The initial efficiency of the proteolytic system of Lactococcus lactis strains determines their responses to a cheese environment

International Dairy Journal 21 (2011) 335e345

Contents lists available at ScienceDirect

International Dairy Journal journal homepage: www.elsevier.com/locate/idairyj

The initial efficiency of the proteolytic system of Lactococcus lactis strains determines their responses to a cheese environment Mireille Yvon, Chistophe Gitton, Emilie Chambellon, Gaëlle Bergot, Véronique Monnet* INRA, UMR1319 Micalis, Domaine de Vilvert, F-78352 Jouy-en-Josas, France

a r t i c l e i n f o

a b s t r a c t

Article history: Received 17 September 2010 Received in revised form 25 November 2010 Accepted 30 November 2010

During cheese-making, Lactococcus lactis is confronted with various stresses that affect its metabolic activities and, therefore, texture and flavour formation. Our objective was to investigate the behaviour in a cheese model of two L. lactis strains with a common metabolic core but also specific features. Global cytoplasmic proteomes and targeted enzyme activities were analyzed in cells harvested from cheese after 1 and 7 days and metabolite production was determined. In both strains, the adaptation mechanisms to the cheese environment were mainly responses to medium acidification and amino acid starvation. They were induced before day 1 and the pathways thus triggered remained active during ripening. Response intensity differed in the two strains, leading to notable differences in proteome and metabolite production. In particular, we highlighted the importance and consequences of the intensity of initial proteolysis on the global metabolism of L. lactis in cheese. Ó 2011 Elsevier Ltd. All rights reserved.

1. Introduction Lactic acid bacteria (LAB) are widely employed for food fermentation. Throughout the food chain, they encounter various environments and stresses to which they need to adapt. Despite their industrial importance and the huge amount of knowledge accumulated on LAB metabolism, we still poorly understand how they adapt in foods. LAB are generally selected on the basis of genotypic or phenotypic tests that reveal their acidification, texturing and flavouring potentials, as well as their resistance to phages. However, until now, very few post-genomic studies have globally described how LAB express these functions during food processes such as cheese-making although we know that environment influences gene expression, protein production and stability, enzyme functionality and metabolite production. Several transcriptomic or proteomic analyses have been performed in the context of targeted laboratory experiments that more or less reproduce the different stresses encountered during the cheese-making process. The experiment that best approached cheese-making conditions was performed with Lactococcus lactis grown in non-buffered milk, under anaerobiosis and with a controlled temperature downshift (Raynaud, Perrin, CocaignBousquet, & Loubiere, 2005). Under these dynamic conditions,

* Corresponding author. Tel.: þ33 1 34 65 21 49; fax: þ33 1 34 65 21 63. E-mail address: [email protected] (V. Monnet). 0958-6946/$ e see front matter Ó 2011 Elsevier Ltd. All rights reserved. doi:10.1016/j.idairyj.2010.11.010

a combined transcriptome and metabolic analysis was performed. Alongside this, the responses of L. lactis laboratory strains to major stresses, i.e., acid, thermal or oxidative stresses and carbon or nitrogen starvation have been relatively well characterized in laboratory media (Dressaire, Gitton et al. 2009; Dressaire, Redon et al. 2009; Dressaire et al., 2008). In this context, our objective was to use post-genomic approaches to characterize the behaviour of LAB in a food matrix, and particularly that of L. lactis in cheese. This study was realized in the framework of the Genoferment project (ANR-05-PNRA-020). A few gene expression analyses on bacteria in cheese have already been reported for L. lactis in the framework of this project (Ulve et al., 2008) and for Enterococcus faecalis (Makhzami et al., 2008), which thus demonstrated the feasibility of the study. Concerning proteomics, LAB proteomes have been characterized after growth in milk (Derzelle, Bolotin, Mistou, & Rul, 2005; Gitton et al., 2005) and recently in L. lactis and Lactobacillus plantarum after their isolation from mouse faeces (Beganovic et al., 2010; Bron, Grangette, Mercenier, de Vos, & Kleerebezem, 2004; Roy, Meyrand, Corthier, Monnet, & Mistou, 2008). The objective of the present work was therefore to compare the behaviour of two different L. lactis strains with a common metabolic core but also specific features (ability to metabolize citrate in one case, and the presence of glutamate dehydrogenase in the other) in a model cheese made using ultrafiltered milk. Both global cytoplasmic proteomes and targeted enzyme activities were analyzed in cells harvested from the cheese after 1 and 7 days of ripening and metabolite production was determined. The results

336

M. Yvon et al. / International Dairy Journal 21 (2011) 335e345

were compared with data already acquired on LAB stress-responses and then evaluated in terms of cheese technology. 2. Materials and methods 2.1. Strains, cheese model and cell recovery L. lactis subsp. lactis strains LD61 and UCMA5713 were obtained from the Genoferment collection (D. Passerini et al., unpublished). Strain LD61 is considered to be a model cheese strain and had previously been used for laboratory experiments (Raynaud et al., 2005). The two strains display different genomic profiles as determined by Pulsed Field Gel Electrophoresis (PFGE), but have similar genome sizes (2645 and 2677 kb, respectively) and both possess the genes required for growth in milk (prtP and lac operon). LD61 also possesses genes for the utilization of citrate (citP, citL) and therefore belongs to the biovariant diacetylactis, while UCMA5713 possesses the gdh gene coding for a glutamate dehydrogenase that has been shown to be beneficial regarding amino acid conversion to aroma compounds (Tanous, Chambellon, Delespaul, & Yvon, 2006). The cheese model was a UF-type cheese made from milk ultrafiltered using CARBOSEP M1 pilot equipment for 80 min, as previously described (Saboya, Goudedranche, Maubois, Lerayer, & Lortal, 2001). The five-fold concentrated UF-retentate containing 6% fat was prepared and supplied by the Laboratoire des Sciences et Technologie du Lait et de l’œuf (INRA, Rennes, France). It had the same composition as that used in the study by Ulve et al. (2008). Overnight cultures (16 h) of L. lactis grown in M17 containing 5 g L1 lactose (M17Lac) were used to inoculate (1/1000) 180 g of UFretentate in 0.25 L Schott flasks to which a ten-fold diluted rennet (Maxiren 180, DSM food specialties, Delft, The Netherlands) solution (filtered at 0.45 mm) was added (0.03%, v/v) simultaneously. The mixture was incubated for 8 h at 30  C and then kept at 12  C for 7 days. Control cheeses were also prepared by the addition of rennet to ultrafiltered milk without any bacterial inoculation. Each cheese experiment was performed in triplicate. One day and seven days after inoculation, 20 g cheese samples were collected and stored at 80  C for metabolite analysis, and the remainder (160 g) was immediately used to recover Lactococcus cells. To recover the bacteria, cheese samples (160 g) were solubilized in nine volumes of 0.1 M Tris buffer (pH 8.0) containing 20 g L1 trisodium citrate, using an Ultra-Turrax T25 (IKA Laboratory Technology, Staufen, Denmark) at 16,000 rpm for 2 min. The bacteria were then harvested by centrifugation (5000  g, 10 min, 4  C). The cell pellet was washed with 200 mL ice-cold TE buffer (10 mM Tris, 1 mM EDTA, pH 8.0), divided in two and stored frozen at 20  C for proteomic and enzymatic analyses. 2.2. Kinetics of growth and acidification To determine the growth and acidification kinetics of each strain, 300 g UF-cheeses were prepared as described above, distributed between 10 flasks and incubated as described above. Each hour for 7 h, on day one (D1) and seven (D7) after inoculation, one flask was used firstly to measure the pH and secondly to enumerate L. lactis. The cheese sample was diluted in Ringer’s solution and homogenized using an Ultra-Turrax at 16,000 rpm for 2 min. Appropriate decimal dilutions were made in Ringer’s solution and plated on M17Lac. Lactococci were enumerated after incubation at 30  C for 24 h.

