- Email: [email protected]
The mitochondrial genome of the spinyhead croaker Collichthys lucida: Genome organization and phylogenetic consideration
Marine Genomics 4 (2011) 17–23
Contents lists available at ScienceDirect
Marine Genomics j o u r n a l h o m e p a g e : w w w. e l s ev i e r. c o m / l o c a t e / m a r g e n
The mitochondrial genome of the spinyhead croaker Collichthys lucida: Genome organization and phylogenetic consideration Yuanzhi Cheng, Rixin Wang, Tianjun Xu ⁎ Key Laboratory for Marine Living Resources and Molecular Engineering, College of Marine Science, Zhejiang Ocean University, Zhoushan 316000, PR China
a r t i c l e
i n f o
Article history: Received 10 November 2010 Received in revised form 1 December 2010 Accepted 3 December 2010 Available online 3 January 2011 Keywords: Collichthys lucida Complete mitochondrial genome Percoidei Phylogeny
a b s t r a c t The complete mitochondrial genome of the spiny head croaker Collichthys lucida was determined in the present study. The mitochondrial DNA was 16,442 base pairs in length, and contained 13 protein coding genes, 22 transfer RNAs, 2 ribosomal RNAs, and one major non-coding control region, with the content and order of genes being similar to those in typical teleosts. Most of the genes of C. lucida were encoded on the Hstrand, while the ND6 and eight tRNA (Gln, Ala, Asn, Cys, Tyr, Ser (UCN), Glu and Pro) genes were encoded on the L-strand. The reading frames of two pairs of genes overlapped: ATPase 8 and 6 and ND4L and ND4 by ten and seven nucleotides, respectively. The control region was unusually short at only 768 bp, and absence of typical conserved blocks (CSB-D, CSB-E, and CSB-F). Phylogenetic analyses indicated that C. lucida was located in the cluster of fish species from the family Sciaenidae, supporting the traditional taxonomic classification of fish, and in the cluster of Serranidae, the divergence time in Plectropomus leopardus is longer than that among its coordinal species. On the other hand, phylogenetic analyses do not support the monophyletic of family Centracanthidae and genera Larimichthys and Collichthys, which is against the morphological results. © 2010 Elsevier B.V. All rights reserved.
1. Introduction The fish mitochondrial genome is a small, double stranded and circular DNA molecular, and is almost exclusively maternally inherited. In general, the size of mitochondrial genome is approximately 15 to 20 kb and it contains 13 protein-coding genes, 2 ribosomal RNAs (12S rRNA and 16S rRNA), 22 transfer RNAs (tRNAs), a major non-coding region that contains the initial sites for mitochondrial DNA replication and RNA transcription (Boore, 1999). Fish mitochondrial DNA also has a genomic organization similar to other vertebrates (Kartavtsev et al., 2007). Because of constant gene content, multiple copy status in a cell, lack of recombination and paralogous genes, mitochondrial DNA has been an important model system for studying molecular evolution, phylogeny and genome structure (Curole and Kocher, 1999; Podsiadlowski et al., 2007). The spiny head croaker Collichthys lucida, a small sized bottomdwelling food fish, is widely distributed from the Yellow Sea to South China Sea. The C. lucida fishing season begins in April, and runs until September (Zhu et al., 1963). Over the past 20 years, resources of C. lucida have declined rapidly as a result of over-fishing and environment change (Cheng, 2000). During the past decade, intensive studies have been carried out in the areas of catch statistics, size composition, early life history, and morphological variation (Shan et al., 2007; Liao et al., 2009; Huang et al., 2010). However, much more work needs to develop
plans for rational utilization and resources management. Mitochondrial DNA marker has become very useful in population genetic structures and phylogenetic studies (Perdices et al., 2004; Jondeung et al., 2006; Zhang et al., 2009). Further studies of genetic characteristics of C. lucida based on new and multiple mitochondrial gene markers are worth performing to tackle this problem. The family Sciaenidae is one of the largest within the Perciformes, with approximately 270 species in about 70 genera (Nelson, 2006). To date, only four complete mitochondrial genome sequences for the family Sciaenidae have been represented in GenBank. The aim of this study was to obtain new sequence data of C. lucida for future uses in population genetic structures and phylogenetic studies of Sciaenidae. We present the first complete mitochondrial genome sequence of this species. We characterized its gene organization, a putative structure of the control region of C. lucida and compared it with the other four Sciaenidae species mitochondrial genome sequences. Finally, we constructed a ML tree using 45 species representing 21 families to examine the evolutionary position of C. lucida and infer the phylogenetic relationships of Percoidei species. All information reported in this article may facilitate further investigation of the molecular evolution of Sciaenidae. 2. Materials and methods 2.1. Sample collection and DNA isolation
⁎ Corresponding author. College of Marine Science, Zhejiang Ocean University, 316000 Zhoushan, Zhejiang province, PR China. Tel./fax: + 86 580 2550826. E-mail address: [email protected] (T.J. Xu). 1874-7787/$ – see front matter © 2010 Elsevier B.V. All rights reserved. doi:10.1016/j.margen.2010.12.001
The specimen of C. lucida captured from the wild was obtained from a local fish market in China, and the whole tail fin was immediately
18
Y. Cheng et al. / Marine Genomics 4 (2011) 17–23
preserved in 100% ethanol. Total genomic DNA was isolated using a traditional phenol-chloroform method (Sambrook and Russell, 2001) and kept at −20 °C. 2.2. PCR amplification and sequencing
Table 2 Species used in this study. Order
Family
Species
Accession number
Perciformes
Caesionidae Centracanthidae Centrarchidae
Pterocaesio tile Spicara maena Micropterus dolomieu Micropterus salmoides Lates calcarifer Chaetodon auripes Heniochus diphreutes Emmelichthys struhsakeri Enoplosus armatus Kuhlia mugil Kyphosus cinerascens Labracoglossa argentiventris Scorpis lineolata Lethrinus obsoletus Monotaxis grandoculis Lutjanus malabaricus Lutjanus rivulatus Lutjanus sebae Monodactylus argenteus Oplegnathus fasciatus Oplegnathus punctatus Etheostoma radiosum Percina macrolepida Centropyge loricula Chaetodontoplus septentrionalis Diagramma pictum Parapristipoma trilineatum Collichthys niveatus Larimichthys crocea Larimichthys polyactis Miichthys miiuy Collichthys lucida Anyperodon leucogrammicus Epinephelus akaara Epinephelus bruneus Epinephelus coioides Epinephelus septemfasciatus Plectropomus leopardus Acanthopagrus latus Pagellus bogaraveo Pagrus auriga Pagrus major Parargyrops edita Rhynchopelates oxyrhynchus Toxotes chatareus Myxocyprinus asiaticus
AP004447 AP009164 AB378749 DQ536425 DQ010541 AP006004 AP006005 NC_004407 AP006008 AP011065 AP011061 AP011062 AP011063 AP009165 NC_010957 FJ824741 AP006000 FJ824742 AP009169 AP006010 AP011066 AY341348 DQ536430 AP006006 AP006007 AP009167 AP009168 HM219223 EU339149 GU586227 HM447240 NC_014350 GQ131336 EU043377 FJ594964 EU043376 NC_013829 DQ101270 EF506764 AB305023 AB124801 AP002949 EF107158 AP011064 AP006806 AP006764
12 pairs of primers (Table 1) were designed, based upon the reported complete mitochondrial genome sequences for the Larimichthys crocea, Larimichthys polyactis, C. niveatus, Miichthys miiuy (Cui et al., 2009; NC_013754; HM219223; NC_014351). PCR was conducted on a PTC-200 using the following program: predenaturation at 94 °C for 4 min; 35 cycles of denaturation at 94 °C for 50 s, annealing at 60 °C for 60 s, extension at 72 °C for 2–3 min; and final extension at 72 °C for 10 min. Each PCR reaction volume contained 0.2 μM of each primers, 5.0 μl of 10 × Taq Plus polymerase buffer, 0.2 mM dNTPS, 2 unit of Taq Plus DNA polymerase with proof-reading characteristic (TIANGEN), and 1 μl of DNA template. The PCR products were electrophoresed on a 1% agarose gel to check the integrity and were visualized by the Molecular Imager Gel Doc XR system (BioRad, USA). The PCR products were purified using a QIAEX II Gel Extraction Kit (Qiagen). The purified DNA was then sequenced on ABI 3730, where the same PCR primers were used.
