- Email: [email protected]
The effect of equine herpesvirus type 4 on type-I interferon signaling molecules
Veterinary Immunology and Immunopathology 219 (2020) 109971
Contents lists available at ScienceDirect
Veterinary Immunology and Immunopathology journal homepage: www.elsevier.com/locate/vetimm
Research paper
The effect of equine herpesvirus type 4 on type-I interferon signaling molecules
T
Fatai S. Oladunnia,c,*, Stephanie Reedya, Udeni B.R. Balasuriyab, David W. Horohova, Thomas M. Chambersa a
Maxwell H. Gluck Equine Research Center, Department of Veterinary Science, University of Kentucky, Lexington, KY 40546, USA Louisiana Animal Disease Diagnostic Laboratory and Department of Pathobiological Sciences, School of Veterinary Medicine, Louisiana State University, Baton Rouge, LA 70803, USA c Department of Veterinary Microbiology, University of Ilorin, Ilorin, Nigeria b
A R T I C LE I N FO
A B S T R A C T
Keywords: EHV-4 STAT1 STAT2 Innate immunity Type-I interferon
Equine herpesvirus type 4 (EHV-4) is mildly pathogenic but is a common cause of respiratory disease in horses worldwide. We previously demonstrated that unlike EHV-1, EHV-4 is not a potent inducer of type-I IFN and does not suppress that IFN response, especially during late infection, when compared to EHV-1 infection in equine endothelial cells (EECs). Here, we investigated the impact of EHV-4 infection in EECs on type-I IFN signaling molecules at 3, 6, and 12 hpi. Findings from our study revealed that EHV-4 did not induce nor suppress TLR3 and TLR4 expression in EECs at all the studied time points. EHV-4 was able to induce variable amounts of IRF7 and IRF9 in EECs with no evidence of suppressive effect on these important transcription factors of IFN-α/β induction. Intriguingly, EHV-4 did interfere with the phosphorylation of STAT1/STAT2 at 3 hpi and 6 hpi, less so at 12 hpi. An active EHV-4 viral gene expression was required for the suppressive effect of EHV-4 on STAT1/ STAT2 phosphorylation during early infection. One or more early viral genes of EHV-4 are involved in the suppression of STAT1/STAT2 phosphorylation observed during early time points in EHV-4-infected EECs. The inability of EHV-4 to significantly down-regulate key molecules of type-I IFN signaling may be related to the lower severity of pathogenesis when compared with EHV-1. Harnessing this knowledge may prove useful in controlling future outbreaks of the disease.
1. Introduction Equine herpesvirus 4 (EHV-4) is a ubiquitous virus relevant for its ability to cause clinically significant upper respiratory tract (URT) disease in horse populations worldwide. This virus, along with EHV-1, has been found for over 80 years to be the most common herpesviruses impeding successful breeding, competition, and recreational horse industries all around the world (Allen et al., 2002). EHV-4 belongs to the genus Varicellovirus of the subfamily Alphaherpesvirinae (Davison et al., 2009). The virus was considered as subtype 2 of EHV-1 and known as the same virus until 1981 when DNA sequence information indicated otherwise (Sabine et al., 1981; Studdert et al., 1981). EHV-4 has a genome size of about 146-kbp and encodes 76 ORF, with three of those genes duplicated (Telford et al., 1998). The genomic architecture of EHV-4 comprises a linear double-stranded, DNA organized into a long unique segment (UL, 112,398 bp) flanked by a short inverted repeat sequence (TRL/IRL, 27 bp) and a short unique segment (US, 12,789 bp)
⁎
that is flanked by a large inverted repeat sequence (TRS/IRS, 10,178 bp) (Allen et al., 2002; Telford et al., 1998). The level of nucleotide identity between EHV-1 and EHV-4, within individual homologous genes, ranges from 55 to 84% while the amino acid sequence identity ranges from 55 to 96% (Telford et al., 1998, 1992). Despite the close relatedness of EHV-4 to EHV-1, the genetic differences between the two viruses are sufficient to affect their host range and disease phenotypes. EHV-4 mostly infect the URT of horses causing respiratory syndromes, whereas EHV-1 has a more diverse host range and causes pathologies including respiratory disease, abortion and equine herpesviral myeloencephalopathy (EHM) (Patel and Heldens, 2005). Unlike EHV-1, EHV-4 has a streamlined host range and the virus can efficiently infect only equine cells; it replicates only poorly in a few other cell lines (Whalley et al., 2007). Lytic infection by EHV-4 is thought to mainly occur in the epithelial cells of the URT, although equine endothelial cells (EEC) are also permissive to EHV-4 infection (Osterrieder and Van de Walle, 2010). Alphaherpesviruses have been
Corresponding author. E-mail address: [email protected] (F.S. Oladunni).
https://doi.org/10.1016/j.vetimm.2019.109971 Received 13 June 2019; Received in revised form 2 October 2019; Accepted 26 October 2019 0165-2427/ © 2019 Elsevier B.V. All rights reserved.
Veterinary Immunology and Immunopathology 219 (2020) 109971
F.S. Oladunni, et al.
et al., 1962).
demonstrated to enter different cell types by different pathways that, mostly, utilize similar viral glycoproteins, namely, glycoprotein D (gD), gB, gH, and gL, in conjunction with host cellular receptors and co-receptors (Campadelli-Fiume and Menotti, 2007; Geraghty et al., 1998; Hutchinson et al., 1992; Mercer et al., 2010; Shukla et al., 1999). The major viral component that defines the differential cellular tropism between EHV-1 and EHV-4 has been found to be gD. An exchange of gD of EHV-1 for that of EHV-4 was able to enhance EHV-4 entry in an originally non-permissive cell (Azab et al., 2013). Unlike many alphaherpesviruses that enter endothelial cells via viral envelope fusion with the plasma membrane, EHV-4 does so by an endocytic pathway which is reportedly dependent on dynamin-II, cholesterol, caveolin-1, and tyrosine kinase (Azab et al., 2013). The detailed pathogenesis of EHV-4 has not been fully uncovered but the infection mirrors that of EHV-1 at the initial stage in which the virus infects the epithelial cells of the URT and its associated lymphoid system. However, the pathogenicity, extent of virus spread and invasiveness in an infected horse are not as severe when compared to EHV-1 infection. The sequence similarity of EHV-4 with EHV-1 makes a detailed examination of EHV-4 pathogenesis useful, as this can provide clues to the molecular basis of pathogenesis of both viruses. Usually, the extent of EHV-4 infection and viral cell-to-cell spread does not occur beyond the infection of regional lymph nodes of the URT (Patel et al., 1982). The virus is normally unable to attain the level of viremia in circulating lymphocytes needed to initiate the process of abortion and neurologic syndromes seen in many cases of EHV-1 infection. However, cell-associated viremia as a result of EHV-4 has been reported (Matsumura et al., 1992) and in rare cases, EHV-4-induced abortion has been documented (Whitwell et al., 1994). The ability of EHV-4 to induce abortion, although rare, suggests that the virus can sometimes overcome host immune activity that normally limits the infection process. Over the years, many studies have focused on the evasion of host immune protection by EHV-1 in equine hosts. However, in comparison, relatively little is known about the immune evasion strategies of EHV-4. Recently, we were able to demonstrate that EHV-4 reduced type-1 interferon (IFN) production at the early onset of infection but lost this ability over time (Oladunni et al., 2018). Here, we investigated the impact of EHV-4 on host type-1 IFN signaling molecules in order to gain insight into the immune evasion strategies of EHV-4 during infection using an EEC model.
2.2. Viral infections EECs were seeded in 6-well culture plates (Corning, NY) 48 h prior to infection to obtain more than 90% confluency at the time of infection. Monolayer cells were thereafter infected with EHV-4 at an MOI of 5 for 1 h in a humidified incubator at 37 °C with 5% CO2. In parallel, cells were either mock-infected with virus diluent (negative control) or treated with 80 μg/ml of polyinosinic acid: polycytidylic acid (Poly-I:C) (positive control). The cells were then incubated with complete growth medium for 3 h, 6 h, and 12 h respectively. Cell lysates were collected at these time points to evaluate target mRNAs and proteins using real-time PCR and western blot assay respectively. All experiments were performed in duplicate and repeated on three independent days. 2.3. RNA extraction and real-time PCR assay Total cellular RNA was extracted using the QiaAmp RNeasy plus mini kit (Qiagen Inc. Valencia, CA) from EHV-4 infected and control EECs at 3 h, 6 h, and 12 h respectively according to the manufacturer’s protocol. The quantity and quality of the cellular RNA were examined by OD260/OD280 measurement using the Synergy H1 hybrid plate reader (Biotek, Winooski, VT). One microgram of total cellular RNA was reverse transcribed as described (Breathnach et al., 2006) using 0.5 μg oligo dT primer. Equal amounts of cDNA were used for the transcription analysis of different genes by TaqMan real-time PCR using primers and probes (Thermo Scientific, Pittsburgh, PA) in a ViiA™ 7 Fast Real-Time PCR system (Applied Biosystems, Foster City, CA). Details of the primers and probes used in this study are provided in Table 1. All reactions were performed in duplicate. The real-time PCR data were normalized using the equine ribosomal protein large P0 (RPLP0) transcript as an endogenous control. The PCR efficiency for all reactions was assessed by LinReg software (Ramakers et al., 2003). Fold changes in the gene expression were calculated using the comparative ΔΔCT method for relative quantification (RQ) (Livak and Schmittgen, 2001), using the average Ct value of mock-infected samples for each individual gene as the calibrator. 2.4. Western blot analysis
2. Materials and methods
Confluent EECs were infected with EHV-4 at an MOI of 5. At 30 min prior to the end of experiment, infected cells were treated with recombinant equine IFN-α (rEqIFN-α) at 1000IU/ml to stimulate phosphorylation of STAT proteins following established protocols (Johnson et al., 2008; Sarkar et al., 2016). Cells were then washed in cold PBS and solubilized in RIPA lysis buffer system (Santa Cruz, Dallas, TX) enriched with phosphatase inhibitor (Thermo Scientific, Pittsburgh, PA) on ice. Protein concentrations were determined using the BCA protein assay kit (Thermo Scientific, Pittsburgh, PA) and measured using the Synergy H1 hybrid plate reader (Biotek, Winooski, VT). Equal amount of proteins were then separated in 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and transferred onto
2.1. Cells and viruses Equine pulmonary artery endothelial cells (EECs; (Hedges et al., 2001)) were cultured in Dulbecco’s modified Eagle’s medium (DMEM, Mediatech Inc.) with 10% iron-supplemented bovine calf serum (BCS, Hyclone Laboratories, Inc., Logan, UT), 100 U/ml penicillin-streptomycin (Life Technologies, Carlsbad, CA), 1 mM sodium pyruvate, 0.1 mM non-essential amino acids and 200 mM L-glutamine (Life Technologies, Carlsbad, CA) in a humidified incubator at 37 °C with 5% CO2. The EHV-4 strain T445 (hereafter EHV-4) was previously isolated and archived by the late Dr. George P. Allen at the Maxwell H. Gluck Equine Research Center, University of Kentucky. Virus stocks of EHV-4, were prepared by infection of 90–100% confluent EECs at a multiplicity of 0.5 in DMEM in the absence of BCS as described (Oladunni et al., 2018). After the virus has produced nearly 100% cytopathic effect (CPE), the tissue culture fluid (TCF) containing the virus was freezethawed three times and clarified at 2000 x g for 30 min at 4 °C, filtered through 0.45 μm cellulose acetate membrane filters (Thermo Scientific Nunc, Pittsburgh, PA) and purified by ultracentrifugation at 100,000 x g for 4 h at 4 °C through a 20% sucrose cushion. The virus pellet was resuspended in DMEM with 2% BCS, sonicated briefly, aliquoted in 100 μl volumes and stored at −80 °C until further use. The infectious virus titer was determined by plaque assay in EECs as described (McCollum
Table 1 Primers and probes for real-time PCR. Target gene
Sequences (5’-3’) / Assay ID
EqRPLP0
Fwd: CTGATTACACCTTCCCACTTGCT Rev: AGCCACAAATGCAGATGGATCA Probe: FAM-AAGGCCTTGACCTTTTC-NFQ (Sarkar et al., 2015) Ec03467747_m1 Ec03468994_m1 AJBJX9T ARMFXCF
EqTLR3 EqTLR4 EqIRF7 EqIRF9
All primers and probes were purchased from Life Technologies, Carlsbad, CA. 2
Veterinary Immunology and Immunopathology 219 (2020) 109971
F.S. Oladunni, et al.