tributylphosphine containing a cocktail of protease inhibitors diluted 20-fold (P8465; SigmaeAldrich, St Louis, MO, USA) and 40 U mL1 of catalase to limit protein degradation and isoform formation, respectively. The cell suspension was transferred to the pre-cooled chamber of a BASIC Z cell disrupter (Constant Systems Ltd, Northants, UK) and was subjected to a pressure of 2500 bar. The suspension was centrifuged at 5000  g for 20 min at 4  C to remove unbroken cells and large cellular debris. The supernatant was collected and centrifuged at 220,000  g for 30 min at 4  C. The total protein concentration in the resulting supernatant (cytosolic fraction) was determined using the Coomassie protein assay reagent (Pierce, Rockford, IL, USA), with bovine serum albumin as a standard. The cytosolic fraction was aliquoted and stored frozen at 20  C. 2.3.2. Two-dimensional electrophoresis 2-DE was performed as previously described (Gitton et al., 2005) but with some minor modifications. Briefly, a volume of cytosolic fraction corresponding to 300 mg of protein was incubated for 30 min at 37  C with 25 U benzonase nuclease. It was then thawed on ice and precipitated with 75% (v/v) methanol. The protein pellet was resuspended in 500 mL isoelectric focusing (IEF) buffer 1, consisting of 7 M urea, 2 M thiourea, 4% CHAPS(3-[(3-cholamidopropyl)-dimethylammonio]-1-propanesulfonate), 100 mM dithiothreitol and 0.5% pH 4 to 7 immobilized pH gradient (IPG) buffer (Amersham-Pharmacia Biotec, Uppsala, Sweden). The sample was loaded on a 24-cm pH 4e7 IPG strip (Amersham-Pharmacia Biotec) which was rehydrated at 50 V for 11 h. IEF was carried out for 65,000 V h at a maximum of 8000 V, using the Protean II IEF cell (Bio-Rad, Hercules, CA, USA). After the completion of IEF, the IPG strip was incubated for 15 min while shaking in 150 mM TriseHCl (pH 8.8), 0.1% (w/v) SDS. It was then positioned on sodium dodecyl sulfateepolyacrylamide gels, using 1% low-melting-point agarose in 150 mM TriseHCl (pH 8.8). Seconddimension electrophoresis was performed on 12% polyacrylamide gels (24 by 20 by 0.1 cm) in 25 mM Tris, 192 mM glycine, 0.1% sodium dodecyl sulfate (pH 8.3), using the EttaneDalt II apparatus (GE Healthcare Europe GmbH, Orsay, France). Electrophoresis was run at 1 W/gel for 16 h at 4  C. The gels were stained with BioSafe colloidal Coomassie blue (Bio-Rad) for 1 h and then de-stained with three successive washes in deionized water. The set of images and the information associated with the spots can be retrieved by downloading the PARIS software (http://www.inra.fr/bia/J/imaste/paris/) (Wang, Caron, Mistou, Gitton, & Trubuil, 2004). 2.3.3. Image acquisition and 2-DE-gel analysis Gel images were generated using an Epson Expression 1640XL scanner (Epson, Long Beach, CA, USA) controlled by Silver Fast software. Image files were recorded at 65536 Gray levels (16 BitsPerPixel). Image manipulation and analysis were performed with SameSpot v2.0 software (Nonlinear Dynamics, Newcastle upon Tyne, UK). A comparative analysis was made by analyzing images from three independent cultures of the two strains for the two “ripening” times. For each spot, the ratio of the expression level of the corresponding protein was calculated for each strain between the two sample time points (D1 and D7) and for each time point between the two strains. A protein was included in the list of up- or downregulated proteins according to the following criteria: (i) a minimum of a two-fold change of abundance between two conditions observed in the set of triplicate gels, and (ii) the difference was statistically significant (Student’s t test, p < 0.05). For proteins that were only detected in one strain, the ratio could not be calculated.

2.3. Proteomic analysis 2.3.1. Preparation of cytoplasmic protein extract The cell pellet corresponding to 80 g of cheese was resuspended in 4 mL of 20 mM sodium phosphate buffer (pH 6.4), 1 mM EDTA, 10 mM

2.3.4. Protein identification Proteins were identified at the PAPPSO platform (INRA, Jouy-enJosas, France) using Maldi-TOF mass spectrometry. Protein spots were excised from stained gels and then digested in-gel by trypsin.

M. Yvon et al. / International Dairy Journal 21 (2011) 335e345

The resulting peptide mixtures were analyzed using a Voyager DE STR Instrument (Applied Biosystems, Framingham, CA, USA). Database searches were conducted with the MS-Fit software (http://prospector.ucsf.edu) on an L. lactis-specific database. The few spots that could not be identified using MALDI-TOF were analyzed by LC-MS/MS with an Ultimate 3000 LC system (Dionex, Voisins le Bretonneux, France) connected to a linear ion trap mass spectrometer (LTQ, Thermo Fisher, Illkirch, France) with a nanoelectrospray interface to enable the separation, ionization and fragmentation of peptides, respectively. Protein identifications were performed with Bioworks 3.3 software (Thermo Fisher). 2.4. Metabolite analysis 2.4.1. Analysis of organic acids by HPLC Two gram cheese samples were blended with 8 mL of 5 mM H2SO4 and homogenized with the Ultra-Turrax at 11,000 rpm for 20 s. An aliquot of the cheese suspension was centrifuged for 5 min at 23,000g and the supernatant was filtered through a Millex HV 0.45 mm filter (Millipore, Molsheim, France) before HPLC analysis. Organic acids were separated on an Aminex HPX87H column (300  7.8 mm) (Bio-Rad) at 40  C using 5 mM H2SO4 as the mobile phase at a flow rate of 0.6 mL min1. They were detected at 214 nm and identified by their retention times compared with those of standard compounds (ketoacids, hydroxyacids and acids derived from amino acids and glucose). The concentrations of fermentation products (citrate, pyruvate, succinate, lactate, formate, acetate and fumarate) were calculated from external standard calibrations while the concentrations of other compounds were expressed as peak areas. 2.4.2. Analysis of free amino acids by HPLC Free amino acids in cheese samples were determined by cation exchange chromatography with lithium buffers and ninhydrin postcolumn derivatization using a Pickering PCX 5200 module (Pickering Laboratories, Mountain View, CA, USA) fitted to a Waters (Milford, MA, USA) biocompatible HPLC system (626 pump, 717 plus auto sampler and 2487 detector) (Le Bars & Yvon, 2008). Samples were essentially prepared as previously described (Ziadi et al., 2010). Briefly,10 g cheese samples were blended with 20 mL cold sterile H2O and homogenized with the Ultra-Turrax at 11,000 rpm for 20 s. An aliquot of 0.5 mL of the homogenized suspensions was blended with 0.5 mL of Seraprep reagent (Pickering Laboratories). The mixture was kept for 5 min on ice and then centrifuged for 5 min at 23,000  g. The supernatant was then filtered through a Millex HV filter (Millipore) and diluted twice with the injection buffer (Li220, Pickering Laboratories). The injection sample volume was 50 mL and detection was performed at 570 nm and 440 nm. Concentrations were determined from external standard calibrations. 2.4.3. Analysis of volatile compounds by dynamic headspace extraction and GCeMS The analysis of volatile compounds by dynamic headspace extraction and GCeMS was performed essentially as previously described (Berger, Khan, Molimard, Martin, & Spinnler, 1999; Kieronczyk, Skeie, Langsrud, Le Bars, & Yvon, 2004). Twenty mL of cheese suspensions in water, prepared as described above, were placed in a 25-mL needle sparger tube (Teckmar and Dohrmann, Cincinnati, OH, USA) and 2 mL pure octanol and 25% NaH2PO4 (w/v) were added to prevent foaming and improve the release of volatile compounds, respectively (Lee, Diono, Kim, & Min, 2003). The components were identified by their retention times and mass spectra as compared with those in the NIST98 library (Agilent, Massy, France). Their concentration was expressed as the peak area of specific ions. The ethanol concentration was calculated by