Centropomidae Chaetodontidae Emmelichthyidae Enoplosidae Kuhliidae Kyphosidae
Lethrinidae Lutjanidae
Monodactylidae Oplegnathidae Percidae
2.3. Genome annotation and sequence analysis
Pomacanthidae
The Sequencher™ (Gene Code, Ann Arbor, MI, USA) program was used for editing and assembling the contiguous, overlapping sequences. The primary DNA sequence data were characterized using BLAST searches at NCBI. The different genes were identified by sequence comparison with croaker homologues. In addition, the 13 protein-coding genes were predicted using the start codon and the stop codons whereas the 22 tRNA genes were recognized by their capability to fold into cloverleaf secondary structures, and the presence of specific anticodons. The complete nucleotide sequence of the C. lucida mitogenome has been deposited in GenBank, which can be accessed with Accession number NC_014350. The mitochondrial genome DNA sequences of 45 fish species belonging to 21 families (Table 2) were selected and used to construct phylogenetic trees to predict the evolutionary position of C. lucida within the Percoidei. Analysis was based on complete 16 S rRNA gene sequences. All the nucleotides were subjected to alignments using
Pomadasyidae Sciaenidae
Serranidae
Sparidae
Cypriniformes
Terapontidae Toxotidae Catostomidae
Table 1 PCR primers in the analysis of the C. lucida mitochondrial genome. Primer
Sequence (5′-3′)
CL-1F CL-1R CL-2F CL-2R CL-3F CL-3R CL-4F CL-4R CL-5F CL-5R CL-6F CL-6R CL-7F CL-7R CL-8F CL-8R CL-9F CL-9R CL-10F CL-10R CL-11F CL-11R CL-12F CL-12R
GGAGGATTTAGCAGTAAGCAG AGACATTAGGACAGGGTTCAGT AATCTCCCTCGTGGCAGTAA GGTCAAAGCCGCATTCATAG CCAACCTTATGGCAGAACTAA GCCTATGGATACAAAGAAAACGACT GCTACCTCCTTTACAGCCATTT GTGTCCGAGTTTAGACCCAGT AACCAACCATAGCCCACGACA ATTCATTTCCCAGGCAACCAG GACATTGGCACCCTCTATCTAA AGGCAAGGTCTTCGTAATCAGT TCATCATCGGCTCTACATTCCTG GGCGAGACTGGCAATAAATCATC AAACTACGAACGAACGCACAG GAAGGATATGATTCCGACACC CCTATTTACCGCTACCTGTGC ACGGATGAGAAGGCTATGGA ATAAAGACCCGTATGAATGGC ATGAGCGGTAAGATAGCAAGG CCCTCCAACTCCTTAGAAAAG GGTGACCGAAGAATCAGAATA TGGAGGCATACCAGTAGAACAC CACTCTTTACGCCGTTGACTAT
Clustal X with default settings (Thompson et al., 1997), and then the sequences were checked and adjusted manually. For these data sets, the model GTR + I + G was selected for ML analyses by ModelTest 3.7 (Posada and Crandall, 1998). ML analyses were conducted using PhyML 3.0 (Guindon and Gascuel, 2003), 1000 bootstraps were used to estimate the node reliability (Felsenstein, 1985). 3. Results and discussion The complete mitochondrial DNA sequence of C. lucida was determined to be 16, 442 bp long, which is nearly identical to those of other Sciaenidae species in length with only a few base variations. The number and size of non-coding spacer and the length of main non-coding regions are responsible for the length variations of mitogenomes in species. The new sequence included two ribosomal RNA genes, 13 protein-coding genes, 22 transfer RNA genes, and a putative control region (Table 3 and Fig. 1). It is obvious that the gene distribution are the same as those of other fish mitochondrial genomes, and most of these genes are encoded on the H-strand, except for the ND6 gene and eight tRNA genes, which are encoded on the L-strand. The overall base composition of L-strand is as follows: T
Y. Cheng et al. / Marine Genomics 4 (2011) 17–23
19
Table 3 Characteristics of the mitochondrial genome of C. lucida. Gene
tRNA-Phe 12S rRNA tRNA-Val 16S rRNA tRNA-Leu-(UUR) ND1 tRNA-Ile tRNA-Gln tRNA-Met ND2 tRNA-Trp tRNA-Ala tRNA-Asn tRNA-Cys tRNA-Tyr COX1 tRNA-Ser-(UCN) tRNA-Asp COX2 tRNA-Lys ATPase8 ATPase6 COX3 tRNA-Gly ND3 tRNA-Arg ND4L ND4 tRNA-His tRNA-Ser-(AGY) tRNA-Leu-(CUN) ND5 ND6 tRNA-Glu Cytb tRNA-Thr tRNA-Pro Control Region
Position
Size (bp)
From
To
Nucleotide
1 70 1017 1089 2786 2860 3839 3908 3979 4049 5095 5167 5238 5348 5415 5487 7039 7114 7191 7882 7958 8116 8799 9584 9655 10004 10073 10363 11744 11813 11885 11958 13793 14312 14385 15526 15600 15672
69 1016 1087 2784 2859 3834 3908 3979 4048 5094 5165 5235 5310 5415 5484 7043 7110 7182 7881 7956 8125 8799 9583 9654 10003 10072 10369 11743 11812 11879 11957 13796 14311 14380 15525 15597 15669 16442
69 947 71 1696 74 975 70 72 70 1046 71 69 73 68 70 1557 72 69 691 75 168 684 785 71 349 69 297 1381 69 67 73 1839 519 69 1141 72 70 771
Codon Amino acid
Initiation
Intergenic nucleotideI
Strand
0 0 1 1 0 4 −1 −1 0 −1 1 2 37 −1 2 −5 3 8 0 1 − 10 −1 0 0 0 0 −7 0 0 5 0 −4 0 4 0 2 2
H H H H H H H L H H H L L L L H L H H H H H H H H H H H H H H H H L H H L
StopI
324
ATG
TAG
348
ATG
TA-
518
ATG
AGA
230
ATG
T–
55 227 261
ATG ATG ATG
TAA TAA TA-
116
ATG
T–
98 460
ATG ATG
TAA T–
612 172
ATG ATG
TAA TAA
380
ATG
T–
I
TA- and T– represent incomplete stop codons. Numbers correspond to the nucleotides separating adjacent genes. Negative numbers indicate overlapping nucleotides.
II
(25.6%), A (28.0%), C (30.7%), G (15.7%), and the A + T content (53.6%) is similar to those of other croakers (from 51.9% to 53%) (Table 4). As in most vertebrates, the overall base compositions are skewed against G in mitochondrial genomes, which is due to a strong bias against the use of G at the third codon position (Miya and Nishida, 1999; Peng et al., 2006). All expected 13 large open reading frames were detected in the mitochondrial genome of C. lucida. Just like in the mitochondrial genome of other vertebrates except for lamprey (Lee and Kocher, 1995), there are two cases of reading frame overlap in two genes encoded by the same strand (ATPase 8 and 6 overlap by 10 bp, ND4L and ND4 overlap by 7 bp). The T:C:A:G base composition of the mitochondrial 13 protein-coding gene sequence is 27.7:31.6:25.3:15.4 and is summarized in Table 4. As expected, an anti-G bias at 15.4% is observed in the third codon position, which is typical in vertebrates (Ponce et al., 2008; Liu and Cui, 2009). The A + T composition at the first codon position is 46.8%. The values for the second and third codon positions are 58.3% and 53.8, respectively. The A + T composition of the second codon position is relatively higher than most Percoidei fishes, and the primidines at this codon position are overrepresented in comparison with purines, owing to hydrophobic character of the proteins (Naylor et al., 1995). All protein-coding genes had a methionine (ATG) start codon. Variance in termination codons seems to be a common tendency in fish mitogenomes (Miya et al., 2003; Manchado et al., 2004). Seven protein-coding genes in C. lucida mitogenome ended with complete
termination codons, TAA (ATPase8, ATPase6, ND4L, ND5, and ND6), TAG (ND1) and AGA (COI), the remaining 6 genes ended with incomplete termination codons, either TA (ND2, CO3) or T (CO2, ND3, ND4, and Cytb) (Table 3). For those genes with incomplete stop codon, the transcripts would be modified to form complete termination signal UAA via post-transcriptional polyadenylation (Ojala et al., 1981). In total, 3801 codons in 13 protein-coding genes are identified in C. lucida mitogenome excluding stop codons (Table 5). For amino acids with fourfold degenerate third position, codons ended in C were the most frequent, followed by codon families ended in A and T. However, for arginine, A was more frequent than C. Among twofold degenerate codons, C appeared to be used more than T in pyrimidine codon families, whereas purine codons encoded mostly with A. In accord with the overall G-bias, G was the least common third position nucleotide in all codons except for glycine. Leucine was the most frequent amino acid, alanine is the second most amino acid, and cystine was the least frequent. CUC was the most frequently used codon (199/3801), CCG is the least frequently used codon (5/3801), this codon usage bias might be associated with the available tRNAs in organism. Although most of these features are similar to other fish species, small differences of codon usage and relative synonymous codon usage in the 13 protein-coding genes were still detected among reported croakers (data not shown), which might reflect that different organisms having selection act on their codon usage can have different preferred codons, as reported in Ikemura (1985). In addition, we compared predicted star and stop codons of protein genes among
20
Y. Cheng et al. / Marine Genomics 4 (2011) 17–23
Fig. 1. Gene map of mitochondrial genome of the spiny head croaker, C. lucida (Perciformes, Sciaenidae). Gene encoded on the heavy or light strands are shown outside or inside the circle gene map, respectively. Inner ring displays the GC content.
Percoide species available in GenBank, and found that most of the genes have one preferable type of star/stop codon usage. However, COI has two types of star/stop codon usage. COI proteins in Sciaenidae fishes mitochondrial DNA possessed ATG/AGA as initiation and termination codons, whereas in other Percoidei fishes, this is not the case (they possessed GTG/TAA as most common, GTG/AGG or GTG/T– are rarely used). Studies in insects have shown the existence of positive correlation between the incidence of canonical initiation and termination codons and relative rate of the gene evolution (Szafranski, 2009). It is needed to confirm whether this relationship also applies to fish. Although putative gene boundaries for the two rRNA genes in the genome have been found, these cannot be accurately determined until transcript mapping is carried out. The 12S and 16S rRNA genes Table 4 The base compositions of the C. lucida mitochondrial genome.
