The complete mitochondrial genome sequence and gene organization of the mud crab (Scylla paramamosain) with phylogenetic consideration

Gene 519 (2013) 120–127

Contents lists available at SciVerse ScienceDirect

Gene journal homepage: www.elsevier.com/locate/gene

The complete mitochondrial genome sequence and gene organization of the mud crab (Scylla paramamosain) with phylogenetic consideration Hongyu Ma, Chunyan Ma, Xincang Li, Zhen Xu, Nana Feng, Lingbo Ma ⁎ Key Laboratory of East China Sea and Oceanic Fishery Resources Exploitation, Ministry of Agriculture, East China Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences, Shanghai, 200090, China

a r t i c l e

i n f o

Article history: Accepted 17 January 2013 Available online 4 February 2013 Keywords: Scylla paramamosain Mitochondrial genome 454 sequencing Gene content Phylogenetic relationship

a b s t r a c t The complete mitochondrial genome is of great importance for better understanding the genome-level characteristics and phylogenetic relationships among related species. In the present study, we determined the complete mitochondrial genome DNA sequence of the mud crab (Scylla paramamosain) by 454 deep sequencing and Sanger sequencing approaches. The complete genome DNA was 15,824 bp in length and contained a typical set of 13 protein-coding genes, 22 transfer RNA (tRNA) genes, two ribosomal RNA (rRNA) genes and a putative control region (CR). Of 37 genes, twenty-three were encoded by the heavy strand (H-strand), while the other ones were encoded by light strand (L-strand). The gene order in the mitochondrial genome was largely identical to those obtained in most arthropods, although the relative position of gene tRNAHis differed from other arthropods. Among 13 protein-coding genes, three (ATPase subunit 6 (ATP6), NADH dehydrogenase subunits 1 (ND1) and ND3) started with a rare start codon ATT, whereas, one gene cytochrome c oxidase subunit I (COI) ended with the incomplete stop codon TA. All 22 tRNAs could fold into a typical clover-leaf secondary structure, with the gene sizes ranging from 63 to 73 bp. The phylogenetic analysis based on 12 concatenated protein-coding genes showed that the molecular genetic relationship of 19 species of 11 genera was identical to the traditional taxonomy. © 2013 Elsevier B.V. All rights reserved.

1. Introduction In most metazoans, the mitochondrial genome DNA is a typically closed-circular molecule (14–18 kb in length) and autonomously replicated and transcribed (Boore, 1999; Nakao et al., 2002). Although the gene rearrangements and deletions have been observed in several species (Liu and Cui, 2009; Shen et al., 2007), the mitochondrial genome generally encodes 37 genes: 13 protein-coding genes, 22 transfer RNAs and two ribosomal RNAs, as well as a large non-coding region which may control its replication and transcription. The complete mitochondrial genomes not only provide more information than single genes, but also show genome-level characteristics which are valuable for better understanding genome evolution and phylogeny (Lei et al., 2010). Up to now, the complete mitochondrial genomes have been reported in many aquatic organisms, including Penaeus monodon (Wilson et al., 2000), Portunus trituberculatus (Yamauchi et al., 2003), Abbreviations: PCR, polymerase chain reaction; tRNA, transfer RNA; rRNA, ribosomal RNA; CR, control region; ATP6 and ATP8, ATPase subunits 6 and 8; ND1–ND6 and ND4L, NADH dehydrogenase subunits 1–6 and 4L; COI–COIII, cytochrome c oxidase subunits I–III; 16S and 12S, large and small subunits ribosomal RNA; Cyt b, cytochrome b; bp, base pair; H-strand, heavy strand; L-strand, light strand; SNP, single nucleotide polymorphism. ⁎ Corresponding author. Tel.: +86 21 65809298. E-mail address: [email protected] (L. Ma). 0378-1119/$ – see front matter © 2013 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.gene.2013.01.028

Eriocheir sinensis (Sun et al., 2005), Fenneropenaeus chinensis (Shen et al., 2007), Apostichopus japonicas (Shen et al., 2009), Radix balthica (Feldmeyer et al., 2010), Lutra lutra (Ki et al., 2010), Miichthys miiuy (Cheng et al., 2010), Charybdis japonica (Liu and Cui, 2010) and Collichthys lucidus (Cheng et al., 2012a). Due to its haploid nature, limited recombination, maternal inheritance and rapid evolutionary rate, the mitochondrial DNA has now been widely used for studying population genetics (Brown et al., 2011; Lee et al., 2010; Ma et al., 2011a), phylogeography and phylogeny (Keskin and Can, 2009; Gvozdik et al., 2010; Xu et al., 2009), and species identification (Feng et al., 2011; Ma et al., 2012a). The mud crab (Scylla paramamosain Estampador, 1949) (Decapoda: Portunidae) is broadly distributed along the southeastern coastal regions of China. As a commercially important marine fisheries resource and cultured species, S. paramamosain has not only wonderful muscle flavor, but also fast growth rate. Records of S. paramamosain aquaculture could be dated back more than 100 years in China (Shen and Lai, 1994) and more than 30 years in other Asian countries (Keenan and Blackshaw, 1999). S. paramamosain adults usually mate inshore, and then the gravid females migrate offshore to spawn (Perrine, 1979). However, in recent years the fisheries resource of S. paramamosain has been declining severely due to over-fishing and seawater pollution. In order to estimate and conserve this valuable crab resource, population genetic structure and diversity have been investigated by mitochondrial DNA (He et al., 2010; Ma et al., 2006, 2011a) and microsatellite markers