337

external standard calibration in control cheese (made without bacteria). 2.4.4. Analysis of volatile compounds by solid-phase microextraction and GCeMS In a 20 mL PTFE sealed vial, 5 mL of cheese suspensions in water (prepared as described above) were acidified by the addition of 1 mL of 1 M H2SO4. Volatile compounds were extracted from the headspace phase with a Multi-Purpose Sampler MPS2 (Gerstel, GmbH&Co., Mulheim an der Ruhr, Germany) fitted with a solidphase microextraction (SPME) fibre (Carboxen/PDMS 75 mm, Supelco, Bellfonte, PA, USA) and analyzed using GCeMS as described by (Kieronczyk et al., 2004). The separated compounds were detected and identified as described above using the purge and trap method. Their concentrations were expressed as the peak areas of specific ions. 2.5. Determination of enzyme activities Cell-wall proteinase activity was measured on whole lactococcal cells grown in retentate at 30  C for 3.5 h. Bacteria were recovered by centrifugation after dilution of the culture in 4 vol 0.1 M Tris buffer (pH 8.0) containing 20 g L1 trisodium citrate. The cell pellets were washed three times with 50 mM b-glycerophosphate buffer (pH 7.0) containing 30 mM CaCl2. The bacteria were resuspended in 1 mL 0.1 M Tris buffer (pH 6.5) and their concentration evaluated by absorbance measurement at 600 nm. The bacteria were then incubated at 30  C for 24 h in the presence of 1 mM MeO-suc-ArgPro-Tyr-pNa (SigmaeAldrich, Saint-Quentin Fallavier, France). For high ionic strength conditions, NaCl (1.76 M final concentration) was added. The release of pNa was measured after 5, 30, 90, 150 min and 24 h incubation at 30  C by absorbance measurements at 410 nm after the bacteria had been removed by centrifugation. Several other enzyme activities were determined in extracts of cells harvested at D1 and D7. The cell extract was prepared, and aminotransferase activities were measured, as previously described (Rijnen, Bonneau, & Yvon, 1999; Ziadi et al., 2010). Phenylalanine, isoleucine and aspartic acid were used as substrates for aromatic aminotransferase (ArAT), branched-chain aminotransferase (BcAT) and aspartate aminotransferase (AspAT), respectively. Lactate dehydrogenase and D-2-hydroxyisocaproate dehydrogenase activities were determined as previously described (Chambellon et al., 2009) using pyruvate and 2-ketoisocaproate as substrates, respectively. Activities were measured at 37  C with freshly prepared cell extracts from Lactococcus strains. The reaction mixture contained 50 mM triethanolamine (pH 7.0), 0.2 mM NADH, and 10 mM substrate. For LDH activity, the reaction medium also contained 0.2 mM fructose 1,6-bisphosphate (FBP). The decrease in the absorbance of NADH was monitored at 340 nm (3 ¼ 6.22 mM1 cm1). One unit of enzyme was defined as the amount which catalyzed the oxidation of 1 mmol NADH per min at 37  C. NADP-dependent glutamate dehydrogenase was determined in fresh cell extracts using a test based on the colorimetric glutamic acid assay of Boehringer, as previously described (Kieronczyk, Skeie, Langsrud, & Yvon, 2003). Quantifications were performed using calibration curves established with pure NADPH. One unit of GDH activity corresponds to the production of 1 nmol NADPH per min of the reaction. Esterase activity was determined in microplates by monitoring the hydrolysis of the chromogenic p-nitrophenylbutyrate substrate. The reaction mixture contained 200 mL 50 mM TriseHCl buffer (pH 8.0), 10 mL 5 mM p-nitrophenylbutyrate in ethanol and 5 mL cell extract. Incubations were performed at 37  C, and the increase in absorbance at 405 nm, due to the release of p-nitrophenyl, was

338

M. Yvon et al. / International Dairy Journal 21 (2011) 335e345

monitored over 60 min. The results are expressed as DOD405 min1 mg of protein1. For all types of activity, the data are the means of determinations in cell extracts from three separate cheese trials  standard deviation. 2.6. Screening for genes by PCR amplification Chromosomal DNA was extracted from L. lactis cells, as described by (Sambrook, Russel, & Sambrook, 2001). PCR amplification was carried out on a PerkineElmer 2400 or 2720 DNA thermal cycler (Coutaboeuf, France) using Taq polymerase (Q Biogen, Illkirch, France). The oligonucleotides used (Table 1) were designed from the genome sequence of L. lactis IL1403 (Bolotin et al., 2001) and were synthesized by Eurogentec (Seraign, Belgium). 2.7. Statistical analysis Principal components analysis (PCA) was carried out using Statgraphics Plus 5.1 software (Sigma Plus, Levallois-Perret, France). 3. Results 3.1. Growth and acidification of L. lactis strains in cheese The growth and acidification kinetics of LD61 and UCMA5713 strains were monitored during UF-cheese-making experiments (Fig. 1, Table 2). Like all proteinase-positive strains, UCMA5713 and LD61 strains displayed biphasic exponential growth (Fig. 1), including a first phase during which amino acids were used as a nitrogen source and a second phase, slower, corresponding to the utilization of caseins as an amino acid source (Juillard et al., 1995). The UCMA5713 strain grew and acidified more rapidly than LD61, especially during the second phase of growth (Fig. 1). When the cheese was stored at 12  C after 8 h of cultivation, the growth of LD61 was not totally complete and the pH had decreased from 6.53 (initial pH) to 6.2, while the growth of UCMA5713 was almost finished and the pH reached 5.8. At D1, cell counts were 1.6 fold higher in cheese made with UCMA5713 than in cheese made with LD61, but the pH values of the two cheeses were similar (Table 2). Between D1 and D7 acidification continued for both strains, which resulted in a reduction in the pH of 0.5 units. Cell counts showed that the two strains did not lyse in cheese between D1 and D7. A previous study using the LD61 strain grown in skim milk in an anaerobic environment without pH regulation and with a similar temperature downshift, reported pH values at D1 and D7 that were about 0.3e0.5 unit lower than those we observed in the retentate

Table 1 Primers used in the study. Primer Sequence (50 e30 )

Primer Sequence (50 e30 )

arcA-F arcA-R asnB-F asnB-R galT-F galT-R galE-F galE-R lacR-F lacR-R mae-F mae-R gadB-F gadB-R

xylA-F xylA-R aroA-F aroA-R glt-F glt-R gyrA-F gyrA-R nif-F nif-R pepF-F pepF-R prtP-F prtP-R

AATGTTCAATTTCAACTTCG CAGCACTTAGCGATATGG TCCAGGTTACTACTATGC ATTTGATCAGAAACTTCACC AATCTTAGAACAGACATTGG TCAAAACCAGAAAAAGACC TCTAGTGCTTTGATGTGTG TGTGCTTACTCTTTAGTGG TAATGGATTGCTCTATATCG GCACTATTGAATTGATAAGC TATCGTTGTCTTAGCAGG CATTCGCACTCAATAAACC GTTGGTAGTTCTCCTCCA AAACTTAGTTATTTCATCTGG

GCGTCAAAATCATATTGGT TTCCATGATATTGATATTGC CATTGCTTGAATGACTTCG CAACTCGTCTTTTACTGGG ATCAGTGGGTAAACTTGG TGCGATTATTGGGTCTGG TTGGTTTCAATATGTTGGC ATCAGACATTCCCATTCC TTCTATTAAACACAAGTTGG TTCCATTCGTCTTCGTCG GCGGATATTAAGTTACCTAGGT TTTGGCAATTACTTCTAAAGGAT GTTGACGAACAACACGGCTTGCAT TGATGTCCCTGGCGTTCCCAC

Fig. 1. Growth and acidification kinetics of L. lactis LD61 and UCMA5713 strains in UFtype cheese: (:) cfu mL1 LD61, (-) cfu mL1 UCMA5713, ( ) pH LD61, ( ) pH UCMA5713; data are the means of determinations in three separate cheese trials and error bars indicate standard deviation.