Protein coding 1st 2nd 3rd Total tRNAs rRNAs Control region Overall
T
C
A
G
A+T
21 40 22 27.7 26.5 20.5 31.1 25.6
28.6 27.6 38.6 31.6 23.0 26.3 23.9 30.7
25.8 18.3 31.8 25.3 28.1 33.0 31.6 28.0
25.0 13.7 7.4 15.4 22.5 20.1 13.4 15.7
46.8 58.3 53.8 53.0 54.6 53.5 62.7 53.6
encoded on the sense strand were located between tRNA-Phe and tRNA-Leu-UUR, being separated by the tRNA-Val gene. Being 947 and 1696 bp long, respectively, the two rRNA genes were conserved either in A + T content or gene length and locations, compared with those of other genes reported for Sciaenidae and similar to other reported vertebrates. However, both of the rRNA genes including numerous substitutions among fish species suggest the possibility of using these rRNA genes for phylogeny (Kartavtsev et al., 2007). 22 tRNA genes were identified from the mitochondrial genome of C. lucida by comparing with the homologues of other Percoidei species and by the software tRNAScan-SE1.21, which were interspersed between rRNA and protein-coding genes, ranged from 67 (tRNA-Ser-AGY) to 75 (tRNA-Lys) nucleotides long. As reported in some other vertebrates (Kim and Lee, 2004; Oh et al., 2007), all tRNA genes can be folded into typical cloverleaf secondary structures with the known exception of tRNA-Ser-AGY gene. In tRNA-Ser-AGY gene, a complete DHU arm is missing, and the unpaired replacement for the DHU arm is included (Masayuki et al., 2001). Aberrant tRNA can also fit the ribosome by adjusting its structural conformation and function in a similar way to that of usual tRNAs in the ribosome (Ohtsuki et al., 2002). As in most vertebrates, the major non-coding region in C. lucida mitochondrial genome is located between tRNA-Pro and tRNA-Phe. It was determined to be 771 bp in length, shorter than other analyzed Sciaenidae species, and it had an overall base composition that is rich in A and T (A + T = 62.7%). The control region is characterized by discrete and conserved sequence blocks (Lin et al., 2006). By comparing with the recognition sites in Percoidei fishes, conserved
Y. Cheng et al. / Marine Genomics 4 (2011) 17–23 Table 5 Codon usage in C. lucida mitochondrial protein-coding genes. Amino Acid
Codon
Count/Frequences (%)
Amino Acid
Codon
Number/Frequences (%)
Phe
TTT TTC TTA TTG CTT CTC CTA CTG ATT ATC ATA ATG GTT GTC GTA GTG TCT TCC TCA TCG CCT CCC CCA CCG ACT ACC ACA ACG GCT GCC GCA GCG
102/2.7 132/3.5 86/2.3 20/0.5 147/3.9 199/5.2 181/4.8 50/1.3 160/4.2 116/3.1 92/2.4 62/1.6 49/1.3 66/1.7 55/1.4 23/0.6 36/0.9 65/1.7 62/1.6 12/0.3 38/1.0 132/3.5 50/1.3 5/0.13 63/1.7 128/3.4 119/3.1 6/0.15 59/1.6 174/4.6 92/2.4 12/0.3
Tyr
TAT TAC TAA TAG CAT CAC CAA CAG AAT AAC AAA AAG GAT GAC GAA GAG TGT TGC TGA TGG CGT CGC CGA CGG AGT AGC AGA AGG GGT GGC GGA GGG
39/1.0 68/1.8 5/0.13 1/0.03 30/0.8 81/2.1 93/2.4 7/0.2 43/1.1 79/2.1 61/1.6 6/0.2 27/0.7 48/1.3 85/2.2 19/0.5 7/0.2 23/0.6 107/2.8 14/0.4 9/0.2 16/0.4 47/1.2 7/0.2 9/0.2 39/1.0 1/0.03 0/0 31/0.8 107/2.8 69/1.8 37/1.0
Leu
Ile Met Val
Ser
Pro
Thr
Ala
stopI His Gln Asn Lys Asp Glu Cys Trp Arg
Ser stop Gly
I
The incomplete T or TA of the termination codon is not included.
sequence blocks CSB-1, CSB-2, and CSB-3, which are thought to be involved in positioning RNA polymerase both for transcription and for priming replication (Clayton, 1991; Shadel and Clayton, 1997), were found in C. lucida, no CSB-D, -E, and -F were identified (Fig. 2). The lack of the typical sequences of these conserved blocks was previously confirmed in the L. crocea, L. polyactis, and C. niveatus (Cui et al., 2009; HM219223). However, C. lucida also contain a GTGGA box which is a typical characteristic of CSB-E in vertebrates. Although the segments corresponding to the CSB-D, -E and -F are absent in Larimichthys and Collichthys, the typical tripartite structure with ETAS, central and CSB domains of control region can be identified in sinipercine fishes (Zhao et al., 2006) and also in other Percoidei species such as Lates calcarifer (Lin et al., 2006) and Pagellus bogaraveo (Ponce et al., 2008). Such
21
variations imply a rapid evolving structure of control region; in combination with more sequences of fishes it will be useful to dissect the structure–function relationships of the control region. 14 other non-coding regions with a total of 73 bp long sequences were detected in the mtDNA genome of C. lucida. The 37 bp fragment of the putative origin of light strand replication (OL), as in most vertebrates, is located in a cluster of five tRNA genes (WANCY region) between tRNA-Asn and tRNA-Cys. As was expected, this region has the potential to fold into a stable stem-loop secondary structure that is generally a characteristic of the origin of light strand replication (Kawaguchi et al., 2001). The loop of OL is usually T-rich in mammalian, amphibian, or reptilian (Wong and Clayton, 1985; Macey et al., 1997; Mauro et al., 2004) and C-rich in most reported fish (Taanman, 1999; Ponce et al., 2008). C. lucida possessed a common C-rich loop, similar to L. arimichthys crocea, L. arimichthys polyactis, and Collichthys niveatus. However, its coordinal species M. iichthys miiuy had a A + G-rich loop (Cheng et al., 2010) and T-rich loop was also detected in Scombridae fishes (NC_005313, NC_005318, and NC_005316). Such variation of loop may associate with the evolutionary pattern of species and may affect its function. Further information mining of more fish species may be useful to elucidate the possible action of multiple molecular mechanisms in the evolution of OL and gene content and arrangement in the WANCY region of teleosts (Ponce et al., 2008). The sequence 5′GCCGG-3′ is exactly shown at the base of the stem within the tRNA-Cys gene. It was described necessarily for the replication of light-strand (Hixson et al., 1986). The remaining eight noncoding regions were located between protein-coding genes and tRNA genes and between tRNA genes with a range from 1 to 8 bp, respectively (Table 3). Phylogenetic analyses were used to examine the evolutionary position of the phylogenetic relationships among Percoidei species. The tree included 45 species belonging to 21 families. Fig. 3 shows a ML tree based on phylogenetic analysis of complete 16S rRNA gene sequences. The tree was rooted by a fish species belonging to the order Cypriniformes. Consistent with the traditional systematic classification (Nelson, 2006), most fish families were reconstructed as monophyletic. C. lucida was clustered with the other croakers from the family Sciaenidae, supporting the traditional taxonomic classification. The trees constructed in this study are similar to the one reported by Cui et al. (2009). We have noticed that the branch length of Plectropomus leopardus was much longer than its coordinal species in the cluster of Serranidae, suggesting that the divergence time in P. leopardus is longer than that among its coordinal species in Serranidae. Spicara maena is not monophyletic in our analyses. It was grouped in a cluster containing fish from the family Sparidae, which is in disagreement with its traditional position and the evolutionary position of family Centracanthidae deserves to be further studied.
Fig. 2. The complete sequence of mitochondrial control region of C. lucida. ETAS: extended termination associated sequence; CSB-1, -2, -3: conserved sequence blocks 1, 2 and 3. The motif (TAS: TACAT) is underlined. GTGGAG motif is shadowed.
22
Y. Cheng et al. / Marine Genomics 4 (2011) 17–23
Fig. 3. Phylogenetic tree of the Percoidei based on the ML analysis of complete 16S rRNA gene sequences. Myxocyprinus asiaticus was used as an outgroup. The numbers on the branches are bootstrap values.
