The ikaros gene is required for the development of all lymphoid lineages

Cell, Vol. 79, 143-156,

October

7. 1994, Copyright

0 1994 by Cell Press

The lkaros Gene Is Required for the Development of All Lymphoid Lineages Katia Georgopoulos,’ Michael Bigby,+ Jin-Hong Wang,7 Arpad Molnar,’ Paul Wu,’ Susan Winandy, l and Arlene Sharpe* *Cutaneous Biology Research Center Massachusetts General Hospital Charlestown, Massachusetts 02129 tHarvard Medical School Boston, Massachusetts 02115 *Immunology Research Division Department of Pathology Brigham and Women’s Hospital Boston, Massachusetts 02114

Summary The ikaros gene encodes a family of early hematopoietic- and lymphocyte-restricted transcription factors. Mice homorygous for a germline mutation in the lkaros DNA-binding domain lack not only T and B lymphocytes and natural killer cells but also their earliest defined progenitors. In contrast, the erythroid and myeloid lineages were intact in these mutant mice. We propose that ikaros promotes differentiation of pluripotential hematopoietic stem ceil(s) into the lymphocyte pathways. In the absence of a functional lkaros gene, these stem cells are exclusively diverted into the erythroid and myeloid lineages. introduction Development of the lymphoid system from pluripotent hematopoietic stem cells (HSCs) is a poorly characterized process. The existence and ontogeny of common or distinct lymphocyte progenitors for T, B, and natural killer (NK) ceil lineages and the sites of their production remain to be determined (Ikuta et al., 1992; Spangrude, 1989). In addition, thesignals that triggerand sustain thedifferentiation of progenitors to mature immunocompetent lymphocytes remain elusive. In many developmental systems, temporally expressed or activated transcription factors have been described that mediate ceil fate decisions and promote differentiation (reviewed by Skeath et al., 1992; Weintraub, 1993). These factors also may play a pivotal role at subsequent branch points of differentiation. Such developmental master switches may also exist for the lymphopoietic system. Several transcription factors have been implicated in the control of T and B cell-specific gene expression (Clevers et al., 1993). The lkaros gene is one of the strongest candidates for a master regulator of lymphocyte specification and differentiation. The lkaros gene was initially described for its ability to bind to and activate the enhancer of the CD36 gene, an early and definitive marker of T cell differentiation (Georgopoulos et al., 1992a). During embryogenesis, lkaros expression is restricted to sites of hematopoiesis at which it precedes and overlaps lymphocyte

development. In adult mice, lkaros is expressed in T cells and their progenitors as well as in early B cells (Georgopoulos et al., 1992a; unpublished data). The lkaros gene encodes a family of zinc finger DNAbinding proteins that are products of alternate splicing (Molnar et al., submitted). Of these lkaros isoforms, Ik-1 and lk-2 are abundantly expressed throughout lymphocyte development, while lk-3, lk-4, and lk-5 are expressed at low levels. The lkaros proteins contain two zinc finger domains located at their N- and C-termini. The zinc finger composition of the N-terminal domain is regulated by differential splicing. Two of these N-terminal finger modules are shared by four of the lkaros isoforms (Ik-1, lk-2, lk-3, and lk-4) and mediate binding to a core recognition sequence (GGGAA/T). However, the DNA binding affinity and fine specificity of these proteins are determined by their overall N-terminal domain zinc finger composition. Of the lkaros isoforms, lk-5 with one zinc finger at its N-terminal domain cannot bind to the core consensus sequence recognized by the rest of the proteins. Nevertheless, low affinity binding to reiterated sequences related to the GGGAAR core motif was detected by all five isoforms. This low affinity binding was attributed to the two C-terminal zinc fingers present in all of these proteins. In addition to their distinct DNA binding properties, the lkaros proteins differ in their ability to activate transcription, and they range from strong activators to suppressors. Together, the lkaros protein isoforms may control multiple layers of gene expression during lymphocyte ontogeny in the embryo and in the adult. Significantly, high affinity binding sites for the lkaros proteins were identified in the regulatory domains of many lymphocyte-specific genes, including the members of the CD3-T cell receptor (CD3TCR) complex, RAG-l, TdT, the interleukin-2 receptor, immunoglobulin (lg) heavy and light chains, and the early B cell-restricted signal transducing molecule Iga (Molnar et al., submitted). These genes play important roles in T and B cell differentiation pathways, and their expression is a prerequisite for lymphocyte development. The lkaros gene is highly conserved between mice and humans, which is in further support of its being a functionally fundamental component of the lymphopoietic system across species (Molnar et al., unpublished data). To test the hypothesis that lkaros is a major determinant of lymphocyte specification, development, and homeostasis, we created a deletion in the ikaros gene by removing the sequence encoding the high affinity DNA-binding domain. The deletion was introduced into the embryonic stem (ES) cell genome by homologous recombination. This mutation is expected to abolish the ability of four of the ikaros proteins to bind to their recognition sites. ES cells that incorporated this mutation by homologous recombination were used to generate transgenic mice. Mice homozygous for this lkaros mutation lacked not only mature T and B lymphocytes but also their earliest described progenitors (Ardavin et al., 1993; Godfrey and Zlotnik, 1993; lkuta et al., 1992; Karasuyama et al., 1994). NK

Cell 144

ceils, which are proposed to arise from a common T cell precursor, also were absent in lkaros mutant mice (Hackett et al., 1986; Rodewald et al., 1992). However, the erythroid and myeloid compartments of the hematopoietic system in the lkaros mutant mice were intact. Together, these two lineages comprised almost 100% of the spleen and the bone marrow cell populations. These results demonstrate that lkaros proteins are required for the development of all cells of the lymphocyte lineage. This is the only known transcription factor whose expression is essential for lymphopoiesis but not for the development of the erythroid and myeloid lineages. Results

1

2

3

4

5

6

7

S

Targeting the DNA-Binding Domain of the lkaros Gene and the Generation of lkaros Mutant Mice Given the extensive differential splicing of lkaros transcripts, the multiple transcription initiation sites, and the size and complexity of this genomic locus (K. G., unpublished data), we designed a homologous recombination vector to replace an 8.5 kb genomic fragment containing part of exon 3 and exon 4 with the neo cassette (Figure 1A). This mutation deletes zinc fingers 1, 2, and 3, which mediate the high affinity sequence-specific DNA binding of four of the lkaros protein isoforms (Ik-1, lk-2, lk-3, and lk-4). This mutation is expected to impair the ability of these proteins to bind DNA and modulate transcription. The recombination vector was electroporated in the ES cell line Jl (Li et al., 1992). Two ES cell lines with legitimate homologous recombination events were injected into day 3.5 blastocysts (Figure 16, see ES cells whose DNA analysis is shown in lanes 4 and 9). Chimeras were bred against the background of the host blastocyst, and germline transmission was determined in Fl litters. F2 litters were scored for the lkaros mutation as shown in Figure 1C.