(Raynaud et al., 2005). This difference was probably linked to the buffer capacity of the retentate which was higher than that of skim milk. 3.2. Metabolite analysis 3.2.1. Total free amino acids and fermentation products During the first day, proteolysis by strain UCMA5713 appeared to be more efficient than that achieved by strain LD61. Indeed, the total amount of free amino acids produced in cheese was 2.5 fold higher (Table 3), while the biomass of UCMA5713 was only 1.6 fold higher. This result suggests that the growth of LD61 was initially limited by weaker proteolysis. However, at D7, free amino acid production by both strains was similar, although the biomass of LD61 was lower. During the first 24 h, LD61 consumed a large part of lactose and all citrate (about 11 mM) and produced simultaneously 96 mM lactic acid, about 11 mM acetate (arising mainly from citrate catabolism) and a small quantity of formic acid (3.2 mM). As expected, UCMA5713 did not consume citrate because it does not harbor the genes required for citrate utilization and therefore consumed only lactose which was mainly transformed into lactic acid and small quantities of acetate, formate and ethanol that accounted for about 3% of all fermentation products. At this time point (D1), lactic acid production by UCMA5713 was 1.5 fold higher than that of LD61, which agreed with the fact that UCMA5713 grew 1.6 fold faster than LD61 in cheese. Between D1 and D7, both strains continued to produce lactic acid and at D7 their production was identical. Both strains also produced small quantities of acetic acid and formic acid. During this period, the production of mixed-acid products represented 3%e4% of total fermentation products for LD61 and about 8%e9% for UCMA5713. This progressive induction of mixed-acid fermentation was probably due carbon starvation or a low growth rate.

Table 2 Growth and acidification kinetics in cheese made with the L. lactis LD61 and UCMA5713 strains. Measurements were made on day one (D1) and seven (D7) after inoculation.a Parameter

LD61 D1

UCMA5713 D7

D1

D7

Cell counts 3.1  0.6  109 2.8  0.3  109 5.0  1.6  109 5.7  1.1  109 Cheese pH 5.37  0.03 4.87  0.02 5.07  0.02 4.68  0.02 a Data are means with standard deviation of determinations in three separate cheese trials.

M. Yvon et al. / International Dairy Journal 21 (2011) 335e345

339

Table 3 Concentrations of total free amino acids and fermentation products (mmol g1) in cheese samples collected on day one (D1) and seven (D7) after inoculation with the L. lactis LD61 and UCMA5713 strains.a Component

Free amino acids Citrate Lactic acid Acetic acid Formic acid Ethanol Succinic acid a b

Controlb

LD61

D1

D7

D1

0.49  0.13 11.1  1.3 1.74  0.01 0 0 0.05 0

0.64  0.02 10.5  0.7 2.09  0.17 0 0 0.04 0

2.4 0.9 96 11 3.2 0.025 0.57

UCMA5713 D7       

0.2 0.1 3 0.2 0.3 0.003 0.04

7.6 1.2 217 14.2 5.5 0.066 1.29

D1       

0.7 0.1 4 0.4 0.3 0.005 0.05

5.95 12.6 135 1.2 2.4 0.15 0.9

D7       

0.15 0.3 4 0.4 0.4 0.01 0.07

7.5 12.8 217 3.4 7.0 0.23 1.69

      

1.3 0.8 12 0.2 0.4 0.03 0.09

Data are means with standard deviation of determinations in three separate cheese trials. Control cheese was made without bacteria inoculation.

3.2.2. Comparison of metabolite composition of cheese Principal Component Analysis was performed on the values obtained for the 70 metabolites analyzed by HPLC and GCeMS. Fig. 2 shows the projection of the cheese samples on the plane formed by the first two principal components that explained 68% of total variance. The most explanatory variables are also projected on the plane. The cheese samples clearly differed as a function of the strain used for cheese-making and of ripening time. We examined the evolution of metabolite concentrations between D1 and D7. With both strains, the concentrations of most free amino acids increased, as did those of leucine and phenylalanine, but arginine levels fell markedly while aspartate levels remained constant. Citrulline, ornithine and GABA appeared in cheese at D7 only, and asparagine concentrations were 7e17-fold higher at D7 than at D1. Moreover, the concentrations of pyruvate and benzaldehyde fell between D1 and D7 while those of lactate, formate, succinate and some hydroxyacids, derived from amino acids, rose. Lactate and formate are produced from pyruvate by LDH and PFL, respectively. Citrulline and ornithine, which are not present in casein, result from arginine catabolism by ArcABC (Fig. 3). Asparagine can be produced from aspartate by AsnB, but it may also result from casein hydrolysis. Succinate could be produced

from aspartate, citrate or pyruvate via the reductive TCA pathway. Finally GABA is produced from glutamate by GadB. Considering the differences between strains at D1, the mean level of free amino acids was 2.5 times lower in cheese made with LD61 than in that made with UCMA5713 (Fig. 4). However, the Asp and Asn levels were the same while those of Thr, Met and Ile were respectively 6, 11 and 6 times lower in LD61 cheese, indicating that the relative production of Asp and Asn by LD61 was higher, while the production of Thr, Met and Ile was lower. Notably, the isoleucine level was very low in cheese made with LD61 (8  1 nmoles per g of cheese). These results suggest that the proteolytic system of LD61 is less efficient than that of UCMA5713 during the first day. This deficit was then made up and at D7, only 8 amino acids remained at different concentrations in the cheeses made with LD61 and UCMA5713 (Table 5). In particular, the levels of citrulline, asparagine and isoleucine were finally higher in cheese made with LD61 while those of threonine, methionine and arginine were much lower. These results showed that arginine degradation to citrulline was more rapid in cheese made with LD61 than in cheese made with UCMA5713. They also showed that LD61 produced more aspartate and asparagine at D1, and much more isoleucine between D1 and D7, than UCMA5713.

Fig. 2. Plots of the first two components of principal components analysis performed on metabolite levels in UF-type cheeses made in triplicate with L. lactis LD61 and UCMA5713 strains, after 1 (D1) and 7 days (D7) of ripening at 12  C. The most explanatory variables are projected on the plane.

340

M. Yvon et al. / International Dairy Journal 21 (2011) 335e345 Table 4 Volatile compounds with significantly different levels after 7 days (D7) in cheeses made with the L. lactis LD61 and UCMA5713 strains (p < 0.05).a Compound

LD61

UCMA5713

Diacetyl Acetoin 2,3-Butanediol

2272  586 2498  1067 508  91

1240  133 352  24 402  25

a Values are surface area  103 and are means with standard deviation of determinations in three separate cheese trials.

3.3. Enzyme activities Fig. 3. Arginine deiminase pathway in L. lactis. Proteins involved in the pathway are in italics.

14 12 10 8 6 4

His

Arg

Lys

Orn

GABA

Tyr

Phe

Ile

Leu

Met

Cit

Val

Ala

Gly

Pro

Gln

Glu

Asn

Asp

0

Thr

2 Ser

Ratio UCMA5713/LD61 at Day 1

We also observed that LD61 was associated with high levels of diacetyl, acetoin, 2,3-butanediol and acetate whatever the ripening time, while UCMA5713 was associated with a high level of citrate (Tables 3 and 4). This observation was in line with the fact that LD61 catabolises citrate (Fig. 5) while UCMA5713 does not. Citrate catabolism also generates oxaloacetate (OAA) that can be converted by AspaT into aspartate which, in turn, can be transformed into Asn by AsnB (Fig. 5). Therefore, the higher level of asparagine found in LD61 cheese at D7 (Table 5) probably resulted from citrate catabolism. Aspartate can also be transformed into threonine which can directly generate ketobutyrate (or oxobutanoate), one of the isoleucine precursors (Fig. 5). Interestingly, we observed that the threonine level was lower in LD61 cheese than in UCMA5713 cheese, while isoleucine and propanoate levels (Table 6) were higher at D7. These results suggest that LD61 catabolised threonine to a-ketobutyrate which was then partly used in the Ile biosynthesis pathway and partly degraded to propanoate. a-Ketoglutarate production by LD61 (Table 6) may also be reliant on citrate catabolism since OAA conversion to Asp by aspartate oxoglutarate aminotransferase results in the deamination of Glu to a-ketoglutarate (Fig. 5). Cheese made with UCMA5713 contained a higher level of a-ketoglutarate than LD61 cheese, probably because of the specific glutamate dehydrogenase (GDH) activity of UCMA5713. The higher levels of ketoacids (KIV, Phenylactate) and hydroxyacids (HMV, HMBA) derived from amino acids in cheese made with LD61 (Table 6) indicated greater amino acid catabolism by LD61 than by UCMA5713. Finally, ethanol resulting from the action of AdhE was mainly found in cheese made with UCMA5713 (Fig. 2 and Table 3).