H. Ma et al. / Gene 519 (2013) 120–127

121

Table 1 Primers used for filling the gaps in the mitochondrial genome of Scylla paramamosain after assembly of 454 reads and contigs. Primer name

Forward (5′–3′)

Reverse (5′–3′)

Ta (°C)

Sp-ND3-5 Sp-16-12S Sp-12-ND2

GGAGCTTTAGAATGATCTAAGTAAT AATTATCCCTGATACACAAGGTACA AAAGTATAACCGCAACTGCTGGCAC

AAAGTAGCAGATAAAGGTTGATTTG TTAGTCTTGTCAGAGGAACCTGTT TTAATTCAAACAGAACTAAAGAGAT

53 55 60

(Ma et al., 2011b, 2012b; Takano et al., 2005). These studies revealed a high level of population genetic diversity, low differentiation among different locations, and little genetic structure for this important crab species. In addition, a set of gene-derived single nucleotide polymorphism (SNP) markers and functional genes were reported for this species (Chen et al., 2010; Imjongjirak et al., 2009; Ma et al., 2011c). Besides, no more information about population genetic background and genetic resource is available for S. paramamosain. In the present study, we determined the complete mitochondrial genome DNA sequence of the mud crab (S. paramamosain) by 454 deep sequencing and traditional Sanger sequencing, and identified the genome organization, nucleotide composition, gene order and codon usage. Moreover, we analyzed the molecular phylogenetic relationships of S. paramamosain with other 18 species of Decapods. This study should be useful for studies on population genetic structure, stock identification, evolution and phylogeny, and conservation genetics of S. paramamosain and other related crab species. 2. Materials and methods 2.1. Analysis of transcriptome derived mitochondrial DNA sequences The transcriptome of S. paramamosain has been sequenced on a titanium plate on the Roche 454 Genome Sequencer FLX Titanium in a previous study (Ma et al., submitted for publication). A de novo assembly of all high quality reads was carried out to produce contigs and singletons using the software MIRA. The unigenes were determined and annotated based on sequence similarity of contigs and singletons with known proteins (E≤0.00001) in UniProt and non-redundant (NR) protein databases. All unigenes which belonged to the mitochondrial genes were selected and assembled again and compared with the complete mitochondrial genome DNA of P. trituberculatus (Yamauchi et al., 2003) using the software SeqMan (DNASTAR). 2.2. Primers design, PCR and sequencing In order to fill the gaps in the mitochondrial genome of S. paramamosain, three pairs of primers were designed based on the flanking sequences of the gaps using the software Primer Premier 5.0 (Table 1). Genomic DNA was extracted from muscle tissue using the traditional proteinase K and phenol–chloroform extraction protocol as described in Ma et al. (2009). Polymerase chain reaction (PCR) was performed on a Peltier Thermal Cycler in 25 μl total volume that included 0.4 μM each primer, 0.2 mM each dNTP, 1× PCR buffer, 1.5 mM MgCl2, 0.75 unit Taq polymerase, and approximately 100 ng template DNA under the following conditions: one cycle of denaturation at

94 °C for 4 min; 37 cycles of 30 s at 94 °C, 50 s at a primer-specific annealing temperature (Table 1), and 50 s at 72 °C. As a final step, products were extended for 7 min at 72 °C. The PCR products were separated on 1.5% agarose gels. After recovered and purified, the PCR products were directly sequenced in both directions using ABI Prism 3730 automated DNA sequencer (PE Corporation). Sequences from PCR and from the former contigs of mitochondrial genome were edited and assembled using two softwares EditSeq and SeqMan (DNASTAR). 2.3. Gene identification and genome analysis Protein-coding genes, rRNA genes and non-coding regions were determined by sequence comparisons with the known complete mitochondrial genome of the closely related species, including P. trituberculatus (Yamauchi et al., 2003), and C. japonica (Liu and Cui, 2010) using BLASTN tool at NCBI database. Most tRNA genes were identified by their proposed clover-leaf secondary structure and anticodons using web-based tRNA-scan SE 1.21 program (Lowe and Eddy, 1997; http://lowelab.ucsc.edu/tRNAscan-SE/) with default search mode, while the remaining genes were determined by inspecting sequences for tRNA-like secondary structures and anticodons. All 13 protein-coding genes were automatically translated into amino acids using the software MEGA 4.0 (Kumar et al., 2008). The codon usage of 13 protein-coding genes and the nucleotide composition of the mitochondrial genome were determined by MEGA 4.0 also. The complete mitochondrial genome DNA sequence was deposited in GenBank database. 2.4. Phylogenetic analysis In order to elucidate the phylogenetic position of S. paramamosain within Decapoda, the complete mitochondrial genomes of 18 species were downloaded from GenBank database, which included Callinectes sapidus (NC_006281), C. japonica (FJ460517), Eriocheir hepuensis (NC_011598), Eriocheir japonica (NC_011597), E. sinensis (NC_006992), F. chinensis (DQ518969), Geothelphusa dehaani (NC_ 007379), Litopenaeus vannamei (DQ534543), Macrobrachium rosenbergii (NC_006880), Marsupenaeus japonicus (NC_007010), Pagurus longicarpus (NC_003058), Panulirus japonicus (NC_004251), P. monodon (NC_ 002184), P. trituberculatus (AB093006), Pseudocarcinus gigas (NC_ 006891), Scylla olivacea (NC_012569), Scylla serrata (NC_012565), Scylla tranquebarica (NC_012567). One species Harpiosquilla harpax (NC_006916) was used as outgroup taxa. Each of 13 protein-coding genes was aligned separately using Clustal W in MEGA 4.0 with default settings. Gene ND6 was not used in the subsequent analysis due to its high heterogeneity and