9

C -A

D

Figure 1. Targeting of the DNA-Binding by Homologous Recombination

Domain

of the lkaros

Gene

(A) Recombination strategy for targeting a deletion of an 3.5 kb genomic fragment encompassing part of exon 3 (E3) and exon 4 (E4). Probe A derived from a region outside the recombination locus was used to screen for homologous recombination events. Single integration events of the recombination vector were determined using the neomycin-derived probe 9. Abbreviations: kB, kilobase; w.t., wild type; rec., recombinant; mu., mutant; and tk, thymidine kinase. (6) Analysis of genomic DNA from 12 selected ES cell clones. A 12.5 kb and a 10.5 kb BamHl genomic fragment derived from the wild-type and the targeted lkaros alleles, respectively, hybridized to probe A. A 13.33 kb fragment derived from the recombination locus hybridized to probe 9. (C) Southern analysis of tail DNAs from a 2-week-old F2 litter revealed the occurrence of homozygous offspring at the expected Mendelian frequency. Abbreviations: +I+, wild-type; +I-, heterozygous mutant; and -I-, homozygous mutant. (D) Homozygous pups were significantly smaller than wild-type controls after the first postnatal week. This difference increased during the third and fourth weeks of their lives. Homozygous mutant (minus sign) and wild-type (plus sign) littermates from 1-4 weeks of age are shown from right to left.

lkaros Mutant Mice Are Born but Fail to Thrive Mice homozygous for the lkaros mutation were born with the expected Mendelian frequency, indicating that the mutation does not affect their survival in utero. At birth, homozygous, heterozygous, and wild-type littermates were indistinguishable. One week after birth, however, homozygous pups were identifiable by their smaller size (Figure 1D). The size of homozygous animals varied from onethird to two-thirds of that of their wild-type littermates (Figure 1 D). This failure to thrive became more prominent during the second and third weeks of their lives. However, no differences were detected between wild-type and heterozygous pups. The majority of the lkaros mutant mice (approximately 95%) died between the first and third weeks of their lives. A large proportion of these deaths were associated with cannibalism by the mothers. Analysis of homozygous mice derived from the two distinct ES cell clones verified that the phenotype observed was due to the mutation in the lkaros gene. lkaros mutant mice derived from both ES cell clones were identical in terms of their growth, survival, hematopoietic populations, and disease contraction. Animals were studied from sev-

Lymphocytes 145

Figure

Are Absent

2. Histological

in lkaros

Analysis

Mutant

of Thymic

Mice

Tissue

in lkaros

Mutant

Mice

(A and B) Thoracic cavity of a wild-type (+/+) compared with an lkaros mutant mouse (at 1.66 x magnification). A rudimentary thymic tissue (1) comprised of two separate lobes (arrows) was detected at the base of the trachea above the heart(h) in the mutant animal. Upon close examination, feeding blood vessels were observed. Both animals were 2 weeks of age. Insert displays the rudimentary tissue in the mutant animal at higher magnification. (C) Medullary (m) and cortical (c) architecture of a wild-type thymus revealed by hematoxylin and eosin staining at 16.6x magnification. (D) Lack of cortical and medullary areas in the mutant organ (63x magnification). Note the size difference between the wild-type and mutant thymus (C versus the insert in D; both pictures are taken at 16.6 x magnification). (E and F) Cell composition of wild-type and mutant thymuses, respectively, at 496x magnification. Arrows point to eosinophils detected in both

erai days to 12 weeks past birth on the 129SV x BALBlc, 129SV x C57BU6, and 129SV genetic backgrounds. lkaros Mutant Mice Have a Rudimentary lhymus with no Definitive T Cell Precursors The thymus was not readily visible on gross anatomical examination of the thoracic cavity in lkaros mutant mice. However, upon careful microscopic inspection, a rudimentary tissue was observed above the heart, sometimes located higher in the thoracic cavity (Figure 28). Its location and its nonfused, biiobed appearance resembled an early embryonic thymus. Histological analysis of this tissue revealed an epitheliai structure similar to that of the thymic medulla in wild-type controls (compare Figures 2D and 2F with Figures 2C and 2E). Electron microscopy revealed desmosomes and basement membrane surrounding many cells, thus confirming the presence of epitheiiai cells in this tissue (data not shown). Lymphoid-appearing ceils were visible in this tissue, but were less densely packed than those found in the wild-type thymus (Figure 2F). Eosinophils detected in the wild-type thymus were seen in this tissue also, especially around portal arteries (Figures 2E and 2F). A large number of holes were present throughout this epitheiial structure. These holes resembled those resulting from the abortive formation of Hassall’s corpuscles reported in thymic medullary epithelia. These data strongly suggest that this tissue is a rudimentary thymus. lmmunohistochemical analysis of the rudimentary thymus with antibodies to Thy-l and CD3 revealed no staining in contrast with the wild-type thymus that had bright diffuse staining with Thy-l and focal staining with CD3 (data not shown). The cell composition of these thymic rudiments was analyzed by flow cytometry. In 62 ikaros mutant mice analyzed, a maximum of 1 x 105 cells were obtained per thymic rudiment. This number of putative thymocytes contrasted the 1 x lo8 to 2 x 10’ cells regularly obtained from the wild-type thymus. When homozygous mutant littermates were available, thymic tissues were pooled; otherwise, mutant thymuses were analyzed individually. Flow cytometric analysis was performed on these cells with combinations of antibodies to Thy-l, CD25, CD4, CD6, CD3, TCRaj3, and heat-stable antigens (HSAs) (Figure 3). These combinations of antigens demarcate a number of stages in thymocyte development from the pro-T cell to the mature T cell (reviewed by Godfrey and Ziotnik, 1993). Cells from the lkaros mutant thymuses were negative for any definitive T cell differentiation antigens, including Thy-l. The majority of these cells expressed HSA, known to be on 95% of hematopoietic cells. in two groups of homozygous animals analyzed, a small proportion of these cells (10%) were CD4’“1HSA+. Interestingly, in 3 out of a total of 65 ikaros mutant mice, a slightly larger thymic rudiment was found that contained 0.5 x lo6 to 1 x 10s cells (Figure 3C). Cells in these mutant thymuses displayed a T cell phenotype of which the most definitive is shown in Figure 3C. In this organ, 36% of the cells were Thy-l +, 17% were CD4+, and 10% were CD25+. A small fraction of these cells expressed both CD4 and CD6 (2.3%) but no single-positive CD6+ cells were detected. In addition, no significant numbers of

TCRaP

HSA Figure 3. Flow Cytometric Analysis of Cells in the Rudimentary Thy mus of lkaros Mutant Mice (A) The cell composition of the thymus in wild-type controls (+I+; 2 x 10 cells recovered per thymus) and in lkaros mutant mice (-/-; B and C) was determined. A maximum of 1 x 1Q cells were recovered per thymus in 62 out of 55 mutant animals (irrespective of age); a group of three 2-weekold mutant mice is shown in (B). In 3 out of 55 mutant animals, 0.5 x IO to 1 x 10’ cells were recovered per thymus. From this group of three, the thymus with the most definitive T cell phenotype is shown in (C). Cells were double stained with: a pool of FITC- and PEtonjugated isotype controls, anti-CD4PE/anti-CDSmC, antiCD3%nti-TCRa5~cTC, anti-Thy1 .2pE/antiCD25~c, and an&CD49 anti-HSAF”C. Positlve populations are boxed, and percentages are indicated. Animals whose cell analysis is shown were 2 weeks of age.

