL BSA 5.0 μL, 2.5 mmol/L dNTPs 1.5 μL, 0.1 μmol/L primers (both direction) 1.8 μL, 1.0units Taq DNA polymerase and 1.5 μL of the template DNA). The cycling parameters were as follows: 1 min at 94 °C; followed by 35 cycles of 1 min at 94°C,1 min at 45 °C–48 °C and 2–2.5 min at 72 °C; final elongation for 10 min at 72 °C. Long-fragment PCR was implemented using LA Taq DNA polymerase (Takara Bio, Otsu, Shiga, Japan) and each PCR reaction was also performed in 50 μL mixture (10 × LA PCR Buffer I (Mg2 + plus) 5 μL, 2.5 mmol/L MgCl2 3 μL, 2.5 mmol/L dNTP Mix 8.0 μL, 0.1 μmol/L primers (both direction) 1.5 μL, 1.0units LA Taq DNA polymerase and 1.5 μL of the template DNA). The relevant PCR parameters were as follows: 5 min at 95 °C; followed by 30 cycles of 55 s at 95 °C, 2 min at 47–52 °C and 2–2.5 min at 68 °C; final elongation for 10 min at 68 °C. The PCR products were separated by electrophoresis in a 1.2% agarose gel and purified using the DNA gel extraction kit (TaKaRa). All PCR fragments were directly sequenced after purification with the QIA quick PCR Purification Kit reagents (QIAGEN). All fragments were sequenced by primer walking from double strands.
1453 1442 1452 1446 1472 1455
1460 1462 1457
79.0 78.1 79.2 79.0 79.0 78.3
80.1 80.2 79.8
81.5 80.9 81.6
NC018040 FJ810212 NC021411 HM243594 EU625344 HM563681 94.0 94.3 92.8 92.5 89.8 93.2 498 1270 514 362 419 395 84.2 84.4 84.3 83.8 83.9 83.7 2097 2112 2100 2092 2018 2101
Size (bp) AT (%)
81.4 80.7 81.4 81.4 80.6 81.2
AT (%) Size (bp) Size (bp)
the sample was preserved in 100% ethyl alcohol immediately and stored at − 20 °C before DNA extraction. The total genomic DNA was extracted from the thorax muscle using a DNA extraction kit (Sangon, China) according to the manufacturer's instruction.
Data analysis
b
a
Termination codons were excluded in total codon count. Protein coding genes.
3720 3722 3691 −0.187 −0.191 −0.221 81.3 81.3 80.9 15,404 15,389 15,242
−0.016 −0.011 −0.009
3719 3717 3721 3720 3724 3719 −0.210 −0.262 −0.212 −0.198 −0.232 −0.238 −0.015 0.006 −0.014 −0.031 −0.040 −0.005 80.6 80.5 80.7 80.3 80.2 79.9 15,340 16,094 15,357 15,185 15,263 15,242
No. codons AT (%)
AT-skew
GC-skew Size (bp)
Taxon
Table 3 Characteristics of the mitogenomes of Papilionidae species.
Papilionidae Papilioninae Papilio bianor Papilio maraho Papilio maackii Papilio machaon Troides aeacus Teinopalpus aureus Parnassiinae Parnassius apollo Parnassius bremeri Sericinus montela
PCGb Mitogenome (majority strand)
a
tRNA
AT (%)
rRNA
AT (%)
AT-rich region
Genbank accession no.
References
Xu et al., unpublished Wu et al. (2010) Dong et al. (2013) Xu et al., unpublished Jiang et al., unpublished Qin et al. (2013)
666
Sequences obtained were assembled and data regarding the sequence were determined using BioEdit version 4.8.9 (Hall, 1999). PCGs and rRNA genes were identified by comparing their similarity to published insect mitochondrial sequences using Clustal X 1.83 (Thompson et al., 1997) and MEGA 5.0 (Tamura et al., 2011). Both the lrRNA and srRNA predicted secondary structures were drawn according to models proposed for these genes in other insects (Gillespie et al., 2006; Cameron and Whiting, 2008). The proposed secondary structures of the tRNA genes were predicted with the aid of tRNAscan-SE 1.21 using invertebrate codon predictors and a cove score cut-off of 1 (Lowe and Eddy, 1997). The tRNAs not found by tRNAscan-SE were identified through comparison of P. apollo nucleotide sequence with the regions coding these tRNAs in other insects. All tRNAs were folded by hand, using tRNAscan-SE output as template when possible. Nucleotide composition was calculated using Mega 5.0 (Tamura et al., 2011). The bias in nucleotide composition can be measured as AT-skew and GC-skew ((A% − T%) / (A% + T%) and (G% − C%) / (G% + C%), respectively) (Perna and Kocher, 1995). The AT-rich regions were determined via the alignment of the sequences with homologous regions of known full-length insect mitogenome sequences and the tandem repeats in the AT-rich region were predicted by the Tandem Repeats Finder available online (http://tandem.bu.edu/trf/trf.html) (Benson, 1999). The complete mtDNA sequence of P. apollo was deposited in GenBank under accession no. KF746065.
Y. Chen et al. / Journal of Asia-Pacific Entomology 17 (2014) 663–671
667
Table 4 Relative synonymous codon usage (RSCU) and number of codons per 1000 codons (NC1000) in the protein-coding genes of the Parnassius apollo mitogenome. Amino acid
Codon
RSCU
NC1000
Amino acid
Codon
RSCU
NC1000
Amino acid
Codon
RSCU
NC1000
Amino acid
Codon
RSCU
NC1000
F
TTT TTC TTA TTG CTT CTC CTA CTG ATT ATC ATA ATG GTT GTC GTA GTG
1.84 0.16 5.42 0.07 0.27 0.02 0.22 0.00 1.92 0.08 1.87 0.13 2.05 0.09 1.83 0.03
90.86 7.80 133.87 1.61 6.72 0.54 5.38 0.00 116.94 5.11 76.61 5.38 16.13 0.81 15.86 0.27
S2
TCT TCC TCA TCG CCT CCC CCA CCG ACT ACC ACA ACG GCT GCC GCA GCG
2.82 0.27 2.24 0.05 2.40 0.37 1.23 0.00 2.36 0.21 1.40 0.03 2.42 0.24 1.34 0.00
30.38 2.96 24.19 0.54 19.35 2.96 9.95 0.00 24.46 2.15 14.52 0.27 19.35 1.88 10.75 0.00
Y
TAT TAC
1.94 0.06
49.46 1.61
C
TGT TGC TGA TGG CGT CGC CGA CGG AGT AGC AGA AGG GGT GGC GGA GGG
1.82 0.18 1.98 0.02 1.31 0.15 2.33 0.22 0.67 0.02 1.92 0.00 1.06 0.04 2.52 0.39
8.06 0.81 25.27 0.27 4.84 0.54 8.60 0.81 7.26 0.27 20.7 0.00 13.98 0.54 33.33 5.11
L2 L1
I M V
P
T
A
W H Q N K D E
CAT CAC CAA CAG AAT AAC AAA AAG GAT GAC GAA GAG
1.92 0.08 1.97 0.03 1.87 0.13 1.92 0.08 1.90 0.10 1.87 0.13
18.28 0.81 16.13 0.27 65.32 4.57 25.81 1.08 15.59 0.81 19.35 1.34
R
S1
G
Termination codons were excluded to the count due to the uncertainty in many species.
Results and discussion Gene structure, organization and composition The P. apollo mitogenome contains the 37 genes typical of insects: 13 PCGs, 2 rRNA genes, 22 tRNA genes, and one non-coding AT-rich region (control region) (Fig. 1, Table 2). Like many other insect mitogenomes, the major strand codes for 23 genes (9 PCGs and 14 tRNAs) and the AT-rich region, while the minor strand codes for the remaining 14 genes (4 PCGs, 8 tRNAs and 2 rRNA genes). Though the genome size is nearly the same with that of available congeneric mitogenome, Parnassius bremeri (15,389 bp in size), the 15,404-bp long genome is the second largest of the Papilionidae butterflies, after Papilio maraho (16,094 bp in size) (Table 3). The gene order and orientation are similar to that found in the inferred ancestral hexapod (Boore et al., 1998; Crease, 1999), with the exception of the arrangement of tRNAs between the AT-rich region and the ND2 gene. This type of arrangement (M-I-Q) is found in nearly all the lepidopterans, whereas the insect ground plan arrangement is I-Q-M (Taylor et al., 1993; Cao et al., 2012; Cameron, 2014). As is the case in other Papilionidae butterflies, the nucleotide composition of the entire P. apollo mitogenome is significantly biased, with the highest A + T content (81.3%) of Papilionidae species the same as that of P. bremeri (Table 3). The overall AT- and GC-skews of the P. apollo mitogenome (measured on the majority strand) are −0.016 and − 0.187, respectively, indicating that more Ts and Cs than As and Gs are used (Table 3). This is similar to the skew statistics of other Papilionidae butterfly species which have negligible AT-skew values (−0.040 to 0.006) and moderate GC-skew values (−0.262 to −0.191).