Fig. 1. Gene organization of the mitochondrial genome of Scylla paramamosain. The genes are abbreviated as follows: COI–COIII denote for cytochrome c oxidase subunits I–III, ATP6 and ATP8 denote for ATPase subunits 6 and 8, ND1–ND6 and ND4L denote for NADH dehydrogenase subunits 1–6 and 4L. Cyt b devote for cytochrome b, 12S and 16S denote for the small and large subunits ribosomal RNA, CR denotes for control region. The complete mitochondrial genome DNA sequence has been deposited in GenBank with the accession number JX457150.

122

H. Ma et al. / Gene 519 (2013) 120–127

consistently poor phylogenetic performance (Miya and Nishida, 2000). All other 12 protein-coding gene alignments were concatenated to a single multiple sequence alignment. The phylogenetic tree was reconstructed using neighbor-joining (NJ) in MEGA 4.0 with 1000 bootstrap replicates.

After assembly of the large genome fragments and their gaps successfully, we obtained the complete mitochondrial genome DNA sequence and deposited it in GenBank database (the accession number: JX457150). 3.2. Genome organization and composition

3. Results 3.1. Complete mitochondrial genome DNA sequence A total of 1,314,101 high quality reads with an average length of 411 bp were generated by 454 deep sequencing of the transcriptome of S. paramamosain (Ma et al., submitted for publication). After de novo assembly and functional annotation, more than 700 unigenes were found belonging to 13 protein-coding genes and two rRNA genes of mitochondrial genome, respectively. These unigenes were assembled and compared with the complete mitochondrial DNA of P. trituberculatus (Yamauchi et al., 2003) that resulted in three independent large mitochondrial genome fragments, remaining three gaps between genes NADH dehydrogenase subunits 3 (ND3) and ND5, large subunits ribosomal RNA (16S rRNA) and 12S rRNA, and 12S rRNA and ND2, respectively. The corresponding fragments were amplified successfully by three pairs of primers (Table 1) and then Sanger sequenced.

Table 2 Characteristics of genes in the mitochondrial genome of Scylla paramamosain. Gene

COI tRNALeu (UUR) COII tRNALys tRNAAsp ATP8 ATP6 COIII tRNAGly ND3 tRNAAla tRNAArg tRNAAsn tRNASer (AGN) tRNAGlu tRNAHis tRNAPhe ND5 ND4 ND4L tRNAThr tRNAPro ND6 Cyt b tRNASer (UCN) ND1 tRNALeu (CUN) 16S rRNA tRNAVal 12S rRNA Control region tRNAIle tRNAGln tRNAMet ND2 tRNATrp tRNACys tRNATyr a

Position

Size (bp)

Codon

From

To

1 1535 1628 2313 2381 2448 2603 3280 4071 4138 4499 4575 4639 4710 4777 4883 4946 5012 6762 8090 8395 8462 8533 9039 10,174 10,267 11,229 11,297 12,637 12,710 13,579

1535 1602 2314 2379 2447 2609 3280 4071 4137 4491 4564 4638 4707 4776 4843 4945 5011 6739 8096 8392 8461 8530 9039 10,175 10,241 11,223 11,296 12,636 12,709 13,578 14,411

14,412 14,475 14,549 14,617 15,623 15,690 15,758

14,477 66 14,543 69 14,616 68 15,623 1007 335 15,690 68 15,757 68 15,824 67

1535 68 687 67 67 162 678 792 67 354 66 64 69 67 67 63 66 1728 1335 303 67 69 507 1137 68 957 68 1340 73 869 833

Amino Start Stop acid

a

511

ATG

TA−

228

ATG

TAA

53 225 263

ATG ATT ATG

TAG TAA TAA

117

ATT

TAA

575 444 100

ATG ATG ATG

TAA TAA TAA

168 378

ATG ATG

TAA TAA

318

ATT

TAA

ATG

TAG

Intergenic Strandc nucleotide (bp)b −1 25 −2 1 0 −7 −1 −1 0 7 10 0 2 0 39 0 0 22 −7 2 0 2 −1 −2 25 5 0 0 0 0 0

H H H H H H H H H H H H H H H L L L L L H L H H H L L L L L

−3 5 0 −2 −1 0 0

H L H H H L L

TA represents incomplete stop codons. Numbers correspond to the nucleotides separating adjacent genes. Negative numbers indicate overlapping nucleotides. c H and L indicate that the gene is encoded by the H or L strand. b

The mitochondrial genome DNA of S. paramamosain was a circular molecule of 15,824 bp in length and contained a typical set of 37 genes: 13 protein-coding genes, 22 transfer RNA (tRNA) genes and two ribosomal RNA (12S rRNA and 16S rRNA) genes. Besides the above genes, there was a non-coding region between genes 12S rRNA and tRNA Ile with a high A + T content as a putative control region. Twenty-three genes were encoded by heavy strand (H-strand) including nine protein-coding genes and 14 tRNA genes, while the other genes were encoded by light strand (L-strand), containing four protein-coding genes, eight tRNA genes and two rRNA genes. The gene order and direction of transcription in mitochondrial genome of S. paramamosain were shown in Fig. 1. Table 3 The base composition in different regions of mitochondrial genome of Scylla paramamosain (the genes which are encoded by the L-strand are converted to complementary strand sequences). Region