CD3+/TCR+ cells were present (0.7%). In contrast with the lkaros mutant mice, control littermates contained 1 x 10s to 2 x 1O8cells per thymic organ and exhibited the normal complement of mature and immature thymocytes (Figure 3A). lkaros Mutant Mice Lack Peripheral Lymphoid Centers Inguinal, cervical, axillary, and mesenteric lymph nodes were absent as observed by both visual and microscopic examination. Lymph nodes were absent in all of the homozygous mutant mice examined but were readily detected in all of the wild-type littermates (data not shown). Peyer’s patches and lymphocyte follicles were also absent from the gastrointestinal tract of these mutant animals (data not shown). Dendritic Epidermal T Cells Are Absent in lkaros Mutant Mice Epidermal sheets from ear skin of lkaros mutant and wild-

Lymphocytes 147

Figure

Are Absent

4. lkaros

Epidermal microscopy

Mutant

in lkaros

Mice Lack

Mutant

Mice

Epidermal

yS T Cells

sheets obtained from the ear skin of normal (+/+; A and C) or lkaros mutant mice (-I-; with anti+ (A and B) or anti-class II (C and D) MAbs (130x magnification).

type mice were examined forrS T cells and for Langerhans cells (Bigby et al., 1987). Epidermal sheets were stained with monoclonal antibodies (MAbs) specific for yS T cell receptors or major histocompatibility complex (MHC) class II molecules and were examined by epifluorescence microscopy. y6 T cells were absent from epidermal sheets of lkaros homozygous mutants, but they were readily detectable in epidermal sheets from wild-type controls (Figures 4A and 48). Staining with the MHC class II antibody revealed the presence of dendritic epidermal Langerhans cells in the epidermis of both mutant and wild-type animals (Figures 4C and 4D). Hematopoietic Populations in the Bone Marrow of lkaros Mutant Mice The number of cells obtained from the femoral marrow of lkaros mutant mice was lo-fold lower than that obtained from wild-type controls. Bone marrow hematopoietic populations were analyzed by flow cytometry with antibodies to lineage-specific differentiation antigens. Combinations of antibodies to sequentially expressed stage-specific B cell markers were used to examine the pro-B to pre-B cell (CD45R+/CD43+) and the pre-B to the B cell transitions (CD45Fl+/slgM+) (Hardy et al., 1991; Li et al., 1993; Rolink and Melchers, 1991). The CD45R+ population, a hallmark of B cell development in the bone marrow, was absent in lkaros mutant mice. This CD45R+ population, comprised

B and D) were stained

for immunofluorescence

of B lymphocytes in various stages of maturation, was a major population in control mice (Figure 5A). Of these CD45R+ cells, the CD45Rb/CD43’0 population is comprised of immature lymphocytes at the pro-B cell stage, while the CD45R+/slgM+ population is comprised of mature B cells (Figures 5A and 58). The rest of the CD45R’ population contained cells with rearranged heavy but not light chain cells (pm-Bstage) as well as cells of other hematopoietic lineages (Hardy et al., 1991). A small number of CD45Rb cells were detected in some mutant mice that were negative for other definitive B cell markers (e.g., CD43 or IgM) (Figures 5A and 58). These cells may belong to another hematopoietic lineage (Hardy and Hayakawa, 1986). Because of the absence of T cell precursors in the thymic rudiment of lkaros mutant mice, we analyzed the bone marrow for the presence of T cell progenitors. A small population of Thy-II0 cells was found in most mutant mice examined. These cells were negative for the CD3, SCA-1, and CD4 antigens expressed on early T cell precursors (Figures 5C and 5D; data not shown). This population of Thy-l lo cells may contain the earliest lymphocyte progenitors, including T and B cell precursors, that are arrested in development, and therefore, they may be unable to home to the thymus or proceed to the next stage of their differentiation in the bone marrow. A large percentage of the nucleated cells in lkaros mu-

+I+

+/+

-/-

-/-

B

A 5

5

8

s CD43

The Spleen In lkaros Mutant Mice Is Enlarged and Heavily Populated with Cells of Erythrold and Myeiold Origin

C

D 7* E

i: 0 Thy-l

CD61

mice may be due to a delayed switch from fetal to adult hematopoiesis. Alternatively, it may be due to infections occurring in these animals. Since such changes in cell populations were detected in both healthy and sick homozygous mutants, the former possibility is favored.

SCA-1

OR-1

Figure 5. Hematopoietic Populations in the Bone Marrow of lkaros Mutant Mice Bone marrow cells recovered from the two femurs of P-weekold lkaros mutant mice (-/-; 0.6 x IO6 to 1.5 x 10’ cells) and of wildtype littermates (+/+; 1 x IO’to 2 x 10’ cells) were analyzed with the following combinations of MAbs: antiCD46RPE/antiCD4VX (A); antiCD46W/anti-lgMFm (B); antiCDWanti-Thy1 .2FRc (C); anti-Thy-1.2-/ anti-BCA-1 mc (D); anti-TER-11 SPE/antiCD61 WC (E); and anti-Mac-l 7 anti-Gr-lF”C (F). Positive populations are boxed, and percentages are shown.

tant bone marrow was positive for TER-119, a definitive marker for developing and mature etythrocytes; and a substantial percentage of bone marrow cells expressed the myeloid lineage marker Mac-l (Figures 5E and 5F). The percentage of erythrocyte precursors in the mutant bone marrow, at 2 weeks of age, was nearly twice that of myeloid precursors. By comparison, wild-type bone marrow contained nearly equal percentages of erythroid and myeloid precursors (Figures 5E and 5F). Interestingly, the Mac-l+/ Gr-1’ subpopulation, which was found in the wild-type bone marrow and which contains mature polymorphonuclear cells, was absent in these lkaros mutant bone marrow cell populations (Fleming et al., 1993; Hestdal et al., 1991). Nevertheless, blood smears and infected tissues from mutant mice contained numerous circulating and infiltrating cells with mature polymorphonuclear and granulocytic morphology (data not shown). The ratio of TER119+ to Mac-l+ cells was related to the age of the homozygous mutants. In lkaros mutant mice older than 3 weeks of age, 20% of the bone marrow cells were TER119+ and 60% were Mac-l+ (data not shown). Although a decrease in the ratio of erythroid to myeloid progenitors was also detected in wild-type littermates (from 1:l to 1:2), the change was larger in lkaros mutant animals. The differences in the percentages of erythroid and myeloid progenitors observed at different ages of lkaros mutant

The spleens of lkaros mutant mice were 1.5 times to 3 times larger than the spleens of wild-type littermates (Figure 6A). The enlargement of the spleen contrasted with the total lack of other peripheral lymphoid tissues and the minuscule size of the thymus. The well-structured red and white pulp morphology of the wild-type spleen, indicative of predominant erythroid and lymphoid areas, was absent in spleens from mutant mice (Figures 6B and 6C). In lkaros mutant mice, the spleen displayed a less organized morphology comprised of areas heavily populated with cells of myeloid origin and of areas populated by erythrocyte precursors (Figures 6B-6D). A large number of megakaryocytes was also found in this tissue (Figure 6C). The relative representation of hematopoietic lineages in the mutant spleen was analyzed by flow cytometry. Mature T cells, which express either CD4+ or CD6+ and comprise approximately 40% of cells in a normal spleen, were absent (Figure 7A). a3 and y5 TCR-expressing cells also were not detected (data not shown). However, a small but distinct population of Thy-P cells, which were CD3- and SCA-l-negative, was present (Figures 78 and 7C). A similar Thy-l” population was also observed in the bone marrow of these mice and may contain hematopoietic stem cells and lymphocyte precursors. The CD45R+/lgM+ population that contains mature B cells was absent in the lkaros mutant spleen (Figure 7D). Since the spleen in lkaros mutant mice is an active site of extramedullary hematopoiesis, we tested for the presence of CD45Rb/CD43b (pro-B) cells, which are normally found in the bone marrow of adult mice. This pro-B cell population was absent in both the bone marrow and the spleen of lkaros homozygous mutants (see Figure 5A; Figure 7E). Erythrocyte progenitors made up the majority of spleen cells in the lkaros mutant mice (Figure 7F). This population, which ranged from 70% at l-2 weeks of age to 25% in older mutant mice, never exceeded 20% in the spleen of wild-type controls. Myeloid cells were the second largest population and ranged from 9% in young animals to 60% in older mice, but they never exceeded 5% in wild-type controls. Changes in the ratio of myeloid to erythroid populations were observed both in the spleen and bone marrow as lkaros mutant mice aged. Thus, the myeloid and erythroid lineages together accounted for the majority of the splenocytes (60%-100%) in lkaros mutant mice. In contrast, these two lineages represent less than 20% of the total cell population in the wild-type spleen, which was predominantly composed of mature T and 6 cells (Figures 7A and 7D). The presence of myeloid progenitors in the spleen of lkaros mutant mice was confirmed using a soft agar clono-