polyvinylidene difluoride membranes (BioRad, Hercules, CA). Membranes were blocked with 5% milk, 0.1% Tween-20 in Tris-buffered saline (TBS), and incubated overnight with the appropriate primary antibodies according to the manufacturer’s direction. The membranes were then washed and incubated with corresponding secondary antibody for 1 h at room temperature (RT). Protein bands were detected by enhanced chemiluminescence (Thermo Scientific, Pittsburgh, PA) and imaged immediately using Azure c600 (Azure Biosystems, Dublin, CA). 2.5. Antibodies and other reagents Rabbit anti-STAT1 and rabbit anti-STAT2 primary antibodies were purchased from Santa Cruz Biotechnology (Dallas, TX). Rabbit anti-βactin primary antibody, rabbit anti-phospho-STAT1 primary antibody, and goat anti-rabbit IgG secondary antibody conjugated with horseradish peroxidase (HRP) were purchased from Cell Signaling Technology (Beverly, CA). Rabbit anti-phospho-STAT2 primary antibody was purchased from Rockland Immunochemicals Inc. (Limerick, PA). Polyinosinic acid: polycytidylic acid (Poly-I:C) and lipopolysaccharide (LPS) were purchased from Invivogen (San Diego, CA) and Phosphonoacetic acid (PAA) was purchased from Fisher Scientific (Pittsburgh, PA). Recombinant equine IFN-α (rEqIFN-α) was purchased from Kingfisher Biotech, Inc. (Saint Paul, MN). 2.6. Statistical analysis Data from the study were analyzed by ANOVA with pairwise multiple comparison procedures by Tukey’s HSD test using GraphPad Prism version 6.04 (GraphPad Software, Inc., La Jolla, CA). P-Values less than 0.05 were considered to be statistically significant. 3. Results 3.1. Effect of EHV-4 on TLR expression in EECs One of the mechanisms by which the innate immune system senses impending invasion by pathogenic microorganisms is through cellular Toll-like receptors (TLR) which recognize conserved small molecular motifs known as pathogen-associated molecular patterns (PAMP) (Akira and Takeda, 2004). We first evaluated the impact of EHV-4 infection on TLR3 and TLR4, based on their reported prominent roles in the viral replication cycle (Ablasser et al., 2009; Akira et al., 2001) and their relative abundance in EECs. The kinetics of induction of TLR3/TLR4 mRNA following EHV-4 infection in EECs revealed a manner similar to the expression observed in mock-infected cells at 3, 6, and 12 hpi (Fig. 1A and B). In the presence of either TLR3 agonist (Poly-I:C) or TLR4 agonist (LPS), EHV-4 was unable to statistically significantly reduce TLR3/TLR4 mRNA at all studied time-points. These findings suggest that EHV-4 can neither induce nor inhibit TLR3/TLR4 expression in EECs at the studied time-points. An antagonistic effect of EHV-4 on TLR3 and TLR4, part of a key host cell innate immune sensing apparatus, was not evident which is in accord with our previous finding of elevated IFN-β levels in EHV-4 infected EECs at later time points (Oladunni et al., 2018).
Fig. 1. Effect of EHV-4 infection on TLR mRNA transcription. Mock-infected EECs (M, solid bars) were either treated with 80 μg/ml of Poly-I:C for A or 10 μg/ml of LPS for B (both labelled as P, clear bars) or infected at an MOI of 5 with EHV-4 in the absence (E4, checker-board bars) or presence of P (P + E4, diagonal-striped bars). At indicated time-points, the cells were lysed and equine (A) TLR3 and (B) TLR4 mRNA were quantified by real-time PCR as described in the text. Data were normalized to the levels of endogenous control equine RPLP0 mRNA at the same time point. Each bar represents the mean and standard deviation from three independent experiments. Non-significant data is denoted by ns.
3.2. Effect of EHV-4 on IFN regulatory factors (IRF)
Activated STAT1 in conjunction with activated STAT2 and IRF9 form an IFN activated transcription factor, ISGF3, which is a heterocomplex involved in IFN-α/β gene induction (Harada et al., 1996; Kawakami et al., 1995; Yoneyama et al., 1996). We recently demonstrated that EHV-1 has the ability to interfere with the phosphorylation and activation status of STAT1/STAT2 in infected EECs (Oladunni et al., 2019; Sarkar et al., 2016). To investigate whether EHV-4, similarly, interfere with the cellular abundance and activation status of STAT1/ STAT2, EECs were infected at an MOI of 5 and then treated with 1000 IU/ml of rEqIFN-α for 30 min prior to cell lysis for western immunoblotting. As a control, EECs were also infected, in parallel, with
induction of IRF9 mRNA following EHV-4 infection was slightly different. Although not statistically significant, EHV-4 appeared to induce IRF9 mRNA at 3 hpi, however this induction had declined at 6 and 12 hpi respectively (data not shown). In the presence of Poly-I:C, EHV-4 was unable to statistically significantly inhibit the expression of IRF9 mRNA at all three time-points. 3.3. Effect of EHV-4 on STAT1/STAT2 phosphorylation
Interferon regulatory factors (IRF) 3, 7, and 9 are essential factors needed for efficient transcription of diverse IFN-α/β genes which in turn promote robust antiviral immune responses (Padalino et al., 2015; Sato et al., 2000; Schindler et al., 2007; Wesoly et al., 2007). We examined the effect of EHV-4 on IRF7 and IRF9 mRNA following infection in EECs. EHV-4 induction of IRF7 mRNA was similar to what was observed in mock-infected cells at 3, 6, and 12 hpi (data not shown). The virus was also unable to statistically significantly alter IRF7 mRNA in cells stimulated with Poly-I:C at these time-points. The pattern of 3
Veterinary Immunology and Immunopathology 219 (2020) 109971
F.S. Oladunni, et al.
Fig. 2. Effect of EHV-4 infection on IFN-induced STAT1/STAT2 phosphorylation. EECs were either mock-infected (M) or infected with EHV-4 (E4) or EHV-1 (E1) at an MOI of 5 and cells were either treated or left untreated (+/- in the figure) with equine rEqIFNα at 1000 IU/ml for 30 min before lysis. The abundance of phosphorylated versus total STAT1 at (A) 3 h, (B) 6 h, and (C) 12 h or phosphorylated versus total STAT2 at (D) 3 h, (E) 6 h, and (F) 12 h were then quantified using western blot analysis. Membranes were stripped and reprobed with β-actin as a control for equal loading of samples. The western blot images were representative of 3 different blots from independent experiments.
4 was UV-inactivated in a 33 mm petri dish placed 10 cm from a 40watt UV lamp (UV Stratalinker 1800, CA) for 30 min. The inactivation of UV-treated EHV-4 was demonstrated by the absence of cytopathic effect when this was used to infect RK-13 cells. EECs were then infected with UV-inactivated EHV-4 at an equivalent dilution as the wild type (WT) EHV-4. Total cell lysates were then prepared for western immunoblotting. Mock-infected cells stimulated with 1000 IU/ml of rEqIFN-α were included as the positive control. Following 3hpi, EECs infected with UV-inactivated EHV-4 induced a level of phosphorylated STAT1/STAT2 similar to that of mock-infected cells (Fig. 3A and D). The UV-inactivated virus also failed to down-regulate phosphorylated STAT1/STAT2 when cells were co-incubated with exogenous IFN at 3 hpi. Similarly, EECs infected with UV-inactivated EHV-4 neither induced nor suppressed phosphorylation of STAT1/STAT2 in the presence of rEqIFN-α at 6 hpi (Fig. 3B and E). This trend continues at 12 hpi. EECs infected with UV-inactivated EHV-4 induced a similar level of phosphorylated STAT1/STAT2 when compared with mock-infected cells (Fig. 3C and F). The UV-inactivated EHV-4 did not hinder the phosphorylation of STAT1/STAT2 in the presence of an exogenous IFN at 12 hpi. UV-inactivated EHV-4 infection also did not alter the cellular abundance level of total STAT1/STAT2 at 3, 6, and 12 hpi. These findings suggest that active viral replication is required for EHV-4 to affect the cellular abundance of phosphorylated STAT1/STAT2 in EECs during an infection, and that proteins associated with the infecting virion particles are not responsible.
EHV-1 in the presence or absence of exogenous IFN treatment. Findings from our study revealed that EHV-4 infection failed to induce the phosphorylation of STAT1/STAT2 at 3 hpi (Fig. 2A and D). The virus also reduced phosphorylation of STAT1/ STAT2 when cells were stimulated with exogenous IFN at this time-point. By 6 hpi, EHV-4 had induced a small but detectable level of STAT1/STAT2 phosphorylation (Fig. 2B and E). However, virus infection also suppressed phosphorylation of STAT1/STAT2 that was stimulated by exogenous IFN at 6 hpi. By 12 hpi, EHV-4 infection had stimulated phosphorylation of STAT1/ STAT2 in infected EECs to levels comparable to exogenous IFN stimulation (Fig. 2C and F). At 12 hpi, there was little sign of viral suppression of exogenous IFN-stimulated phosphorylation of STAT1/STAT2. The endogenous level of total STAT1/STAT2 remained unchanged at all the three time points. Findings from our study revealed a trend of a progressive increase in the cellular abundance of phosphorylated STAT1/STAT2 in EHV-4-infected cells either in the presence or absence of an exogenous IFN treatment which differs from the pattern observed in EHV-1 infection (Oladunni et al., 2019; Sarkar et al., 2016).
3.4. Effect of UV-inactivated EHV-4 on STAT1/STAT2 phosphorylation The data above indicate that EHV-4 infection exerted a suppressive effect on endogenous levels of phosphorylated STAT1/STAT2 early in the infection process. For this reason, we next tested the hypothesis that the suppression of phosphorylated STAT1/STAT2 is dependent on an active viral replication of EHV-4 in EECs. We performed similar experiments as above, using UV-inactivated EHV-4. Briefly, purified EHV4
Veterinary Immunology and Immunopathology 219 (2020) 109971
F.S. Oladunni, et al.
Fig. 3. Effect of UV-inactivated EHV-4 on STAT1/STAT2 phosphorylation. EECs were either mock-infected (M) or infected with UV-inactivated EHV-4 (E4) at an MOI of 5 and cells were either treated or left untreated (+/- in the figure) with 1000 IU/ml of equine rEqIFN-α for 30 min before lysis. The abundance of phosphorylated versus total STAT1 at (A) 3 h, (B) 6 h, and (C) 12 h or phosphorylated versus total STAT2 at (D) 3 h, (E) 6 h, and (F) 12 h were then quantified using western blot analysis. Membranes were stripped and reprobed with β-actin as a control for equal loading of samples. Images were representative of 3 independent biological experiments.
on viral suppression of phosphorylated STAT1/STAT2. This finding is in contrast to that of EHV-1 virus that utilizes late viral genes to repress STAT1/STAT2 phosphorylation in infected EECs (Oladunni et al., 2019; Sarkar et al., 2016).