Fig. 4. Ratio of free amino acid concentrations in UF-type cheeses made with L. lactis LD61 and UCMA5713 strains after ripening for 1 day at 12  C. Data are the means of determinations in three separate cheese trials and error bars indicate standard deviation.

The activities of seven enzymes involved in pyruvate and amino acid catabolism were measured in extracts of cells harvested from cheese at D1 and D7 (Table 7). No significant differences were observed between D1 and D7 regarding the enzyme activities of the two strains, except for aspartate oxoglutarate activity which was increased in UCMA5713. These results indicate that most of these enzymes were produced before D1 and were still active after 7 days of ripening. Considering the differences between strains, several activities were 2- to 4-fold stronger in LD61 than in UCMA5713. This was the case for phenylalanine oxoglutarate aminotransferase activity (ArAT) at D7, aspartate oxoglutarate aminotransferase activity (AspAT) at D1, and D-2-hydroxyisocaproate dehydrogenase activity at both D1 and D7. Glutamate dehydrogenase activity was only present in the UCMA5713 strain. Cell-wall proteinase activity was determined in cells harvested in the mid-log phase. By using the MeO-suc-Arg-Pro-Tyr-pNA substrate, both strains displayed a higher level of proteolytic activity in the high ionic strength buffer (1.76 M NaCl) than in the absence of NaCl, which was suggestive of PIII-type proteinase activity (Exterkate, 1990). Proteolytic activity was detected in both strains and was about three times higher with strain UCMA5713 than with strain LD61 which was in agreement with the initial and more efficient proteolysis of strain UCMA5713. 3.4. Proteome analysis 3.4.1. Evolution between Day1 and day 7 We observed very few changes in the proteomes of the two strains between D1 and D7. Only fifteen proteins significantly varied in abundance between D1 and D7 in LD61, and only four varied in UCMA5713 (Table 8). These proteins are involved in various functions but most of them are known to be induced by acid stress, such as GapA, ArcA, YkiE, LuxS, YahB and YgdA (Frees, Vogensen, & Ingmer, 2003; Raynaud et al., 2005; Solem, Koebmann, & Jensen, 2003; Willemoes, Kilstrup, Roepstorff, & Hammer, 2002). Moreover, we examined the evolution of the enzymes involved in the changes observed at the metabolite level (Table 9). The abundance of lactate dehydrogenase (LDH) did not vary between D1 and D7, suggesting that the production of lactate during this period was not due to an induction of the enzyme but to the fact that the enzyme was probably still active after D1. Nine spots representing different forms of pyruvate formate lyase (PFL), which requires enzymatic activation to become functional (Melchiorsen et al., 2000), were identified in both strains by mass spectrometry. Analysis of the respective abundances of these spots indicated that 50%e70% of PFL was already activated at D1 and that this percentage decreased slightly between D1 and D7. The early activation of PFL was in agreement with the formate production observed before D1. Among the enzymes involved in arginine degradation to ornithine, we only detected ArcA in LD61 and its abundance increased

M. Yvon et al. / International Dairy Journal 21 (2011) 335e345

341

Fig. 5. Pathway leading from citrate to isoleucine (Ile), propanoate, asparagine (Asn) or diacetyl, acetoine and 2,3-butanediol. Proteins involved in the pathway are in italics. KMV, a-ketomethylvalerate; OAA, oxaloacetate.

two-fold between D1 and D7. The other enzymes of the ArcB and ArcC pathways were not detected in LD61, and no enzyme of the pathway was detected in UCMA5713, although both strains degraded arginine to ornithine. Similarly, AsnB was only detected in LD61 but its concentration did not change between D1 and D7, while asparagine was only detected at D7. Finally GadB and PanE, the enzymes responsible for glutamate decarboxylation and hydroxyacid formation, respectively, were detected in neither LD61 nor UCMA5713, probably the amounts produced were too small. 3.4.2. Differences in the proteomes of the L. lactis LD61 and UCMA5713 strains To compare the strains, we only focused on the results obtained at D1 because there were minor changes in the proteomes of the two strains between D1 and D7.

Table 5 Free amino acids with significantly different levels after 7 days (D7) in cheeses made with the L. lactis LD61 and UCMA5713 strains (p < 0.05).a Amino acid

LD61

Arginine Citruline GABA Asparagine Threonine Glutamine Methionine Isoleucine

0 123 22 210 443 69 27 128

      

UCMA5713 53 43 14 74 769 52 42 84

24 3 60 30 11 7 24

       

8 9 5 7 130 5 7 14

a Values are concentrations expressed as nmoles g1 of cheese and are means with standard deviation of determinations in three separate cheese trials.

Table 6 Organic acids with significantly different levels after 7 days (D7) in cheeses made with the L. lactis LD61 and UCMA5713 strains (p < 0.05).a Compound

AA precursor

LD61

a-Ketoglutarate a-Ketoisovalerate

Glu Val Val Ile Met Phe Thr

290 70 78 645 91 408 47

Hydroxyisovalerate Hydroxymethylvalerate Hydroxymethylthiobutyrate Phenyllactate Propanoate

      

UCMA5713 10 2 3 24 8 15 7

400 58 134 364 53 206 11

      

36 1 3 42 5 10 1

Values are peak area  103 and are means with standard deviation of determinations in three separate cheese trials. a

Out of the 310 proteins identified in each strain, about 250 were common, 50 were specific to LD61 and 65 were specific to UCMA5713. Of the 250 common proteins, 40 were more abundant in LD61 and 30 were found at higher levels in UCMA5713. The absence of a few proteins in one strain was due to a lack of encoding genes. This was the case for the proteins encoded by the cit operon (CitC, CitE, CitF, Mae or CitM) that were only present in LD61, and GDH that is specific to UCMA5713. However, most of the differences observed were not due to the absence of a gene from one strain. For example, we verified by PCR amplification that the galE, galT, asnB, lacR, gadB, xylA, aroA, glt, gyrA, nif, pepF genes were present in both strains while the proteins were only found in the LD61 strain. Most differences between the strains were linked to the functional categories of translation, replication, cell process, energy metabolism, purine and pyrimidine metabolism, and amino acid metabolism (Table 10). Proteins involved in the translation process, and especially amino-acyl tRNA synthetases (AlaS, AsnS, GlyS, IleS, LeuS, ThrS, MetS, TrpS, TyrS) were much more abundant in LD61. Six peptidases (PepF, PepC, PepO, PepN, PepDB, YueF) and the oligopeptide transporter OppA, which are involved in the utilization of milk proteins, were more abundant in LD61. Several proteins involved in replication were also more abundant in LD61 (GyrA,

Table 7 Enzyme activities in extracts of cells harvested from cheese made with the L. lactis LD61 and UCMA5713 strains on day one (D1) and seven (D7) after inoculation.a Enzyme

L. lactis LD61 D1

Phenylalanine oxoglutarate aminotransferase Isoleucine oxoglutarate aminotransferase Aspartate oxuglutarate aminotransferase Esterase Lactate dehydrogenase D-2ehydroxyisocaproate dehydrogenase NADP-dependent glutamate dehydrogenase

L. lactis UCMA5713

D7

D1

D7

41  15

80  24

31  9

30  13*

678  156

473  35

448  85

448  112

202  11

153  15

78  3*

146  55

1.23  0.15 1.18  0.24 1.03  0.04 0.95  0.13 32  7 20  12 22  6 23  5 2.3  0.1 2.3  0.5 0.53  0.11* 0.67  0.16* nd

nd

1.95  0.2

1.68  0.78

a Activities are expressed as units per mg of protein: nd, not detected. Data are means with standard deviation of determinations in three separate cheese trials; an asterisk denotes Student’s t test between strains p < 0.05.