Base composition (%)

A + T content (%)

A

G

T

C

Protein-coding gene COI COII ATP8 ATP6 COIII ND3 ND5 ND4 ND4L ND6 Cyt b ND1 ND2

28.14 30.13 27.78 28.61 26.26 27.97 32.99 31.01 30.36 27.81 28.14 28.32 27.48

14.98 14.26 4.94 10.91 14.77 11.30 17.53 16.93 19.80 7.89 12.84 18.08 8.23

37.72 36.10 50.62 42.33 40.91 44.92 40.28 44.12 42.57 45.96 40.02 44.83 44.35

19.15 19.51 16.67 18.14 18.06 15.82 9.20 7.94 7.26 18.34 19.00 8.78 19.94

65.86 66.23 78.40 70.94 67.17 72.88 73.26 75.13 72.94 73.77 68.16 73.15 71.83

tRNA gene tRNALeu (UUR) tRNALys tRNAAsp tRNAGly tRNAAla tRNAArg tRNAAsn tRNASer (AGN) tRNAGlu tRNAHis tRNAPhe tRNAThr tRNAPro tRNASer (UCN) tRNALeu (CUN) tRNAVal tRNAIle tRNAGln tRNAMet tRNATrp tRNACys tRNATyr

38.24 31.34 37.31 44.78 34.85 32.81 37.68 31.34 40.30 36.51 50.00 38.81 39.13 45.59 41.18 35.62 33.33 31.88 33.82 45.59 41.18 38.81

16.18 20.90 8.96 8.96 15.15 14.06 15.94 14.93 5.97 15.87 12.12 8.96 14.49 13.24 13.24 17.81 16.67 23.19 13.24 8.82 19.12 16.42

33.82 29.85 47.76 34.33 37.88 34.38 31.88 40.30 43.28 39.68 31.82 41.79 40.58 33.82 36.76 35.62 40.91 34.78 32.35 32.35 30.88 35.82

11.76 17.91 5.97 11.94 12.12 18.75 14.49 13.43 10.45 7.94 6.06 10.45 5.80 7.35 8.82 10.96 9.09 10.14 20.59 13.24 8.82 8.96

72.06 61.19 85.07 79.10 72.73 67.19 69.57 71.64 83.58 76.19 81.82 80.60 79.71 79.41 77.94 71.23 74.24 66.67 66.18 77.94 72.06 74.63

rRNA gene 16S rRNA 12S rRNA Control region Overall of protein-coding genes Overall of tRNA genes Overall of rRNA genes Overall of the genome

41.64 39.59 45.38 29.24 38.19 40.83 34.87

14.63 15.42 6.00 14.29 14.30 14.94 10.16

35.82 36.13 41.30 41.64 36.37 35.94 38.17

7.91 8.86 7.32 14.83 11.13 8.28 16.80

77.46 75.72 86.67 70.88 74.56 76.78 73.04

H. Ma et al. / Gene 519 (2013) 120–127

Eleven gene overlaps were detected, of which eight were on H-strand, one was on L-strand, and two were on both strands. Meanwhile, twelve intergenic spacers were found, with five on H-strand, two on L-strand and five on both strands, respectively. The total length of overlaps and intergenic spacers were 28 bp and 145 bp in

123

length, with the ranges from 1 to 7 bp and from 1 to 39 bp per location, respectively (Table 2). The longest overlap (7 bp long) occurred between genes ATP8 and ATP6, and between genes ND4 and ND4L, while the biggest intergenic spacer (39 bp long) located between genes tRNA Glu and tRNA His. The overall A + T content was 73.04%

Fig. 2. Putative secondary structures of 22 tRNAs encoded by the mitochondrial genome of Scylla paramamosain.

124

H. Ma et al. / Gene 519 (2013) 120–127

Fig. 2 (continued).

(A = 34.87%; G = 10.16%; T = 38.17%; C = 16.80%) for the H-strand of mitochondrial genome of S. paramamosain, but variable in different regions (Table 3). The highest A + T content was detected in the putative control region (86.67%), whereas the lowest one was found in the protein-coding genes (70.88%). 3.3. Protein-coding genes and codon usage Of the 13 protein-coding genes, nine were encoded by the H-strand (COI, COII, COIII, ATP6, ATP8, ND2, ND3, ND6, Cyt b), and four were encoded by the L-strand (ND1, ND4, ND4L, ND5). These genes comprised 11,182 bp in total and coded 3715 amino acids. Four reading-frame overlaps were detected on the same strand (ATP6 and ATP8 shared seven nucleotides; ATP6 and COIII shared one nucleotide; ND4 and ND4L shared seven nucleotides; ND6 and Cyt b shared one nucleotide), no reading-frame overlaps on different strands were found. Two types of start codons (ATG and ATT) were observed in 13 protein-coding genes, of which ATG started 10 genes while ATT initiated three other genes (ATP6, ND1 and ND3). Twelve open-reading frames ended with TAA or TAG, whereas one had incomplete stop codon TA (COI). The highest A + T content was observed in ATP8 (78.40%), and the lowest one was detected in COI (65.86%). 3.4. Transfer RNA genes and ribosomal RNA genes A total of 22 tRNA genes were encoded by the complete mitochondrial genome of S. paramamosain, each of them folding into the typically clover-leaf secondary structure, except the gene tRNASer (AGN) that lacked the dihydrouracil (DHU) arm (Fig. 2). Fourteen tRNA genes were encoded by H-strand, while the remaining ones were encoded by L-strand. These 22 tRNA genes was totally 1482 bp in length, with each ranging from 63 (tRNAHis) to 73 bp (tRNAVal). All tRNA genes possessed common length of 7 bp for the aminoacyl stem, and invariable size of 7 bp for the anticodon loop. Variable nucleotide length of tRNA