Lymphocytes 149

Are Absent

in lkaros

Mutant

Mice

genie assay. Mixed granulocyte and macrophage colonies were established lo-fold more frequently when spleen cells from P-week-old mutant mice were grown on soft agar in the presence of granulocytelmacrophage colonystimulating factor than when spleen cells from wild-type littermates were used (Table 1). Similar numbers of granulocyte and macrophage colonies were established from the spleen and the bone marrow of mutant mice (Table 1). Red blood cell counts were obtained from lkaros mutant mice and were found to be within physiological range (data not shown). Microscopic examination of blood smears from older mutant mice revealed a large number and variety of circulating polymorphonuclear and basophilic cells not detected in younger animals. These leukocytes were often concentrated over clusters of bacteria (Figure 8F). Interestingly, a number of nucleated proerythrocytes (orthochromic normoblasts) were seen in the blood smears from both younger and older mutant mice. NK Cell Activity Was Absent from the Spleens of lkaros Mutant Mice NK cells were not detected in the spleen of lkaros mutant mice by flow cytometry (data not shown). A small population of these cells was present in wild-type spleens (2%5% determined on the 129SV x C57BL/6 background; data not shown). Given the relatively small numbers of splenic NK cells, we used a functional assay to conclusively address their existence in lkaros mutant mice. Serial dilutions of spleen cells from mutant and wild-type animals were grown in the presence of 500 U/ml of interleukin-2 for 48-72 hr. These conditions are known to generate activated NK cells that can readily lyse their targets (GarniWagner et al., 1990). After two or three days in culture, spleen cells from wild-type control mice effectively lysed chromium-labeled NK cell targets (Yac-1) over a wide range of effector-to-target cell ratios (Table 2). However, spleen cells from the lkaros mutant mice were unable to lyse NK targets even at the highest effector-to-target cell ratio (6O:l) (Table 2). Opportunistic infections and Death among the lkaros Mutant Population Deaths among the lkaros mutant mice occurred as early as the end of their first postnatal week. The mortality rate increased during the second and third weeks of life, and approximately 95% of the mice died within 4 weeks. Gross and histopathological examinations of mice were performed to evaluate the cause of their death.

Figure

6. Histological

Analysis

of the Spleen

in lkaros

Mutant

Mice

(A) Splenomegaly is manifested among the lkaros mutant animals. Spleens shown are from P-week-old wild-type (+/+) and lkaros mutant (-I-) littermates. (B) Red and white pulp architecture in wild-type spleen (93 x magnification). (C) Lackofdistinct red and white pulp structure in lkaros mutant spleen (93x magnification). The number of megakaryocytes (M)in this mutant organ was dramatically increased. (0) The lkaros mutant spleen contains cells with nucleated erythrocyte (e) and myeloid (m) morphology (558 x magnification).

Cdl 150

+I+

+I+

-/-

A

-I-

s

C T aQ E

SCA-1

w

CD43

CD61

GRl Figure 7. Hematopoietic Populations in the Spleen of lkaros Mutant Mice After red blood cells were lysed with NH,CI. cells from the spleen of P-weekold lkaros mutant mice (-I-; 3 x 10’ to 10 x 10’ cells per animal) and wild-type littermates (+/+; 4 x 10’ to 10 x IO7 cells per animal) were examined with the following combinations of MAbs: antiCD4e/antiCD6Fm: (A); antiCD3PE/anti-Thy-l .2Frrc (6); anti-Thy-l .2-/ SCA-lmc (C); antl-CD45RPE/antiiIgMmC (0); antiCD46RPE/antiCWc (E); anti-TER-1 19pE/antiCD61 Fm: (F); and anti-Mac-1 pE/anti-Gr-lmc (G). Positive populations are boxed, and percentages are indicated.

The liver in almost all mutant animals examined contained focal infarcts, often subcapsular, that appeared as pale or white nodules (Figure EC). In extreme cases, half of the liver. had undergone necrosis. Necrotic areas and accumulation of large numbers of monocytes, macrophages, and eosinophils were evident in hematoxylin- and eosin-stained liver sections (Figure EC). Intracellular and extracellular bacteria were identifiable in the subcapsular region in gram-stained sections of liver (Figure 8D). Cultures from the liver grew Pasturella pneumonotropica and Enterobacter species, microorganisms that comprise part of the normal microbial flora in the oral and gastrointestinal cavities of wild-type mice. Cultures from wild-type liver had no growth. The lungs also showed evidence of pneumonia with abscess formation, abundant bacteria, and infiltration with myeloid cells (Figure 8E). In many cases, bacteria were easily identified on Wright-Giemsa-stained blood smears (Figure 8F), indicating high-grade septicemia (Fife et al., 1994). Areas in which bacteria were concentrated exhibited clustering of basophilic cells (Figure 8F). Blood clots were cultured and frequently contained multiple strains of microorganisms. Examination of the intestines did not reveal major histo-

Table 1. Granulocyte and Macrophage Progenitors and Bone Marrow of lkaros Mutant Mice

in the Spleen

Experiment Number

Spleen (Number of Growing Colonies)

Bone Marrow (Number Growing Colonies)

1

+/+ ( 3) -I- (3s)

+/+ ( 3s) -I- ( 66)

2

+/+ ( S) -I- (s5)

+I+ ( 56) -I- (100)

of

Cells from the spleen and bone marrow of wild-type (+/+) and lkaros mutant (-I-) mice were plated at 7.5 x 1o* cells/ml in RPMI-15 medium containing 0.4% agar and supplemented with 5 U of granulocytelmacrophage colony-stimulating factor. Seven days later, the number of growing colonies was counted.