342

M. Yvon et al. / International Dairy Journal 21 (2011) 335e345

Table 8 Cytoplasmic proteins in the L. lactis LD61 and UCMA5713 strains, whose abundance varied between day one (D1) and seven (D7) by a factor >2 in at least one strain. Protein

LD61

UCMA5713

Ratio D7/D1

p value

DpsA1

2.6

0.006

FemD YlaF RpoC GapA YahB

2.6 2.5 2.4 2.4 2.3

0.01 0.02 0.02 0.001 0.003

2.0 1.4 Ndb 1.3 nd

RplD YkiE MycA

2.3 2.2 2.2

0.01 0.004 0.003

1.7 1.5 nd

YgdA

2.1

0.001

1

ArcA PrfB

2.1

0.03

nd 2

GyrA LuxS YqgA

0.5 0.5 0.5

0.01 0.02 0.01

nd nd nd

FtsY RecA CspD

0.75 2 0.34

ns ns 0.002

0.36 0.5 0.58

a b

Ratio D7/D1

Function

p value

0.003 nsa ns

ns 0.01

0.02

Iron-binding ferritin (starvation inducible DNA-binding protein) Amino sugar metabolism Nicotinate metabolism Glycolysis Universal stress protein, cellular process and signaling Ribosomal protein Unknown Myosine-cross reactive antigen Ribosome-associated protein; stress-response protein Arginine deiminase Peptide chain release factor B

Predicted hydrolase of the beta-lactamase superfamily 0.02 0.02 0.07

Cold shock protein

ns, not significant. nd, not detected.

GyrB, HexB, HsdM, PolA, RecA) while proteins involved in cell processes (division: GidA, GidC and detoxification: AhpC, AhpF) were more abundant in UCMA5713. In the energy metabolism category, proteins involved in sugar metabolism, and particularly those involved in the Leloir pathway (GalE, GalT, HasC, LacR, XylA, YrcA) were more abundant in LD61, while those involved in the tagatose pathway (LacA, LacB, LacC, LacF, LacX) were more abundant in UCMA5713. Proteins involved in TCA metabolism (CitC, CitE, CitF, Mae ou CitM and Als) were only present in LD61 while enzymes involved in ATP conversion (AtpD, AtpG) and mixed-acid fermentation (AdhE, AckA2) were mainly present in UCMA5713. Most proteins involved in purine and pyrimidine metabolisms, (PurC, PurE, PurH, PurL, PyrB, PyrC, PyrH, CarA, CarB, PydA, ThyA, NrdD, Add, RmplC) were more abundant in UCMA5713. In the amino acid biosynthesis category, two proteins involved in isoleucine biosynthesis from aspartate (ThrA, IlvC) and

Table 9 Abundance ratio of proteins involved in metabolite production between day one (D1) and seven (D7). Protein

LDH Full-lenght PFL subunit Cleaved PFL subunit ArcA AsnB GadB PanE a b

ns, not significant. nd, not detected.

LD61

UCMA5713

Ratio D7/D1

p value

Ratio D7/D1

p value

0.8 1.6 0.6 2.06 0.9 nd nd

0.0002 0.007 0.01 0.03 ns

1.03 1.1 0.5 ndb nd nd nd

nsa ns ns

several proteins in the aromatic and aspartate families (AroA, AroC, AroH, AsnH, AsnB, AspB, LysA, GlnA, GltD) were more abundant in LD61, while proteins mainly involved in the glutamate and serine families (Gdh, ProA, ProC, CysK, CysM, FhuR) were more abundant in UCMA5713. 4. Discussion The observation of L. lactis strains in a cheese model using proteomic and metabolomic approaches showed that adaptation mechanisms to this environment were mainly induced before ripening (before D1) and that the pathways induced remained active during ripening. We did not observe at the protein level any decrease in the abundance of proteins as had previously been seen at the transcript level during the post-acidification phase of growth in milk (Raynaud et al., 2005). During that transcriptional study performed using the same strain (LD61), the expression of 610 genes decreased between D1 and D7. These genes were involved in functions closely linked to growth, milk protein utilization and purine biosynthesis pathways. This difference between proteomic and transcriptomic approaches was probably due to the fact that protein degradation can be expected to be much slower than transcript degradation. Moreover, not all proteins are detected using a 2D gel approach, thus generating a more restricted metabolic view with the proteomic approach. The important metabolite production between D1 and D7 was due to the fact that L. lactis strains remained viable and did not lyse, as indicated by cell enumeration. Ganesan, Stuart, and Weimer (2007) had previously reported that L. lactis cells can remain metabolically active for several months, even if they are no longer viable. The main adaptation mechanisms induced by a cheese environment in both strains were responses to medium acidification and amino acid starvation. However, the intensity of the responses differed between the two strains, leading to notable divergences in proteome and metabolite production. In both strains, we observed the induction of several mechanisms (arginine deimination, decarboxylation of glutamate, aspartate and citrate) known to confer acid resistance (pH homeostasis) but the response was clearly stronger in LD61 than in UCMA5713. All these mechanisms are known to be induced by acid stress conditions (Garcia-Quintans, Magni, de Mendoza, & Lopez, 1998; Garcia-Quintans, Repizo, Martin, Magni, & Lopez, 2008). The difference in the responses of the two strains to acidification could be explained in two ways. Firstly, although the pH in LD61 cheese fell more slowly than in UCMA5713 cheese, the specific acidification at D1 by LD61 (0.374 pH units per 109 cells) was higher than that of UCMA5713 (0.292 pH units per 109 cells). Secondly, because all these mechanisms of response to acidification are also involved in energy production, the stronger induction of these pathways in LD61 may have been due to a higher energy requirement linked to an increased need for amino acid biosynthesis. The response to amino acid limitation before D1 was indeed much stronger in the LD61 strain. Several proteins encoded by genes regulated by the CodY transcriptional regulator which senses the intracellular level of isoleucine (Guédon, Serror, Ehrlich, Renault, & Delorme, 2001; Guedon et al., 2005), were more abundant in LD61 than in UCMA5713. This is the case for the PepC and PepN peptidases, the peptide transporter OppA and several proteins in the biosynthesis pathway of isoleucine and other amino acids. Moreover, several proteins involved in major physiological functions that have been shown to be repressed by isoleucine starvation (Dressaire, Redon et al. 2009) were less abundant in LD61 than in UCMA5713. These proteins are involved in pyrimidine and purine biosynthesis, in lactose utilization, in mixed-acid fermentation and in fatty acid metabolism.

M. Yvon et al. / International Dairy Journal 21 (2011) 335e345

343

Table 10 Proteins (grouped according to the classification determined by Bolotin et al., 2001) whose abundance differed significantly (p < 0.05) between the L. lactis LD61 and UCMA5713 strains in cells harvested on day one. Proteins more abundant in LD61

Proteins more abundant in UCMA5713 Spot vol  105

Grouping

Protein

Abundance ratio UCMA5713/LD61

2.1

131

Translation Ribosomal protein, translation factor

RplB

2.5

7

RpsJ RpsM Tgt GatB

RplD RplL RplS KsgA Efp PrfB

2 1.7

2.6

10 6 9 34

13 140 35 1 35 3

AlaS

3.7

16

AsnS GlyS IleS LeuS ThrS MetS TrpS TyrS

3 1.9

75 19 30 30 9 10 24 18

PepF PepC PepO PepN PepDB YueF

1.5 2 1.6 1.3

Grouping

Protein

Translation Ribosomal protein

RpsB

Translation Amino-acyl tRNA synthetase

Proteolysis

Replication

Transcription

GyrA GyrB HexB HsdM PolA RecA RpoC RpoD SunL

Abundance ratio LD61/UCMA5713

2.9 2.3

3.7 2.2 3.4 1.9

13.1

Purine and pyrimidine metabolism

Energy metabolism Aerobic, amines, electron transfer

PurA DeoB RmlB

YcgD YpjH YugC ArcA NifJ PgiA Gnd RpiA Tkt PdhC

4.6 3.4

2.6

2.1 2.1 3.4

Translation Amino-acyl tRNA synthetase

41 64 246 84 44 6

Proteolysis

15 44 3 23 18 38

Replication

12 15 3

Transcription

GreA NusA NusG

Cellular process

GidA GidC AhpC AhpF

Cellular process

35 85 41

9 28 8 7 4 119 148 2 73 29

Spot vol  105

Purine and pyrimidine metabolism

Energy metabolism Aerobic, amines, fermentation

PrtP

PurC PurL PurF PurH PyrB PyrC PyrF PyrH CarA CarB PydA ThyA NrdD Add RmlC NrdE YbdE YcgG YrbA AnsB AtpA AtpD AckA2 AdhE Ptk Zwf