was found for the DHU, TΨC and anticodon arms. All tRNA genes possessed the common anticodons in arthropod mitochondrial genomes, except that the genes tRNALys and tRNASer (AGN) possessed TTT and TCT anticodons but CTT and GCT, respectively. There were totally 13 unmatched base pairs in 22 tRNA genes (four A–A mismatches, three T–T mismatches, two T–C mismatches, two G–T mismatches and two A–C mismatches, respectively). The overall A + T content of 22 tRNA was 74.56%, with the biggest rate (85.07%) for tRNAAsp and the lowest rate (61.19%) for tRNALys. The 16S and 12S ribosomal RNA genes were 1340 and 869 bp in length. They located on the L-strand between the gene tRNA Leu (CUN) and the putative control region, being separated by the gene tRNA Val. The A + T content was 77.46% for 16S rRNA gene (A = 41.64%; G = 14.63%; T = 35.82%; C = 7.91%), and 75.72% for 12S rRNA gene (A = 39.59%; G = 15.42%; T = 36.13%; C = 8.86%), respectively. 3.5. Non-coding regions A total of 12 non-coding regions were identified between the coding regions in the mitochondrial genome of S. paramamosain. The largest one was located between the genes 12S rRNA and tRNA Ile with a length of 833 bp, and it was considered to be the putative control region. The other 11 non-coding regions were all small varying from 1 to 39 bp in length. The control region had a much higher A + T content of 86.67% than the overall value (73.04%) of the complete mitochondrial genome. Further, the nucleotide composition of the control region was 45.38% for A, 6.00% for G, 41.30% for T, and 7.32% for C, respectively. 3.6. Phylogenetic relationship The phylogenetic position of S. paramamosain within Decapoda was reconstructed using the 12 concatenated protein-coding genes. The phylogenetic tree was shown in Fig. 3 with high bootstrap supports. From the tree topologies, we can find that the molecular phylogenetic

H. Ma et al. / Gene 519 (2013) 120–127

125

Fig. 3. Phylogenetic relationships of Decapoda species based on 12 protein-coding genes using NJ method.

relationship of these 19 species of 11 genera was identical to the traditional taxonomy (Liu, 2008). Four species including S. paramamosain, S. tranquebarica, S. serrata and S. olivacea of genus Scylla formed a monophyletic group, suggesting the genetically nearest relationship between S. paramamosain and S. tranquebarica. Three species E. sinensis, E. hepuensis and E. japonica of genus Eriocheir formed a monophyletic group. And four shrimp species of M. japonicus, L. vannamei, F. chinensis and P. monodon of genus Penaeus formed a single group.

4. Discussion The complete mitochondrial genome DNA sequence of the mud crab (S. paramamosain) was 15, 824 bp in length, containing the same 13 protein-coding genes, 22 tRNA genes, two rRNA genes and one putative control region as found in other metazoan animals such as Parafronurus youi (Zhang et al., 2008), L. lutra (Ki et al., 2010) and C. japonica (Liu and Cui, 2010). Among Portunids, it was shorter than S. tranquebarica (15,833 bp), but longer than C. japonica (15,738 bp) (Table 4). The variations in size were mainly due to the notable length differences in control region. In addition, the total

length of mitochondrial genomes except control regions was nearly identical for the Portunids. Gene overlaps and intergenic spacers have been found common in Decapods (Liu and Cui, 2010; Shen et al., 2007; Yamauchi et al., 2003) and many other species (Cheng et al., 2012b; Ki et al., 2010; Yin et al., 2012). In this study, the number of gene overlaps (11) in the mitochondrial genome of S. paramamosain was more than that reported by now in most Decapods, whereas the number of intergenic spacers (12) was more than that (11) found in C. japonica (Liu and Cui, 2010), less than that (14) detected in L. vannamei (Shen et al., 2007), and identical with the 12 observed in P. trituberculatus (Yamauchi et al., 2003) and C. sapidus (Place et al., 2005). The overall A + T content (73.04%) for the H-strand of S. paramamosain was similar to that (73.80%) of S. tranquebarica, higher than that of most Decapods, and lower than that (74.90%) of G. dehaani (Table 4). As found in Decapods, the highest A + T content was detected in the control region (86.67%) of S. paramamosain. The relative positions of the 37 mitochondrial genes of S. paramamosain were absolutely identical to that so far reported in other Portunids, such as P. trituberculatus (Yamauchi et al., 2003) and C. japonica (Liu and Cui, 2010). Further, the gene order of

Table 4 Characteristics of mitochondrial genomes of Decapoda species. Species

Scylla paramamosain Scylla tranquebarica Scylla serrata Scylla olivacea Charybdis japonica Portunus trituberculatus Callinectes sapidus Eriocheir sinensis Pseudocarcinus gigas Geothelphusa dehaani Fenneropenaeus chinensis Litopenaeus vannamei

Heavy-strand

13 protein-coding genes

16S rRNA gene

12S rRNA gene

22 tRNA genes

Control region

Length (bp)