ATC sequence requires nine additional amino acids, resulting in a peculiar alignment as compared with other lepidopteran species. However, a codon following this triplet has a stop codon (TAG) which is present at the beginning region of the COI gene. Consequently, this ATC sequence may not be the start codon for the COI gene, and there are no other probable start codons for P. apollo COI. According to these criteria, the first nonoverlapping codon in the COI gene is the CGA, designating arginine existing in a highly conserved region in most lepidopteran insects (Cameron and Whiting, 2008; Hao et al., 2013). Eleven genes have complete termination codons, either TAA (ATP6, ATP8, COIII, CytB, ND2, ND3, ND4, ND4L, ND5, ND6) or TAG (ND1), while the remaining two genes (COI and COII) end with the incomplete termination codon T. This phenomenon of partial termination codons (i.e., T or TA) is observed in all sequenced lepidopteran insects and has been interpreted in terms of posttranscriptional polyadenylation, by which “A” residue(s) are added to create TAA terminator (Kim et al., 2009). The relative synonymous codon usage (RSCU) analysis demonstrated that codons with As or Ts at the third position are always overused compared to other synonymous codons. For example, the codon TTG (Leu) is utilized only twice per 1000 codons, corresponding to an RSCU of 0.07, but its synonymous codon TTA (Leu) is significantly overused (134 per 1000), corresponding to an RSCU of 5.42 (Table 4). This trend has also been noted in all other insect mitogenomes, thus indicating the fact of universally biased usage of A and T nucleotides in the PCGs (Cameron and Whiting, 2007; Nelson et al., 2012). In addition, NC1000 statistics showed that TTT (Phe), TTA (Leu), ATT (Ile), ATA (Met), and AAT (Asn) are the five most frequently used, accounting for 48.36% of all the codons (Table 4). Similar cases have been detected in other lepidopterans (data not shown).
The protein coding genes The intergenic spacer sequences The P. apollo mitogenome harbors 13 protein coding genes (PCGs), which collectively harbor 3720 codons, exclusive of the termination codons. Codon number is identical to that of Papilio machaon. Of the 13 PCGs, nine are encoded on the J-strand (ATP6, ATP8, COI, COII, COIII, CytB, ND2, ND3, ND6), while the other four are encoded on the Nstrand (ND1, ND4, ND4L, ND5). All PCGs are initiated by typical ATN codons (ATP8, ND2, ND3 and ND5 with ATT; ATP6, COII, COIII, CytB, ND1, ND4 and ND4L with ATG; ND6 with ATC), except COI gene which utilizes CGA as a start codon. In the COI gene, no canonical ATN initiator was found in the start site. The only plausible traditional start codon for the COI gene is ATC, located within the tRNATyr gene, overlapping 25 bp with the tRNATyr. This
The P. apollo mitogenome includes a total of 164 bp of intergenic spacer regions, spread over 14 non-coding regions, ranging from 1 to 68 bp. The four longest spacers are located between tRNAGln and ND2 (40 bp), tRNASer(AGN) and tRNAGlu (68 bp), ND6 and CytB (16 bp), and tRNASer(UCN) and ND1 (16 bp) (Table 2). The tRNAGln -ND2 spacer has been detected in most other Papilionidae species, with a size range of 40 to 72 bp. This sequence is 70% homologous to its neighboring ND2 gene, suggesting that this sequence may be derived from ND2 (Fig. 2). The Ser-Glu spacer is unique to the genus Parnassius, and in P. bremeri the corresponding region is 43 bp long (Kim et al., 2009). This region sequence appears to be the result of an 8-fold repetition of TTTCTTCT motif
668
Y. Chen et al. / Journal of Asia-Pacific Entomology 17 (2014) 663–671
was detected in all sequenced Papilionidae butterflies, which harbor an ATACTAA motif (Fig. 3). Due to this intergenic spacer sequences are located at the end site of the major-strand coding region, this 7-bp sequence was suggested to be the possible binding site for mtTERM, the transcription termination peptide (Taanman, 1999; Cameron and Whiting, 2008). The tRNA genes
Fig. 3. Alignment of the intergenic spacer between the tRNASer(UCN) and ND1 among all sequenced Papilionidae butterflies, with the ATACTAA motif shown by shadow area.
or a 4-fold repetition of a CTTTATTT motif (Fig. 2). The third one (16 bp) shows a low level of sequence similarity compared with its neighboring ND6 and CytB genes, showing significant variations in length among the sequenced lepidopterans (data not shown). Finally, the last one (16 bp)
There are 22 tRNA genes in the P. apollo mitogenome, ranging in length from 61 bp (tRNASer (AGN)) to 71 bp (tRNALys) (Table 2). The nucleotide composition of these 22 tRNA genes (1,460 bp in total size) is AT biased (81.5%). All of them possess the typical clover-leaf secondary structures, with the exception of tRNASer (AGN), which lacks a dihydrouridine (DHU) arm (Fig. 4). Similar cases have been detected in most insects including all lepidopterans studied to date (Wolstenholme, 1992; Salvato et al., 2008; Hu et al., 2010; Wang et al., 2011; Sun et al., 2012; Zhao et al., 2013).
Fig. 4. Predicated clover-leaf secondary structure of the Parnassius apollo tRNA genes.
Y. Chen et al. / Journal of Asia-Pacific Entomology 17 (2014) 663–671
669
Fig. 5. Predicted secondary structure of the Parnassius apollo lrRNA. Roman numerals denote the conserved domain structure. Helices are numbered according to the annotation systems of Gillespie et al. (2006). Tertiary structures are denoted by boxed bases joined by solid lines. Watson–Crick pairs are joined by dashes, other interactions are joined by plus signs.
All P. apollo tRNAs possess 7 bp aminoacyl stems, 7 bp anticodon loop and 5 bp anticodon stems, but other portions of tRNAs are variable in length, particularly within the DHU and TΨC loops (4–7 bp and 3–9 bp, respectively). A total of 11 pair mismatches are found in all the tRNA stem regions: 6 U-Us, 2 A-Cs, 2 U-Cs, and one G-A (Fig. 4).
The rRNA genes Like all other insect mitogenome sequences, two rRNA genes (1342 bp lrRNA and 771 bp srRNA) are found in the P. apollo mitogenome. They are located between tRNA Leu(CUN) and tRNAVal, and between tRNAVal and the AT-rich region (Table 2), with an A + T% of 84.1% and 85.3%, respectively. Both of these values are well within the range reported for other lepidopteran insects (Salvato et al., 2008). In predictive secondary structures, lrRNA contained six domains (labeled I, II, III, IV, V, and VI) with 49 helices, while the srRNA harbored three domains (labeled I, II, III) with 33 helices (Figs. 5 and 6), respectively. The morphological characteristics of both lrRNA and srRNA are quite similar to their counterparts in
Apis mellifera, and Manduca sexta (Gillespie et al., 2006; Cameron and Whiting, 2008). The AT-rich region The 504 bp AT-rich region of P. apollo mitogenome is located between srRNA and tRNA Met , and shows a relatively high level of A + T content (93.8%); well within the range of other Papilionidae species 92.5% in P. machaon to 94.3% in P. maraho (Table 3). The region is composed mostly of non-repetitive sequences, but harbors some typical structures characteristic of lepidopterans: the putative O N (Origin of minority or light strand replication) located 22 bp upstream of the 5′-end of the srRNA gene, and contains the motif ATAGA followed by an 17 bp poly-T stretch; and a microsatellite-like repeat (TA) 9 preceded by the ATTTA motif (Fig. 7). Another (TA) 9 microsatellite repeat located 126 bp upstream of the srRNA, is found in both Parnassius species (Fig. 7). It has been previously demonstrated that the presence of tRNA-like sequences within the AT-rich region in mammalian mitogenome is due to the failure to cleave the tRNA primers from the nascent DNA
670
Y. Chen et al. / Journal of Asia-Pacific Entomology 17 (2014) 663–671
Fig. 6. Predicted secondary structure of the Parnassius apollo srRNA. The annotation is the same as in Fig. 5.
strand after the mitochondrial DNA synthesis, and consequently tRNAlike sequences are incorporated into the mitogenome (Cantatore et al., 1987). Afterwards, the tRNA-like sequences have also been reported
in many insects, such as Hymenoptera (Cha et al., 2007), Diptera (Cameron et al., 2007), Lepidoptera (Kim et al., 2009), and Coleoptera (Hong et al., 2009). In P. apollo, one tRNATrp -like and one
Fig. 7. Characteristic sequences of AT-rich region of Parnassius apollo. (A) The special TA repeat sequences of the AT-rich region in P. apollo and P. bremeri. (B) Sequence of P. apollo AT-rich region. The shadow areas show the ATAGA motif, poly-T stretch, ATTTA sequence and microsatellite TA repeat sequence. The underlined sequences show the tRNATrp-like sequence and the tRNALeu(UUR)-like sequence. (C) Secondary structures of the tRNATrp-like sequence and the tRNALeu(UUR)-like sequence.