3.5. Effect of EHV-4 late gene expression on STAT1/STAT2 phosphorylation The suppression of phosphorylated STAT1/STAT2 exhibited in EHV4-infected cells was prominent at 3 hpi and 6 hpi, but not at 12 hpi. This pattern suggests a mechanism involving one or more viral early genes. To rule out dependence on EHV-4 late gene expression, we used a chemical inhibitor, Phosphonoacetic acid (PAA) (Acros Organics, NJ), to block the EHV-4 late gene expression as previously described (Sarkar et al., 2015; Sugimoto et al., 2013). We then evaluated the cellular abundance and phosphorylation of STAT1/STAT2 in EECs infected with EHV-4 in the presence or absence of PAA at different time-points by western blot. In the presence of PAA, EHV-4 failed to induce phosphorylated STAT1/STAT2 at 3 hpi (Fig. 4A and D). The PAA-treated EHV-4 also exerted a downregulating effect on phosphorylated STAT1/ STAT2 in the presence of exogenous IFN at 3 hpi. Following 6 hpi, PAAmediated blockage of EHV-4 late gene expression induced a modest level of phosphorylated STAT1/STAT2 in infected EECs (Fig. 4B and E). Also, at this time-point, PAA-treated EHV-4 suppressed the phosphorylation of STAT1/STAT2 in infected cells in a manner observed with the WT virus. At 3 and 6 hpi, the patterns observed in untreated and PAAtreated EHV-4-infected EECs were similar, indicating the involvement of early rather than late viral factors. Interestingly, PAA-treated EHV-4 induced a small level of phosphorylated STAT1/STAT2 but reduced the phosphorylation of STAT1/STAT2 stimulated by rEqIFN-α at 12 hpi (Fig. 4C and F). The endogenous level of total STAT1/STAT2 remained unchanged at all the three time-points studied. These data suggest to us that possibly some late viral genes of EHV-4 have a counteracting effect
4. Discussion The primary cellular targets of most respiratory virus infections are epithelial cells of the respiratory tract. They play an active role in the production and release of IFN-α/β which mediates antiviral innate immune responses (Muller et al., 1994) to inhibit viral replication in infected cells (Isaacs and Lindenmann, 1957). Within the lower respiratory tract, alveolar epithelial cells are in close proximity to the underlying endothelium which is thus susceptible to infection by virus particles produced by infected and damaged epithelial cells (Short et al., 2014). Previously we have demonstrated that there is a difference in the induction kinetics of IFN-β between EHV-1 and EHV-4 in EECs (Oladunni et al., 2018), a cell line related to the endothelial cells lining all blood vessels. Here, we explored the influence of EHV-4 infection on important host cell signaling molecules needed for type-I IFN production using our already established EEC model. Our present study revealed that EHV-4 lacked the potency to stimulate TLR3 and TLR4 transcription following infection in EECs. Since TLR3 and TLR4 expression is not upregulated, it is possible IFN induction by EHV-4 utilizes other sensors than the TLR family, such as those triggered by cytoplasmic recognition of viral replication; retinoic acid-inducible gene I (RIG-I), or melanoma differentiation-associated protein 5 (MDA-5) to initiate type-I IFN signaling pathways in EECs. All 5
Veterinary Immunology and Immunopathology 219 (2020) 109971
F.S. Oladunni, et al.
Fig. 4. Effect of viral late gene blockage of EHV-4 on STAT1/STAT2 phosphorylation. EECs were either mock-infected (M) or infected with EHV-4 (E4), at an MOI of 5, in the presence of PAA (300 μg/ml). Cells were then treated or left untreated (+/- in the figure) with equine rEqIFNα at 1000 IU/ml for 30 min before lysis. The abundance of phosphorylated versus total STAT1 at (A) 3 h, (B) 6 h, and (C) 12 h or phosphorylated versus total STAT2 at (D) 3 h, (E) 6 h, and (F) 12 h were then quantified using western blot analysis. Membranes were stripped and reprobed with β-actin as a control for equal loading of samples. The western blot images were representative of 3 different blots from independent experiments.
infection of EECs, the endogenous level of IRF7 remained fairly abundant and capable of transactivating type-I IFN inducible genes. Our finding is in contrast to that of Zhu et al., who found that the ORF45 of KSHV interacts with IRF7 and inhibits its phosphorylation and nuclear accumulation (Zhu et al., 2002). It is also dissimilar to herpes simplex virus type1 (HSV-1) which blocks IFN regulatory factor IRF3- and IRF7mediated activation of IFN-stimulated genes using its ICP0 RING finger domain (Lin et al., 2004). These examples are pointers to the anti-IFN mechanisms utilized by other herpesviruses to promote virus replication in their respective hosts. EHV-4, however, apparently lacks a similar capacity due to its inability to inhibit IRF7 which is required, together with IRF3, for inducing type-I IFN genes. Our data also showed that EHV-4 was unable to down-regulate IRF9 mRNA when cells were stimulated with Poly-I:C at all time points. Degradation of the cellular level of IRF9 and subsequent blocking of its nuclear translocation to prevent the formation of IFN stimulated gene factor3 (ISGF3) complex is an IFN-evasive mechanism utilized by many other herpesviruses (Miller et al., 1998, 1999). Since both IRF7 and IRF9 play significant roles in the induction phase of type-I IFN production, we speculate that the inability of EHV-4 to down-regulate these two key transcription factors may account for its lack of suppressive effect on type-I IFN in EECs (Oladunni et al., 2018). Importantly, EHV-4 failed to induce any significant phosphorylation of STAT1/STAT2 early during infection at 3 h. At this same time-point, the virus had statistically significantly suppressed the phosphorylation of STAT1/STAT2 when cells were co-incubated with exogenous IFN. However, our data did show that induction of phosphorylation of STAT1/STAT2 in response to EHV-4 infection increased over time while
DNA viruses, including EHV-4, are known to produce dsRNA by convergent transcription and thus could activate IFN-inducible dsRNAdependent protein kinase R (PKR), and possibly RIG-I or MDA-5 (Bowie and Unterholzner, 2008). In addition, EHV-4 did not have the capacity to suppress TLR3 and TLR4 transcription. This is unlike most other herpesviruses. For example, we demonstrated that the molecular mechanism of suppression of type-I IFN induction by EHV-1, a virus closely related to EHV-4, involves the virus first downregulating TLR3 and TLR4 transcription in EECs (Oladunni et al., 2019). Also, TLR4 mRNA levels and protein expression are significantly downregulated upon primary Kaposi sarcoma-associated herpesvirus (KSHV) infection of human lymphatic endothelial cells (Lagos et al., 2008). EHV-4 did not inhibit TLR3 and TLR4 expression, so we do not envisage an antagonistic response to the effectiveness of synthetic TLR agonists like PolyI:C were such to be administered as immune adjuvants when vaccinating against EHV-4 infection. It is possible that EHV-4 did not affect TLR3/4 receptor expression but that the virus interferes with the expression of TLR-mediated signaling molecules. However, the lack of equine specific antibodies such as anti-TRIF hindered our ability to test this hypothesis. We hope such reagents will become available for study of the effect of EHV-4 on downstream adapter proteins mediating TLR3/4 signaling during infection of EECs. Transcription factors involved in IFN production are activated when a virus is initially detected. Activated transcription factors, such as IRF7, subsequently translocate to the nucleus and interact with IFN promoter sequences, leading to the upregulation of IFN genes (Zhu et al., 2002). Data from our study showed that EHV-4 was unable to affect IRF7 transcription. These data suggest that during EHV-4 6
Veterinary Immunology and Immunopathology 219 (2020) 109971
F.S. Oladunni, et al.
the viral suppressive effect on phosphorylated STAT1/STAT2 by exogenous IFN was lost as infection progressed. We believe that the inability of EHV-4 infected cells to induce STAT1/STAT2 phosphorylation at both 3 and 6 hpi even in the presence of exogenous IFN will downregulate IFN induction at early time-points, as we previously observed (Oladunni et al., 2018). We also showed that the ability to inhibit the phosphorylation of STAT1/STAT2 by EHV-4 requires de novo viral DNA synthesis. UV-inactivation of EHV-4 abolished the suppressive effects on STAT1/STAT2 phosphorylation that were profoundly present during the early onset of WT virus infection at 3 and 6 h. The possibility remains that the UV-inactivation step had some effects on EHV-4 primary transcription which may have downstream effect on STAT phosphorylation. The striking difference in the phenotypes of STAT1/STAT2 phosphorylation in EECs infected with EHV-4 either in the presence or absence of PAA treatment occurred at 12 hpi. Data suggested that one or more early viral genes of EHV-4 were needed for suppression of STAT1/STAT2 phosphorylation, but by the later period this activity has worn off. One major shortfall of our study is our inability to demonstrate whether EHV-4 alters the protein levels of studied TLRs and IRFs due to lack of equine-specific antibodies. We hope that future studies will be able to address this limitation to uncover the impact of EHV-4 on posttranscriptional levels of these factors. The inability of EHV-4 to exert a negative influence on key molecules of type-I IFN response may also be directly related to its reduced pathogenicity when compared to EHV-1 explaining why EHV-4 infection is mostly restricted to the URT. In a different study, Vandekerckhove et al., (Vandekerckhove et al., 2011) reported a reduced lateral spread of EHV-4 in nasal mucosal epithelium when compared to EHV-1 suggesting the inability of EHV-4 to inhibit the antiviral effects of type-I IFNs in mucosal epithelial cells. We are currently studying equine tracheal explants to see how they compare with EECs in regard to immunomodulatory effects of EHV-4. This striking difference in the pathogenic potential between EHV-1 and EHV-4 provides additional evidence for the lesser severity of respiratory signs observed, in vivo, during EHV-4 infection (Heldens et al., 2001; Patel et al., 2003; Patel and Heldens, 2005).