A+T (%)

No. of amino acid

A+T (%)

Length (bp)

A+T (%)

Length (bp)

A+T (%)

Length (bp)

A+T (%)

Length (bp)

A+ T (%)

JX457150 NC_012567 NC_012565 NC_012569 FJ460517 AB093006

15,824 15,833 15,775 15,723 15,738 16,026

73.04 73.80 72.50 69.40 69.20 70.20

3715 3716 3715 3715 3712 3715

70.88 72.00 70.70 67.30 67.80 68.80

1340 1339 1355 1337 1317 1332

77.46 77.10 76.50 74.40 74.20 73.80

869 869 874 852 834 840

75.72 75.90 74.80 72.40 70.30 70.10

1482 1486 1484 1482 1458 1468

74.56 74.40 74.10 72.30 70.90 72.00

833 854 786 778 863 1104

86.67 86.50 84.50 79.00 74.70 76.30

Present study Unpublished Unpublished Unpublished Liu and Cui (2010) Yamauchi et al. (2003)

NC_006281 NC_006992 NC_006891 NC_007379 DQ518969

16,263 16,354 15,515 18,197 16,004

69.10 71.70 70.50 74.90 68.90

3712 3718 3734 3711 3710

67.00 68.90 68.80 71.50 67.50

1323 1311 1324 1315 1367

71.80 77.40 74.90 77.10 72.70

785 899 821 821 852

70.30 76.60 73.80 76.40 69.90

1463 1473 1460 1519 1501

71.60 72.40 73.20 75.80 65.90

1435 896 593 514 997

78.20 83.10 80.30 87.20 82.30

Place et al. (2005) Sun et al. (2005) Miller et al. (2005) Segawa and Aotsuka (2005) Shen et al. (2007)

DQ534543

15,989

67.80

3710

66.10

1371

71.80

853

69.60

1493

65.30

998

82.50

Shen et al. (2007)

GenBank accession no.

Reference

126

H. Ma et al. / Gene 519 (2013) 120–127

S. paramamosain was largely consistent with that in most arthropods, except the relative position of gene tRNA His (Table 2, Fig. 1). In most arthropods, the typical position of tRNA His was located between genes NAD4 and NAD5, but in S. paramamosain it was found between genes tRNA Glu and tRNA Phe. The rearrangements of mitochondrial genes were relatively common events in Crustacea (Shen et al., 2007). For the protein-coding genes in genus Scylla, gene ND1 was located between genes Cyt b and ND2, but in genus Eriocheir, it translocated between genes ND3 and ND5, with the relative position of other protein-coding genes unchangeable. One most acceptable mechanism of mitochondrial gene rearrangements is tandem duplication of gene regions resulting from slipped-strand mispairing, followed by deletions of genes (Yamauchi et al., 2003). In this study, all 13 protein-coding genes started with the typical start codon ATN, whereas, twelve of them used the typical TAA or TAG as their stop codon, remaining COI gene ended with an incomplete stop codon TA. These variable start codons and incomplete stop codons are commonly found in many invertebrate mitochondrial genes. For example, there were two types of start codons (ATG and GTG) and four incomplete stop codons (T) in mitochondrial genes of Cranoglanis bouderius (Peng et al., 2006). Two types of start codons (ATG and GTG) and two incomplete stop codons (T) were detected in Lutjanus russellii (Guo et al., 2008). For incomplete stop codon, the complete one may be produced by posttranscriptional polyadenylation (Ojala et al., 1981). The gene tRNASer (AGN) lacked the dihydrouracil (DHU) arm that was also found in other Decapods, such as F. chinensis (Shen et al., 2007) and C. japonica (Liu and Cui, 2010). Moreover, the anticodons of genes tRNALys and tRNASer (AGN) were TTT and TCT, which differed from those (CTT and GCT) commonly found in most Decapods. The difference between both types of anticodons was found in the third wobble position of codons and it was further detected in P. trituberculatus (Yamauchi et al., 2003) and C. japonica (Liu and Cui, 2010). 5. Conclusion In conclusion, the complete mitochondrial genome DNA sequence of the mud crab (S. paramamosain) was determined in this study, which was 15,824 bp in length, including a typical set of 37 genes: 13 protein-coding genes, 2 rRNA genes and 22 tRNA genes, as well as a putative control region. This study will be of great importance for studies on population genetic structure, stock identification, evolution and phylogeny, and conservation genetics of S. paramamosain and the related crab species. Acknowledgments This study was supported by the National Non-Profit Institutes (East China Sea Fisheries Research Institute) (no. 2011M05), the National Natural Science Foundation of China (no. 31001106), and the Science and Technology Commission of Shanghai Municipality (no. 10JC1418600). References Boore, J.L., 1999. Animal mitochondrial genomes. Nucleic Acids Res. 27, 1767–1780. Brown, V.A., Brooke, A., Fordyce, J.A., McCracken, G.F., 2011. Genetic analysis of population of the threatened bat Pteropus mariannus. Conserv. Genet. 12, 933–941. Chen, F.Y., Liu, H.P., Bo, J., Ren, H.L., Wang, K.J., 2010. Identification of genes differentially expressed in hemocytes of Scylla paramamosain in response to lipopolysaccharide. Fish Shellfish Immunol. 28, 167–177. Cheng, J., Ma, G., Miao, Z., Shui, B., Gao, T., 2012a. Complete mitochondrial genome sequence of the spinyhead croaker Collichthys lucidus (Perciformes, Sciaenidae) with phylogenetic considerations. Mol. Biol. Rep. 39, 4249–4259. Cheng, R., Zheng, X., Lin, X., Yang, J., Li, Q., 2012b. Determination of the complete mitochondrial DNA sequence of Octopus minor. Mol. Biol. Rep. 39, 3461–3470. Cheng, Y., Xu, T., Shi, G., Wang, R., 2010. Complete mitochondrial genome of the miiuy croaker Miichthys miiuy (Perciformes, Sciaenidae) with phylogenetic consideration. Mar. Genomics 3, 201–209.