Y. Chen et al. / Journal of Asia-Pacific Entomology 17 (2014) 663–671
tRNALeu(UUR)-like sequences are detected in its AT-rich region, as is the case in its congeneric species P. bremeri (Fig. 7). Acknowledgments This work was supported by the National Science Foundation of China (Grant No. 41172004) and the opening funds from the State Key Laboratory of Palaeobiology and Stratigraphy, Nanjing Institute of Geology and Palaeontology, Chinese Academy of Sciences (Grant No. 104143). References Benson, G., 1999. Tandem repeats finder: a program to analyze DNA sequences. Nucleic Acids Res. 27, 573–580. Boore, J.L., 1999. Animal mitochondrial genomes. Nucleic Acids Res. 27, 1767–1780. Boore, J.L., Lavrov, D.V., Brown, W.M., 1998. Gene translocation links insects and crustaceans. Nature 392, 667–668. Cameron, S.L., 2014. Insect mitochondrial genomics: implications for evolution and phylogeny. Annu. Rev. Entomol. 59, 95–117. Cameron, S.L., Whiting, M.F., 2007. Mitochondrial genomic comparisons of the subterranean termites from the Genus Reticulitermes (Insecta: Isoptera: Rhinotermitidae). Genome 50, 188–202. Cameron, S.L., Whiting, M.F., 2008. The complete mitochondrial genome of the tobacco hornworm, Manduca sexta, (Insecta: Lepidoptera: Sphingidae), and an examination of mitochondrial gene variability within butterflies and moths. Gene 408, 112–123. Cameron, S.L., Lambkin, C.L., Barker, S.C., Whiting, M.F., 2007. A mitochondrial genome phylogeny of Diptera: whole genome sequence data accurately resolve relationships over broad timescales with high precision. Syst. Entomol. 32, 40–59. Cantatore, P., Gadaleta, M.N., Roberti, M., Saccone, C., Wilson, A.C., 1987. Duplication and remodeling of tRNA genes during the evolutionary rearrangement of mitochondrial genomes. Nature 329, 853–855. Cao, Y.Q., Ma, C., Chen, J.Y., Yang, D.R., 2012. The complete mitochondrial genomes of two ghost moths, Thitarodes renzhiensis and Thitarodes yunnanensis: the ancestral gene arrangement in Lepidoptera. BMC Genomics 13, 276. Carter, D., 2000. Butterflies and Moths. Dorling Kindersley, London. Caterino, M.S., Sperling, F.A.H., 1999. Papilio phylogeny based on mitochondrial cytochrome oxidase I and II genes. Mol. Phylogenet. Evol. 11, 122–137. Cha, S.Y., Yoon, H.J., Lee, E.M., Yoon, M.H., Hwang, J.S., Jin, B.R., Han, Y.S., Kim, I., 2007. The complete nucleotide sequence and gene organization of the mitochondrial genome of the bumblebee, Bombus ignitus (Hymenoptera: Apidae). Gene 392, 206–220. Collins, N.M., Morris, M.G., 1985. Threatened Swallowtail Butterflies of the World. IUCN, Gland, Switzerland and Cambridge, UK. Crease, T., 1999. The complete sequence of the mitochondrial genome of Daphnia pulex (Cladocera: Crustacea). Gene 233, 89–99. Dong, Y., Zhu, L.X., Wu, Y.F., Wu, X.B., 2013. The complete mitochondrial genome of the Alpine black swallowtail, Papilio maackii (Insecta: Lepidoptera: Papilionidae). Mitochondrial DNA 24, 639–641. Gillespie, J.J., Johnston, J.S., Cannone, J.J., Gutell, R.R., 2006. Characteristics of the nuclear (18S, 5.8S, 28S and 5S) and mitochondrial (12S and 16S) Rrna genes of Apis mellifera (Insecta: Hymenoptera): structure, organization and retrotransposable elements. Insect Mol. Biol. 15, 657–686. Gimenez, D.M., 1996. Parnassius apollo. IUCN 2013. IUCN Red List of Threatened Species. Version 2013.1 (bwww.iucnredlist.orgN. Assessed 1 August 1996). Hall, T.A., 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 41, 95–98. Hao, J.S., Sun, M.E., Sun, X.Y., Shao, L.L., Yang, Q., 2013. Complete mitogenomes of Euploea mulciber (Nymphalidae: Danainae) and Libythea celtis (Nymphalidae: Libytheinae) and their phylogenetic implications. ISRN Genomics 491636, 1–14. Hong, M.Y., Jeong, H.C., Kim, M.J., Jeong, H.U., Lee, S.H., Kim, I., 2009. Complete mitogenome sequence of the jewel beetle, Chrysochroa fulgidissima (Coleoptera: Buprestidae). Mitochondrial DNA 20, 46–60.
671
Hu, J., Zhang, D.X., Hao, J.S., Huang, D.Y., Cameron, S., Zhu, C.D., 2010. The complete mitochondrial genome of the yellow coaster, Acraea issoria (Lepidoptera: Nymphalidae: Heliconiinae: Acraeini): sequence, gene organization and a unique tRNA translocation event. Mol. Biol. Rep. 37, 3431–3438. Ji, L.W., Hao, J.S., Wang, Y., Huang, D.Y., Zhao, J.L., Zhu, C.D., 2012. The complete mitochondrial genome of the dragon swallowtail, Sericinus montela Gray (Lepidoptera: Papilionidae) and its phylogenetic implication. Acta Entomol. Sin. 55, 91–100. Kim, M.I., Baek, J.Y., Kim, M.J., Jeong, H.C., Kim, K.G., Bae, C.H., Han, Y.S., Jin, B.R., Kim, I., 2009. Complete nucleotide sequence and organization of the mitogenome of the red–spotted apollo butterfly, Parnassius bremeri (Lepidoptera: Papilionidae) and comparison with other lepidopteran insects. Mol. Cell 28, 347–363. Lowe, T.M., Eddy, S.R., 1997. tRNAscan-SE: a program for improved detection of transfer RNA genes in genomic sequence. Nucleic Acids Res. 25, 955–964. Nardi, F., Spinsanti, G., Boore, J.L., Carapelli, A., Dallai, R., Frati, F., et al., 2003. Hexapod origins: monophyletic or paraphyletic? Science 299, 1887–1889. Nardi, F., Carapelli, A., Dallai, R., Roderick, G.K., Frati, F., 2005. Population structure and colonization history of the olive fly Bactrocera oleae (Diptera: Tephritidae). Mol. Ecol. 14, 2729–2738. Nelson, L.A., Lambkin, C.L., Batterham, P., Wallman, J.F., Dowton, M., Whiting, M.F., Yeates, D.K., Cameron, S.L., 2012. Beyond barcoding: a mitochondrial genomics approach to molecular phylogenetics and diagnostics of blowflies (Diptera: Calliphoridae). Gene 511, 131–142. Perna, N.T., Kocher, T.D., 1995. Patterns of nucleotide composition at fourfold degenerate sites of animal mitochondrial genome. J. Mol. Evol. 41, 353–358. Qin, F., Jiang, G.F., Zhou, S.Y., 2013. Complete mitochondrial genome of the Teinopalpus aureus guangxiensis (Lepidoptera: Papilionidae) and related phylogenetic analyses. Mitochondrial DNA 23, 123–125. Salvato, P., Simonato, M., Battisti, A., Negrisolo, E., 2008. The complete mitochondrial genome of the bag-shelter moth Ochrogaster lunifer (Lepidoptera, Notodontidae). BMC Genomics 9, 331. Simmons, R.B., Weller, S.J., 2001. Utility and evolution of cytochrome b in insects. Mol. Phylogenet. Evol. 20, 196–210. Simon, C., Buckley, T.R., Frati, F., Stewart, J.B., Beckenbach, A.T., 2006. Incorporating molecular evolution into phylogenetic analysis and a new compilation of conserved polymerase chain reaction primers for animal mitochondrial DNA. Ann. Rev. Ecol. Evol. Syst. 37, 545–579. Singh, V.K., Mangalam, A.K., Dwivedi, S., Naik, S., 1998. Primer premier: program for design of degenerate primers from a protein sequence. BioTechniques 24, 318–319. Still, J., 1996. Butterflies and Moths of Britain and Europe. Harper Collins, London. Sun, Q.Q., Sun, X.Y., Wang, X.C., Gai, Y.H., Hu, J., Zhu, C.D., Hao, J.S., 2012. Complete sequence of the mitochondrial genome of the Japanese buff-tip moth, Phalera flavescens (Lepidoptera: Notodontidae). Genet. Mol. Res. 11, 4213–4225. Taanman, J.W., 1999. The mitochondrial genome: structure, transcription, translation and replication. Biochim. Biophys. Acta 1410, 103–123. Tamura, K., Peterson, D., Peterson, N., Stecher, G., et al., 2011. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 28, 2731–2739. Taylor, M.F., McKechnie, S.W., Pierce, N., Kreitman, M., 1993. The lepidopteran mitochondrial control region: structure and evolution. Mol. Biol. Evol. 10, 1259–1272. Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., 1997. The CLUSTAL_X windows interface: flexible strategies for multiple sequences alignment aided by quality analysis tools. Nucleic Acids Res. 24, 4876–4882. Wang, X.C., Sun, X.Y., Sun, Q.Q., Zhang, D.X., Hu, J., Yang, Q., Hao, J.S., 2011. The complete mitochondrial genome of the laced fritillary Argyreus hyperbius (Lepidoptera: Nymphalidae). Zool. Res. 32, 465–475. Wolstenholme, D.R., 1992. Animal mitochondrial DNA: structure and evolution. Int. Rev. Cytol. 141, 173–216. Wu, L.W., Lees, D.C., Yen, S.H., Hsu, Y.F., 2010. The complete mitochondrial genome of the near–threatened swallowtail, Agehana maraho (Lepidoptera: Papilionidae): evaluating sequence variability and suitable markers for conservation genetic studies. Entomol. News 121, 267–280. Zhao, F., Huang, D.Y., Shi, Q.H., Hao, J.S., Sun, X.Y., Zhang, L.L., Yang, Q., 2013. The first mitochondrial genome for the butterfly family Riodinidae and its systematic implications. Zool. Res. 34, 109–119.