receptor signalling. Nat. Rev. Immunol. 8, 911. Breathnach, C., Sturgill-Wright, T., Stiltner, J., Adams, A., Lunn, D., Horohov, D., 2006. Foals are interferon gamma-deficient at birth. Vet. Immunol. Immunopathol. 112, 199–209. Campadelli-Fiume, G., Menotti, L., 2007. Entry of Alphaherpesviruses Into the Cell. Davison, A.J., Eberle, R., Ehlers, B., Hayward, G.S., McGeoch, D.J., Minson, A.C., Pellett, P.E., Roizman, B., Studdert, M.J., Thiry, E., 2009. The order herpesvirales. Arch. Virol. 154, 171–177. Geraghty, R.J., Krummenacher, C., Cohen, G.H., Eisenberg, R.J., Spear, P.G.J.S., 1998. Entry of Alphaherpesviruses Mediated by Poliovirus Receptor-Related Protein 1 and Poliovirus Receptor 280. pp. 1618–1620. Harada, H., Matsumoto, M., Sato, M., Kashiwazaki, Y., Kimura, T., Kitagawa, M., Yokochi, T., Sok‐Pin Tan, R., Takasugi, T., Kadokawa, Y., 1996. Regulation of IFN‐α/β genes: evidence for a dual function of the transcription factor complex ISGF3 in the production and action of IFN‐α/β. Genes Cells 1, 995–1005. Hedges, J.F., Demaula, C.D., Moore, B.D., Mclaughlin, B.E., Simon, S.I., Maclachlan, N.J., 2001. Characterization of equine E‐selectin. Immunology 103, 498–504. Heldens, J.G., Hannant, D., Cullinane, A.A., Prendergast, M.J., Mumford, J.A., Nelly, M., Kydd, J.H., Weststrate, M.W., van den Hoven, R.J.V., 2001. Clinical and Virological Evaluation of the Efficacy of an Inactivated EHV1 and EHV4 Whole Virus Vaccine (Duvaxyn EHV1, 4). Vaccination/challenge Experiments in Foals and Pregnant Mares 19. pp. 4307–4317. Hutchinson, L., Browne, H., Wargent, V., Davis-Poynter, N., Primorac, S., Goldsmith, K., Minson, A., Johnson, D.J.J., 1992. A Novel Herpes simplex Virus Glycoprotein, gL, Forms a Complex With Glycoprotein H (gH) and Affects Normal Folding and Surface Expression of gH 66. pp. 2240–2250. Isaacs, A., Lindenmann, J., 1957. Virus interference. I. The interferon. Proc. R. Soc. Lond. B 147, 258–267. Johnson, K.E., Song, B., Knipe, D.M., 2008. Role for herpes simplex virus 1 ICP27 in the inhibition of type I interferon signaling. Virology 374, 487–494. Kawakami, T., Matsumoto, M., Sato, M., Harada, H., Taniguchi, T., Kitagawa, M., 1995. Possible involvement of the transcription factor ISGF3γ in virus‐induced expression of the IFN‐β gene. FEBS Lett. 358, 225–229. Lagos, D., Vart, R.J., Gratrix, F., Westrop, S.J., Emuss, V., Wong, P.-P., Robey, R., Imami, N., Bower, M., Gotch, F., 2008. Toll-like receptor 4 mediates innate immunity to Kaposi sarcoma herpesvirus. Cell Host Microbe 4, 470–483. Lin, R., Noyce, R.S., Collins, S.E., Everett, R.D., Mossman, K.L., 2004. The herpes simplex virus ICP0 RING finger domain inhibits IRF3-and IRF7-mediated activation of interferon-stimulated genes. J. Virol. 78, 1675–1684. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2− ΔΔCT method. Methods 25, 402–408. Matsumura, T., Sugiura, T., Imagawa, H., Fukunaga, Y., Kamada, M., 1992. Epizootiological aspects of type 1 and type 4 equine herpesvirus infections among horse populations. J. Vet. Med. Sci. 54, 207–211. McCollum, W., Cheatham, J., Doll, E., Wilson, J., 1962. Isolation and propagation of equine arteritis virus in monolayer cell cultures of rabbit kidney. Cornell Vet. 52 452&. Mercer, J., Schelhaas, M., Helenius, A.J.A., 2010. Virus Entry by Endocytosis 79. pp. 803–833. Miller, D.M., Rahill, B.M., Boss, J.M., Lairmore, M.D., Durbin, J.E., Waldman, J.W., Sedmak, D.D., 1998. Human cytomegalovirus inhibits major histocompatibility complex class II expression by disruption of the Jak/Stat pathway. J. Exp. Med. 187, 675–683. Miller, D.M., Zhang, Y., Rahill, B.M., Waldman, W.J., Sedmak, D.D., 1999. Human cytomegalovirus inhibits IFN-α-stimulated antiviral and immunoregulatory responses by blocking multiple levels of IFN-α signal transduction. J. Immunol. 162, 6107–6113. Muller, U., Steinhoff, U., Reis, L., Hemmi, S., Pavlovic, J., Zinkernagel, R.M., Aguet, M., 1994. Functional role of type I and type II interferons in antiviral defense. Science 264, 1918–1921. Oladunni, F., Sarkar, S., Reedy, S., Balasuriya, U., Horohov, D., Chambers, T., 2018. Absence of relationship between type-I interferon suppression and neuropathogenicity of EHV-1. Vet. Immunol. Immunopathol. 197, 24–30. Oladunni, F.S., Sarkar, S., Reedy, S., Balasuriya, U.B., Horohov, D.W., Chambers, T.M.J.J., 2019. Equine herpesvirus 1 targets the sensitization and induction steps to inhibit the Type I interferon response in equine endothelial cells. JVI 01342-01319. Osterrieder, N., Van de Walle, G.R., 2010. Pathogenic potential of equine alphaherpesviruses: the importance of the mononuclear cell compartment in disease outcome. Vet. Microbiol. 143, 21–28. Padalino, B., Muscat, K.E., Ficorilli, N., Hartley, C.A., Raidal, S.L., Knight, P., Celi, P., Gilkerson, J.R., Muscatello, G., 2015. Equine herpesviruses in the transported horse. Proceedings of the 37th Bain Fallon Memorial Lectures, Reproduction - Podiatry and Lameness - Foal Medicine and Surgery, 19-24 July 2015, Lovedale, New South Wales, Australia, 15. Patel, J., Edington, N., Mumford, J., 1982. Variation in cellular tropism between isolates of equine herpesvirus-1 in foals. Arch. Virol. 74, 41–51. Patel, J., Földi, J., Bateman, H., Williams, J., Didlick, S., Stark, R.J.V., 2003. Equid Herpesvirus (EHV-1) Live Vaccine Strain C147: Efficacy Against Respiratory Diseases Following EHV Types 1 and 4 Challenges 92. pp. 1–17. Patel, J., Heldens, J., 2005. Equine herpesviruses 1 (EHV-1) and 4 (EHV-4)–epidemiology, disease and immunoprophylaxis: a brief review. Vet. J. 170, 14–23. Ramakers, C., Ruijter, J.M., Deprez, R.H.L., Moorman, A.F., 2003. Assumption-free analysis of quantitative real-time polymerase chain reaction (PCR) data. Neurosci. Lett. 339, 62–66. Sabine, M., Robertson, G., Whalley, J., 1981. Differentiation of sub‐types of equine herpesvirus I by restriction endonuclease analysis. Aust. Vet. J. 57, 148–149.
Declaration for Competing Interest None of the authors of this paper has a financial or personal relationship that could inappropriately influence or bias the content of this publication. Acknowledgment Fatai S. Oladunni was supported by a grant from the American Quarter Horse Association Young Investigator Award and by a fellowship from the Geoffrey C. Hughes Foundation. This work was supported in part by a grant from the Equine Drug Research Council of the Kentucky Horse Racing Commission. The work is part of a project of the Kentucky Agricultural Experiment Station (KY014053), supported by the National Institute of Food and Agriculture, U.S. Department of Agriculture, Animal Health Program. References Ablasser, A., Bauernfeind, F., Hartmann, G., Latz, E., Fitzgerald, K.A., Hornung, V., 2009. RIG-I-dependent sensing of poly (dA: dT) through the induction of an RNA polymerase III–transcribed RNA intermediate. Nat. Immunol. 10, 1065–1072. Akira, S., Takeda, K., 2004. Toll-like receptor signalling. Nat. Rev. Immunol. 4, 499. Akira, S., Takeda, K., Kaisho, T., 2001. Toll-like receptors: critical proteins linking innate and acquired immunity. Nat. Immunol. 2, 675–680. Allen, G.P., Slater, J.D., Smith, K.C., 2002. In: Coetzer, J. (Ed.), In Infectious Diseases of Livestock. Oxford University Press, Capetown 2002. Azab, W., Lehmann, M.J., Osterrieder, N., 2013. Glycoprotein H and α4β1-integrins determine the entry pathway of alphaherpesviruses. Journal of virology, JVI 0352203512. Bowie, A.G., Unterholzner, L., 2008. Viral evasion and subversion of pattern-recognition
7
Veterinary Immunology and Immunopathology 219 (2020) 109971
F.S. Oladunni, et al.
Telford, E., Watson, M.S., Perry, J., Cullinane, A.A., Davison, A.J., 1998. The DNA sequence of equine herpesvirus-4. J. Gen. Virol. 79, 1197–1203. Telford, E.A., Watson, M.S., McBride, K., Davison, A.J., 1992. The DNA sequence of equine herpesvirus-1. Virology 189, 304–316. Vandekerckhove, A.P., Glorieux, S., Gryspeerdt, A., Steukers, L., Van Doorsselaere, J., Osterrieder, N., Van de Walle, G., Nauwynck, H., 2011. Equine alphaherpesviruses (EHV-1 and EHV-4) differ in their efficiency to infect mononuclear cells during early steps of infection in nasal mucosal explants. Vet. Microbiol. 152, 21–28. Wesoly, J., Szweykowska-Kulinska, Z., Bluyssen, H.A., 2007. STAT activation and differential complex formation dictate selectivity of interferon responses. Acta Bioch. Polonica-English Ed. 54, 27. Whalley, J., Ruitenberg, K., Sullivan, K., Seshadri, L., Hansen, K., Birch, D., Gilkerson, J., Wellington, J., 2007. Host cell tropism of equine herpesviruses: glycoprotein D of EHV-1 enables EHV-4 to infect a non-permissive cell line. Arch. Virol. 152, 717–725. Whitwell, K., Smith, K., Sinclair, R., Mumford, J., 1994. Foetal Lesions in Spontaneous EHV-4 Abortion in Mares. Yoneyama, M., Suhara, W., Fukuhara, Y., Sato, M., Ozato, K., Fujita, T., 1996. Autocrine amplification of type I interferon gene expression mediated by interferon stimulated gene factor 3 (ISGF3). J. Biochem. 120, 160–169. Zhu, F.X., King, S.M., Smith, E.J., Levy, D.E., Yuan, Y., 2002. A Kaposi’s sarcoma-associated herpesviral protein inhibits virus-mediated induction of type I interferon by blocking IRF-7 phosphorylation and nuclear accumulation. Proc. Natl. Acad. Sci. 99, 5573–5578.
Sarkar, S., Balasuriya, U.B., Horohov, D.W., Chambers, T.M., 2015. Equine herpesvirus-1 suppresses type-I interferon induction in equine endothelial cells. Vet. Immunol. Immunopathol. 167, 122–129. Sarkar, S., Balasuriya, U.B., Horohov, D.W., Chambers, T.M., 2016. The neuropathogenic T953 strain of equine herpesvirus-1 inhibits type-I IFN mediated antiviral activity in equine endothelial cells. Vet. Microbiol. 183, 110–118. Sato, M., Suemori, H., Hata, N., Asagiri, M., Ogasawara, K., Nakao, K., Nakaya, T., Katsuki, M., Noguchi, S., Tanaka, N., 2000. Distinct and essential roles of transcription factors IRF-3 and IRF-7 in response to viruses for IFN-α/β gene induction. Immunity 13, 539–548. Schindler, C., Levy, D.E., Decker, T., 2007. JAK-STAT signaling: from interferons to cytokines. J. Biol. Chem. 282, 20059–20063. Short, K.R., Veldhuis Kroeze, E.J., Reperant, L.A., Richard, M., Kuiken, T., 2014. Influenza virus and endothelial cells: a species specific relationship. Front. Microbiol. 5, 653. Shukla, D., Liu, J., Blaiklock, P., Shworak, N.W., Bai, X., Esko, J.D., Cohen, G.H., Eisenberg, R.J., Rosenberg, R.D., Spear, P.G.J.C., 1999. A Novel Role for 3-O-Sulfated Heparan Sulfate in Herpes simplex Virus 1 Entry 99. pp. 13–22. Studdert, M., Simpson, T., Roizman, B., 1981. Differentiation of respiratory and abortigenic isolates of equine herpesvirus 1 by restriction endonucleases. Science 214, 562–564. Sugimoto, A., Sato, Y., Kanda, T., Murata, T., Narita, Y., Kawashima, D., Kimura, H., Tatsuya, T., 2013. Different distributions of Epstein-Barr virus early and late gene transcripts within viral replication compartments. Journal of virology, JVI 0021900213.