Members of the Sciaenidae live in marine, brackish and freshwater habitats along the Atlantic, Indian and Pacific coasts. China has the highest number of species in the family, with about 30 species in 17 genera. Based on our analysis, C. niveatus is found to be most closely related to L. polyactis, the two species were grouped with L. crocea and
then grouped with C. lucida, and this topology is nearly identical to our previous analyses using COI and Cytb gene sequences. However, the Percoidei is the largest suborder of the Perciformes and comparises 3176 species in 79 families (Nelson, 2006), and the sequences of most of these species are not available. It is impossible to know the details
Y. Cheng et al. / Marine Genomics 4 (2011) 17–23
of their evolutionary relationships; therefore more complete mitochondrial DNA should be sequenced. Acknowledgments This study was supported by Nation Nature Science Foundation of China (31001120), Zhejiang Provincial Natural Science Foundation of China (Y3100013), National sparking plan project (2010GA700010), Seeding Grants Programs of Science and Technology Commission Foundation of Zhejiang Province and Open Foundation from Ocean Fishery Science and Technology in the Most Important Subjects of Zhejiang (20100209). References Boore, J.L., 1999. Animal mitochondrial genomes. Nucleic Acids Res. 27, 1767–1780. Cheng, J.S., 2000. The structure and diversity of demersal fish communities in winter in the East China Sea and the yellow sea. Mar. Fish. Res. 3, 1–8 (in Chinese with an English abstract). Cheng, Y.Z., Xu, T.J., Shi, G., Wang, R.X., 2010. Complete mitochondrial genome of the miiuy croaker Miichthys miiuy (Perciformes, Sciaenidae) with phylogenetic consideration. Mar. Genomics 3, 201–209. Clayton, D.A., 1991. Nuclear gadgets in mitochondrial DNA replication and transcription. Trends Biochem. Sci. 16, 107–111. Cui, Z.X., Liu, Y., Li, C.P., You, F., Chu, K.H., 2009. The complete mitochondrial genome of the large yellow croaker, Larimichthys cracea (Perciformes, Sciaenidae): unusual features of its control region and the phylogenetic position of the Sciaenidae. Gene 432, 33–43. Curole, A.P., Kocher, T.D., 1999. Mitogenomics: digging deeper with complete mitochondrial genomes. Trends Ecol. Evol. 14, 394–398. Felsenstein, J., 1985. Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39, 783–791. Guindon, S., Gascuel, O., 2003. A simple, fast, and accurate algorithm to estimate large phylogenies by maximum likelihood. Syst. Biol. 52, 696–704. Hixson, J.E., Wong, T.W., Clayton, D.A., 1986. Both the conserved and divergent 5′flanking sequences are required for initiation at the human mitochondrial origin of light strand replication. J. Biol. Chem. 261, 2384–2390. Huang, L.M., Li, J., Xie, Y.J., Zhang, Y.Z., 2010. Study of the Collichthys lucidus fisheries resources of the Minjiang Estuary and its adjacent water. J. Oceanogr. Taiwan Strait 2, 250–256. Ikemura, T., 1985. Codon usage and tRNA content in unicellular and multicellular organisms. Mol. Biol. Evol. 2, 13–35. Jondeung, A., Sangthong, P., Zardoya, R., 2006. The complete mitochondrial DNA sequence of the Mekong giant catfish (Pangasianodon gigas), and the phylogenetic relationships among Siluriformes. Gene 387, 49–57. Kartavtsev, Y.P., Jung, S.Q., Lee, Y.M., Byeon, H., Lee, J.S., 2007. Complete mitochondrial genome of the bullhead torrent catfish, Liobagrus obesus (Siluriformes, Amblycipididae): genome description and phylogenetic considerations inferred from the Cyt b and 16 S rRNA genes. Gene 396, 13–27. Kawaguchi, A., Miya, M., Nishida, M., 2001. Complete mitochondrial DNA sequence of Aulopus japonicus (Teleostei: Aulopiformes), a basal Eurypterygii: longer DNA sequences and higher-level relationships. Ichthyol. Res. 48, 213–223. Kim, I.C., Lee, J.S., 2004. The complete mitochondrial genome of the rockfish Sebastes schlegeli (Scorpaeniformes, Scorpaenidae). Mol. Cells 17, 322–328. Lee, W.J., Kocher, T.D., 1995. Complete sequence of a sea lamprey (Pettromyzon marinus) mitochondrial genome: early establishment of the vertebrate genome organization. Genetics 139, 873–887. Liao, R., Ou, Y.J., Gou, X.W., Li, J.E., 2009. Morphological variations and discrimination of four fish species Chinese bahaba Bahaba flavolabiata, large yellow croaker Pseudosciaena crocea, Ting'wak Wak tingi and spinyhead croaker Collichthys lucidus. J. Dalian Fish. Univ. 4, 305–310. Lin, G., Lo, L.C., Zhu, Z.Y., Feng, F., Chou, R., Yue, G.H., 2006. The complete mitochondrial genome sequence and characterization of single-nucleotide polymorphisms in the control region of the Asian seabass (Lates calcarifer). Mar. Biotechnol. 8, 71–79. Liu, Y., Cui, Z.X., 2009. The complete mitochondrial genome sequence of the cutlassfish Trichiurus japonicus (Perciformes: Trichiuridae): genome characterization and phylogenetic considerations. Mar. Geonomics 2, 133–142.
23
Macey, J.R., Larson, A., Ananjeva, N.B., Fang, Z., Papenfuss, T.J., 1997. Two novel gene orders and the role of light-strand replication in rearrangements of the vertebrate mitochondrial genome. Mol. Biol. Evol. 14, 91–104. Manchado, M., Catanese, G., Infante, C., 2004. Complete mitochondrial DNA sequence of the Atlantic bluefin tuna Thunnus thynnus. Fish. Sci. 70, 68–73. Masayuki, S., Yasushi, K., Hideki, K., Yoji, K., Midori, N., Masami, H., Hiromichi, Y., 2001. Complete nucleotide sequence and gene rearrangement of the mitochondrial genome of the Japanese pond frog Rana nigromaculata. Genes Genet. Syst. 76, 311–325. Mauro, D.S., Gower, D.J., Oommen, O.V., Wilkinson, M., Zardoya, R., 2004. Phylogeny of caecilian amphibians (Gymnophiona) based on complete mitochondrial genomes and nuclear RAG1. Mol. Phylogenet. Evol. 23, 227–234. Miya, M., Nishida, M., 1999. Organization of the mitochondrial genome of a deep-sea fish, Gonostoma gracile (Teleostei, Stomiiformes): first example of transfer RNA gene rearrangements in bony fishes. Mar. Biotechnol. 1, 416–426. Miya, M., Takeshima, H., Endo, H., Ishiguro, N.B., Inoue, J.G., Mukai, T., Satoh, T.P., Yamaguchi, M., Kawaguchi, A., Mabuchi, K., Shirai, S.M., Nishida, M., 2003. Major patterns of higher teleostean phylogenies: a new perspective based on 100 complete mitochondrial DNA sequences. Mol. Phylogenet. Evol. 26, 121–138. Naylor, G.J., Collins, T.M., Brown, W.M., 1995. Hydrophobicity and phylogeny. Nature 373, 555–556. Nelson, J.S., 2006. Fishes of the World, 4th ed. John Wiley and Sons, New York. Oh, D.J., Kim, J.Y., Lee, J.A., Yoon, W.J., Park, S.Y., Jung, Y.H., 2007. Complete mitochondrial genome of the rock bream Oplegnathus fasciatus (Perciformes, Oplegnathidae) with phylogenetic considerations. Gene 392, 174–180. Ohtsuki, T., Kawai, G., Watanabe, K., 2002. The minimal tRNA: unique structure of Ascaris suum mitochondrial tRNAser-UCU having a short T arm and lacking the entire D arm. FEBS Lett. 514, 37–43. Ojala, D., Montoya, J., Attardi, G., 1981. tRNA punctuation model of RNA processing in human mitochondria. Nature 290, 470–474. Peng, Z., Wang, J., He, S., 2006. The complete mitochondrial genome of the helmet catfish Cranoglanis bouderius (Siluriformes: Cranoglanididae) and the phylogeny of otophysan fishes. Gene 376, 290–297. Perdices, A., Cunha, C., Coelho, M.M., 2004. Phylogenetic structure of Zacco platypus (Teleostei, Cyprinidae) populations on the upper and middle Chang Jiang (Yangtze) drainage inferred from cytochrome b sequences. Mol. Phylogenet. Evol. 31, 192–203. Podsiadlowski, L., Kohlhagen, H., Koch, M., 2007. The complete mitochondrial genome of Scutigerella causeyae (Myriapoda: Symphyla) and the phylogenetic position of Symphyla. Mol. Phylogenet. Evol. 45, 251–260. Ponce, M., Infante, C., Jiménez-Cantizano, R.M., Pérez, L., Manchado, M., 2008. Complete mitochondrial genome of the blackspot seabream, Pagellus bogaraveo (Perciformes: Sparidae), with high levels of length heteroplasmy in the WANCY region. Gene 409, 44–52. Posada, D., Crandall, K.A., 1998. MODELTEST: testing the model of DNA substitution. Bioinformatics 14, 817–818. Sambrook, J., Russell, D.W. (Eds.), 2001. Molecular Cloning: A Laboratory Manual, 3 rd ed. Cold Spring Harbor Laboratory Press, New York, NY. Shadel, G.S., Clayton, D.A., 1997. Mitochondrial DNA maintenance in vertebrates. Annu. Rev. Biochem. 66, 409–435. Shan, L.Z., Shao, X.B., Yan, M.C., 2007. The study on biological char actersistics of Collichthy lueidus (Richardson). J. Aquac. 6, 4–5. Szafranski, P., 2009. The mitochondrial trn-cox1 locus: rapid evolution in Pompilidae and evidence of bias in cox1 initiation and termination codon usage. Mitochondr DNA 20, 15–25. Taanman, J.W., 1999. The mitochondrial genome: structure, transcription, translation and replication. Biochim. Biophys. Acta 1410, 103–123. Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., Higgins, D.G., 1997. The CLUSTAL-X Windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 25, 4876–4882. Wong, T.W., Clayton, D.A., 1985. In vitro replication of human mitochondrial DNA: accurate initiation at the origin of light-strand synthesis. Cell 42, 951–958. Zhang, X.Y., Yue, B.S., Jiang, W.X., Song, Z.B., 2009. The complete mitochondrial genome of rock carp Procypris rabaudi (Cypriniformes: Cyprinidae) and phylogenetic implications. Mol. Biol. Rep. 36, 981–991. Zhao, J.L., Wang, W.W., Li, S.F., Cai, W.Q., 2006. Structure of the mitochondrial DNA control region of the sinipercine fishes and their phylogenetic relationship. Acta Genet. Sin. 33, 793–799. Zhu, Y.D., Lo, Y.L., Wu, H.L., 1963. A Study on the Classification of the Sciaenoid Fishes of China, with Description of New Genera and Species. Shanghai Science and Technology Press, China.