Contents lists available at ScienceDirect
Journal of Asia-Pacific Entomology journal homepage: www.elsevier.com/locate/jape
The complete mitochondrial genome of the endangered Apollo butterfly, Parnassius apollo (Lepidoptera: Papilionidae) and its comparison to other Papilionidae species Yan-hong Chen a, Dun-yuan Huang a,b,c, Yun-liang Wang a, Chao-dong Zhu b, Jia-sheng Hao a,⁎ a b c
Laboratory of Molecular Evolution and Biodiversity, College of Life Sciences, Anhui Normal University, Wuhu, PR China Institute of Zoology, Chinese Academy of Sciences, Beijing, PR China College of Forestry, Jiangxi Environmental Engineering Vocational College, Ganzhou, PR China
a r t i c l e
i n f o
Article history: Received 19 December 2013 Revised 8 April 2014 Accepted 6 June 2014 Available online 14 June 2014 Keywords: Parnassiinae Parnassius apollo Mitochondrial genome tRNA-like sequence Intergenic spacer
a b s t r a c t The Apollo butterfly, Parnassius apollo is a representative species of the butterfly subfamily Parnassiinae. This charming species is one of the most endangered butterfly species in the world. In this study, we sequenced its complete mitochondrial genome (mitogenome), with the aim of accumulating genetic information for further studies of population genetics and mitogenome evolution in the Papilionidae. The 15,404-bp long mitogenome harbors a typical set of 37 genes and is the largest butterfly mitogenome determined, except for Papilio maraho (16,094 bp). Like many other sequenced lepidopteran species, one tRNA Trp -like and one tRNA Leu (UUR)-like sequences were detected in the AT-rich region. A total of 164 bp of non-coding sequences are dispersed in 14 regions throughout the genome. The longest intergenic spacer (68 bp) is located between tRNA Ser(AGN) and tRNA Glu, and is the largest spacer at this location among Papilionidae species. This spacer may have resulted from an 8-fold repetition of a TTTCTTCT motif or a 4-fold repetition of a CTTTATTT motif. © 2014 Korean Society of Applied Entomology, Taiwan Entomological Society and Malaysian Plant Protection Society. Published by Elsevier B.V. All rights reserved.
Introduction The Apollo butterfly, Parnassius apollo is distributed mainly in the mountainous areas of Europe and northwest of China. This beautiful and charming species is one of the largest Parnassius butterfly species, with a wingspan of about 70 mm (Carter, 2000). Its adults are decorated with large black eye-spots on the forewings and red eye-spots on the hind wings. The size and color of the striking eye-spots can change as their habitats vary, and a variety of subspecies have evolved in different areas. Mainly owing to the overcollection, habitat loss, the destruction of its host plant (Sedum and Sempervivum species) and climate change, the Apollo butterfly is now becoming endangered in some of its habitats (Collins and Morris, 1985). It consequently has been assessed as vulnerable (VU) in Appendix II in CITES (Collins and Morris, 1985; Still, 1996) and IUCN Red List (Gimenez, 1996), as well as listed as Grade-II protected by the Chinese government. The typical insect mitochondrial genome (mitogenome) has a circular structure about 15–16 kb long, and contains 37 genes, ⁎ Corresponding author at: No.1, EastBeijing Road, Wuhu, Anhui Province, China.
including 13 protein coding genes (PCGs), 22 transfer RNA (tRNA) genes, 2 ribosome RNA (rRNA) genes and a non-coding region (i.e., the control region or the AT-rich region) (Wolstenholme, 1992; Boore, 1999). In view of its maternal inheritance and strict orthology, the lack of recombination and an accelerated evolutionary rate compared to nuclear genome, mitogenome has become popular in comparative and evolutionary genomics, molecular evolution, phylogenetics, and population genetics (Nardi et al., 2003, 2005; Simon et al., 2006; Cameron, 2014). Up to the present, 45 complete or nearly complete mitogenome sequences of true butterflies (superfamily: Papilionoidea) have been reported including 8 species from the family Papilionidae. Within the subfamily Parnassiinae, there are two complete mitogenome sequences (Kim et al., 2009; Ji et al., 2012). Thus, more mitogenomic data of representative species, especially of endangered species, are very important for the studies of Papilionoidae phylogeny and ecology. In this study, the complete mitogenome sequence of P. apollo was determined using the long PCR and the conserved primer walking methods, and the sequence was analyzed to determine gene arrangement, nucleotide composition and secondary
http://dx.doi.org/10.1016/j.aspen.2014.06.002 1226-8615/© 2014 Korean Society of Applied Entomology, Taiwan Entomological Society and Malaysian Plant Protection Society. Published by Elsevier B.V. All rights reserved.
664
Y. Chen et al. / Journal of Asia-Pacific Entomology 17 (2014) 663–671
Fig. 1. Circular map of the mitochondrial genome of Parnassius apollo. The abbreviations for the genes are as follows: COI, COII, and COIII refer to the cytochrome oxidase subunits, CytB refers to cytochrome B, ATP6 and ATP8 refer to subunits 6 and 8 of F0 ATPase, and ND1-6 refers to components of NADH dehydrogenase. tRNAs are indicated by the IUPAC-IUB single letter amino acid codes, while L1, L2, S1, and S2 denote tRNALeu(CUN), tRNALeu(UUR), tRNASer(AGN) and tRNASer(UCN), respectively. Gene names that are not underlined indicate transcription on the majority strand whereas underlines indicate transcription on the minority strand. The P. apollo mitogenome was sequenced by 6 short fragments (SF1-SF6) and 7 long fragments (LF1-LF7) as templates, shown as single lines within a circle.