2

2

3.3

2.5 2.5 2.5 2

2.5 3.3 2.5

2.5 2

1.7 2.5

15 5 42 1 3 30 25 35 79 8 70 25 8 8 9 32 23 5 3 3 7 28 12 13 27 7 3 106 57 6 29 6 7 (continued on next page)

344

M. Yvon et al. / International Dairy Journal 21 (2011) 335e345

Table 10 (continued ) Proteins more abundant in LD61

Proteins more abundant in UCMA5713

Grouping

Protein

Energy: sugar metabolism

GalE GalT HasC LacR XylA YrcA

Energy:TCA cycle

Amino acid metabolism

CitC CitE CitF Mae Als AroA AroC AroH AsnB AsnH IlvC ThrA AspB LysA AraT GlnA GltD

Abundance ratio LD61/UCMA5713

Spot vol  105

Energy: sugar metabolism

LacA LacB LacC LacD LacX

2 2.5

281 494 41 647 66

Energy:TCA cycle

5.8

4 8 11 33 5 9 12 47 10 10 151 8

Amino acid metabolism

4.2 3 2.3 2.1 1.9

25 6

Cell envelope

MurA1 YwaG MurD MurE MycA

1.8

9 4 13 5 12

YbaB OppA RgpD

Spot vol  105

9 183 417 115 12

2.3 2.1

Transport

Abundance ratio UCMA5713/LD61

2.9

4.3

ClpE PhoL

LplL ThiL

Protein

18 6 21 14 3 14

Adaptation

Fatty acid metabolism

Grouping

2.6 2

6 5

3 16 4

By contrast, two proteins involved in the Leloir pathway (GalE and GalT) and the repressor of the lac operon (LacR) were only present in LD61, indicating a shift from the tagatose pathway to the Leloir pathway which is less efficient for lactose catabolism. Such a reorientation of the lactose consumption pathway may be associated with a reduced catabolic rate since a strong decrease in glucose consumption has also been measured during isoleucine starvation (Dressaire, Redon et al. 2009). Moreover, we observed a higher production in LD61 of several amino-acyl tRNA synthetases which are regulated by a T-box element that is controlled by amino acid availability (Wels, Groot Kormelink, Kleerebezem, Siezen, & Francke, 2008). All these responses suggested a stronger limitation of amino acid availability, and especially of isoleucine availability, in LD61 than in UCMA5713 during growth. This limitation was confirmed by the free amino acid analysis in cheese at D1. The growth curve of LD61 in the milk retentate also indicated a limitation of amino acid availability. Indeed, the second phase of growth, corresponding to casein utilization as an amino acid source, was slower than that seen in UCMA5713. This limitation of amino acid availability may be due to a lower rate of casein hydrolysis by PrtP and/or a low peptide uptake

GDH ProA ProB ProC TrpB AroF GlnQ CysK CysM FhuR Ceo

Cell envelope

MurA2 MurB MurF Asd

Fatty acid metabolism

FabZ1 FabD AccB

Transport

PtnAB MsmK ChoQ OptD OptF

1.4 1.7

8 5

2 2

3 2 7 8 16 22 5 6

3 3 3 17

2.5

3.3

7 7 10 12 5 6 52 20

via the Opp system. Measurements of cell-wall proteinase activities in both strains in the mid-log phase confirmed that primary casein proteolysis was more efficient in strain UCMA5713. However, induction of the proteolytic system in LD61 via CodY regulation strongly stimulated free amino acid production between D1 and D7, which was 5-fold higher in LD61 cheese than in UCMA5713 cheese. Moreover, induction of the isoleucine biosynthesis pathway in LD61 further increased the production of Ile at D7. In terms of technological properties, it appeared that the LD61 strain, which initially grew and acidified more slowly than the UCMA5713 strain, finally produced large quantities of free amino acids because of stronger induction of its proteolytic system. Moreover, amino acid catabolism in this strain was stronger than in UCMA5713, but it mainly produced hydroxyacids that are not aroma compounds. This finding suggests that citrate fermentation in strain LD61 was more efficient that glutamate dehydrogenase (GDH) activity in strain UCMA5713 in producing the a-ketoglutarate necessary for the first step of amino acid catabolism. However, the citrate was rapidly consumed and therefore this pathway could not produce a-kg for long period, contrary to GDH that was still active at D7 and for which plenty of substrate (Glu) was still available.

M. Yvon et al. / International Dairy Journal 21 (2011) 335e345

In UF-type cheese, the use of strains belonging to the diacetylactis biovariant appears to be beneficial because the aroma compounds resulting from citrate fermentation (diacetyl and acetoin) remain in the cheese as they are not eliminated in whey during cheese pressing. In another respect, UCMA5713 cheese differed from LD61 cheese in that it contained higher levels of ethanol and methionine which are necessary for the production of ester and sulphur compounds, respectively, as they are both highly aromatic compounds. To conclude, this work underlined the fact that LAB selection for efficient and targeted cheese ripening cannot be based solely on genetic analysis. Both the timing and level of gene expression, and catalytic protein efficiency, are major factors that determine the overall metabolism of lactic acid bacteria. In particular, our findings highlighted the importance and consequences of the intensity of initial proteolysis with respect to global metabolism of L. lactis in a cheese environment. Acknowledgements This work received financial support from the French National Agency for Research (PNRA, Genoferment project). We would like to thank Coralie Deladrière for her assistance with protein identification at the PAPPSO platform (INRA, Jouy-en-Josas) and the Laboratoire des Sciences et Technologie du Lait et de l’oeuf (INRA, Rennes, France) for supplying us with the UF-retentate. References Beganovic, J., Guillot, A., van de Guchte, M., Jouan, A., Gitton, C., Loux, V., et al. (2010). Characterization of the insoluble proteome of Lactococcus lactis by SDSePAGE LC-MS/MS leads to the identification of new markers of adaptation of the bacteria to the mouse digestive tract. Journal of Proteome Research, 9, 677e688. Berger, C., Khan, J. A., Molimard, P., Martin, N., & Spinnler, H. E. (1999). Production of sulfur flavors by ten strains of Geotrichum candidum. Applied and Environmental Microbiology, 65, 5510e5514. Bolotin, A., Wincker, P., Mauger, S., Jaillon, O., Malarme, K., Weissenbach, J., et al. (2001). The complete genome sequence of the lactic acid bacterium Lactococcus lactis ssp. lactis IL1403. Genome Research, 11, 731e753. Bron, P. A., Grangette, C., Mercenier, A., de Vos, W. M., & Kleerebezem, M. (2004). Identification of Lactobacillus plantarum genes that are induced in the gastrointestinal tract of mice. Journal of Bacteriology, 186, 5721e5729. Chambellon, E., Rijnen, L., Lorquet, F., Gitton, C., van Hylckama Vlieg, J. E., Wouters, J. A., et al. (2009). The D-2-hydroxyacid dehydrogenase incorrectly annotated PanE is the sole reduction system for branched-chain 2-keto acids in Lactococcus lactis. Journal of Bacteriology, 191, 873e881. Derzelle, S., Bolotin, A., Mistou, M. Y., & Rul, F. (2005). Proteome analysis of Streptococcus thermophilus grown in milk reveals pyruvate formate-lyase as the major upregulated protein. Applied and Environmental Microbiology, 71, 8597e8605. Dressaire, C., Gitton, C., Loubiere, P., Monnet, V., Queinnec, I., & CocaignBousquet, M. (2009). Transcriptome and proteome exploration to model translation efficiency and protein stability in Lactococcus lactis. Public Library of Science Computational Biology, 5, e1000606. Dressaire, C., Redon, E., Gitton, C., Loubiere, P., Monnet, V., & Cocaign-Bousquet, M. (2009). Comprendre l’adaptation de Lactococcus lactis par une approche de biologie intégrative à l’échelle du génome: Dynamic transcriptome and proteome integration to investigate the adaptation of Lactococcus lactis to isoleucine starvation. France: Microbiologie et Biocatalyse Industrielle, University of Toulouse. Dressaire, C., Redon, E., Milhem, H., Besse, P., Loubiere, P., & Cocaign-Bousquet, M. (2008). Growth rate regulated genes and their wide involvement in the Lactococcus lactis stress responses. BMC Genomics, 9, 343. Exterkate, F. A. (1990). Differences in short peptide-substrate cleavage by two cellenvelope-located serine proteinases of Lactococcus lactis subsp. cremoris are related to secondary binding specificity. Applied Microbiology and Biotechnology, 33, 401e406. Frees, D., Vogensen, F. K., & Ingmer, H. (2003). Identification of proteins induced at low pH in Lactococcus lactis. International Journal of Food Microbiology, 87, 293e300.