8
Contents lists available at ScienceDirect
Veterinary Immunology and Immunopathology journal homepage: www.elsevier.com/locate/vetimm
Research paper
The effect of equine herpesvirus type 4 on type-I interferon signaling molecules
T
Fatai S. Oladunnia,c,*, Stephanie Reedya, Udeni B.R. Balasuriyab, David W. Horohova, Thomas M. Chambersa a
Maxwell H. Gluck Equine Research Center, Department of Veterinary Science, University of Kentucky, Lexington, KY 40546, USA Louisiana Animal Disease Diagnostic Laboratory and Department of Pathobiological Sciences, School of Veterinary Medicine, Louisiana State University, Baton Rouge, LA 70803, USA c Department of Veterinary Microbiology, University of Ilorin, Ilorin, Nigeria b
A R T I C LE I N FO
A B S T R A C T
Keywords: EHV-4 STAT1 STAT2 Innate immunity Type-I interferon
Equine herpesvirus type 4 (EHV-4) is mildly pathogenic but is a common cause of respiratory disease in horses worldwide. We previously demonstrated that unlike EHV-1, EHV-4 is not a potent inducer of type-I IFN and does not suppress that IFN response, especially during late infection, when compared to EHV-1 infection in equine endothelial cells (EECs). Here, we investigated the impact of EHV-4 infection in EECs on type-I IFN signaling molecules at 3, 6, and 12 hpi. Findings from our study revealed that EHV-4 did not induce nor suppress TLR3 and TLR4 expression in EECs at all the studied time points. EHV-4 was able to induce variable amounts of IRF7 and IRF9 in EECs with no evidence of suppressive effect on these important transcription factors of IFN-α/β induction. Intriguingly, EHV-4 did interfere with the phosphorylation of STAT1/STAT2 at 3 hpi and 6 hpi, less so at 12 hpi. An active EHV-4 viral gene expression was required for the suppressive effect of EHV-4 on STAT1/ STAT2 phosphorylation during early infection. One or more early viral genes of EHV-4 are involved in the suppression of STAT1/STAT2 phosphorylation observed during early time points in EHV-4-infected EECs. The inability of EHV-4 to significantly down-regulate key molecules of type-I IFN signaling may be related to the lower severity of pathogenesis when compared with EHV-1. Harnessing this knowledge may prove useful in controlling future outbreaks of the disease.
1. Introduction Equine herpesvirus 4 (EHV-4) is a ubiquitous virus relevant for its ability to cause clinically significant upper respiratory tract (URT) disease in horse populations worldwide. This virus, along with EHV-1, has been found for over 80 years to be the most common herpesviruses impeding successful breeding, competition, and recreational horse industries all around the world (Allen et al., 2002). EHV-4 belongs to the genus Varicellovirus of the subfamily Alphaherpesvirinae (Davison et al., 2009). The virus was considered as subtype 2 of EHV-1 and known as the same virus until 1981 when DNA sequence information indicated otherwise (Sabine et al., 1981; Studdert et al., 1981). EHV-4 has a genome size of about 146-kbp and encodes 76 ORF, with three of those genes duplicated (Telford et al., 1998). The genomic architecture of EHV-4 comprises a linear double-stranded, DNA organized into a long unique segment (UL, 112,398 bp) flanked by a short inverted repeat sequence (TRL/IRL, 27 bp) and a short unique segment (US, 12,789 bp)
⁎
that is flanked by a large inverted repeat sequence (TRS/IRS, 10,178 bp) (Allen et al., 2002; Telford et al., 1998). The level of nucleotide identity between EHV-1 and EHV-4, within individual homologous genes, ranges from 55 to 84% while the amino acid sequence identity ranges from 55 to 96% (Telford et al., 1998, 1992). Despite the close relatedness of EHV-4 to EHV-1, the genetic differences between the two viruses are sufficient to affect their host range and disease phenotypes. EHV-4 mostly infect the URT of horses causing respiratory syndromes, whereas EHV-1 has a more diverse host range and causes pathologies including respiratory disease, abortion and equine herpesviral myeloencephalopathy (EHM) (Patel and Heldens, 2005). Unlike EHV-1, EHV-4 has a streamlined host range and the virus can efficiently infect only equine cells; it replicates only poorly in a few other cell lines (Whalley et al., 2007). Lytic infection by EHV-4 is thought to mainly occur in the epithelial cells of the URT, although equine endothelial cells (EEC) are also permissive to EHV-4 infection (Osterrieder and Van de Walle, 2010). Alphaherpesviruses have been
Corresponding author. E-mail address: [email protected] (F.S. Oladunni).
https://doi.org/10.1016/j.vetimm.2019.109971 Received 13 June 2019; Received in revised form 2 October 2019; Accepted 26 October 2019 0165-2427/ © 2019 Elsevier B.V. All rights reserved.
Veterinary Immunology and Immunopathology 219 (2020) 109971
F.S. Oladunni, et al.
et al., 1962).
demonstrated to enter different cell types by different pathways that, mostly, utilize similar viral glycoproteins, namely, glycoprotein D (gD), gB, gH, and gL, in conjunction with host cellular receptors and co-receptors (Campadelli-Fiume and Menotti, 2007; Geraghty et al., 1998; Hutchinson et al., 1992; Mercer et al., 2010; Shukla et al., 1999). The major viral component that defines the differential cellular tropism between EHV-1 and EHV-4 has been found to be gD. An exchange of gD of EHV-1 for that of EHV-4 was able to enhance EHV-4 entry in an originally non-permissive cell (Azab et al., 2013). Unlike many alphaherpesviruses that enter endothelial cells via viral envelope fusion with the plasma membrane, EHV-4 does so by an endocytic pathway which is reportedly dependent on dynamin-II, cholesterol, caveolin-1, and tyrosine kinase (Azab et al., 2013). The detailed pathogenesis of EHV-4 has not been fully uncovered but the infection mirrors that of EHV-1 at the initial stage in which the virus infects the epithelial cells of the URT and its associated lymphoid system. However, the pathogenicity, extent of virus spread and invasiveness in an infected horse are not as severe when compared to EHV-1 infection. The sequence similarity of EHV-4 with EHV-1 makes a detailed examination of EHV-4 pathogenesis useful, as this can provide clues to the molecular basis of pathogenesis of both viruses. Usually, the extent of EHV-4 infection and viral cell-to-cell spread does not occur beyond the infection of regional lymph nodes of the URT (Patel et al., 1982). The virus is normally unable to attain the level of viremia in circulating lymphocytes needed to initiate the process of abortion and neurologic syndromes seen in many cases of EHV-1 infection. However, cell-associated viremia as a result of EHV-4 has been reported (Matsumura et al., 1992) and in rare cases, EHV-4-induced abortion has been documented (Whitwell et al., 1994). The ability of EHV-4 to induce abortion, although rare, suggests that the virus can sometimes overcome host immune activity that normally limits the infection process. Over the years, many studies have focused on the evasion of host immune protection by EHV-1 in equine hosts. However, in comparison, relatively little is known about the immune evasion strategies of EHV-4. Recently, we were able to demonstrate that EHV-4 reduced type-1 interferon (IFN) production at the early onset of infection but lost this ability over time (Oladunni et al., 2018). Here, we investigated the impact of EHV-4 on host type-1 IFN signaling molecules in order to gain insight into the immune evasion strategies of EHV-4 during infection using an EEC model.
2.2. Viral infections EECs were seeded in 6-well culture plates (Corning, NY) 48 h prior to infection to obtain more than 90% confluency at the time of infection. Monolayer cells were thereafter infected with EHV-4 at an MOI of 5 for 1 h in a humidified incubator at 37 °C with 5% CO2. In parallel, cells were either mock-infected with virus diluent (negative control) or treated with 80 μg/ml of polyinosinic acid: polycytidylic acid (Poly-I:C) (positive control). The cells were then incubated with complete growth medium for 3 h, 6 h, and 12 h respectively. Cell lysates were collected at these time points to evaluate target mRNAs and proteins using real-time PCR and western blot assay respectively. All experiments were performed in duplicate and repeated on three independent days. 2.3. RNA extraction and real-time PCR assay Total cellular RNA was extracted using the QiaAmp RNeasy plus mini kit (Qiagen Inc. Valencia, CA) from EHV-4 infected and control EECs at 3 h, 6 h, and 12 h respectively according to the manufacturer’s protocol. The quantity and quality of the cellular RNA were examined by OD260/OD280 measurement using the Synergy H1 hybrid plate reader (Biotek, Winooski, VT). One microgram of total cellular RNA was reverse transcribed as described (Breathnach et al., 2006) using 0.5 μg oligo dT primer. Equal amounts of cDNA were used for the transcription analysis of different genes by TaqMan real-time PCR using primers and probes (Thermo Scientific, Pittsburgh, PA) in a ViiA™ 7 Fast Real-Time PCR system (Applied Biosystems, Foster City, CA). Details of the primers and probes used in this study are provided in Table 1. All reactions were performed in duplicate. The real-time PCR data were normalized using the equine ribosomal protein large P0 (RPLP0) transcript as an endogenous control. The PCR efficiency for all reactions was assessed by LinReg software (Ramakers et al., 2003). Fold changes in the gene expression were calculated using the comparative ΔΔCT method for relative quantification (RQ) (Livak and Schmittgen, 2001), using the average Ct value of mock-infected samples for each individual gene as the calibrator. 2.4. Western blot analysis
2. Materials and methods
Confluent EECs were infected with EHV-4 at an MOI of 5. At 30 min prior to the end of experiment, infected cells were treated with recombinant equine IFN-α (rEqIFN-α) at 1000IU/ml to stimulate phosphorylation of STAT proteins following established protocols (Johnson et al., 2008; Sarkar et al., 2016). Cells were then washed in cold PBS and solubilized in RIPA lysis buffer system (Santa Cruz, Dallas, TX) enriched with phosphatase inhibitor (Thermo Scientific, Pittsburgh, PA) on ice. Protein concentrations were determined using the BCA protein assay kit (Thermo Scientific, Pittsburgh, PA) and measured using the Synergy H1 hybrid plate reader (Biotek, Winooski, VT). Equal amount of proteins were then separated in 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and transferred onto
2.1. Cells and viruses Equine pulmonary artery endothelial cells (EECs; (Hedges et al., 2001)) were cultured in Dulbecco’s modified Eagle’s medium (DMEM, Mediatech Inc.) with 10% iron-supplemented bovine calf serum (BCS, Hyclone Laboratories, Inc., Logan, UT), 100 U/ml penicillin-streptomycin (Life Technologies, Carlsbad, CA), 1 mM sodium pyruvate, 0.1 mM non-essential amino acids and 200 mM L-glutamine (Life Technologies, Carlsbad, CA) in a humidified incubator at 37 °C with 5% CO2. The EHV-4 strain T445 (hereafter EHV-4) was previously isolated and archived by the late Dr. George P. Allen at the Maxwell H. Gluck Equine Research Center, University of Kentucky. Virus stocks of EHV-4, were prepared by infection of 90–100% confluent EECs at a multiplicity of 0.5 in DMEM in the absence of BCS as described (Oladunni et al., 2018). After the virus has produced nearly 100% cytopathic effect (CPE), the tissue culture fluid (TCF) containing the virus was freezethawed three times and clarified at 2000 x g for 30 min at 4 °C, filtered through 0.45 μm cellulose acetate membrane filters (Thermo Scientific Nunc, Pittsburgh, PA) and purified by ultracentrifugation at 100,000 x g for 4 h at 4 °C through a 20% sucrose cushion. The virus pellet was resuspended in DMEM with 2% BCS, sonicated briefly, aliquoted in 100 μl volumes and stored at −80 °C until further use. The infectious virus titer was determined by plaque assay in EECs as described (McCollum
Table 1 Primers and probes for real-time PCR. Target gene
Sequences (5’-3’) / Assay ID
EqRPLP0
Fwd: CTGATTACACCTTCCCACTTGCT Rev: AGCCACAAATGCAGATGGATCA Probe: FAM-AAGGCCTTGACCTTTTC-NFQ (Sarkar et al., 2015) Ec03467747_m1 Ec03468994_m1 AJBJX9T ARMFXCF
EqTLR3 EqTLR4 EqIRF7 EqIRF9
All primers and probes were purchased from Life Technologies, Carlsbad, CA. 2
Veterinary Immunology and Immunopathology 219 (2020) 109971
F.S. Oladunni, et al.