Table 1 List of primers used to amplify and sequence the mitogenome of Parnassius apollo. Fragment name Short fragments SF1 SF2 SF3 SF4 SF5 SF6 Long fragments LF1 LF2 LF3 LF4 LF5 LF6 LF7 a b c d e f g
Primer name
Directione
Sequence(5′–3′)
Nucleotide positionf
Mismatchg
Annealing temperature(°C)
ND2-Fa ND2-Ra k698b k807b COIII-Fa COIII-Ra ND5-Fc ND5-Rc REVCB2Hd REVCBJd lrRNA-Fa lrRNA-Ra
F R F R F R F R F R F R
CGTTCATTTCTATTTCAGC ACACCACCTATTGTTCCTA TACAATTTATCGCCTAAACTTCAGCC TGAAAATGAGCTACAACATAATA ATCTCAATGATGACGAGAT CAAATCCAAAATGGTGAGTA AAAACTTCCAGAAAATAATCTC TTGCTTTATCTACTTTAAGACA TGAGGACAAATATCATTTTGAGGW ACTGGTCGAGCTCCAATTCATGT TACGCTGTCATCCCTAA AAGTCTAATCTGCCCAC
298–316 718–736 1699–1721 2548–2570 4859–4878 5386–5405 6786–6807 7261–7282 10895–10918 11498–11520 12976–12992 13,337–13,353
2 1 3 0 1 3 5 1 1 3 1 0
47.3
ND2-COI-Fa ND2-COI-Ra COI-COIII-Fa COI-COIII-Ra COIII-ND5-Fa COIII-ND5-Ra ND5-CytB-Fc ND5-CytB-Rc CytB-lrRNA-Fa CytB-lrRNA-Ra lrRNA-srRNA-Fa lrRNA-srRNA-Ra srRNA-ND2-Fa srRNA-ND2-Ra
F R F R F R F R F R F R F R
CCCTTTCATTTCTGATTCC ACTGTTCGTCCTGTTCCT TCACAAGAAAGTGGAAAA TCTCTCATCGTAAGCCT GCTGATAGTATTTATGGTTC TTGTATGTGCTGGAGTT AATTATACCAGCACATAT TTATCGACTGCAAATC TCCTGCTAACCCTTTAGTCA GAGTATTTTGTTGGGGT CTGGGGTCTTCTCGTCT GCAATAAGTTGGCGGTA GAAACACTTTCCAGTACCT CTAAACCAATTCAACATCC
564–582 1803–1820 2212–2229 4929–4945 5263–5282 7152–7168 7149–7166 10992–11007 11263–11282 13082–13098 13158–13174 14495–14511 14139–14157 330–348
1 2 0 3 0 1 3 2 3 0 2 3 0 1
51.1
Primers newly designed for this genome. Primers from Caterino and Sperling (1999). Primers from Zhao et al. (2013). Primers from Simmon and Weller (2001). F and R, forward and reverse direction of transcription. Nucleotide positions are with respective to Parnassius apollo mitogenome. Mismatches are with respective to P. apollo mitogenome.
46.9 46.8 46.5 45.0 47.5
47.2 47.7 47.1 49.2 51.6 49.7
Y. Chen et al. / Journal of Asia-Pacific Entomology 17 (2014) 663–671
665
Table 2 Organization of the Parnassius apollo mitogenome. Gene
Direction
Position
Size(bp)
Intergenic length
Anticodon
Start codon
Stop codon
tRNAMet tRNAlle tRNAGln ND2 tRNATrp tRNACys tRNATyr COI tRNALeu (UUR) COII tRNALys tRNAAsp ATP8 ATP6 COIII tRNAGly ND3 tRNAAla tRNAArg tRNAAsn tRNASer(AGN) tRNAGlu tRNAPhe ND5 tRNAHis ND4 ND4L tRNAThr tRNAPro ND6 CytB tRNASer(UCN) ND1 tRNALeu(CUN) lrRNA tRNAVal srRNA AT-rich region
F F R F F R R F F F F F F F F F F F F F F F R R R R R F R F F F R R R R R
1–69 70–133 131–199 240–1253 1253–1318 1311–1376 1381–1444 1447–2977 2978–3044 3045–3726 3727–3797 3797–3863 3864–4025 4019–4696 4696–5484 5488–5554 5555–5908 5908–5973 5973–6038 6039–6105 6109–6169 6238–6303 6302–6367 6369–8102 8103–8167 8167–9507 9507–9797 9800–9866 9867–9931 9934–10464 10481–11629 11631–11697 11714–12652 12654–12722 12723–14064 14065–14129 14130–14900 14901–15404
69 64 69 1014 66 66 64 1531 67 682 71 67 162 678 789 67 354 66 66 67 61 66 66 1734 65 1341 291 67 65 531 1149 67 939 69 1342 65 771 504
0 0 −3 40 −1 −8 4 2 0 0 0 −1 0 –7 –1 3 0 −1 –1 0 3 68 −2 1 0 −1 5 2 0 2 16 1 16 1 0 0 0 0
33–35 CAT 99–101 GAT 167–169 TTG – 1283–1285 TCA 1345–1347 GCA 1412–1414 GTA – 3008–3010 TAA – 3757–3759 CTT 3828–3830 GTC – – – 5518–5520 TCC – 5938–5940 TGC 6002–6004 TCG 6069–6071 GTT 6030–6032 GCT 6269–6271 TTC 6333–6335 GAA – 8135–8137 GTG – – 9832–9834 TGT 9989–9991 TGG – – 11660–11662 TGA – 12690–12692 TAG – 14097–14099 TAC – –
– – – ATT – – – CGA – ATG – – ATT ATG ATG – ATT – – – – – – ATT – ATG ATG – – ATC ATG – ATG – – – – –
– – – TAA – – – T-tRNA – T-tRNA – – TAA TAA TAA – TAA – – – – – – TAA – TAA TAA – – TAA TAA – TAG – – – – –
F = forward; R = reverse.
structures, with the aim of providing key molecular data for the studies of its population genetics, conservation biology, molecular ecology, historical biogeography, etc. Furthermore, the mitogenome sequence was compared with those of other Papilionidae species available, to improve our understanding of molecular evolution within the Papilionidae mitogenomes.
Materials and methods Sample collection and DNA extraction An adult individual of P. apollo was collected in Mountain Tianshan, Xinjiang Province, China in July 2012. After collection,
Fig. 2. Sequences of two relatively large intergenic spacers. (A) Alignment of the spacer sequence located between tRNAGln and ND2 gene, and the neighboring partial ND2 gene of Parnassius apollo. Asterisks indicate consensus sequences in the alignment between the spacer sequence and the ND2 gene. Sequence homology is shown on the right side of the alignment. (B) The intergenic spacer sequence detected between the tRNASer(AGN) and tRNAGlu of P. apollo (68 bp), and the alignment of repeat sequences detected within the intergenic spacer sequence. The nucleotide position is indicated at the beginning and end sites of the sequence.
Y. Chen et al. / Journal of Asia-Pacific Entomology 17 (2014) 663–671
This study Kim et al. (2009) Ji et al. (2012)
PCR amplification and sequence determining
2113 2117 2097
84.5 84.4 83.9
504 504 408
93.8 93.7 94.1
KF746065 FJ871125 HQ259122
To sequence the full-length mitogenome of P. apollo, 13 pairs of primers for the amplification of 6 short fragments and 7 long fragments were used (Fig. 1). Three short fragments (SF2, SF4, SF5) and one long fragment (LF4) were amplified using universal PCR primers from Caterino and Sperling (1999), Simmons and Weller (2001), and Zhao et al. (2013). Other primers including the AT-rich region were designed by the multiple sequence alignments of the known mitochondrial sequences of the lepidopteran species, using Clustal X 1.83 (Thompson et al., 1997) and Primer Premier 5.0 software (Singh et al., 1998) (Table 1). Short-fragment PCR was implemented using Taq DNA polymerase (Takara Bio, Otsu, shiga, Japan) and each PCR reaction was performed in 50 μL mixture (10 × Buffer 6.0 μL, 2.5 mmol/L MgCl2 8.0 μL, 0.2 μg/μL BSA 5.0 μL, 2.5 mmol/L dNTPs 1.5 μL, 0.1 μmol/L primers (both direction) 1.8 μL, 1.0units Taq DNA polymerase and 1.5 μL of the template DNA). The cycling parameters were as follows: 1 min at 94 °C; followed by 35 cycles of 1 min at 94°C,1 min at 45 °C–48 °C and 2–2.5 min at 72 °C; final elongation for 10 min at 72 °C. Long-fragment PCR was implemented using LA Taq DNA polymerase (Takara Bio, Otsu, Shiga, Japan) and each PCR reaction was also performed in 50 μL mixture (10 × LA PCR Buffer I (Mg2 + plus) 5 μL, 2.5 mmol/L MgCl2 3 μL, 2.5 mmol/L dNTP Mix 8.0 μL, 0.1 μmol/L primers (both direction) 1.5 μL, 1.0units LA Taq DNA polymerase and 1.5 μL of the template DNA). The relevant PCR parameters were as follows: 5 min at 95 °C; followed by 30 cycles of 55 s at 95 °C, 2 min at 47–52 °C and 2–2.5 min at 68 °C; final elongation for 10 min at 68 °C. The PCR products were separated by electrophoresis in a 1.2% agarose gel and purified using the DNA gel extraction kit (TaKaRa). All PCR fragments were directly sequenced after purification with the QIA quick PCR Purification Kit reagents (QIAGEN). All fragments were sequenced by primer walking from double strands.
1453 1442 1452 1446 1472 1455
1460 1462 1457
79.0 78.1 79.2 79.0 79.0 78.3
80.1 80.2 79.8
81.5 80.9 81.6
NC018040 FJ810212 NC021411 HM243594 EU625344 HM563681 94.0 94.3 92.8 92.5 89.8 93.2 498 1270 514 362 419 395 84.2 84.4 84.3 83.8 83.9 83.7 2097 2112 2100 2092 2018 2101
Size (bp) AT (%)
81.4 80.7 81.4 81.4 80.6 81.2
AT (%) Size (bp) Size (bp)
the sample was preserved in 100% ethyl alcohol immediately and stored at − 20 °C before DNA extraction. The total genomic DNA was extracted from the thorax muscle using a DNA extraction kit (Sangon, China) according to the manufacturer's instruction.