Contents lists available at ScienceDirect
Marine Genomics j o u r n a l h o m e p a g e : w w w. e l s ev i e r. c o m / l o c a t e / m a r g e n
The mitochondrial genome of the spinyhead croaker Collichthys lucida: Genome organization and phylogenetic consideration Yuanzhi Cheng, Rixin Wang, Tianjun Xu ⁎ Key Laboratory for Marine Living Resources and Molecular Engineering, College of Marine Science, Zhejiang Ocean University, Zhoushan 316000, PR China
a r t i c l e
i n f o
Article history: Received 10 November 2010 Received in revised form 1 December 2010 Accepted 3 December 2010 Available online 3 January 2011 Keywords: Collichthys lucida Complete mitochondrial genome Percoidei Phylogeny
a b s t r a c t The complete mitochondrial genome of the spiny head croaker Collichthys lucida was determined in the present study. The mitochondrial DNA was 16,442 base pairs in length, and contained 13 protein coding genes, 22 transfer RNAs, 2 ribosomal RNAs, and one major non-coding control region, with the content and order of genes being similar to those in typical teleosts. Most of the genes of C. lucida were encoded on the Hstrand, while the ND6 and eight tRNA (Gln, Ala, Asn, Cys, Tyr, Ser (UCN), Glu and Pro) genes were encoded on the L-strand. The reading frames of two pairs of genes overlapped: ATPase 8 and 6 and ND4L and ND4 by ten and seven nucleotides, respectively. The control region was unusually short at only 768 bp, and absence of typical conserved blocks (CSB-D, CSB-E, and CSB-F). Phylogenetic analyses indicated that C. lucida was located in the cluster of fish species from the family Sciaenidae, supporting the traditional taxonomic classification of fish, and in the cluster of Serranidae, the divergence time in Plectropomus leopardus is longer than that among its coordinal species. On the other hand, phylogenetic analyses do not support the monophyletic of family Centracanthidae and genera Larimichthys and Collichthys, which is against the morphological results. © 2010 Elsevier B.V. All rights reserved.
1. Introduction The fish mitochondrial genome is a small, double stranded and circular DNA molecular, and is almost exclusively maternally inherited. In general, the size of mitochondrial genome is approximately 15 to 20 kb and it contains 13 protein-coding genes, 2 ribosomal RNAs (12S rRNA and 16S rRNA), 22 transfer RNAs (tRNAs), a major non-coding region that contains the initial sites for mitochondrial DNA replication and RNA transcription (Boore, 1999). Fish mitochondrial DNA also has a genomic organization similar to other vertebrates (Kartavtsev et al., 2007). Because of constant gene content, multiple copy status in a cell, lack of recombination and paralogous genes, mitochondrial DNA has been an important model system for studying molecular evolution, phylogeny and genome structure (Curole and Kocher, 1999; Podsiadlowski et al., 2007). The spiny head croaker Collichthys lucida, a small sized bottomdwelling food fish, is widely distributed from the Yellow Sea to South China Sea. The C. lucida fishing season begins in April, and runs until September (Zhu et al., 1963). Over the past 20 years, resources of C. lucida have declined rapidly as a result of over-fishing and environment change (Cheng, 2000). During the past decade, intensive studies have been carried out in the areas of catch statistics, size composition, early life history, and morphological variation (Shan et al., 2007; Liao et al., 2009; Huang et al., 2010). However, much more work needs to develop
plans for rational utilization and resources management. Mitochondrial DNA marker has become very useful in population genetic structures and phylogenetic studies (Perdices et al., 2004; Jondeung et al., 2006; Zhang et al., 2009). Further studies of genetic characteristics of C. lucida based on new and multiple mitochondrial gene markers are worth performing to tackle this problem. The family Sciaenidae is one of the largest within the Perciformes, with approximately 270 species in about 70 genera (Nelson, 2006). To date, only four complete mitochondrial genome sequences for the family Sciaenidae have been represented in GenBank. The aim of this study was to obtain new sequence data of C. lucida for future uses in population genetic structures and phylogenetic studies of Sciaenidae. We present the first complete mitochondrial genome sequence of this species. We characterized its gene organization, a putative structure of the control region of C. lucida and compared it with the other four Sciaenidae species mitochondrial genome sequences. Finally, we constructed a ML tree using 45 species representing 21 families to examine the evolutionary position of C. lucida and infer the phylogenetic relationships of Percoidei species. All information reported in this article may facilitate further investigation of the molecular evolution of Sciaenidae. 2. Materials and methods 2.1. Sample collection and DNA isolation
⁎ Corresponding author. College of Marine Science, Zhejiang Ocean University, 316000 Zhoushan, Zhejiang province, PR China. Tel./fax: + 86 580 2550826. E-mail address: [email protected] (T.J. Xu). 1874-7787/$ – see front matter © 2010 Elsevier B.V. All rights reserved. doi:10.1016/j.margen.2010.12.001
The specimen of C. lucida captured from the wild was obtained from a local fish market in China, and the whole tail fin was immediately
18
Y. Cheng et al. / Marine Genomics 4 (2011) 17–23
preserved in 100% ethanol. Total genomic DNA was isolated using a traditional phenol-chloroform method (Sambrook and Russell, 2001) and kept at −20 °C. 2.2. PCR amplification and sequencing
Table 2 Species used in this study. Order
Family
Species
Accession number
Perciformes
Caesionidae Centracanthidae Centrarchidae
Pterocaesio tile Spicara maena Micropterus dolomieu Micropterus salmoides Lates calcarifer Chaetodon auripes Heniochus diphreutes Emmelichthys struhsakeri Enoplosus armatus Kuhlia mugil Kyphosus cinerascens Labracoglossa argentiventris Scorpis lineolata Lethrinus obsoletus Monotaxis grandoculis Lutjanus malabaricus Lutjanus rivulatus Lutjanus sebae Monodactylus argenteus Oplegnathus fasciatus Oplegnathus punctatus Etheostoma radiosum Percina macrolepida Centropyge loricula Chaetodontoplus septentrionalis Diagramma pictum Parapristipoma trilineatum Collichthys niveatus Larimichthys crocea Larimichthys polyactis Miichthys miiuy Collichthys lucida Anyperodon leucogrammicus Epinephelus akaara Epinephelus bruneus Epinephelus coioides Epinephelus septemfasciatus Plectropomus leopardus Acanthopagrus latus Pagellus bogaraveo Pagrus auriga Pagrus major Parargyrops edita Rhynchopelates oxyrhynchus Toxotes chatareus Myxocyprinus asiaticus
AP004447 AP009164 AB378749 DQ536425 DQ010541 AP006004 AP006005 NC_004407 AP006008 AP011065 AP011061 AP011062 AP011063 AP009165 NC_010957 FJ824741 AP006000 FJ824742 AP009169 AP006010 AP011066 AY341348 DQ536430 AP006006 AP006007 AP009167 AP009168 HM219223 EU339149 GU586227 HM447240 NC_014350 GQ131336 EU043377 FJ594964 EU043376 NC_013829 DQ101270 EF506764 AB305023 AB124801 AP002949 EF107158 AP011064 AP006806 AP006764
12 pairs of primers (Table 1) were designed, based upon the reported complete mitochondrial genome sequences for the Larimichthys crocea, Larimichthys polyactis, C. niveatus, Miichthys miiuy (Cui et al., 2009; NC_013754; HM219223; NC_014351). PCR was conducted on a PTC-200 using the following program: predenaturation at 94 °C for 4 min; 35 cycles of denaturation at 94 °C for 50 s, annealing at 60 °C for 60 s, extension at 72 °C for 2–3 min; and final extension at 72 °C for 10 min. Each PCR reaction volume contained 0.2 μM of each primers, 5.0 μl of 10 × Taq Plus polymerase buffer, 0.2 mM dNTPS, 2 unit of Taq Plus DNA polymerase with proof-reading characteristic (TIANGEN), and 1 μl of DNA template. The PCR products were electrophoresed on a 1% agarose gel to check the integrity and were visualized by the Molecular Imager Gel Doc XR system (BioRad, USA). The PCR products were purified using a QIAEX II Gel Extraction Kit (Qiagen). The purified DNA was then sequenced on ABI 3730, where the same PCR primers were used.