Estampador, E.P., 1949. Studies on Scylla (Crustacea: Portunidae) I. Revision of the genus. Philipp. J. Sci. 78, 95–108. Feldmeyer, B., Hoffmeier, K., Pfenninger, M., 2010. The complete mitochondrial genome of Radix balthica (Pulmonata, Basommatophora), obtained by low coverage shot gun next generation sequencing. Mol. Phylogenet. Evol. 57, 1329–1333. Feng, Y., Li, Q., Kong, L., Zheng, X., 2011. DNA barcoding and phylogenetic analysis of Pectinidae (Mollusca: Bivalvia) based on mitochondrial COI and 16S rRNA genes. Mol. Biol. Rep. 38, 291–299. Guo, Y., Wang, Z., Liu, C., Liu, Y., 2008. Sequencing and analysis of the complete mitochondrial DNA of Russell's snapper (L. russellii). Prog. Nat. Sci. 18, 1233–1238. Gvozdik, V., Moravec, J., Klutsch, C., Kotlik, P., 2010. Phylogeography of the Middle Eastern tree frogs (Hyla, Hylidae, Amphibia) as inferred from nuclear and mitochondrial DNA variation, with a description of a new species. Mol. Phylogenet. Evol. 55, 1146–1166. He, L., Zhang, A., Weese, D., Zhua, C., Jiang, C., Qiao, Z., 2010. Late Pleistocene population expansion of Scylla paramamosain along the coast of China: a population dynamic response to the Last Interglacial sea level highstand. J. Exp. Mar. Biol. Ecol. 385, 20–28. Imjongjirak, C., Amparyup, P., Tassanakajon, A., Sittipraneed, S., 2009. Molecular cloning and characterization of crustin from mud crab Scylla paramamosain. Mol. Biol. Rep. 36, 841–850. Keenan, C., Blackshaw, P.A., 1999. Mud crab aquaculture and biology. ACAIR Proceedings, 78. Watson Ferguson & Co, Australia. Keskin, E., Can, A., 2009. Phylogenetic relationships among four species and a sub-species of Mullidae (Actinopterygii; Perciformes) based on mitochondrial cytochrome B, 12S rRNA and cytochrome oxidase II genes. Biochem. Syst. Ecol. 37, 653–661. Ki, J., Hwang, D., Park, T., Han, S., Lee, J., 2010. A comparative analysis of the complete mitochondrial genome of the Eurasian otter Lutra lutra (Carnivora; Mustelidae). Mol. Biol. Rep. 37, 1943–1955. Kumar, S., Dudley, J., Nei, M., Tamura, K., 2008. MEGA: a biologist-centric software for evolutionary analysis of DNA and protein sequences. Brief. Bioinform. 9, 299–306. Lee, K.E., et al., 2010. Genetic variation and structuring in the threatened koala populations of Southeast Queensland. Conserv. Genet. 11, 2091–2103. Lei, R., et al., 2010. Complete sequence and gene organization of the mitochondrial genome for Hubbard's sportive lemur (Lepilemur hubbardorum). Gene 464, 44–49. Liu, J.Y., 2008. Checklist of Marine Biota of China Seas. Science Press, Beijing. Liu, Y., Cui, Z.X., 2009. The complete mitochondrial genome sequence of the cutlassfish Trichiurus japonicas (Perciformes: Trichiuridae): Genome characterization and phylogenetic considerations. Mar. Genomics 2, 133–142. Liu, Y., Cui, Z.X., 2010. Complete mitochondrial genome of the Asian paddle crab Charybdis japonica (Crustacea: Decapoda: Portunidae): gene rearrangement of the marine brachyurans and phylogenetic considerations of the decapods. Mol. Biol. Rep. 37, 2559–2569. Lowe, T.M., Eddy, S.R., 1997. tRNAscan-SE: a program for improved detection of transfer RNA genes in genomic sequence. Nucleic Acids Res. 25, 955–964. Ma, H.Y., Ma, C.Y., Ma, L.B., 2011a. Population genetic diversity of mud crab (Scylla paramamosain) in Hainan Island of China based on mitochondrial DNA. Biochem. Syst. Ecol. 39, 434–440. Ma, H.Y., Ma, C.Y., Ma, L.B., Zhang, F.Y., Qiao, Z.G., 2011b. Isolation and characterization of 54 polymorphic microsatellite markers in Scylla paramamosain by FIASCO approach. J. World Aquacult. Soc. 42, 591–597. Ma, H.Y., Ma, Q.Q., Ma, C.Y., Ma, L.B., 2011c. Isolation and characterization of genederived single nucleotide polymorphism (SNP) markers in Scylla paramamosain. Biochem. Syst. Ecol. 39, 419–424. Ma, H.Y., Ma, C.Y., Ma, L.B., 2012a. Molecular identification of genus Scylla (Decapoda: Portunidae) based on DNA barcoding and polymerase chain reaction. Biochem. Syst. Ecol. 41, 41–47. Ma, H.Y., et al., submitted for publication. Transcriptome analysis in mud crab (Scylla paramamosain) using 454 deep sequencing: assembly, annotation and markers discovery. J. Bio. Chem. Ma, H.Y., Cui, H.Y., Ma, C.Y., Ma, L.B., 2012b. High genetic diversity and low differentiation in mud crab (Scylla paramamosain) along the southeastern coast of China revealed by microsatellite markers. J. Exp. Biol. 215, 3120–3125. Ma, H.Y., Yang, J.F., Su, P.Z., Chen, S.L., 2009. Genetic analysis of gynogenetic and common populations of Verasper moseri using SSR markers. Wuhan Univ. J. Nat. Sci. 14, 267–273. Ma, L.B., Zhang, F.Y., Ma, C.Y., Qiao, Z.G., 2006. Scylla paramamosain (Estampador) the most common mud crab (Genus Scylla) in China: evidence from mtDNA. Aquac. Res. 37, 1694–1698. Miller, A.D., Murphy, N.P., Burridge, C.P., Austin, C.M., 2005. Complete mitochondrial DNA sequences of the decapod crustaceans Pseudocarcinus gigas (Menippidae) and Macrobrachium rosenbergii (Palaemonidae). Mar. Biotechnol. 7, 339–349. Miya, M., Nishida, M., 2000. Use of mitogenomic information in teleostean molecular phylogenetics: a tree-based exploration under the maximum-parsimony optimality criterion. Mol. Phylogenet. Evol. 17, 437–455. Nakao, M., Yokoyama, N., Sako, Y., Fukunaga, M., Ito, A., 2002. The complete mitochondrial DNA sequence of the cestode Echinococcus multilocularis (Cyclophyllidea: Taeniidae). Mitochondrion 1, 497–509. Ojala, D., Montoya, J., Attardi, G., 1981. tRNA punctuation model of RNA processing in human mitochondria. Nature 290, 470–474. Peng, Z., Wang, J., He, S., 2006. The complete mitochondrial genome of the helmet catfish Cranoglanis bouderius (Siluriformes: Cranoglanididae) and the phylogeny of otophysan fishes. Gene 376, 290–297. Perrine, D., 1979. The Mangrove Crab on Ponape. Marine Resources Division, Ponape Eastern Caroline Islands (88 pp). Place, A.R., Feng, X., Steven, C.R., Fourcade, H.M., Boore, J.L., 2005. Genetic markers in blue crabs (Callinectes sapidus) II. Complete mitochondrial genome sequence and characterization of genetic variation. J. Exp. Mar. Biol. Ecol. 319, 15–27.