polyvinylidene difluoride membranes (BioRad, Hercules, CA). Membranes were blocked with 5% milk, 0.1% Tween-20 in Tris-buffered saline (TBS), and incubated overnight with the appropriate primary antibodies according to the manufacturer’s direction. The membranes were then washed and incubated with corresponding secondary antibody for 1 h at room temperature (RT). Protein bands were detected by enhanced chemiluminescence (Thermo Scientific, Pittsburgh, PA) and imaged immediately using Azure c600 (Azure Biosystems, Dublin, CA). 2.5. Antibodies and other reagents Rabbit anti-STAT1 and rabbit anti-STAT2 primary antibodies were purchased from Santa Cruz Biotechnology (Dallas, TX). Rabbit anti-βactin primary antibody, rabbit anti-phospho-STAT1 primary antibody, and goat anti-rabbit IgG secondary antibody conjugated with horseradish peroxidase (HRP) were purchased from Cell Signaling Technology (Beverly, CA). Rabbit anti-phospho-STAT2 primary antibody was purchased from Rockland Immunochemicals Inc. (Limerick, PA). Polyinosinic acid: polycytidylic acid (Poly-I:C) and lipopolysaccharide (LPS) were purchased from Invivogen (San Diego, CA) and Phosphonoacetic acid (PAA) was purchased from Fisher Scientific (Pittsburgh, PA). Recombinant equine IFN-α (rEqIFN-α) was purchased from Kingfisher Biotech, Inc. (Saint Paul, MN). 2.6. Statistical analysis Data from the study were analyzed by ANOVA with pairwise multiple comparison procedures by Tukey’s HSD test using GraphPad Prism version 6.04 (GraphPad Software, Inc., La Jolla, CA). P-Values less than 0.05 were considered to be statistically significant. 3. Results 3.1. Effect of EHV-4 on TLR expression in EECs One of the mechanisms by which the innate immune system senses impending invasion by pathogenic microorganisms is through cellular Toll-like receptors (TLR) which recognize conserved small molecular motifs known as pathogen-associated molecular patterns (PAMP) (Akira and Takeda, 2004). We first evaluated the impact of EHV-4 infection on TLR3 and TLR4, based on their reported prominent roles in the viral replication cycle (Ablasser et al., 2009; Akira et al., 2001) and their relative abundance in EECs. The kinetics of induction of TLR3/TLR4 mRNA following EHV-4 infection in EECs revealed a manner similar to the expression observed in mock-infected cells at 3, 6, and 12 hpi (Fig. 1A and B). In the presence of either TLR3 agonist (Poly-I:C) or TLR4 agonist (LPS), EHV-4 was unable to statistically significantly reduce TLR3/TLR4 mRNA at all studied time-points. These findings suggest that EHV-4 can neither induce nor inhibit TLR3/TLR4 expression in EECs at the studied time-points. An antagonistic effect of EHV-4 on TLR3 and TLR4, part of a key host cell innate immune sensing apparatus, was not evident which is in accord with our previous finding of elevated IFN-β levels in EHV-4 infected EECs at later time points (Oladunni et al., 2018).
Fig. 1. Effect of EHV-4 infection on TLR mRNA transcription. Mock-infected EECs (M, solid bars) were either treated with 80 μg/ml of Poly-I:C for A or 10 μg/ml of LPS for B (both labelled as P, clear bars) or infected at an MOI of 5 with EHV-4 in the absence (E4, checker-board bars) or presence of P (P + E4, diagonal-striped bars). At indicated time-points, the cells were lysed and equine (A) TLR3 and (B) TLR4 mRNA were quantified by real-time PCR as described in the text. Data were normalized to the levels of endogenous control equine RPLP0 mRNA at the same time point. Each bar represents the mean and standard deviation from three independent experiments. Non-significant data is denoted by ns.
3.2. Effect of EHV-4 on IFN regulatory factors (IRF)
Activated STAT1 in conjunction with activated STAT2 and IRF9 form an IFN activated transcription factor, ISGF3, which is a heterocomplex involved in IFN-α/β gene induction (Harada et al., 1996; Kawakami et al., 1995; Yoneyama et al., 1996). We recently demonstrated that EHV-1 has the ability to interfere with the phosphorylation and activation status of STAT1/STAT2 in infected EECs (Oladunni et al., 2019; Sarkar et al., 2016). To investigate whether EHV-4, similarly, interfere with the cellular abundance and activation status of STAT1/ STAT2, EECs were infected at an MOI of 5 and then treated with 1000 IU/ml of rEqIFN-α for 30 min prior to cell lysis for western immunoblotting. As a control, EECs were also infected, in parallel, with
induction of IRF9 mRNA following EHV-4 infection was slightly different. Although not statistically significant, EHV-4 appeared to induce IRF9 mRNA at 3 hpi, however this induction had declined at 6 and 12 hpi respectively (data not shown). In the presence of Poly-I:C, EHV-4 was unable to statistically significantly inhibit the expression of IRF9 mRNA at all three time-points. 3.3. Effect of EHV-4 on STAT1/STAT2 phosphorylation
Interferon regulatory factors (IRF) 3, 7, and 9 are essential factors needed for efficient transcription of diverse IFN-α/β genes which in turn promote robust antiviral immune responses (Padalino et al., 2015; Sato et al., 2000; Schindler et al., 2007; Wesoly et al., 2007). We examined the effect of EHV-4 on IRF7 and IRF9 mRNA following infection in EECs. EHV-4 induction of IRF7 mRNA was similar to what was observed in mock-infected cells at 3, 6, and 12 hpi (data not shown). The virus was also unable to statistically significantly alter IRF7 mRNA in cells stimulated with Poly-I:C at these time-points. The pattern of 3
Veterinary Immunology and Immunopathology 219 (2020) 109971
F.S. Oladunni, et al.
Fig. 2. Effect of EHV-4 infection on IFN-induced STAT1/STAT2 phosphorylation. EECs were either mock-infected (M) or infected with EHV-4 (E4) or EHV-1 (E1) at an MOI of 5 and cells were either treated or left untreated (+/- in the figure) with equine rEqIFNα at 1000 IU/ml for 30 min before lysis. The abundance of phosphorylated versus total STAT1 at (A) 3 h, (B) 6 h, and (C) 12 h or phosphorylated versus total STAT2 at (D) 3 h, (E) 6 h, and (F) 12 h were then quantified using western blot analysis. Membranes were stripped and reprobed with β-actin as a control for equal loading of samples. The western blot images were representative of 3 different blots from independent experiments.
4 was UV-inactivated in a 33 mm petri dish placed 10 cm from a 40watt UV lamp (UV Stratalinker 1800, CA) for 30 min. The inactivation of UV-treated EHV-4 was demonstrated by the absence of cytopathic effect when this was used to infect RK-13 cells. EECs were then infected with UV-inactivated EHV-4 at an equivalent dilution as the wild type (WT) EHV-4. Total cell lysates were then prepared for western immunoblotting. Mock-infected cells stimulated with 1000 IU/ml of rEqIFN-α were included as the positive control. Following 3hpi, EECs infected with UV-inactivated EHV-4 induced a level of phosphorylated STAT1/STAT2 similar to that of mock-infected cells (Fig. 3A and D). The UV-inactivated virus also failed to down-regulate phosphorylated STAT1/STAT2 when cells were co-incubated with exogenous IFN at 3 hpi. Similarly, EECs infected with UV-inactivated EHV-4 neither induced nor suppressed phosphorylation of STAT1/STAT2 in the presence of rEqIFN-α at 6 hpi (Fig. 3B and E). This trend continues at 12 hpi. EECs infected with UV-inactivated EHV-4 induced a similar level of phosphorylated STAT1/STAT2 when compared with mock-infected cells (Fig. 3C and F). The UV-inactivated EHV-4 did not hinder the phosphorylation of STAT1/STAT2 in the presence of an exogenous IFN at 12 hpi. UV-inactivated EHV-4 infection also did not alter the cellular abundance level of total STAT1/STAT2 at 3, 6, and 12 hpi. These findings suggest that active viral replication is required for EHV-4 to affect the cellular abundance of phosphorylated STAT1/STAT2 in EECs during an infection, and that proteins associated with the infecting virion particles are not responsible.
EHV-1 in the presence or absence of exogenous IFN treatment. Findings from our study revealed that EHV-4 infection failed to induce the phosphorylation of STAT1/STAT2 at 3 hpi (Fig. 2A and D). The virus also reduced phosphorylation of STAT1/ STAT2 when cells were stimulated with exogenous IFN at this time-point. By 6 hpi, EHV-4 had induced a small but detectable level of STAT1/STAT2 phosphorylation (Fig. 2B and E). However, virus infection also suppressed phosphorylation of STAT1/STAT2 that was stimulated by exogenous IFN at 6 hpi. By 12 hpi, EHV-4 infection had stimulated phosphorylation of STAT1/ STAT2 in infected EECs to levels comparable to exogenous IFN stimulation (Fig. 2C and F). At 12 hpi, there was little sign of viral suppression of exogenous IFN-stimulated phosphorylation of STAT1/STAT2. The endogenous level of total STAT1/STAT2 remained unchanged at all the three time points. Findings from our study revealed a trend of a progressive increase in the cellular abundance of phosphorylated STAT1/STAT2 in EHV-4-infected cells either in the presence or absence of an exogenous IFN treatment which differs from the pattern observed in EHV-1 infection (Oladunni et al., 2019; Sarkar et al., 2016).
3.4. Effect of UV-inactivated EHV-4 on STAT1/STAT2 phosphorylation The data above indicate that EHV-4 infection exerted a suppressive effect on endogenous levels of phosphorylated STAT1/STAT2 early in the infection process. For this reason, we next tested the hypothesis that the suppression of phosphorylated STAT1/STAT2 is dependent on an active viral replication of EHV-4 in EECs. We performed similar experiments as above, using UV-inactivated EHV-4. Briefly, purified EHV4
Veterinary Immunology and Immunopathology 219 (2020) 109971
F.S. Oladunni, et al.
Fig. 3. Effect of UV-inactivated EHV-4 on STAT1/STAT2 phosphorylation. EECs were either mock-infected (M) or infected with UV-inactivated EHV-4 (E4) at an MOI of 5 and cells were either treated or left untreated (+/- in the figure) with 1000 IU/ml of equine rEqIFN-α for 30 min before lysis. The abundance of phosphorylated versus total STAT1 at (A) 3 h, (B) 6 h, and (C) 12 h or phosphorylated versus total STAT2 at (D) 3 h, (E) 6 h, and (F) 12 h were then quantified using western blot analysis. Membranes were stripped and reprobed with β-actin as a control for equal loading of samples. Images were representative of 3 independent biological experiments.
on viral suppression of phosphorylated STAT1/STAT2. This finding is in contrast to that of EHV-1 virus that utilizes late viral genes to repress STAT1/STAT2 phosphorylation in infected EECs (Oladunni et al., 2019; Sarkar et al., 2016).