pathological abnormalities; however, lkaros mutant mice consistently had numerous and diverse bacterial microorganisms in their intestinal tract (Figure8A). Large numbers of gram-negative and gram-positive rods and cocci were detected on gram stains of intestinal sections (Figure 8A). Although a small number of bacteria were observed in wild-type intestinal tissue, their number and diversity did not compare with those detected in mutant mice (Figure 8B). Cultures from these gastrointestinal epithelia identified a number of microorganisms. Anaerobic endosporeforming bacteria of the Oscillospira caryophanon group were found in the intestines of the lkaros mutant mice but were not detected in wild-type controls. Analysis of lkaros Mutant mRNAs and.Proteins The production of lkaros mRNAs in the spleen of lkaros mutant mice was examined using a reverse transcription polymerase chain reaction (PM) amplification assay. Primers derived from the lkaros exons within and outside the targeted deletion were used to amplify cDNAs prepared from lkaros mutant spleen RNA (see Figure 1A; Figure 9A). Analysisof the amplification products revealed the production of lkaros mRNAs in this mutant organ (Figure 9B). These lkaros mRNAs lack exons 3 and 4, and the major species is comprised of exons 1, 2, 5, 6, and 7 (Figures 9A and 9B). The proteins encoded by these transcripts lack the zinc finger modules -1, -2 and -3 encoded by exons 3 and 4 (Figure 9A). The presence of these mutant proteins in total spleen cell extracts was examined. Low amounts of proteins that correlate in size with that predicted from the mutant cDNAs were detected by Western blot analysis (data not shown). Since the majorityofcells in thespleenof lkarosmutants areof erythroid and myeloid origin, the presence of lkaros transcripts and proteins in this organ may reflect its expression in early hematopoietic progenitors (Georgopoulos et al., 1992a; unpublished data). In addition, the lkaros gene may be autoregulated, and the lack of functional lkaros products may dysregulate its expression in the hematopoietic system. Nuclear extracts prepared from mutant and wild-type spleen and thymus were examined for lkaros binding activities in a gel retardation assay. Four complexes were formed when a high affinity Ikaros-binding site was tested

Lymphocytes 151

Are Absent

in lkaros

Mutant

Mice

Figure 8. Histopathological Analysis of Gastrointestinal Tract, Liver, Lung, and Blood in lkaros Mutant Mice (A and 6) Gram-stained sections from the gastrointestinal tract from lkaros mutant (-/-) and wild-type (+/+) littermates, respectively (at 3 weeks of age). Numerous gram-positive and gram-negative microorganisms are detected in the gastrointestinal tract of mutant mice. (C and D) Hematoxyfin-. eosin-, and gram-stained liver sections from a l-month-old mutant (-/-) animal exhibited necrotic areas and bacteria mainly in the subcapsular region and extensive infiltration with myelocytes and eosinophils. Arrows point to areas rich in bacteria. (E) Hematoxylin and eosin staining of lung tissue from a i-month-old mutant (-I-) animal revealed consolidation and bacteria and myeloid infiltration. Arrows point to areas rich in bacteria. (F) Wright-Giemsa staining of a blood smear from a l-month-old lkaros mutant mouse (-I-). A group of basophilic leukocytes is detected over clusters of bacteria.

against nuclear protein8 from wild-type thymU and spleen (Figure 9C, lanes 1 and 2). No such complexes were detected when extracts from the spleen of lkaros mutant mice were Used in this assay (Figure 9C, lane 3). The sequence specificity of the protein-DNA complexes detected with wild-type nuclear extracts and the presence of lkaros proteins in these complexes were examined.

Self-DNA competed for binding of all four complexes (Figure 9C, lane 5) while a variant of this DNA with a mutation in the core of the lkaros consensus sequence had no effect (Figure 9C, lane 6). Pretreatment of wild-type thymic nuclear extracts with lkaros antibodies prevented formation of all four of these complexes, whereas an unrelated antibody did not (Figure 9C, lanes 7 and 8). However, both

Cell 152

Table 2. lkaros

Mutant

Mice Lack NK Cell Activity Percent

Lysis”

(%)

Experiment 1 (Standard Deviation)

Effector-toTarget Cell Ratio 6O:l 3O:l 15:l 7.5:1

Experiment 2 (Standard Deviation)

+/+

-- l

ii+

-- l

59 (6) 48 (4) 43 (61

1 2 4 (1) 4

ND 75 (15) 57( 3) B( 4)

ND 4 10 2

16 (2)

Spleen cells from wild type (+/+) or lkaros mutant (-I-) mice were cultured in complete RPM1 medium containing 500 U/ml recombinant interleukin-2 for 72 hr and were then cultured in triplicate with 3000 Crsr-labeled Yac-1 cells in the indicated ratios in a standard 4 hr chromium release assay. Abbreviations: ND, not determined; and CPM, counts per minute. [CPM - spontaneously released CPM] x 100 ’ Percent lysis = ITotal lysis CPM - spontaneously released CPM]

B - +/+

- +/+ STS -----

C

STS

- +/+ ----C

STS

- +/+ C

2-I-L

lkaros mutant and wild-type nuclear extracts supported the formation of complexes over an AP-l-binding site (Figure 9B, lanes 10-12). Therefore, these binding studies indicate that lack of lkaros DNA binding activity from the lymphoid organs in lkaros mutant mice correlates with the total lack of lymphocytes obsenred in these animals. Discussion Our analysis of mice with a mutation in the lkaros gene provides convincing evidence that the lkaros gene plays a pivotal role in lymphocyte specification. An intact lkaros gene is essential for the development of mature T and B lymphocytes and NKcells. The lkaros gene is not essential for the production of totipotential hematopoietic stem cells,

C

Antlbody Compmitkn

Genotype

+ -+

+/+ -/TSS

1

Probe

.

z

3

+ +

+

+/+ T--

456789

1

--+/+ -/TSS

10

-

1112

2

Figure 9. Ikaros mRNAs and Lack of lkaros DNA Binding Activity in the Spleen Populations of lkaros Mutant Mics (A) Diagrammatic representation of exon usage in the lkaros gene. The zinc finger modules are shown as perpendicular stippled boxes. Fingers 1, 2, and 3 (Fl, F2, and F3, respectively) encoded by the deleted exons 3 (E3) and 4 (E4) are involved in the high affinity DNA binding of the lkaros proteins. Sites of primers used for the reverse transcription PCR analysis are indicated with open, closed, and hatched boxes.

(B) cDNAs prepared from wild-type (+/+) thymus (T) or wild-type and mutant (-/-) spleen (S) total RNA were PCR amplified with sets of primers that delineate their exon composition (shown as open, closed, and hatched boxes below the gel analysis of PCR products). From wild-type thymus and spleen cDNAs, products of the Ik-1 and lk-2 transcripts were predominantly amplified. No amplification products were detected with cDNA control reactions (total RNA and cDNA template, which are shown as the lanes demarcated by C). The major lkaros product amplified from mutant spleen cDNAs did not contain exon 3 and exon 4 but consisted of exons 1, 2, 5, 6, and 7. (C) The presence of Ikaros-related DNA binding activity in cells from wild-type thymus and wild-type (+I+) and mutant (-I-) spleens was tested with an oligonucleotide that contains a high affinity binding site for all lkaros proteins (lanes 1-3, probe 1 equals IK-BS4, which is TCAGCTTTTGGGAATGTATTCCCTGTCA). Four DNA-binding complexes were detected with wild-type thymus and spleen nuclear extracts (arrows). The sequence specificity of these complexes was established in competition assays using nuclear proteins from wild-type thymus (lane 4). Self-DNA competed effectively for binding of all four complexes (lane 5, IKBB4), whereas a variant with a mutation in the Ikaros-binding site had no such effect (lane 6, IK-BBC, which is TCAGCTtlTGAGMTACCCTGTCA). Affinity-purified antibodies raised to the N-terminal domain of the lkaros proteins abrogated binding of all four complexes (lane 7) whereas an antibody to a keratinocyte-specific protein had no such effect (lane 8). No binding activities were detected in the absence of thymic nuclear proteins and in the presence of lkaros antibodies (lane 9). None of these Ikaros-related binding activities were detected when nuclear extracts made from the spleen of lkaros mutant mice were used (lane 3). However, both wild-type and mutant nuclear extracts displayed binding activities over an AP-t-binding site (lanes 1O-l 2, probe 2 equals AP-1, which is GGCATGACTCAGAGCGA).