Centropomidae Chaetodontidae Emmelichthyidae Enoplosidae Kuhliidae Kyphosidae
Lethrinidae Lutjanidae
Monodactylidae Oplegnathidae Percidae
2.3. Genome annotation and sequence analysis
Pomacanthidae
The Sequencher™ (Gene Code, Ann Arbor, MI, USA) program was used for editing and assembling the contiguous, overlapping sequences. The primary DNA sequence data were characterized using BLAST searches at NCBI. The different genes were identified by sequence comparison with croaker homologues. In addition, the 13 protein-coding genes were predicted using the start codon and the stop codons whereas the 22 tRNA genes were recognized by their capability to fold into cloverleaf secondary structures, and the presence of specific anticodons. The complete nucleotide sequence of the C. lucida mitogenome has been deposited in GenBank, which can be accessed with Accession number NC_014350. The mitochondrial genome DNA sequences of 45 fish species belonging to 21 families (Table 2) were selected and used to construct phylogenetic trees to predict the evolutionary position of C. lucida within the Percoidei. Analysis was based on complete 16 S rRNA gene sequences. All the nucleotides were subjected to alignments using
Pomadasyidae Sciaenidae
Serranidae
Sparidae
Cypriniformes
Terapontidae Toxotidae Catostomidae
Table 1 PCR primers in the analysis of the C. lucida mitochondrial genome. Primer
Sequence (5′-3′)
CL-1F CL-1R CL-2F CL-2R CL-3F CL-3R CL-4F CL-4R CL-5F CL-5R CL-6F CL-6R CL-7F CL-7R CL-8F CL-8R CL-9F CL-9R CL-10F CL-10R CL-11F CL-11R CL-12F CL-12R
GGAGGATTTAGCAGTAAGCAG AGACATTAGGACAGGGTTCAGT AATCTCCCTCGTGGCAGTAA GGTCAAAGCCGCATTCATAG CCAACCTTATGGCAGAACTAA GCCTATGGATACAAAGAAAACGACT GCTACCTCCTTTACAGCCATTT GTGTCCGAGTTTAGACCCAGT AACCAACCATAGCCCACGACA ATTCATTTCCCAGGCAACCAG GACATTGGCACCCTCTATCTAA AGGCAAGGTCTTCGTAATCAGT TCATCATCGGCTCTACATTCCTG GGCGAGACTGGCAATAAATCATC AAACTACGAACGAACGCACAG GAAGGATATGATTCCGACACC CCTATTTACCGCTACCTGTGC ACGGATGAGAAGGCTATGGA ATAAAGACCCGTATGAATGGC ATGAGCGGTAAGATAGCAAGG CCCTCCAACTCCTTAGAAAAG GGTGACCGAAGAATCAGAATA TGGAGGCATACCAGTAGAACAC CACTCTTTACGCCGTTGACTAT
Clustal X with default settings (Thompson et al., 1997), and then the sequences were checked and adjusted manually. For these data sets, the model GTR + I + G was selected for ML analyses by ModelTest 3.7 (Posada and Crandall, 1998). ML analyses were conducted using PhyML 3.0 (Guindon and Gascuel, 2003), 1000 bootstraps were used to estimate the node reliability (Felsenstein, 1985). 3. Results and discussion The complete mitochondrial DNA sequence of C. lucida was determined to be 16, 442 bp long, which is nearly identical to those of other Sciaenidae species in length with only a few base variations. The number and size of non-coding spacer and the length of main non-coding regions are responsible for the length variations of mitogenomes in species. The new sequence included two ribosomal RNA genes, 13 protein-coding genes, 22 transfer RNA genes, and a putative control region (Table 3 and Fig. 1). It is obvious that the gene distribution are the same as those of other fish mitochondrial genomes, and most of these genes are encoded on the H-strand, except for the ND6 gene and eight tRNA genes, which are encoded on the L-strand. The overall base composition of L-strand is as follows: T
Y. Cheng et al. / Marine Genomics 4 (2011) 17–23
19
Table 3 Characteristics of the mitochondrial genome of C. lucida. Gene
tRNA-Phe 12S rRNA tRNA-Val 16S rRNA tRNA-Leu-(UUR) ND1 tRNA-Ile tRNA-Gln tRNA-Met ND2 tRNA-Trp tRNA-Ala tRNA-Asn tRNA-Cys tRNA-Tyr COX1 tRNA-Ser-(UCN) tRNA-Asp COX2 tRNA-Lys ATPase8 ATPase6 COX3 tRNA-Gly ND3 tRNA-Arg ND4L ND4 tRNA-His tRNA-Ser-(AGY) tRNA-Leu-(CUN) ND5 ND6 tRNA-Glu Cytb tRNA-Thr tRNA-Pro Control Region
Position
Size (bp)
From
To
Nucleotide
1 70 1017 1089 2786 2860 3839 3908 3979 4049 5095 5167 5238 5348 5415 5487 7039 7114 7191 7882 7958 8116 8799 9584 9655 10004 10073 10363 11744 11813 11885 11958 13793 14312 14385 15526 15600 15672
69 1016 1087 2784 2859 3834 3908 3979 4048 5094 5165 5235 5310 5415 5484 7043 7110 7182 7881 7956 8125 8799 9583 9654 10003 10072 10369 11743 11812 11879 11957 13796 14311 14380 15525 15597 15669 16442
69 947 71 1696 74 975 70 72 70 1046 71 69 73 68 70 1557 72 69 691 75 168 684 785 71 349 69 297 1381 69 67 73 1839 519 69 1141 72 70 771
Codon Amino acid
Initiation
Intergenic nucleotideI
Strand
0 0 1 1 0 4 −1 −1 0 −1 1 2 37 −1 2 −5 3 8 0 1 − 10 −1 0 0 0 0 −7 0 0 5 0 −4 0 4 0 2 2
H H H H H H H L H H H L L L L H L H H H H H H H H H H H H H H H H L H H L
StopI
324
ATG
TAG
348
ATG
TA-
518
ATG
AGA
230
ATG
T–
55 227 261
ATG ATG ATG
TAA TAA TA-
116
ATG
T–
98 460
ATG ATG
TAA T–
612 172
ATG ATG
TAA TAA
380
ATG
T–
I
TA- and T– represent incomplete stop codons. Numbers correspond to the nucleotides separating adjacent genes. Negative numbers indicate overlapping nucleotides.
II
(25.6%), A (28.0%), C (30.7%), G (15.7%), and the A + T content (53.6%) is similar to those of other croakers (from 51.9% to 53%) (Table 4). As in most vertebrates, the overall base compositions are skewed against G in mitochondrial genomes, which is due to a strong bias against the use of G at the third codon position (Miya and Nishida, 1999; Peng et al., 2006). All expected 13 large open reading frames were detected in the mitochondrial genome of C. lucida. Just like in the mitochondrial genome of other vertebrates except for lamprey (Lee and Kocher, 1995), there are two cases of reading frame overlap in two genes encoded by the same strand (ATPase 8 and 6 overlap by 10 bp, ND4L and ND4 overlap by 7 bp). The T:C:A:G base composition of the mitochondrial 13 protein-coding gene sequence is 27.7:31.6:25.3:15.4 and is summarized in Table 4. As expected, an anti-G bias at 15.4% is observed in the third codon position, which is typical in vertebrates (Ponce et al., 2008; Liu and Cui, 2009). The A + T composition at the first codon position is 46.8%. The values for the second and third codon positions are 58.3% and 53.8, respectively. The A + T composition of the second codon position is relatively higher than most Percoidei fishes, and the primidines at this codon position are overrepresented in comparison with purines, owing to hydrophobic character of the proteins (Naylor et al., 1995). All protein-coding genes had a methionine (ATG) start codon. Variance in termination codons seems to be a common tendency in fish mitogenomes (Miya et al., 2003; Manchado et al., 2004). Seven protein-coding genes in C. lucida mitogenome ended with complete
termination codons, TAA (ATPase8, ATPase6, ND4L, ND5, and ND6), TAG (ND1) and AGA (COI), the remaining 6 genes ended with incomplete termination codons, either TA (ND2, CO3) or T (CO2, ND3, ND4, and Cytb) (Table 3). For those genes with incomplete stop codon, the transcripts would be modified to form complete termination signal UAA via post-transcriptional polyadenylation (Ojala et al., 1981). In total, 3801 codons in 13 protein-coding genes are identified in C. lucida mitogenome excluding stop codons (Table 5). For amino acids with fourfold degenerate third position, codons ended in C were the most frequent, followed by codon families ended in A and T. However, for arginine, A was more frequent than C. Among twofold degenerate codons, C appeared to be used more than T in pyrimidine codon families, whereas purine codons encoded mostly with A. In accord with the overall G-bias, G was the least common third position nucleotide in all codons except for glycine. Leucine was the most frequent amino acid, alanine is the second most amino acid, and cystine was the least frequent. CUC was the most frequently used codon (199/3801), CCG is the least frequently used codon (5/3801), this codon usage bias might be associated with the available tRNAs in organism. Although most of these features are similar to other fish species, small differences of codon usage and relative synonymous codon usage in the 13 protein-coding genes were still detected among reported croakers (data not shown), which might reflect that different organisms having selection act on their codon usage can have different preferred codons, as reported in Ikemura (1985). In addition, we compared predicted star and stop codons of protein genes among
20
Y. Cheng et al. / Marine Genomics 4 (2011) 17–23
Fig. 1. Gene map of mitochondrial genome of the spiny head croaker, C. lucida (Perciformes, Sciaenidae). Gene encoded on the heavy or light strands are shown outside or inside the circle gene map, respectively. Inner ring displays the GC content.
Percoide species available in GenBank, and found that most of the genes have one preferable type of star/stop codon usage. However, COI has two types of star/stop codon usage. COI proteins in Sciaenidae fishes mitochondrial DNA possessed ATG/AGA as initiation and termination codons, whereas in other Percoidei fishes, this is not the case (they possessed GTG/TAA as most common, GTG/AGG or GTG/T– are rarely used). Studies in insects have shown the existence of positive correlation between the incidence of canonical initiation and termination codons and relative rate of the gene evolution (Szafranski, 2009). It is needed to confirm whether this relationship also applies to fish. Although putative gene boundaries for the two rRNA genes in the genome have been found, these cannot be accurately determined until transcript mapping is carried out. The 12S and 16S rRNA genes Table 4 The base compositions of the C. lucida mitochondrial genome.