Data analysis
b
a
Termination codons were excluded in total codon count. Protein coding genes.
3720 3722 3691 −0.187 −0.191 −0.221 81.3 81.3 80.9 15,404 15,389 15,242
−0.016 −0.011 −0.009
3719 3717 3721 3720 3724 3719 −0.210 −0.262 −0.212 −0.198 −0.232 −0.238 −0.015 0.006 −0.014 −0.031 −0.040 −0.005 80.6 80.5 80.7 80.3 80.2 79.9 15,340 16,094 15,357 15,185 15,263 15,242
No. codons AT (%)
AT-skew
GC-skew Size (bp)
Taxon
Table 3 Characteristics of the mitogenomes of Papilionidae species.
Papilionidae Papilioninae Papilio bianor Papilio maraho Papilio maackii Papilio machaon Troides aeacus Teinopalpus aureus Parnassiinae Parnassius apollo Parnassius bremeri Sericinus montela
PCGb Mitogenome (majority strand)
a
tRNA
AT (%)
rRNA
AT (%)
AT-rich region
Genbank accession no.
References
Xu et al., unpublished Wu et al. (2010) Dong et al. (2013) Xu et al., unpublished Jiang et al., unpublished Qin et al. (2013)
666
Sequences obtained were assembled and data regarding the sequence were determined using BioEdit version 4.8.9 (Hall, 1999). PCGs and rRNA genes were identified by comparing their similarity to published insect mitochondrial sequences using Clustal X 1.83 (Thompson et al., 1997) and MEGA 5.0 (Tamura et al., 2011). Both the lrRNA and srRNA predicted secondary structures were drawn according to models proposed for these genes in other insects (Gillespie et al., 2006; Cameron and Whiting, 2008). The proposed secondary structures of the tRNA genes were predicted with the aid of tRNAscan-SE 1.21 using invertebrate codon predictors and a cove score cut-off of 1 (Lowe and Eddy, 1997). The tRNAs not found by tRNAscan-SE were identified through comparison of P. apollo nucleotide sequence with the regions coding these tRNAs in other insects. All tRNAs were folded by hand, using tRNAscan-SE output as template when possible. Nucleotide composition was calculated using Mega 5.0 (Tamura et al., 2011). The bias in nucleotide composition can be measured as AT-skew and GC-skew ((A% − T%) / (A% + T%) and (G% − C%) / (G% + C%), respectively) (Perna and Kocher, 1995). The AT-rich regions were determined via the alignment of the sequences with homologous regions of known full-length insect mitogenome sequences and the tandem repeats in the AT-rich region were predicted by the Tandem Repeats Finder available online (http://tandem.bu.edu/trf/trf.html) (Benson, 1999). The complete mtDNA sequence of P. apollo was deposited in GenBank under accession no. KF746065.
Y. Chen et al. / Journal of Asia-Pacific Entomology 17 (2014) 663–671
667
Table 4 Relative synonymous codon usage (RSCU) and number of codons per 1000 codons (NC1000) in the protein-coding genes of the Parnassius apollo mitogenome. Amino acid
Codon
RSCU
NC1000
Amino acid
Codon
RSCU
NC1000
Amino acid
Codon
RSCU
NC1000
Amino acid
Codon
RSCU
NC1000
F
TTT TTC TTA TTG CTT CTC CTA CTG ATT ATC ATA ATG GTT GTC GTA GTG
1.84 0.16 5.42 0.07 0.27 0.02 0.22 0.00 1.92 0.08 1.87 0.13 2.05 0.09 1.83 0.03
90.86 7.80 133.87 1.61 6.72 0.54 5.38 0.00 116.94 5.11 76.61 5.38 16.13 0.81 15.86 0.27
S2
TCT TCC TCA TCG CCT CCC CCA CCG ACT ACC ACA ACG GCT GCC GCA GCG
2.82 0.27 2.24 0.05 2.40 0.37 1.23 0.00 2.36 0.21 1.40 0.03 2.42 0.24 1.34 0.00
30.38 2.96 24.19 0.54 19.35 2.96 9.95 0.00 24.46 2.15 14.52 0.27 19.35 1.88 10.75 0.00
Y
TAT TAC
1.94 0.06
49.46 1.61
C
TGT TGC TGA TGG CGT CGC CGA CGG AGT AGC AGA AGG GGT GGC GGA GGG
1.82 0.18 1.98 0.02 1.31 0.15 2.33 0.22 0.67 0.02 1.92 0.00 1.06 0.04 2.52 0.39
8.06 0.81 25.27 0.27 4.84 0.54 8.60 0.81 7.26 0.27 20.7 0.00 13.98 0.54 33.33 5.11
L2 L1
I M V
P
T
A
W H Q N K D E
CAT CAC CAA CAG AAT AAC AAA AAG GAT GAC GAA GAG
1.92 0.08 1.97 0.03 1.87 0.13 1.92 0.08 1.90 0.10 1.87 0.13
18.28 0.81 16.13 0.27 65.32 4.57 25.81 1.08 15.59 0.81 19.35 1.34
R
S1
G
Termination codons were excluded to the count due to the uncertainty in many species.
Results and discussion Gene structure, organization and composition The P. apollo mitogenome contains the 37 genes typical of insects: 13 PCGs, 2 rRNA genes, 22 tRNA genes, and one non-coding AT-rich region (control region) (Fig. 1, Table 2). Like many other insect mitogenomes, the major strand codes for 23 genes (9 PCGs and 14 tRNAs) and the AT-rich region, while the minor strand codes for the remaining 14 genes (4 PCGs, 8 tRNAs and 2 rRNA genes). Though the genome size is nearly the same with that of available congeneric mitogenome, Parnassius bremeri (15,389 bp in size), the 15,404-bp long genome is the second largest of the Papilionidae butterflies, after Papilio maraho (16,094 bp in size) (Table 3). The gene order and orientation are similar to that found in the inferred ancestral hexapod (Boore et al., 1998; Crease, 1999), with the exception of the arrangement of tRNAs between the AT-rich region and the ND2 gene. This type of arrangement (M-I-Q) is found in nearly all the lepidopterans, whereas the insect ground plan arrangement is I-Q-M (Taylor et al., 1993; Cao et al., 2012; Cameron, 2014). As is the case in other Papilionidae butterflies, the nucleotide composition of the entire P. apollo mitogenome is significantly biased, with the highest A + T content (81.3%) of Papilionidae species the same as that of P. bremeri (Table 3). The overall AT- and GC-skews of the P. apollo mitogenome (measured on the majority strand) are −0.016 and − 0.187, respectively, indicating that more Ts and Cs than As and Gs are used (Table 3). This is similar to the skew statistics of other Papilionidae butterfly species which have negligible AT-skew values (−0.040 to 0.006) and moderate GC-skew values (−0.262 to −0.191).
ATC sequence requires nine additional amino acids, resulting in a peculiar alignment as compared with other lepidopteran species. However, a codon following this triplet has a stop codon (TAG) which is present at the beginning region of the COI gene. Consequently, this ATC sequence may not be the start codon for the COI gene, and there are no other probable start codons for P. apollo COI. According to these criteria, the first nonoverlapping codon in the COI gene is the CGA, designating arginine existing in a highly conserved region in most lepidopteran insects (Cameron and Whiting, 2008; Hao et al., 2013). Eleven genes have complete termination codons, either TAA (ATP6, ATP8, COIII, CytB, ND2, ND3, ND4, ND4L, ND5, ND6) or TAG (ND1), while the remaining two genes (COI and COII) end with the incomplete termination codon T. This phenomenon of partial termination codons (i.e., T or TA) is observed in all sequenced lepidopteran insects and has been interpreted in terms of posttranscriptional polyadenylation, by which “A” residue(s) are added to create TAA terminator (Kim et al., 2009). The relative synonymous codon usage (RSCU) analysis demonstrated that codons with As or Ts at the third position are always overused compared to other synonymous codons. For example, the codon TTG (Leu) is utilized only twice per 1000 codons, corresponding to an RSCU of 0.07, but its synonymous codon TTA (Leu) is significantly overused (134 per 1000), corresponding to an RSCU of 5.42 (Table 4). This trend has also been noted in all other insect mitogenomes, thus indicating the fact of universally biased usage of A and T nucleotides in the PCGs (Cameron and Whiting, 2007; Nelson et al., 2012). In addition, NC1000 statistics showed that TTT (Phe), TTA (Leu), ATT (Ile), ATA (Met), and AAT (Asn) are the five most frequently used, accounting for 48.36% of all the codons (Table 4). Similar cases have been detected in other lepidopterans (data not shown).