3.5. Effect of EHV-4 late gene expression on STAT1/STAT2 phosphorylation The suppression of phosphorylated STAT1/STAT2 exhibited in EHV4-infected cells was prominent at 3 hpi and 6 hpi, but not at 12 hpi. This pattern suggests a mechanism involving one or more viral early genes. To rule out dependence on EHV-4 late gene expression, we used a chemical inhibitor, Phosphonoacetic acid (PAA) (Acros Organics, NJ), to block the EHV-4 late gene expression as previously described (Sarkar et al., 2015; Sugimoto et al., 2013). We then evaluated the cellular abundance and phosphorylation of STAT1/STAT2 in EECs infected with EHV-4 in the presence or absence of PAA at different time-points by western blot. In the presence of PAA, EHV-4 failed to induce phosphorylated STAT1/STAT2 at 3 hpi (Fig. 4A and D). The PAA-treated EHV-4 also exerted a downregulating effect on phosphorylated STAT1/ STAT2 in the presence of exogenous IFN at 3 hpi. Following 6 hpi, PAAmediated blockage of EHV-4 late gene expression induced a modest level of phosphorylated STAT1/STAT2 in infected EECs (Fig. 4B and E). Also, at this time-point, PAA-treated EHV-4 suppressed the phosphorylation of STAT1/STAT2 in infected cells in a manner observed with the WT virus. At 3 and 6 hpi, the patterns observed in untreated and PAAtreated EHV-4-infected EECs were similar, indicating the involvement of early rather than late viral factors. Interestingly, PAA-treated EHV-4 induced a small level of phosphorylated STAT1/STAT2 but reduced the phosphorylation of STAT1/STAT2 stimulated by rEqIFN-α at 12 hpi (Fig. 4C and F). The endogenous level of total STAT1/STAT2 remained unchanged at all the three time-points studied. These data suggest to us that possibly some late viral genes of EHV-4 have a counteracting effect
4. Discussion The primary cellular targets of most respiratory virus infections are epithelial cells of the respiratory tract. They play an active role in the production and release of IFN-α/β which mediates antiviral innate immune responses (Muller et al., 1994) to inhibit viral replication in infected cells (Isaacs and Lindenmann, 1957). Within the lower respiratory tract, alveolar epithelial cells are in close proximity to the underlying endothelium which is thus susceptible to infection by virus particles produced by infected and damaged epithelial cells (Short et al., 2014). Previously we have demonstrated that there is a difference in the induction kinetics of IFN-β between EHV-1 and EHV-4 in EECs (Oladunni et al., 2018), a cell line related to the endothelial cells lining all blood vessels. Here, we explored the influence of EHV-4 infection on important host cell signaling molecules needed for type-I IFN production using our already established EEC model. Our present study revealed that EHV-4 lacked the potency to stimulate TLR3 and TLR4 transcription following infection in EECs. Since TLR3 and TLR4 expression is not upregulated, it is possible IFN induction by EHV-4 utilizes other sensors than the TLR family, such as those triggered by cytoplasmic recognition of viral replication; retinoic acid-inducible gene I (RIG-I), or melanoma differentiation-associated protein 5 (MDA-5) to initiate type-I IFN signaling pathways in EECs. All 5
Veterinary Immunology and Immunopathology 219 (2020) 109971
F.S. Oladunni, et al.
Fig. 4. Effect of viral late gene blockage of EHV-4 on STAT1/STAT2 phosphorylation. EECs were either mock-infected (M) or infected with EHV-4 (E4), at an MOI of 5, in the presence of PAA (300 μg/ml). Cells were then treated or left untreated (+/- in the figure) with equine rEqIFNα at 1000 IU/ml for 30 min before lysis. The abundance of phosphorylated versus total STAT1 at (A) 3 h, (B) 6 h, and (C) 12 h or phosphorylated versus total STAT2 at (D) 3 h, (E) 6 h, and (F) 12 h were then quantified using western blot analysis. Membranes were stripped and reprobed with β-actin as a control for equal loading of samples. The western blot images were representative of 3 different blots from independent experiments.
infection of EECs, the endogenous level of IRF7 remained fairly abundant and capable of transactivating type-I IFN inducible genes. Our finding is in contrast to that of Zhu et al., who found that the ORF45 of KSHV interacts with IRF7 and inhibits its phosphorylation and nuclear accumulation (Zhu et al., 2002). It is also dissimilar to herpes simplex virus type1 (HSV-1) which blocks IFN regulatory factor IRF3- and IRF7mediated activation of IFN-stimulated genes using its ICP0 RING finger domain (Lin et al., 2004). These examples are pointers to the anti-IFN mechanisms utilized by other herpesviruses to promote virus replication in their respective hosts. EHV-4, however, apparently lacks a similar capacity due to its inability to inhibit IRF7 which is required, together with IRF3, for inducing type-I IFN genes. Our data also showed that EHV-4 was unable to down-regulate IRF9 mRNA when cells were stimulated with Poly-I:C at all time points. Degradation of the cellular level of IRF9 and subsequent blocking of its nuclear translocation to prevent the formation of IFN stimulated gene factor3 (ISGF3) complex is an IFN-evasive mechanism utilized by many other herpesviruses (Miller et al., 1998, 1999). Since both IRF7 and IRF9 play significant roles in the induction phase of type-I IFN production, we speculate that the inability of EHV-4 to down-regulate these two key transcription factors may account for its lack of suppressive effect on type-I IFN in EECs (Oladunni et al., 2018). Importantly, EHV-4 failed to induce any significant phosphorylation of STAT1/STAT2 early during infection at 3 h. At this same time-point, the virus had statistically significantly suppressed the phosphorylation of STAT1/STAT2 when cells were co-incubated with exogenous IFN. However, our data did show that induction of phosphorylation of STAT1/STAT2 in response to EHV-4 infection increased over time while
DNA viruses, including EHV-4, are known to produce dsRNA by convergent transcription and thus could activate IFN-inducible dsRNAdependent protein kinase R (PKR), and possibly RIG-I or MDA-5 (Bowie and Unterholzner, 2008). In addition, EHV-4 did not have the capacity to suppress TLR3 and TLR4 transcription. This is unlike most other herpesviruses. For example, we demonstrated that the molecular mechanism of suppression of type-I IFN induction by EHV-1, a virus closely related to EHV-4, involves the virus first downregulating TLR3 and TLR4 transcription in EECs (Oladunni et al., 2019). Also, TLR4 mRNA levels and protein expression are significantly downregulated upon primary Kaposi sarcoma-associated herpesvirus (KSHV) infection of human lymphatic endothelial cells (Lagos et al., 2008). EHV-4 did not inhibit TLR3 and TLR4 expression, so we do not envisage an antagonistic response to the effectiveness of synthetic TLR agonists like PolyI:C were such to be administered as immune adjuvants when vaccinating against EHV-4 infection. It is possible that EHV-4 did not affect TLR3/4 receptor expression but that the virus interferes with the expression of TLR-mediated signaling molecules. However, the lack of equine specific antibodies such as anti-TRIF hindered our ability to test this hypothesis. We hope such reagents will become available for study of the effect of EHV-4 on downstream adapter proteins mediating TLR3/4 signaling during infection of EECs. Transcription factors involved in IFN production are activated when a virus is initially detected. Activated transcription factors, such as IRF7, subsequently translocate to the nucleus and interact with IFN promoter sequences, leading to the upregulation of IFN genes (Zhu et al., 2002). Data from our study showed that EHV-4 was unable to affect IRF7 transcription. These data suggest that during EHV-4 6
Veterinary Immunology and Immunopathology 219 (2020) 109971
F.S. Oladunni, et al.
the viral suppressive effect on phosphorylated STAT1/STAT2 by exogenous IFN was lost as infection progressed. We believe that the inability of EHV-4 infected cells to induce STAT1/STAT2 phosphorylation at both 3 and 6 hpi even in the presence of exogenous IFN will downregulate IFN induction at early time-points, as we previously observed (Oladunni et al., 2018). We also showed that the ability to inhibit the phosphorylation of STAT1/STAT2 by EHV-4 requires de novo viral DNA synthesis. UV-inactivation of EHV-4 abolished the suppressive effects on STAT1/STAT2 phosphorylation that were profoundly present during the early onset of WT virus infection at 3 and 6 h. The possibility remains that the UV-inactivation step had some effects on EHV-4 primary transcription which may have downstream effect on STAT phosphorylation. The striking difference in the phenotypes of STAT1/STAT2 phosphorylation in EECs infected with EHV-4 either in the presence or absence of PAA treatment occurred at 12 hpi. Data suggested that one or more early viral genes of EHV-4 were needed for suppression of STAT1/STAT2 phosphorylation, but by the later period this activity has worn off. One major shortfall of our study is our inability to demonstrate whether EHV-4 alters the protein levels of studied TLRs and IRFs due to lack of equine-specific antibodies. We hope that future studies will be able to address this limitation to uncover the impact of EHV-4 on posttranscriptional levels of these factors. The inability of EHV-4 to exert a negative influence on key molecules of type-I IFN response may also be directly related to its reduced pathogenicity when compared to EHV-1 explaining why EHV-4 infection is mostly restricted to the URT. In a different study, Vandekerckhove et al., (Vandekerckhove et al., 2011) reported a reduced lateral spread of EHV-4 in nasal mucosal epithelium when compared to EHV-1 suggesting the inability of EHV-4 to inhibit the antiviral effects of type-I IFNs in mucosal epithelial cells. We are currently studying equine tracheal explants to see how they compare with EECs in regard to immunomodulatory effects of EHV-4. This striking difference in the pathogenic potential between EHV-1 and EHV-4 provides additional evidence for the lesser severity of respiratory signs observed, in vivo, during EHV-4 infection (Heldens et al., 2001; Patel et al., 2003; Patel and Heldens, 2005).