345

Ganesan, B., Stuart, M. R., & Weimer, B. C. (2007). Carbohydrate starvation causes a metabolically active but nonculturable state in Lactococcus lactis. Applied and Environmental Microbiology, 73, 2498e2512. Garcia-Quintans, N., Magni, C., de Mendoza, D., & Lopez, P. (1998). The citrate transport system of Lactococcus lactis subsp. lactis biovar diacetylactis is induced by acid stress. Applied and Environmental Microbiology, 64, 850e857. Garcia-Quintans, N., Repizo, G., Martin, M., Magni, C., & Lopez, P. (2008). Activation of the diacetyl/acetoin pathway in Lactococcus lactis subsp. lactis bv. diacetylactis CRL264 by acidic growth. Applied and Environmental Microbiology, 74, 1988e1996. Gitton, C., Meyrand, M., Wang, J., Caron, C., Trubuil, A., Guillot, A., et al. (2005). Proteomic signature of Lactococcus lactis NCDO763 cultivated in milk. Applied and Environmental Microbiology, 71, 7152e7163. Guédon, E., Serror, P., Ehrlich, S. D., Renault, P., & Delorme, C. (2001). Pleiotropic transcriptional repressor CodY senses the intracellular pool of branched-chain amino acids in Lactococcus lactis. Molecular Microbiology, 40, 1227e1239. Guedon, E., Sperandio, B., Pons, N., Ehrlich, S. D., & Renault, P. (2005). Overall control of nitrogen metabolism in Lactococcus lactis by CodY, and possible models for CodY regulation in Firmicutes. Microbiology, 151, 3895e3909. Juillard, V., Le Bars, D., Kunji, E. R. S., Konings, W. N., Gripon, J.-C., & Richard, J. (1995). Oligopeptides are the main source of nitrogen for Lactococcus lactis during growth in milk. Applied and Environmental Microbiology, 61, 3024e3030. Kieronczyk, A., Skeie, S., Langsrud, T., Le Bars, D., & Yvon, M. (2004). The nature of the aroma compounds produced in a cheese model by glutamate dehydrogenase positive Lactobacillus INF15D depends on its relative aminotransferase activities towards the different amino acids. International Dairy Journal, 14, 227e235. Kieronczyk, A., Skeie, S., Langsrud, T., & Yvon, M. (2003). Cooperation between Lactococcus lactis and non-starter lactobacilli in the formation of cheese aroma from amino acids. Applied and Environmental Microbiology, 69, 734e739. Le Bars, D., & Yvon, M. (2008). Formation of diacetyl and acetoin by Lactococcus lactis via aspartate catabolism. Journal of Applied Microbiology, 104, 171e177. Lee, J.-H., Diono, R., Kim, G.-Y., & Min, D. B. (2003). Optimization of solid phase microextraction analysis for the headspace volatile compounds of parmesan cheese. Journal of Agricultural and Food Chemistry, 51, 1136e1140. Makhzami, S., Quenee, P., Akary, E., Bach, C., Aigle, M., Delacroix-Buchet, A., et al. (2008). In situ gene expression in cheese matrices: application to a set of enterococcal genes. Journal of Microbiological Methods, 75, 485e490. Melchiorsen, C. R., Jokumsen, K. V., Villadsen, J., Johnsen, M. G., Israelsen, H., & Arnau, J. (2000). Synthesis and posttranslational regulation of pyruvate formate-lyase in Lactococcus lactis. Journal of Bacteriology, 18, 4783e4788. Raynaud, S., Perrin, R., Cocaign-Bousquet, M., & Loubiere, P. (2005). Metabolic and transcriptomic adaptation of Lactococcus lactis subsp. lactis biovar diacetylactis in response to autoacidification and temperature downshift in skim milk. Applied and Environmental Microbiology, 71, 8016e8023. Rijnen, L., Bonneau, S., & Yvon, M. (1999). Genetic characterization of the major lactococcal aromatic aminotransferase and its involvement in conversion of amino acids to aroma compounds. Applied and Environmental Microbiology, 65, 4873e4880. Roy, K., Meyrand, M., Corthier, G., Monnet, V., & Mistou, M. Y. (2008). Proteomic investigation of the adaptation of Lactococcus lactis to the mouse digestive tract. Proteomics, 8, 1661e1676. Saboya, L. V., Goudedranche, H., Maubois, J. L., Lerayer, A. L., & Lortal, S. (2001). Impact of broken cells of lactococci or propionibacteria on the ripening of SaintPaulin UF-cheeses: estent of proteolysis and GC-MS profiles. Lait, 81, 699e713. Sambrook, J., Russel, D. W., & Sambrook, J. (2001). Molecular cloning: A laboratory manual. New York, NY, USA: Cold Spring Harbor Laboratory. Solem, C., Koebmann, B. J., & Jensen, P. R. (2003). Glyceraldehyde-3-phosphate dehydrogenase has no control over glycolytic flux in Lactococcus lactis MG1363. Journal of Bacteriology, 185, 1564e1571. Tanous, C., Chambellon, E., Delespaul, G., & Yvon, M. (2006). Glutamate dehydrogenase activity can be naturally transmitted to Lactococcus lactis strains to stimulate the amino acid conversion to aroma compounds. Applied and Environmental Microbiology, 72, 1402e1409. Ulve, V. M., Monnet, C., Valence, F., Fauquant, J., Falentin, H., & Lortal, S. (2008). RNA extraction from cheese for analysis of in situ gene expression of Lactococcus lactis. Journal of Applied Microbiology, 105, 1327e1333. Wang, J., Caron, C., Mistou, M. Y., Gitton, C., & Trubuil, A. (2004). PARIS: a proteomic analysis and resources indexation system. Bioinformatics, 20, 133e135. Wels, M., Groot Kormelink, T., Kleerebezem, M., Siezen, R. J., & Francke, C. (2008). An in silico analysis of T-box regulated genes and T-box evolution in prokaryotes, with emphasis on prediction of substrate specificity of transporters. BMC Genomics, 9, 330. Willemoes, M., Kilstrup, M., Roepstorff, P., & Hammer, K. (2002). Proteome analysis of a Lactococcus lactis strain overexpressing gapA suggests that the gene product is an auxiliary glyceraldehyde 3-phosphate dehydrogenase. Proteomics, 2, 1041e1046. Ziadi, M., Bergot, G., Courtin, P., Chambellon, E., Hamdi, M., & Yvon, M. (2010). Amino acid catabolism by Lactococcus lactis during milk fermentation. International Dairy Journal, 20, 25e31.