Lymphocytes 153

Are Absent

in lkaros

Mutant

Mice

Pluripotent HSC

Proghitors

Progenitors

Intermediate Progenitors

Figure

10. A Model

of the Role of lkaros

in Hematolymphopoietic

Development

Arrest in lymphocyte development is displayed with an X on the lymphopoietic pathways. A potential delay in the switch from embryonic to adult hematopoiesis is depicted with a dashed arrow. A thick arrow indicates increased erythropoiesis and myelopoiesis in lkaros mutant animals. Stippling indicates expression of the lkaros gene in hematopoietic, lymphocyte progenitors and mature progeny (Georgopoulos et al., 1992a; unpublished data). Question marks indicate inconclusive expression data. Positive and negative signals provided by the lkaros proteins for hematopoietic and lymphocyte differentiation are shown by plus and minus signs, respectively. Hypothetical stages in 6, T, and NK cell development are illustrated as alternative pathways. Differentiation antigens that demarcate the various stages of hematopoietic and lymphocyte differentiation, used in the analysis of the lkaros mutant mice, are shown.

erythrocytes, myelocytes, monocytes, dendritic cells, megakaryocytes, and platelets. A mutation in the lkaros gene that abolishes the high affinity DNA-binding domain in at least four of its protein products had profound effects on T lymphocyte development. Mature af3 T cells, which comprise the majority of lymphocytes residing in peripheral lymphaticcenters(e.g., spleen, lymph nodes, Peyer’s patches), were absent in lkaros mutant mice. Cells of the yS T lineage were also not found in lkaros mutant mice. Lymphocyte progenitors that give rise mainly to $5 T cells populate the thymus from day 14 through day 17 of fetal development (Havran and Allison, 1988; lkuta et al., 1992; Raulet et al., 1991). Mature yi5 T cells produced during this time populate the skin and vaginal epithelium and provide the life-long supply of dendritic epidermal T cells (Asnarnow et al., 1988; Havran and Allison, 1990). The absence of $5 T cells in the skin of lkaros mutant mice implies that this stage in Tcell development is also never reached. The lkaros mutation also had profound effects on the development of a third T-related lineage, that of NK cells. Since these cytotoxic cells share differentiation antigens with T cells, it has been prqposed that they arise from a common progenitor (Rodewald et al., 1992). Neither NK cell markers nor NK cytotoxic activity was detected in these mutant animals.

lkaros mutant mice lacked a mature thymus. Instead, they possessed an aberrant piece of tissue that did not stain positive with any definitive Tcell differentiation markers. A maximum of 1 x lo5 cells were recovered from the majority of these thymic rudiments that stained positive with HSA. In some animals, a small subpopulation (
environmental factors in the bone marrow may upregulate expression of the mutant lkaros transcripts, which are sufficient to allow this step in Tcell development to take place. However, a functional lkaros gene is absolutely required for subsequent steps in T cell maturation. Mature T cells were never observed in these animals. Pro-B, pre-B, and mature B cells were absent from the bone marrow and the spleen of all lkaros mutant mice. This total lack of T and B cell progenitors and NK ceils is unprecedented among other naturally occurring and genetically engineered immunodeficient mice. In recombination-deficient mice @CID, RAG-l, RAG-P), T and B lymphocyte development is arrested at the pro-T and pro-B cell stage (Figure lo), at which antigen and lg receptor rearrangements are a prerequisite for transition to the next stage in differentiation (Bosma et al., 1983; Karasuyama et al., 1994; Mombaerts et al., 1992; Shinkai et al., 1992). High numbers of circulating NK cells are found in these animals and are thought to be responsible for their relatively good health. In contrast, lymphocyte development in lkaros mutant mice appears to arrest at an even earlier stage than in the recombination-deficient animals, perhaps at the level of commitment of the pluripotent HSCs to the lymphopoietic pathway(s). The described functional disruption of the lkaros gene may affect the development of a progenitor stem cell that gives rise to T, B, and NK cell lineages. However, the I karos gene products may control the development of three distinct progenitors from the HSC, each responsible for giving rise to a distinct lymphocyte lineage. The Thy-l+ population detected in the bone marrow and spleen of lkaros mutant mice may contain these earliest lymphocyte progenitors arrested at the very first step in their development. In contrast with the total arrest in lymphocyte development, the erythroid and myeloid lineages were intact in lkaros mutant mice. The spleen in these animals was enlarged and contained a large number of erythroid and myeloid progenitors, whereas the bone marrow was hypocellular and contained a larger number of erythroid progenitors compared with wild-type controls. Dysregulated erythropoiesis and myelopoiesis in the spleen and the bone marrow has not been reported in other strains of immunodeficient mice that arrest at later stages in lymphocyte development. The lymphopoietic defect and hematopoietic phenotype in lkaros mutant mice together with the unique pattern of expression of the lkaros gene during embryonic and adult hematopoiesis support the hypothesis that lkaros products provide positive signals for lymphocyte differentiation and negative signals for differentiation into the other hematopoietic lineages (Figure 10). In the absence of functional lkaros proteins, lymphocyte development is blocked at the level of the HSCs, which either by default or due to lack of negative signals commit to the other hematopoietic pathways. Total lack of lymphocytes and their progenitors may increase the production of HSCs; these however, can only produce more erythroid and myeloid progenitors. Pluripotent HSCs have distinct differentiation and migration properties in the embryo and in the adult (Ikuta et al., 1992). The hypocellular bone marrow in the lkaros

mutant mice and the extramedullary hematopoiesis detected ,in the spleen of these animals may be the result of a dysregulated transition from embryonic to adult hematopoiesis. The switch from embryonic to adult hematopoiesis may be partly controlled by Ikaros. Alternatively, the lack of thymocyte progenitors in lkaros mutant mice may hinder the homing of the HSC by affecting the development of the stromal epithelia in the bone marrow cavities (Hodgson and Bradley, 1979; Visser and Eliason, 1983). In the absence of an intact hematopoietic compartment in the bone marrow, the spleen becomes the primarysiteof extramedullary hematopoiesis (Nilsson and Bertoncello, 1994; Ward and Block, 1971). Further studies of the pluripotent HSC populations in lkaros mutant mice may answer many questions about the ontogeny of the lymphopoietic system, including that of the existence of the earliest identifiable lymphocyte progenitors. lkaros mutant mice will also provide an excellent experimental system for addressing the genetic components that exist downstream of the lkaros gene, which are necessary for lymphocyte maturation, ExperImental Procedures Cloning of the Ikaros Gene, Recomblnatlon Constructs, and Targeting of ES Cells A mouse 129SV liver genomic library (gift from C. Andrikopoulos) was screened with a probe derived from the mouse /k-l cDNA. Overlapping genomic clones were isolated that cover a region of 100 kb containing at least six translated exons (unpublished data). The recombination vector described in Figure 1Acontained 9 kb and 2.5 kb of homologous DNA upstream and downstream, respectively, of the pgk-neo gene and the pMC thymidlne kinase gene at its most 5’region. The recombination vector was electroporated into Jl ES cells (Li et al., 1992) maintained on subconfluent embryonic fibroblasts. Neomycinand FIAUresistant ES cell colonies (300) were pick@ and expanded. DNA was prepared and analyzed by Southern blotting using DNA probes from outside the homologous recombination area (Figure IB). Single integration events were scored using a probe derived from the neo gene (Figure 1C). Two distinct ES cell lines heterozygous for this mutation were used in separate blastocyst injections to rule out phenotypes that result from cell line mutations. To explore potential phenotype variability on distinct genetic backgrounds, the mutant ES cells were injected in blastocysts from C57BUB and BALBlc mice. Chimeric animals more than 40% agouti were bred against the appropriate background. Fl mice with germline transmission of the lkaros mutation were bred to homozygocity. The genotype of Fl and F2 mice was determined by Southern and by PCR analysis of tail DNA using either probe A that was described in Figure 1A or appropriate primers designed from neol and the lkaros gene (Ex3F and Ex3R, respectively):

Ex3F, AGT AAT GTT AAA GTA GAG ACT CAG; Ex3R, GTA TGA CTT CTT lTG TGA ACC ATG; and neol, AAG CGA.