Protein coding 1st 2nd 3rd Total tRNAs rRNAs Control region Overall
T
C
A
G
A+T
21 40 22 27.7 26.5 20.5 31.1 25.6
28.6 27.6 38.6 31.6 23.0 26.3 23.9 30.7
25.8 18.3 31.8 25.3 28.1 33.0 31.6 28.0
25.0 13.7 7.4 15.4 22.5 20.1 13.4 15.7
46.8 58.3 53.8 53.0 54.6 53.5 62.7 53.6
encoded on the sense strand were located between tRNA-Phe and tRNA-Leu-UUR, being separated by the tRNA-Val gene. Being 947 and 1696 bp long, respectively, the two rRNA genes were conserved either in A + T content or gene length and locations, compared with those of other genes reported for Sciaenidae and similar to other reported vertebrates. However, both of the rRNA genes including numerous substitutions among fish species suggest the possibility of using these rRNA genes for phylogeny (Kartavtsev et al., 2007). 22 tRNA genes were identified from the mitochondrial genome of C. lucida by comparing with the homologues of other Percoidei species and by the software tRNAScan-SE1.21, which were interspersed between rRNA and protein-coding genes, ranged from 67 (tRNA-Ser-AGY) to 75 (tRNA-Lys) nucleotides long. As reported in some other vertebrates (Kim and Lee, 2004; Oh et al., 2007), all tRNA genes can be folded into typical cloverleaf secondary structures with the known exception of tRNA-Ser-AGY gene. In tRNA-Ser-AGY gene, a complete DHU arm is missing, and the unpaired replacement for the DHU arm is included (Masayuki et al., 2001). Aberrant tRNA can also fit the ribosome by adjusting its structural conformation and function in a similar way to that of usual tRNAs in the ribosome (Ohtsuki et al., 2002). As in most vertebrates, the major non-coding region in C. lucida mitochondrial genome is located between tRNA-Pro and tRNA-Phe. It was determined to be 771 bp in length, shorter than other analyzed Sciaenidae species, and it had an overall base composition that is rich in A and T (A + T = 62.7%). The control region is characterized by discrete and conserved sequence blocks (Lin et al., 2006). By comparing with the recognition sites in Percoidei fishes, conserved
Y. Cheng et al. / Marine Genomics 4 (2011) 17–23 Table 5 Codon usage in C. lucida mitochondrial protein-coding genes. Amino Acid
Codon
Count/Frequences (%)
Amino Acid
Codon
Number/Frequences (%)
Phe
TTT TTC TTA TTG CTT CTC CTA CTG ATT ATC ATA ATG GTT GTC GTA GTG TCT TCC TCA TCG CCT CCC CCA CCG ACT ACC ACA ACG GCT GCC GCA GCG
102/2.7 132/3.5 86/2.3 20/0.5 147/3.9 199/5.2 181/4.8 50/1.3 160/4.2 116/3.1 92/2.4 62/1.6 49/1.3 66/1.7 55/1.4 23/0.6 36/0.9 65/1.7 62/1.6 12/0.3 38/1.0 132/3.5 50/1.3 5/0.13 63/1.7 128/3.4 119/3.1 6/0.15 59/1.6 174/4.6 92/2.4 12/0.3
Tyr
TAT TAC TAA TAG CAT CAC CAA CAG AAT AAC AAA AAG GAT GAC GAA GAG TGT TGC TGA TGG CGT CGC CGA CGG AGT AGC AGA AGG GGT GGC GGA GGG
39/1.0 68/1.8 5/0.13 1/0.03 30/0.8 81/2.1 93/2.4 7/0.2 43/1.1 79/2.1 61/1.6 6/0.2 27/0.7 48/1.3 85/2.2 19/0.5 7/0.2 23/0.6 107/2.8 14/0.4 9/0.2 16/0.4 47/1.2 7/0.2 9/0.2 39/1.0 1/0.03 0/0 31/0.8 107/2.8 69/1.8 37/1.0
Leu
Ile Met Val
Ser
Pro
Thr
Ala
stopI His Gln Asn Lys Asp Glu Cys Trp Arg
Ser stop Gly
I
The incomplete T or TA of the termination codon is not included.
sequence blocks CSB-1, CSB-2, and CSB-3, which are thought to be involved in positioning RNA polymerase both for transcription and for priming replication (Clayton, 1991; Shadel and Clayton, 1997), were found in C. lucida, no CSB-D, -E, and -F were identified (Fig. 2). The lack of the typical sequences of these conserved blocks was previously confirmed in the L. crocea, L. polyactis, and C. niveatus (Cui et al., 2009; HM219223). However, C. lucida also contain a GTGGA box which is a typical characteristic of CSB-E in vertebrates. Although the segments corresponding to the CSB-D, -E and -F are absent in Larimichthys and Collichthys, the typical tripartite structure with ETAS, central and CSB domains of control region can be identified in sinipercine fishes (Zhao et al., 2006) and also in other Percoidei species such as Lates calcarifer (Lin et al., 2006) and Pagellus bogaraveo (Ponce et al., 2008). Such
21
variations imply a rapid evolving structure of control region; in combination with more sequences of fishes it will be useful to dissect the structure–function relationships of the control region. 14 other non-coding regions with a total of 73 bp long sequences were detected in the mtDNA genome of C. lucida. The 37 bp fragment of the putative origin of light strand replication (OL), as in most vertebrates, is located in a cluster of five tRNA genes (WANCY region) between tRNA-Asn and tRNA-Cys. As was expected, this region has the potential to fold into a stable stem-loop secondary structure that is generally a characteristic of the origin of light strand replication (Kawaguchi et al., 2001). The loop of OL is usually T-rich in mammalian, amphibian, or reptilian (Wong and Clayton, 1985; Macey et al., 1997; Mauro et al., 2004) and C-rich in most reported fish (Taanman, 1999; Ponce et al., 2008). C. lucida possessed a common C-rich loop, similar to L. arimichthys crocea, L. arimichthys polyactis, and Collichthys niveatus. However, its coordinal species M. iichthys miiuy had a A + G-rich loop (Cheng et al., 2010) and T-rich loop was also detected in Scombridae fishes (NC_005313, NC_005318, and NC_005316). Such variation of loop may associate with the evolutionary pattern of species and may affect its function. Further information mining of more fish species may be useful to elucidate the possible action of multiple molecular mechanisms in the evolution of OL and gene content and arrangement in the WANCY region of teleosts (Ponce et al., 2008). The sequence 5′GCCGG-3′ is exactly shown at the base of the stem within the tRNA-Cys gene. It was described necessarily for the replication of light-strand (Hixson et al., 1986). The remaining eight noncoding regions were located between protein-coding genes and tRNA genes and between tRNA genes with a range from 1 to 8 bp, respectively (Table 3). Phylogenetic analyses were used to examine the evolutionary position of the phylogenetic relationships among Percoidei species. The tree included 45 species belonging to 21 families. Fig. 3 shows a ML tree based on phylogenetic analysis of complete 16S rRNA gene sequences. The tree was rooted by a fish species belonging to the order Cypriniformes. Consistent with the traditional systematic classification (Nelson, 2006), most fish families were reconstructed as monophyletic. C. lucida was clustered with the other croakers from the family Sciaenidae, supporting the traditional taxonomic classification. The trees constructed in this study are similar to the one reported by Cui et al. (2009). We have noticed that the branch length of Plectropomus leopardus was much longer than its coordinal species in the cluster of Serranidae, suggesting that the divergence time in P. leopardus is longer than that among its coordinal species in Serranidae. Spicara maena is not monophyletic in our analyses. It was grouped in a cluster containing fish from the family Sparidae, which is in disagreement with its traditional position and the evolutionary position of family Centracanthidae deserves to be further studied.
Fig. 2. The complete sequence of mitochondrial control region of C. lucida. ETAS: extended termination associated sequence; CSB-1, -2, -3: conserved sequence blocks 1, 2 and 3. The motif (TAS: TACAT) is underlined. GTGGAG motif is shadowed.
22
Y. Cheng et al. / Marine Genomics 4 (2011) 17–23
Fig. 3. Phylogenetic tree of the Percoidei based on the ML analysis of complete 16S rRNA gene sequences. Myxocyprinus asiaticus was used as an outgroup. The numbers on the branches are bootstrap values.