H. Ma et al. / Gene 519 (2013) 120–127 Segawa, R.D., Aotsuka, T., 2005. The mitochondrial genome of the Japanese freshwater crab, Geothelphusa dehaani (Crustacea: Brachyura): evidence for its evolution via gene duplication. Gene 355, 28–39. Shen, X., et al., 2007. The complete mitochondrial genomes of two common shrimps (Litopenaeus vannamei and Fenneropenaeus chinensis) and their phylogenomic considerations. Gene 403, 98–109. Shen, X., et al., 2009. Complete mitochondrial genome of the sea cucumber Apostichopus japonicas (Echinodermate: Holothuroidea): the first representative from the subclass Aspidochirotacea with the echinoderm ground pattern. Gene 439, 79–86. Shen, Y., Lai, Q., 1994. Present status of mangrove crab (Scylla serrata (Forskal)) culture in China. NAGA: the ICLARM Quarterly, January 28–29. Sun, H., Zhou, K., Song, D., 2005. Mitochondrial genome of the Chinese mitten crab Eriocheir japonica sinenesis (Brachyura: Thoracotremata: Grapsoidea) reveals a novel gene order and two target regions of gene rearrangements. Gene 349, 207–217. Takano, M., et al., 2005. Isolation and characterization of microsatellite DNA markers from mangrove crab, Scylla paramamosain. Mol. Ecol. Notes 5, 794–795.

127

Wilson, K., Cahill, V., Ballment, E., Benzie, J., 2000. The complete sequence of the mitochondrial genome of the crustacean Penaeus monodon: are malacostracan crustaceans more closely related to insects than to branchiopods. Mol. Biol. Evol. 17, 863–874. Xu, J., Chan, T.Y., Tsang, L.M., Chu, K.H., 2009. Phylogeography of the mitten crab Eriocheir sensus tricto in East Asia Pleistocene isolation, population expansion and secondary contact. Mol. Phylogenet. Evol. 52, 45–56. Yamauchi, M.M., Miya, M.U., Nishida, M., 2003. Complete mitochondrial DNA sequence of the swimming crab, Portunus trituberculatus (Crustacea: Decapoda: Brachyura). Gene 311, 129–135. Yin, H., Zhi, Y., Jiang, H., Wang, P., Yin, X., Zhang, D., 2012. The complete mitochondrial genome of Gomphocerus tibetanus Uvarov, 1935 (Orthoptera: Acrididae: Gomphocerinae). Gene 494, 214–218. Zhang, J., Zhou, C., Gai, Y., Song, D., Zhou, K., 2008. The complete mitochondrial genome of Parafronurus youi (Insecta: Ephemeroptera) and phylogenetic position of the Ephemeroptera. Gene 424, 18–24.