CCA GCC TCT GAG CCC AGA

HIstologIcal Analyslr of Ikaros Mutant Ylce Tissues harvested from wild-type and lkaros mutant mice were fixed in 4% buffered formalin, processed, and embedded in paraffin. Sections were cut at 5 km thickness, mounted, and stained with hematoxylin and eosin or with modified gram stains. Light microscopy was performed at 20 x to 600 x magnification on an Olympus BMax-50 mlcro-pe. Analysl8 of Hematopoletlc Cell Populatlons lkaros mutant mice were analyzed in parallel to wild-type At least 10 groups of animals were studied on each mixed (129SV x C57BL16 and on 129SV x BALBlc), and two on a 129SV background. Each group consisted of pooled l-4 littermates at 2-4 weeks of age. Older animals (1

littermates. background were tested organs from month plus)

Lymphocytes 155

Are Absent

in lkaros

Mutant

Mice

were examined individually. A total of 65 mutant mice were analyzed by flow cytometry, but many more were harvested and subjected lo morphological and histological examinations. Red blood cell counts were determined with a Coulter Counter ZM. Red blood ceils in the spleen and bone marrow were lysed by ammonium chloride. Single cell suspensions of thymus, spleen, or bone marrow cells were washed twice in PBS with 0.1% BSA and were incubated for 20 min on ice with a 1:20 dilution of normal rat serum and 1 pg of anti-Fc receptor MAb2.4G2per 1 x 108cellsto blockF~Rll/lll receptors. Cells(0.5 x 106 to 1 x 10e) were incubated with phycoerylhrin(PE-) and fluorescein isothiocyanate-conjugated (FITC-conjugated) MAb for 40 min. Given the few cells recovered from mutant thymuses (maximum of 1 x 105), 1 x lo4 to 2 x 10” thymocytes were used for staining. Cells were washed three times, and one- and two-color flow cytometric analyses were performed on a FACScan (Becton-Dickinson [San Jose, California]). Gating for viable cells was performed using propidium iodide exclusion. Isotype-matched control antibodies were used as negative controls. Cells (5,000-10,000) were analyzed for each sample. The following antibodies (in parentheses) to lineage-specific differentiation antigens were used. Mac-l (TER-119 and M1170.15, Caltag); Gr-1 (RB6-6C5); CD61 (Pl2519); NKl.1 (PK136); CD45R (RA3-682); CD43 (S7); IgM (R6-60.2); Thy-l.2 (53-2.1); HSA (Ml/69 and Jlld); CD6 (53-6.7 and 555.6); CD3-&(145-2C11); CD4 (RM4-4); CD25 (7D4); SCA-l(El3 161-7); TCRaP (H57-597); and TCRyS (GL3). Antibodies were obtained from PharMingen unless otherwise indicated. Granulocytelmacrophage colony-stimulating factor used in the clonogenic assays was obtained from Biosource International.

donk and J. Murphy for bacterial analysis of tissues from transgenic mice; Dr. V. Kumar for the Yac-1 cell line; Drs. A. Abbas, E. SpanopouIOU, and D. Tenen for valuable discussions; and finally Drs. A. Abbas, 8. Morgan, S. Pillai, E. Spanopoulou, and M.-S. Sy for critical review of the manuscript. Transgenic research and other research were supported by a core grant from the Cutaneous Biology Research Center (Shiseido Company Ltd.) and a grant from the National Institutes of Health (NIH, ROl-Al33062-62) to K. G. The research of M. B. was supported by NIH grant AR39795-04. K. G. isa Scholarof the Leukemia Society of America, and A. S. is a Scholar of the Lucille P. Markey Foundation.

Enumeration of Dendritic Epldermal T Cells Ammonium thiocyanate-separated epidermal sheets obtained from ear skin were stained with FIT&conjugated MAb GL3 (specific for y6 T cell receptor) or unconjugated MAb M5/114 (specific for MHC class II antigen), followed by application of FITC-conjugated goat anti-mouse antibody as described (Bigby et al., 1967) and evaluation by immunofluorescence microscopy. lsotype control antibodies were used as negative controls for GL3 and M5/114. Positively stained dendritic cells were identified by epifluorescence microscopy. Ears from three mice of each type were examined.

Clevers, H., Oosterwegel, M., and Georgopoulos, tion factors in early T cell development. Immunol.

lkaros cDNA Analysis Reverse transcription PCR analysis of total RNA prepared from thymus and spleen from wild-type and mutant mice was performed as previously described (Georgopoulos el al., 1992b). The relative concentration of cDNAs prepared from each tissue was determined with a set of forward and reverse actin cDNA primers in amplification reactions performed over a linear range of product formation (data not shown). Adjusted amounts of cDNAs were amplified with four sets of primers derived from exons inside and outside the deleted region. DNA was incubated at 95OC for 5 min; Taq polymerase (Boehringer Mannheim) was then added at 60°C; amplification was performed for 35 cycles, with one cycle consisting of 93OC for 45 s, 60°C for 45 s, and 72OC for 1 min; and this was followed by a chase step at 72OC for 10 min. The sets of primers used were Ex2F/Ex7R, Ex2F/ExGR, Ex3F/Ex7R, and Ex4F/Ex7R, all of which allow determination of exon usage in lkaros transcripts. Ex2F, CAC TAC CTC TGG AGC ACA GCA GAA; Ex3F, AGT AAT GTT AAA GTA GAG ACT CAG; Ex4F, GGT GAA CGG CCT TTC CAG TGC; Ex6R: TCT GAG GCA TAG AGC TCT TAC; and Ex7R, CAT AGG GCA TGT CTG ACA GGC ACT. Gel Retardation Assays Nuclear extracts were prepared, and gel retardation assays were carried out as previously described (Georgopoulos et al., 1992b). Two micrograms of nuclear protein were incubated with end-labeled oligonucleotidescontainingeithera high affinity Ikaros-bindingsite(IK-BS4) or an AP-l-binding site. IK-BS4, TCA GCT ill GGG AAT GTA lTC CCT GTC A; IK-BS5, TCA GCT TTT GAG AAT ACC CTG TCA; and AP-1, GGC ATG ACT CAG AGC GA. Acknowledgments We wish to thank Dr. C. Andrikopoulos for the SV129 genomic library and for help with ES cell culture; L. Du for blastocyst injections; J. Ownbey and N. Yao for genotyping transgenic mice; Drs. A. Onder-

Received

July 12, 1994; revised

August

3, 1994.