receptor signalling. Nat. Rev. Immunol. 8, 911. Breathnach, C., Sturgill-Wright, T., Stiltner, J., Adams, A., Lunn, D., Horohov, D., 2006. Foals are interferon gamma-deficient at birth. Vet. Immunol. Immunopathol. 112, 199–209. Campadelli-Fiume, G., Menotti, L., 2007. Entry of Alphaherpesviruses Into the Cell. Davison, A.J., Eberle, R., Ehlers, B., Hayward, G.S., McGeoch, D.J., Minson, A.C., Pellett, P.E., Roizman, B., Studdert, M.J., Thiry, E., 2009. The order herpesvirales. Arch. Virol. 154, 171–177. Geraghty, R.J., Krummenacher, C., Cohen, G.H., Eisenberg, R.J., Spear, P.G.J.S., 1998. Entry of Alphaherpesviruses Mediated by Poliovirus Receptor-Related Protein 1 and Poliovirus Receptor 280. pp. 1618–1620. Harada, H., Matsumoto, M., Sato, M., Kashiwazaki, Y., Kimura, T., Kitagawa, M., Yokochi, T., Sok‐Pin Tan, R., Takasugi, T., Kadokawa, Y., 1996. Regulation of IFN‐α/β genes: evidence for a dual function of the transcription factor complex ISGF3 in the production and action of IFN‐α/β. Genes Cells 1, 995–1005. Hedges, J.F., Demaula, C.D., Moore, B.D., Mclaughlin, B.E., Simon, S.I., Maclachlan, N.J., 2001. Characterization of equine E‐selectin. Immunology 103, 498–504. Heldens, J.G., Hannant, D., Cullinane, A.A., Prendergast, M.J., Mumford, J.A., Nelly, M., Kydd, J.H., Weststrate, M.W., van den Hoven, R.J.V., 2001. Clinical and Virological Evaluation of the Efficacy of an Inactivated EHV1 and EHV4 Whole Virus Vaccine (Duvaxyn EHV1, 4). Vaccination/challenge Experiments in Foals and Pregnant Mares 19. pp. 4307–4317. Hutchinson, L., Browne, H., Wargent, V., Davis-Poynter, N., Primorac, S., Goldsmith, K., Minson, A., Johnson, D.J.J., 1992. A Novel Herpes simplex Virus Glycoprotein, gL, Forms a Complex With Glycoprotein H (gH) and Affects Normal Folding and Surface Expression of gH 66. pp. 2240–2250. Isaacs, A., Lindenmann, J., 1957. Virus interference. I. The interferon. Proc. R. Soc. Lond. B 147, 258–267. Johnson, K.E., Song, B., Knipe, D.M., 2008. Role for herpes simplex virus 1 ICP27 in the inhibition of type I interferon signaling. Virology 374, 487–494. Kawakami, T., Matsumoto, M., Sato, M., Harada, H., Taniguchi, T., Kitagawa, M., 1995. Possible involvement of the transcription factor ISGF3γ in virus‐induced expression of the IFN‐β gene. FEBS Lett. 358, 225–229. Lagos, D., Vart, R.J., Gratrix, F., Westrop, S.J., Emuss, V., Wong, P.-P., Robey, R., Imami, N., Bower, M., Gotch, F., 2008. Toll-like receptor 4 mediates innate immunity to Kaposi sarcoma herpesvirus. Cell Host Microbe 4, 470–483. Lin, R., Noyce, R.S., Collins, S.E., Everett, R.D., Mossman, K.L., 2004. The herpes simplex virus ICP0 RING finger domain inhibits IRF3-and IRF7-mediated activation of interferon-stimulated genes. J. Virol. 78, 1675–1684. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2− ΔΔCT method. Methods 25, 402–408. Matsumura, T., Sugiura, T., Imagawa, H., Fukunaga, Y., Kamada, M., 1992. Epizootiological aspects of type 1 and type 4 equine herpesvirus infections among horse populations. J. Vet. Med. Sci. 54, 207–211. McCollum, W., Cheatham, J., Doll, E., Wilson, J., 1962. Isolation and propagation of equine arteritis virus in monolayer cell cultures of rabbit kidney. Cornell Vet. 52 452&. Mercer, J., Schelhaas, M., Helenius, A.J.A., 2010. Virus Entry by Endocytosis 79. pp. 803–833. Miller, D.M., Rahill, B.M., Boss, J.M., Lairmore, M.D., Durbin, J.E., Waldman, J.W., Sedmak, D.D., 1998. Human cytomegalovirus inhibits major histocompatibility complex class II expression by disruption of the Jak/Stat pathway. J. Exp. Med. 187, 675–683. Miller, D.M., Zhang, Y., Rahill, B.M., Waldman, W.J., Sedmak, D.D., 1999. Human cytomegalovirus inhibits IFN-α-stimulated antiviral and immunoregulatory responses by blocking multiple levels of IFN-α signal transduction. J. Immunol. 162, 6107–6113. Muller, U., Steinhoff, U., Reis, L., Hemmi, S., Pavlovic, J., Zinkernagel, R.M., Aguet, M., 1994. Functional role of type I and type II interferons in antiviral defense. Science 264, 1918–1921. Oladunni, F., Sarkar, S., Reedy, S., Balasuriya, U., Horohov, D., Chambers, T., 2018. Absence of relationship between type-I interferon suppression and neuropathogenicity of EHV-1. Vet. Immunol. Immunopathol. 197, 24–30. Oladunni, F.S., Sarkar, S., Reedy, S., Balasuriya, U.B., Horohov, D.W., Chambers, T.M.J.J., 2019. Equine herpesvirus 1 targets the sensitization and induction steps to inhibit the Type I interferon response in equine endothelial cells. JVI 01342-01319. Osterrieder, N., Van de Walle, G.R., 2010. Pathogenic potential of equine alphaherpesviruses: the importance of the mononuclear cell compartment in disease outcome. Vet. Microbiol. 143, 21–28. Padalino, B., Muscat, K.E., Ficorilli, N., Hartley, C.A., Raidal, S.L., Knight, P., Celi, P., Gilkerson, J.R., Muscatello, G., 2015. Equine herpesviruses in the transported horse. Proceedings of the 37th Bain Fallon Memorial Lectures, Reproduction - Podiatry and Lameness - Foal Medicine and Surgery, 19-24 July 2015, Lovedale, New South Wales, Australia, 15. Patel, J., Edington, N., Mumford, J., 1982. Variation in cellular tropism between isolates of equine herpesvirus-1 in foals. Arch. Virol. 74, 41–51. Patel, J., Földi, J., Bateman, H., Williams, J., Didlick, S., Stark, R.J.V., 2003. Equid Herpesvirus (EHV-1) Live Vaccine Strain C147: Efficacy Against Respiratory Diseases Following EHV Types 1 and 4 Challenges 92. pp. 1–17. Patel, J., Heldens, J., 2005. Equine herpesviruses 1 (EHV-1) and 4 (EHV-4)–epidemiology, disease and immunoprophylaxis: a brief review. Vet. J. 170, 14–23. Ramakers, C., Ruijter, J.M., Deprez, R.H.L., Moorman, A.F., 2003. Assumption-free analysis of quantitative real-time polymerase chain reaction (PCR) data. Neurosci. Lett. 339, 62–66. Sabine, M., Robertson, G., Whalley, J., 1981. Differentiation of sub‐types of equine herpesvirus I by restriction endonuclease analysis. Aust. Vet. J. 57, 148–149.
Declaration for Competing Interest None of the authors of this paper has a financial or personal relationship that could inappropriately influence or bias the content of this publication. Acknowledgment Fatai S. Oladunni was supported by a grant from the American Quarter Horse Association Young Investigator Award and by a fellowship from the Geoffrey C. Hughes Foundation. This work was supported in part by a grant from the Equine Drug Research Council of the Kentucky Horse Racing Commission. The work is part of a project of the Kentucky Agricultural Experiment Station (KY014053), supported by the National Institute of Food and Agriculture, U.S. Department of Agriculture, Animal Health Program. References Ablasser, A., Bauernfeind, F., Hartmann, G., Latz, E., Fitzgerald, K.A., Hornung, V., 2009. RIG-I-dependent sensing of poly (dA: dT) through the induction of an RNA polymerase III–transcribed RNA intermediate. Nat. Immunol. 10, 1065–1072. Akira, S., Takeda, K., 2004. Toll-like receptor signalling. Nat. Rev. Immunol. 4, 499. Akira, S., Takeda, K., Kaisho, T., 2001. Toll-like receptors: critical proteins linking innate and acquired immunity. Nat. Immunol. 2, 675–680. Allen, G.P., Slater, J.D., Smith, K.C., 2002. In: Coetzer, J. (Ed.), In Infectious Diseases of Livestock. Oxford University Press, Capetown 2002. Azab, W., Lehmann, M.J., Osterrieder, N., 2013. Glycoprotein H and α4β1-integrins determine the entry pathway of alphaherpesviruses. Journal of virology, JVI 0352203512. Bowie, A.G., Unterholzner, L., 2008. Viral evasion and subversion of pattern-recognition
7
Veterinary Immunology and Immunopathology 219 (2020) 109971
F.S. Oladunni, et al.
Telford, E., Watson, M.S., Perry, J., Cullinane, A.A., Davison, A.J., 1998. The DNA sequence of equine herpesvirus-4. J. Gen. Virol. 79, 1197–1203. Telford, E.A., Watson, M.S., McBride, K., Davison, A.J., 1992. The DNA sequence of equine herpesvirus-1. Virology 189, 304–316. Vandekerckhove, A.P., Glorieux, S., Gryspeerdt, A., Steukers, L., Van Doorsselaere, J., Osterrieder, N., Van de Walle, G., Nauwynck, H., 2011. Equine alphaherpesviruses (EHV-1 and EHV-4) differ in their efficiency to infect mononuclear cells during early steps of infection in nasal mucosal explants. Vet. Microbiol. 152, 21–28. Wesoly, J., Szweykowska-Kulinska, Z., Bluyssen, H.A., 2007. STAT activation and differential complex formation dictate selectivity of interferon responses. Acta Bioch. Polonica-English Ed. 54, 27. Whalley, J., Ruitenberg, K., Sullivan, K., Seshadri, L., Hansen, K., Birch, D., Gilkerson, J., Wellington, J., 2007. Host cell tropism of equine herpesviruses: glycoprotein D of EHV-1 enables EHV-4 to infect a non-permissive cell line. Arch. Virol. 152, 717–725. Whitwell, K., Smith, K., Sinclair, R., Mumford, J., 1994. Foetal Lesions in Spontaneous EHV-4 Abortion in Mares. Yoneyama, M., Suhara, W., Fukuhara, Y., Sato, M., Ozato, K., Fujita, T., 1996. Autocrine amplification of type I interferon gene expression mediated by interferon stimulated gene factor 3 (ISGF3). J. Biochem. 120, 160–169. Zhu, F.X., King, S.M., Smith, E.J., Levy, D.E., Yuan, Y., 2002. A Kaposi’s sarcoma-associated herpesviral protein inhibits virus-mediated induction of type I interferon by blocking IRF-7 phosphorylation and nuclear accumulation. Proc. Natl. Acad. Sci. 99, 5573–5578.
Sarkar, S., Balasuriya, U.B., Horohov, D.W., Chambers, T.M., 2015. Equine herpesvirus-1 suppresses type-I interferon induction in equine endothelial cells. Vet. Immunol. Immunopathol. 167, 122–129. Sarkar, S., Balasuriya, U.B., Horohov, D.W., Chambers, T.M., 2016. The neuropathogenic T953 strain of equine herpesvirus-1 inhibits type-I IFN mediated antiviral activity in equine endothelial cells. Vet. Microbiol. 183, 110–118. Sato, M., Suemori, H., Hata, N., Asagiri, M., Ogasawara, K., Nakao, K., Nakaya, T., Katsuki, M., Noguchi, S., Tanaka, N., 2000. Distinct and essential roles of transcription factors IRF-3 and IRF-7 in response to viruses for IFN-α/β gene induction. Immunity 13, 539–548. Schindler, C., Levy, D.E., Decker, T., 2007. JAK-STAT signaling: from interferons to cytokines. J. Biol. Chem. 282, 20059–20063. Short, K.R., Veldhuis Kroeze, E.J., Reperant, L.A., Richard, M., Kuiken, T., 2014. Influenza virus and endothelial cells: a species specific relationship. Front. Microbiol. 5, 653. Shukla, D., Liu, J., Blaiklock, P., Shworak, N.W., Bai, X., Esko, J.D., Cohen, G.H., Eisenberg, R.J., Rosenberg, R.D., Spear, P.G.J.C., 1999. A Novel Role for 3-O-Sulfated Heparan Sulfate in Herpes simplex Virus 1 Entry 99. pp. 13–22. Studdert, M., Simpson, T., Roizman, B., 1981. Differentiation of respiratory and abortigenic isolates of equine herpesvirus 1 by restriction endonucleases. Science 214, 562–564. Sugimoto, A., Sato, Y., Kanda, T., Murata, T., Narita, Y., Kawashima, D., Kimura, H., Tatsuya, T., 2013. Different distributions of Epstein-Barr virus early and late gene transcripts within viral replication compartments. Journal of virology, JVI 0021900213.
8