Members of the Sciaenidae live in marine, brackish and freshwater habitats along the Atlantic, Indian and Pacific coasts. China has the highest number of species in the family, with about 30 species in 17 genera. Based on our analysis, C. niveatus is found to be most closely related to L. polyactis, the two species were grouped with L. crocea and
then grouped with C. lucida, and this topology is nearly identical to our previous analyses using COI and Cytb gene sequences. However, the Percoidei is the largest suborder of the Perciformes and comparises 3176 species in 79 families (Nelson, 2006), and the sequences of most of these species are not available. It is impossible to know the details
Y. Cheng et al. / Marine Genomics 4 (2011) 17–23
of their evolutionary relationships; therefore more complete mitochondrial DNA should be sequenced. Acknowledgments This study was supported by Nation Nature Science Foundation of China (31001120), Zhejiang Provincial Natural Science Foundation of China (Y3100013), National sparking plan project (2010GA700010), Seeding Grants Programs of Science and Technology Commission Foundation of Zhejiang Province and Open Foundation from Ocean Fishery Science and Technology in the Most Important Subjects of Zhejiang (20100209). References Boore, J.L., 1999. Animal mitochondrial genomes. Nucleic Acids Res. 27, 1767–1780. Cheng, J.S., 2000. The structure and diversity of demersal fish communities in winter in the East China Sea and the yellow sea. Mar. Fish. Res. 3, 1–8 (in Chinese with an English abstract). Cheng, Y.Z., Xu, T.J., Shi, G., Wang, R.X., 2010. Complete mitochondrial genome of the miiuy croaker Miichthys miiuy (Perciformes, Sciaenidae) with phylogenetic consideration. Mar. Genomics 3, 201–209. Clayton, D.A., 1991. Nuclear gadgets in mitochondrial DNA replication and transcription. Trends Biochem. Sci. 16, 107–111. Cui, Z.X., Liu, Y., Li, C.P., You, F., Chu, K.H., 2009. The complete mitochondrial genome of the large yellow croaker, Larimichthys cracea (Perciformes, Sciaenidae): unusual features of its control region and the phylogenetic position of the Sciaenidae. Gene 432, 33–43. Curole, A.P., Kocher, T.D., 1999. Mitogenomics: digging deeper with complete mitochondrial genomes. Trends Ecol. Evol. 14, 394–398. Felsenstein, J., 1985. Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39, 783–791. Guindon, S., Gascuel, O., 2003. A simple, fast, and accurate algorithm to estimate large phylogenies by maximum likelihood. Syst. Biol. 52, 696–704. Hixson, J.E., Wong, T.W., Clayton, D.A., 1986. Both the conserved and divergent 5′flanking sequences are required for initiation at the human mitochondrial origin of light strand replication. J. Biol. Chem. 261, 2384–2390. Huang, L.M., Li, J., Xie, Y.J., Zhang, Y.Z., 2010. Study of the Collichthys lucidus fisheries resources of the Minjiang Estuary and its adjacent water. J. Oceanogr. Taiwan Strait 2, 250–256. Ikemura, T., 1985. Codon usage and tRNA content in unicellular and multicellular organisms. Mol. Biol. Evol. 2, 13–35. Jondeung, A., Sangthong, P., Zardoya, R., 2006. The complete mitochondrial DNA sequence of the Mekong giant catfish (Pangasianodon gigas), and the phylogenetic relationships among Siluriformes. Gene 387, 49–57. Kartavtsev, Y.P., Jung, S.Q., Lee, Y.M., Byeon, H., Lee, J.S., 2007. Complete mitochondrial genome of the bullhead torrent catfish, Liobagrus obesus (Siluriformes, Amblycipididae): genome description and phylogenetic considerations inferred from the Cyt b and 16 S rRNA genes. Gene 396, 13–27. Kawaguchi, A., Miya, M., Nishida, M., 2001. Complete mitochondrial DNA sequence of Aulopus japonicus (Teleostei: Aulopiformes), a basal Eurypterygii: longer DNA sequences and higher-level relationships. Ichthyol. Res. 48, 213–223. Kim, I.C., Lee, J.S., 2004. The complete mitochondrial genome of the rockfish Sebastes schlegeli (Scorpaeniformes, Scorpaenidae). Mol. Cells 17, 322–328. Lee, W.J., Kocher, T.D., 1995. Complete sequence of a sea lamprey (Pettromyzon marinus) mitochondrial genome: early establishment of the vertebrate genome organization. Genetics 139, 873–887. Liao, R., Ou, Y.J., Gou, X.W., Li, J.E., 2009. Morphological variations and discrimination of four fish species Chinese bahaba Bahaba flavolabiata, large yellow croaker Pseudosciaena crocea, Ting'wak Wak tingi and spinyhead croaker Collichthys lucidus. J. Dalian Fish. Univ. 4, 305–310. Lin, G., Lo, L.C., Zhu, Z.Y., Feng, F., Chou, R., Yue, G.H., 2006. The complete mitochondrial genome sequence and characterization of single-nucleotide polymorphisms in the control region of the Asian seabass (Lates calcarifer). Mar. Biotechnol. 8, 71–79. Liu, Y., Cui, Z.X., 2009. The complete mitochondrial genome sequence of the cutlassfish Trichiurus japonicus (Perciformes: Trichiuridae): genome characterization and phylogenetic considerations. Mar. Geonomics 2, 133–142.
23
Macey, J.R., Larson, A., Ananjeva, N.B., Fang, Z., Papenfuss, T.J., 1997. Two novel gene orders and the role of light-strand replication in rearrangements of the vertebrate mitochondrial genome. Mol. Biol. Evol. 14, 91–104. Manchado, M., Catanese, G., Infante, C., 2004. Complete mitochondrial DNA sequence of the Atlantic bluefin tuna Thunnus thynnus. Fish. Sci. 70, 68–73. Masayuki, S., Yasushi, K., Hideki, K., Yoji, K., Midori, N., Masami, H., Hiromichi, Y., 2001. Complete nucleotide sequence and gene rearrangement of the mitochondrial genome of the Japanese pond frog Rana nigromaculata. Genes Genet. Syst. 76, 311–325. Mauro, D.S., Gower, D.J., Oommen, O.V., Wilkinson, M., Zardoya, R., 2004. Phylogeny of caecilian amphibians (Gymnophiona) based on complete mitochondrial genomes and nuclear RAG1. Mol. Phylogenet. Evol. 23, 227–234. Miya, M., Nishida, M., 1999. Organization of the mitochondrial genome of a deep-sea fish, Gonostoma gracile (Teleostei, Stomiiformes): first example of transfer RNA gene rearrangements in bony fishes. Mar. Biotechnol. 1, 416–426. Miya, M., Takeshima, H., Endo, H., Ishiguro, N.B., Inoue, J.G., Mukai, T., Satoh, T.P., Yamaguchi, M., Kawaguchi, A., Mabuchi, K., Shirai, S.M., Nishida, M., 2003. Major patterns of higher teleostean phylogenies: a new perspective based on 100 complete mitochondrial DNA sequences. Mol. Phylogenet. Evol. 26, 121–138. Naylor, G.J., Collins, T.M., Brown, W.M., 1995. Hydrophobicity and phylogeny. Nature 373, 555–556. Nelson, J.S., 2006. Fishes of the World, 4th ed. John Wiley and Sons, New York. Oh, D.J., Kim, J.Y., Lee, J.A., Yoon, W.J., Park, S.Y., Jung, Y.H., 2007. Complete mitochondrial genome of the rock bream Oplegnathus fasciatus (Perciformes, Oplegnathidae) with phylogenetic considerations. Gene 392, 174–180. Ohtsuki, T., Kawai, G., Watanabe, K., 2002. The minimal tRNA: unique structure of Ascaris suum mitochondrial tRNAser-UCU having a short T arm and lacking the entire D arm. FEBS Lett. 514, 37–43. Ojala, D., Montoya, J., Attardi, G., 1981. tRNA punctuation model of RNA processing in human mitochondria. Nature 290, 470–474. Peng, Z., Wang, J., He, S., 2006. The complete mitochondrial genome of the helmet catfish Cranoglanis bouderius (Siluriformes: Cranoglanididae) and the phylogeny of otophysan fishes. Gene 376, 290–297. Perdices, A., Cunha, C., Coelho, M.M., 2004. Phylogenetic structure of Zacco platypus (Teleostei, Cyprinidae) populations on the upper and middle Chang Jiang (Yangtze) drainage inferred from cytochrome b sequences. Mol. Phylogenet. Evol. 31, 192–203. Podsiadlowski, L., Kohlhagen, H., Koch, M., 2007. The complete mitochondrial genome of Scutigerella causeyae (Myriapoda: Symphyla) and the phylogenetic position of Symphyla. Mol. Phylogenet. Evol. 45, 251–260. Ponce, M., Infante, C., Jiménez-Cantizano, R.M., Pérez, L., Manchado, M., 2008. Complete mitochondrial genome of the blackspot seabream, Pagellus bogaraveo (Perciformes: Sparidae), with high levels of length heteroplasmy in the WANCY region. Gene 409, 44–52. Posada, D., Crandall, K.A., 1998. MODELTEST: testing the model of DNA substitution. Bioinformatics 14, 817–818. Sambrook, J., Russell, D.W. (Eds.), 2001. Molecular Cloning: A Laboratory Manual, 3 rd ed. Cold Spring Harbor Laboratory Press, New York, NY. Shadel, G.S., Clayton, D.A., 1997. Mitochondrial DNA maintenance in vertebrates. Annu. Rev. Biochem. 66, 409–435. Shan, L.Z., Shao, X.B., Yan, M.C., 2007. The study on biological char actersistics of Collichthy lueidus (Richardson). J. Aquac. 6, 4–5. Szafranski, P., 2009. The mitochondrial trn-cox1 locus: rapid evolution in Pompilidae and evidence of bias in cox1 initiation and termination codon usage. Mitochondr DNA 20, 15–25. Taanman, J.W., 1999. The mitochondrial genome: structure, transcription, translation and replication. Biochim. Biophys. Acta 1410, 103–123. Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., Higgins, D.G., 1997. The CLUSTAL-X Windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 25, 4876–4882. Wong, T.W., Clayton, D.A., 1985. In vitro replication of human mitochondrial DNA: accurate initiation at the origin of light-strand synthesis. Cell 42, 951–958. Zhang, X.Y., Yue, B.S., Jiang, W.X., Song, Z.B., 2009. The complete mitochondrial genome of rock carp Procypris rabaudi (Cypriniformes: Cyprinidae) and phylogenetic implications. Mol. Biol. Rep. 36, 981–991. Zhao, J.L., Wang, W.W., Li, S.F., Cai, W.Q., 2006. Structure of the mitochondrial DNA control region of the sinipercine fishes and their phylogenetic relationship. Acta Genet. Sin. 33, 793–799. Zhu, Y.D., Lo, Y.L., Wu, H.L., 1963. A Study on the Classification of the Sciaenoid Fishes of China, with Description of New Genera and Species. Shanghai Science and Technology Press, China.