References Ardavin, C., Wu, L., Li, C., and Shortman, K. (1993). Thymic dendritic cells and T cells develop simultaneously in the thymus from a common precursor population. Nature 362, 761-763. Asnarnow, D. M., Kuziel, W. A., Bonyhadi, M., Tigelaar, R. E., Tucker, P. W., and Allison, J. P. (1986). Limited diversity of ~6 antigen receptor genes of Thy-i+ dendritic epidermal cells. Cell 55, 637-847. Bigby, M., Kwan, T., and Sy, M. S. (1967). Ratio of Langerhans cells to Thy-l+ dendritic epidermal cells in murine epidermis influences the intensity of contact hypersensitivity. J. Invest. Dermatol. 89,495-499. Bosma, G. C., Custer, bined immunodeficiency

R. P., and Bosma, M. J. (1963). A severe commutation in the mouse. Nature 307,527~530. K. (1993). TranscripToday 74,591-596.

Fife, A., Hill, D., Barton, C., and Burden, P. (1994). Gram negative septicaemia diagnosed on peripheral blood smear appearances. J. Clin. Pathol. 47, 82-64. Fleming, W. H., Alpern, E. J., Uchida, N., Ikuta, K., Spangrude, G. J., and Weissman, I. L. (1993). Functional heterogeneity is associated with the cell cycle status of murine hematopoietic stem cells. J. Cell Biol. 122, 897-902. Garni-Wagner, 8. A., Purohit, A., Mathew, P. A., Bennett, M., and Kumar, V. (I 993). A novel function-associated molecule related to nonMHC-restricted cytotoxicity mediated by activated natural killer cells and T cells. J. Immunol. 751, 60-70. Georgopoulos, K., Moore, D. D., and Derfler, 8. (1992a). lkaros early lymphoid restricted transcription factor, a putative mediator T cell commitment. Science 258, 606-812.

an for

Georgopoulos, K., Morgan, B. A., and Moore, D. D. (1992b). Functionally distinct isoforms of the CRE-BP DNA binding protein mediate activity of a T cell specific enhancer. Mol. Cell. Biol. 12, 747-757. Godfrey, D. I., and Zlotnik, A. (1993). Control development. Immunol. Today 74, 647-553.

points

in early

T-cell

Hackett, J. J., Tutt, M., Lipscomb, M., Bennett, M., Koo, G., and Kumar, V. (1966). Origin and differentiation of natural killer cells. II. Functional and morphologic studies of purified NK-1 .l+ cells. J. Immunol. 138, 3124-3131. Hardy, R. R., and Hayakawa, K. (1986). Development and physiology of Ly-1 B and its human homolog, Leu-1 B. Immunol. Rev. 93, 5379. Hardy, R. R., Camack, C. E., Shinton, S. A., Kemp, J. D., and Hayakawa, K. (1991). Resolution and characterization of pro-B and prepro-B cell states in normal mouse bone marrow. J. Exp. Med. 173, 1213-1225. Havran, W. L., and Allison, J. P. (1966). Developmentally ordered appearance of thymocytes expressing different T-cell antigen receptors. Nature 335, 443445. Havran, W. L., and Allison, J. P. (1990). Origin of Thy-l* dendritic epidermal cells of adult mice from fetal thymic precursors. Nature 344, 66-70. Hestdal, K., Ruscetti, F. W., Ihle, J. N., Jacobsen, S. E. W., Dubois, C. M., Kopp, W. C., Longo, D. L., and Keller, J. R. (1991). Characterization and regulation of RB6-6C5 antigen expression on murine bone marrow cells. J. Immunol. 147, 22-30.

Hodgson, G. S., and Bradley, T. Ft. (1979). Propertiesof hematopoietic stem cells surviving Muorouracil treatment: evidence for a pre-CFUS cell? Nature 287, 381-362. Ikuta, K., Uchida, N., Friedman, J., and Weissman, I. L. (1992). Lymphocyte development from stem ceils. Annu. Rev. Immunol. IO, 759753. Karasuyama, H., Rolink, A., Shinkai, Y., Young, F., Alt, F. W., and Melchers, F. (1994). The expression of V&I5 surrogate light chain in early bone marrow precursor B cells of normal and B cell-deficient mutant mice. Cell 77, 133-43 Li, E., Bestor, T. H., and Jaenisch, R. (1992). Targeted mutation of the DNA methyltransferase gene results in embryonic lethality, Cell 69, 915-926. Li, Y.-S., Hayakawa, K., and Hardy, R. R. (1993). The regulated expression of B lineage-associated genes during B cell differentiation in bone marrow and fetal liver. J. Exp. Med. 778, 951-960. Mombaerts, P., lacomini, J., Johnson, R. S., Herrup, K., Tonegawa, S., and Papaloannou, V. E. (1992). RAG-l-deficient mice have no mature B and T lymphocytes. Cell 68, 869-677. Nilsson, S. K., and Bertoncello, I. (1994). Age-related changes in extramedullary hematopoiesis in the spleen of normal and perturbed osteopetrotic (op/op) mice. Exp. Hematol. 22, 377-93. Pearse, M., Wu, L., Egerton, M., Wilson, A., Shortman, K., and Scollay, R. (1959). A murine early thymocyte developmental sequence is marked by transient expression of the interleukip 2 receptor. Proc. Natl. Acad. Sci. USA 88, 1614-1616. Raulet, D. H., Spencer, D. M., Hsiang, Y., Goldman, J. P., Bix, ht., Liao, N., Zustra, M., Jaenisch, R., and Correa, I. (1991). Control of ~6 T-cell development. Immunol. Rev. 720, 185-204. Rodewald, H.-R., Moingeon, P., Lucich, J. L., Dosiou, C., Lopez, P., and Reinherz, E. L. (1992). A population of early fetal thymocytes expressing Fc~Rllllll contains precursors of T lymphocytes and natural killer cells. Cell 69, 139-150. Rolink, A., and Melchers, F. (1991). Molecular and cellular origins of B lymphocyte diversity. Cell 66, 1061-1094. Shinkai, Y., Rathbun, G., Lam, K.-P., Oltz. E. ht., Stewart, V., Mendelsohn, M., Charron, J., Datta, M.. Young, F., Stall, A. M.. and Alt, F. W. (1992). RAG-2-deficient mice lack mature lymphocytes owing to inability to initiate V(D)J rearrangement. Cell 68, 655-867. Skeath, J. B., Panganiban, G., Selegue. J., and Carroll, S. 8. (1992). Gene regulation in two dimensions: the proneural achaefe and scute genesarecontrolled bycombinationsof axis-patterninggenesthrough a common intergenic control region. Genes Dev. 6, 2606-2619. Spangrude, G. J. (1959). Enrichment of murine haemopoietic stem cells: diverging roads. Immunol. Today 70, 344-350. Visser, J. W., and Eliason, J. F. (1953). In viva studies on the regeneration kinetics of enriched populations of haemopoietic spleen colonyforming cells from normal bone marrow. Cell Tissue Kinet. 16, 395 92. Ward, H. P.. and Block, M. H. (1971). The natural history of agnogenic myeloid metaplasia (AMM) and a critical evaluation of its relationship with the myeloproliferative syndrome. Medicine (Baltimore) 50, 357420. Weintraub, H. (1993). The MyoD family and myogenesis: redundancy, networks, and thresholds. Cell 75, 1241-1244. Wu, L., Mariastefania, A.. Johnson, G. R., Scollay, R., and Shortman, K. (199la). Developmental potential of the earliest precursor cells from the adult mouse thymus. J. Exp. Med. 174, 1617-1627. Wu, L., Scollay, R., Egerton, M., Pearse, M., Spangrude, G. J., and Shortman, K. (1991 b). CD4 expressed on earliest T-lineage precursor cells in the adult murine thymus. Nature 349. 71-74.