The protein coding genes The intergenic spacer sequences The P. apollo mitogenome harbors 13 protein coding genes (PCGs), which collectively harbor 3720 codons, exclusive of the termination codons. Codon number is identical to that of Papilio machaon. Of the 13 PCGs, nine are encoded on the J-strand (ATP6, ATP8, COI, COII, COIII, CytB, ND2, ND3, ND6), while the other four are encoded on the Nstrand (ND1, ND4, ND4L, ND5). All PCGs are initiated by typical ATN codons (ATP8, ND2, ND3 and ND5 with ATT; ATP6, COII, COIII, CytB, ND1, ND4 and ND4L with ATG; ND6 with ATC), except COI gene which utilizes CGA as a start codon. In the COI gene, no canonical ATN initiator was found in the start site. The only plausible traditional start codon for the COI gene is ATC, located within the tRNATyr gene, overlapping 25 bp with the tRNATyr. This
The P. apollo mitogenome includes a total of 164 bp of intergenic spacer regions, spread over 14 non-coding regions, ranging from 1 to 68 bp. The four longest spacers are located between tRNAGln and ND2 (40 bp), tRNASer(AGN) and tRNAGlu (68 bp), ND6 and CytB (16 bp), and tRNASer(UCN) and ND1 (16 bp) (Table 2). The tRNAGln -ND2 spacer has been detected in most other Papilionidae species, with a size range of 40 to 72 bp. This sequence is 70% homologous to its neighboring ND2 gene, suggesting that this sequence may be derived from ND2 (Fig. 2). The Ser-Glu spacer is unique to the genus Parnassius, and in P. bremeri the corresponding region is 43 bp long (Kim et al., 2009). This region sequence appears to be the result of an 8-fold repetition of TTTCTTCT motif
668
Y. Chen et al. / Journal of Asia-Pacific Entomology 17 (2014) 663–671
was detected in all sequenced Papilionidae butterflies, which harbor an ATACTAA motif (Fig. 3). Due to this intergenic spacer sequences are located at the end site of the major-strand coding region, this 7-bp sequence was suggested to be the possible binding site for mtTERM, the transcription termination peptide (Taanman, 1999; Cameron and Whiting, 2008). The tRNA genes
Fig. 3. Alignment of the intergenic spacer between the tRNASer(UCN) and ND1 among all sequenced Papilionidae butterflies, with the ATACTAA motif shown by shadow area.
or a 4-fold repetition of a CTTTATTT motif (Fig. 2). The third one (16 bp) shows a low level of sequence similarity compared with its neighboring ND6 and CytB genes, showing significant variations in length among the sequenced lepidopterans (data not shown). Finally, the last one (16 bp)
There are 22 tRNA genes in the P. apollo mitogenome, ranging in length from 61 bp (tRNASer (AGN)) to 71 bp (tRNALys) (Table 2). The nucleotide composition of these 22 tRNA genes (1,460 bp in total size) is AT biased (81.5%). All of them possess the typical clover-leaf secondary structures, with the exception of tRNASer (AGN), which lacks a dihydrouridine (DHU) arm (Fig. 4). Similar cases have been detected in most insects including all lepidopterans studied to date (Wolstenholme, 1992; Salvato et al., 2008; Hu et al., 2010; Wang et al., 2011; Sun et al., 2012; Zhao et al., 2013).
Fig. 4. Predicated clover-leaf secondary structure of the Parnassius apollo tRNA genes.
Y. Chen et al. / Journal of Asia-Pacific Entomology 17 (2014) 663–671
669
Fig. 5. Predicted secondary structure of the Parnassius apollo lrRNA. Roman numerals denote the conserved domain structure. Helices are numbered according to the annotation systems of Gillespie et al. (2006). Tertiary structures are denoted by boxed bases joined by solid lines. Watson–Crick pairs are joined by dashes, other interactions are joined by plus signs.
All P. apollo tRNAs possess 7 bp aminoacyl stems, 7 bp anticodon loop and 5 bp anticodon stems, but other portions of tRNAs are variable in length, particularly within the DHU and TΨC loops (4–7 bp and 3–9 bp, respectively). A total of 11 pair mismatches are found in all the tRNA stem regions: 6 U-Us, 2 A-Cs, 2 U-Cs, and one G-A (Fig. 4).
The rRNA genes Like all other insect mitogenome sequences, two rRNA genes (1342 bp lrRNA and 771 bp srRNA) are found in the P. apollo mitogenome. They are located between tRNA Leu(CUN) and tRNAVal, and between tRNAVal and the AT-rich region (Table 2), with an A + T% of 84.1% and 85.3%, respectively. Both of these values are well within the range reported for other lepidopteran insects (Salvato et al., 2008). In predictive secondary structures, lrRNA contained six domains (labeled I, II, III, IV, V, and VI) with 49 helices, while the srRNA harbored three domains (labeled I, II, III) with 33 helices (Figs. 5 and 6), respectively. The morphological characteristics of both lrRNA and srRNA are quite similar to their counterparts in
Apis mellifera, and Manduca sexta (Gillespie et al., 2006; Cameron and Whiting, 2008). The AT-rich region The 504 bp AT-rich region of P. apollo mitogenome is located between srRNA and tRNA Met , and shows a relatively high level of A + T content (93.8%); well within the range of other Papilionidae species 92.5% in P. machaon to 94.3% in P. maraho (Table 3). The region is composed mostly of non-repetitive sequences, but harbors some typical structures characteristic of lepidopterans: the putative O N (Origin of minority or light strand replication) located 22 bp upstream of the 5′-end of the srRNA gene, and contains the motif ATAGA followed by an 17 bp poly-T stretch; and a microsatellite-like repeat (TA) 9 preceded by the ATTTA motif (Fig. 7). Another (TA) 9 microsatellite repeat located 126 bp upstream of the srRNA, is found in both Parnassius species (Fig. 7). It has been previously demonstrated that the presence of tRNA-like sequences within the AT-rich region in mammalian mitogenome is due to the failure to cleave the tRNA primers from the nascent DNA
670
Y. Chen et al. / Journal of Asia-Pacific Entomology 17 (2014) 663–671
Fig. 6. Predicted secondary structure of the Parnassius apollo srRNA. The annotation is the same as in Fig. 5.
strand after the mitochondrial DNA synthesis, and consequently tRNAlike sequences are incorporated into the mitogenome (Cantatore et al., 1987). Afterwards, the tRNA-like sequences have also been reported
in many insects, such as Hymenoptera (Cha et al., 2007), Diptera (Cameron et al., 2007), Lepidoptera (Kim et al., 2009), and Coleoptera (Hong et al., 2009). In P. apollo, one tRNATrp -like and one
Fig. 7. Characteristic sequences of AT-rich region of Parnassius apollo. (A) The special TA repeat sequences of the AT-rich region in P. apollo and P. bremeri. (B) Sequence of P. apollo AT-rich region. The shadow areas show the ATAGA motif, poly-T stretch, ATTTA sequence and microsatellite TA repeat sequence. The underlined sequences show the tRNATrp-like sequence and the tRNALeu(UUR)-like sequence. (C) Secondary structures of the tRNATrp-like sequence and the tRNALeu(UUR)-like sequence.
Y. Chen et al. / Journal of Asia-Pacific Entomology 17 (2014) 663–671
tRNALeu(UUR)-like sequences are detected in its AT-rich region, as is the case in its congeneric species P. bremeri (Fig. 7). Acknowledgments This work was supported by the National Science Foundation of China (Grant No. 41172004) and the opening funds from the State Key Laboratory of Palaeobiology and Stratigraphy, Nanjing Institute of Geology and Palaeontology, Chinese Academy of Sciences (Grant No. 104143). References Benson, G., 1999. Tandem repeats finder: a program to analyze DNA sequences. Nucleic Acids Res. 27, 573–580. Boore, J.L., 1999. Animal mitochondrial genomes. Nucleic Acids Res. 27, 1767–1780. Boore, J.L., Lavrov, D.V., Brown, W.M., 1998. Gene translocation links insects and crustaceans. Nature 392, 667–668. Cameron, S.L., 2014. Insect mitochondrial genomics: implications for evolution and phylogeny. Annu. Rev. Entomol. 59, 95–117. Cameron, S.L., Whiting, M.F., 2007. Mitochondrial genomic comparisons of the subterranean termites from the Genus Reticulitermes (Insecta: Isoptera: Rhinotermitidae). Genome 50, 188–202. Cameron, S.L., Whiting, M.F., 2008. The complete mitochondrial genome of the tobacco hornworm, Manduca sexta, (Insecta: Lepidoptera: Sphingidae), and an examination of mitochondrial gene variability within butterflies and moths. Gene 408, 112–123. Cameron, S.L., Lambkin, C.L., Barker, S.C., Whiting, M.F., 2007. A mitochondrial genome phylogeny of Diptera: whole genome sequence data accurately resolve relationships over broad timescales with high precision. Syst. Entomol. 32, 40–59. Cantatore, P., Gadaleta, M.N., Roberti, M., Saccone, C., Wilson, A.C., 1987. Duplication and remodeling of tRNA genes during the evolutionary rearrangement of mitochondrial genomes. Nature 329, 853–855. Cao, Y.Q., Ma, C., Chen, J.Y., Yang, D.R., 2012. The complete mitochondrial genomes of two ghost moths, Thitarodes renzhiensis and Thitarodes yunnanensis: the ancestral gene arrangement in Lepidoptera. BMC Genomics 13, 276. Carter, D., 2000. Butterflies and Moths. Dorling Kindersley, London. Caterino, M.S., Sperling, F.A.H., 1999. Papilio phylogeny based on mitochondrial cytochrome oxidase I and II genes. Mol. Phylogenet. Evol. 11, 122–137. Cha, S.Y., Yoon, H.J., Lee, E.M., Yoon, M.H., Hwang, J.S., Jin, B.R., Han, Y.S., Kim, I., 2007. The complete nucleotide sequence and gene organization of the mitochondrial genome of the bumblebee, Bombus ignitus (Hymenoptera: Apidae). Gene 392, 206–220. Collins, N.M., Morris, M.G., 1985. Threatened Swallowtail Butterflies of the World. IUCN, Gland, Switzerland and Cambridge, UK. Crease, T., 1999. The complete sequence of the mitochondrial genome of Daphnia pulex (Cladocera: Crustacea). Gene 233, 89–99. Dong, Y., Zhu, L.X., Wu, Y.F., Wu, X.B., 2013. The complete mitochondrial genome of the Alpine black swallowtail, Papilio maackii (Insecta: Lepidoptera: Papilionidae). Mitochondrial DNA 24, 639–641. Gillespie, J.J., Johnston, J.S., Cannone, J.J., Gutell, R.R., 2006. Characteristics of the nuclear (18S, 5.8S, 28S and 5S) and mitochondrial (12S and 16S) Rrna genes of Apis mellifera (Insecta: Hymenoptera): structure, organization and retrotransposable elements. Insect Mol. Biol. 15, 657–686. Gimenez, D.M., 1996. Parnassius apollo. IUCN 2013. IUCN Red List of Threatened Species. Version 2013.1 (bwww.iucnredlist.orgN. Assessed 1 August 1996). Hall, T.A., 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 41, 95–98. Hao, J.S., Sun, M.E., Sun, X.Y., Shao, L.L., Yang, Q., 2013. Complete mitogenomes of Euploea mulciber (Nymphalidae: Danainae) and Libythea celtis (Nymphalidae: Libytheinae) and their phylogenetic implications. ISRN Genomics 491636, 1–14. Hong, M.Y., Jeong, H.C., Kim, M.J., Jeong, H.U., Lee, S.H., Kim, I., 2009. Complete mitogenome sequence of the jewel beetle, Chrysochroa fulgidissima (Coleoptera: Buprestidae). Mitochondrial DNA 20, 46–60.
671
Hu, J., Zhang, D.X., Hao, J.S., Huang, D.Y., Cameron, S., Zhu, C.D., 2010. The complete mitochondrial genome of the yellow coaster, Acraea issoria (Lepidoptera: Nymphalidae: Heliconiinae: Acraeini): sequence, gene organization and a unique tRNA translocation event. Mol. Biol. Rep. 37, 3431–3438. Ji, L.W., Hao, J.S., Wang, Y., Huang, D.Y., Zhao, J.L., Zhu, C.D., 2012. The complete mitochondrial genome of the dragon swallowtail, Sericinus montela Gray (Lepidoptera: Papilionidae) and its phylogenetic implication. Acta Entomol. Sin. 55, 91–100. Kim, M.I., Baek, J.Y., Kim, M.J., Jeong, H.C., Kim, K.G., Bae, C.H., Han, Y.S., Jin, B.R., Kim, I., 2009. Complete nucleotide sequence and organization of the mitogenome of the red–spotted apollo butterfly, Parnassius bremeri (Lepidoptera: Papilionidae) and comparison with other lepidopteran insects. Mol. Cell 28, 347–363. Lowe, T.M., Eddy, S.R., 1997. tRNAscan-SE: a program for improved detection of transfer RNA genes in genomic sequence. Nucleic Acids Res. 25, 955–964. Nardi, F., Spinsanti, G., Boore, J.L., Carapelli, A., Dallai, R., Frati, F., et al., 2003. Hexapod origins: monophyletic or paraphyletic? Science 299, 1887–1889. Nardi, F., Carapelli, A., Dallai, R., Roderick, G.K., Frati, F., 2005. Population structure and colonization history of the olive fly Bactrocera oleae (Diptera: Tephritidae). Mol. Ecol. 14, 2729–2738. Nelson, L.A., Lambkin, C.L., Batterham, P., Wallman, J.F., Dowton, M., Whiting, M.F., Yeates, D.K., Cameron, S.L., 2012. Beyond barcoding: a mitochondrial genomics approach to molecular phylogenetics and diagnostics of blowflies (Diptera: Calliphoridae). Gene 511, 131–142. Perna, N.T., Kocher, T.D., 1995. Patterns of nucleotide composition at fourfold degenerate sites of animal mitochondrial genome. J. Mol. Evol. 41, 353–358. Qin, F., Jiang, G.F., Zhou, S.Y., 2013. Complete mitochondrial genome of the Teinopalpus aureus guangxiensis (Lepidoptera: Papilionidae) and related phylogenetic analyses. Mitochondrial DNA 23, 123–125. Salvato, P., Simonato, M., Battisti, A., Negrisolo, E., 2008. The complete mitochondrial genome of the bag-shelter moth Ochrogaster lunifer (Lepidoptera, Notodontidae). BMC Genomics 9, 331. Simmons, R.B., Weller, S.J., 2001. Utility and evolution of cytochrome b in insects. Mol. Phylogenet. Evol. 20, 196–210. Simon, C., Buckley, T.R., Frati, F., Stewart, J.B., Beckenbach, A.T., 2006. Incorporating molecular evolution into phylogenetic analysis and a new compilation of conserved polymerase chain reaction primers for animal mitochondrial DNA. Ann. Rev. Ecol. Evol. Syst. 37, 545–579. Singh, V.K., Mangalam, A.K., Dwivedi, S., Naik, S., 1998. Primer premier: program for design of degenerate primers from a protein sequence. BioTechniques 24, 318–319. Still, J., 1996. Butterflies and Moths of Britain and Europe. Harper Collins, London. Sun, Q.Q., Sun, X.Y., Wang, X.C., Gai, Y.H., Hu, J., Zhu, C.D., Hao, J.S., 2012. Complete sequence of the mitochondrial genome of the Japanese buff-tip moth, Phalera flavescens (Lepidoptera: Notodontidae). Genet. Mol. Res. 11, 4213–4225. Taanman, J.W., 1999. The mitochondrial genome: structure, transcription, translation and replication. Biochim. Biophys. Acta 1410, 103–123. Tamura, K., Peterson, D., Peterson, N., Stecher, G., et al., 2011. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 28, 2731–2739. Taylor, M.F., McKechnie, S.W., Pierce, N., Kreitman, M., 1993. The lepidopteran mitochondrial control region: structure and evolution. Mol. Biol. Evol. 10, 1259–1272. Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., 1997. The CLUSTAL_X windows interface: flexible strategies for multiple sequences alignment aided by quality analysis tools. Nucleic Acids Res. 24, 4876–4882. Wang, X.C., Sun, X.Y., Sun, Q.Q., Zhang, D.X., Hu, J., Yang, Q., Hao, J.S., 2011. The complete mitochondrial genome of the laced fritillary Argyreus hyperbius (Lepidoptera: Nymphalidae). Zool. Res. 32, 465–475. Wolstenholme, D.R., 1992. Animal mitochondrial DNA: structure and evolution. Int. Rev. Cytol. 141, 173–216. Wu, L.W., Lees, D.C., Yen, S.H., Hsu, Y.F., 2010. The complete mitochondrial genome of the near–threatened swallowtail, Agehana maraho (Lepidoptera: Papilionidae): evaluating sequence variability and suitable markers for conservation genetic studies. Entomol. News 121, 267–280. Zhao, F., Huang, D.Y., Shi, Q.H., Hao, J.S., Sun, X.Y., Zhang, L.L., Yang, Q., 2013. The first mitochondrial genome for the butterfly family Riodinidae and its systematic implications. Zool. Res. 34, 109–119.