The modulation of extracellular superoxide dismutase in the specifically enhanced cellular immune response against secondary challenge of Vibrio splendidus in Pacific oyster (Crassostrea gigas)

Developmental and Comparative Immunology 63 (2016) 163e170

Contents lists available at ScienceDirect

Developmental and Comparative Immunology journal homepage: www.elsevier.com/locate/dci

The modulation of extracellular superoxide dismutase in the specifically enhanced cellular immune response against secondary challenge of Vibrio splendidus in Pacific oyster (Crassostrea gigas) Conghui Liu a, c, Tao Zhang a, c, Lingling Wang a, Mengqiang Wang a, Weilin Wang a, c, Zhihao Jia a, c, Shuai Jiang a, Linsheng Song b, * a b c

Key Laboratory of Experimental Marine Biology, Institute of Oceanology, Chinese Academy of Sciences, Qingdao 266071, China Key Laboratory of Mariculture & Stock Enhancement in North China’s Sea, Ministry of Agriculture, Dalian Ocean University, Dalian 116023, China University of Chinese Academy of Sciences, Beijing 100049, China

a r t i c l e i n f o

a b s t r a c t

Article history: Received 5 March 2016 Received in revised form 1 June 2016 Accepted 2 June 2016 Available online 4 June 2016

Extracellular superoxide dismutase (EcSOD) is a copper-containing glycoprotein playing an important role in antioxidant defense of living cells exposed to oxidative stress, and also participating in microorganism internalization and cell adhesion in invertebrates. EcSOD from oyster (designated CgEcSOD) had been previously reported to bind lipopolysaccharides (LPS) and act as a bridge molecule in Vibrio splendidus internalization. Its mRNA expression pattern, PAMP binding spectrum and microorganism binding capability were examined in the present study. The mRNA expression of CgEcSOD in hemocytes was significantly up-regulated at the initial phase and decreased sharply at 48 h post V. splendidus stimulation. The recombinant CgEcSOD protein (rCgEcSOD) could bind LPS, PGN and poly (I:C), as well as various microorganisms including Micrococcus luteus, Staphylococcus aureus, Escherichia coli, Vibrio anguillarum, V. splendidus, Pastoris pastoris and Yarrowia lipolytica at the presence of divalent metal ions Cu2þ. After the secondary V. splendidus stimulation, the mRNA and protein of CgEcSOD were both downregulated significantly. The results collectively indicated that CgEcSOD could not only function in the immune recognition, but also might contribute to the immune priming of oyster by inhibiting the foreign microbe invasion through a specific down-regulation. © 2016 Elsevier Ltd. All rights reserved.

Keywords: Extracellular superoxide dismutase RGD motif Crassostrea gigas Inhibiting factor Immune recognition Immune priming

1. Introduction Extracellular superoxide dismutase (EcSOD) is a highly expressed tetrameric copper-containing enzyme which scavenges superoxide anion to protect against extracellular oxidative damage (Marklund, 1984). Many innate immune responses, such as phagocytosis, are usually accompanied with a mass production of reactive oxygen species (ROS) and reactive oxygen intermediates (ROI) (Johansson et al., 2000). ROS and ROI have been postulated to be involved in many diseases and pathological conditions, such as aging, inflammation, reperfusion damage of ischemic tissue and various cardiovascular diseases (Ahl, 2010). To protect the organism from superoxide, EcSOD functions as an antioxidant enzyme in converting superoxide to hydrogen peroxide (H2O2), which is

* Corresponding author. E-mail address: [email protected] (L. Song). http://dx.doi.org/10.1016/j.dci.2016.06.002 0145-305X/© 2016 Elsevier Ltd. All rights reserved.

further converted to H2O and O2 (Kinnula and Crapo, 2003). A conserved region dominated by 15 residues was reported to form the active site stereochemistry, which supported the primary biological function of superoxide dismutation (Getzoff et al., 1989). The copper ion binding ability of the active sites plays a major role in the catalytic action by accepting an electron from one superoxide radical and donating it to another (Fridovich, 1986). Although the subtle activities of EcSOD in immune response have been implicated, its detailed roles are still in controversy (McCord and Edeas, 2005). EcSOD is involved in the control of ROS concentrations and protecting various tissues from damage, while it has reported to negatively affected host survival and bacterial clearance conversely (Break et al., 2012; Yao et al., 2010). In invertebrate, the immune functions of EcSOD seem to be more intriguing beside its involvement in antioxidation. Different from the mammal EcSODs, there is a particular motif of Arginyl/ Lysine-Glycyl-Aspartic acid (R/KGD) in invertebrate EcSODs, which has been reported to participate in microbe internalization

164

C. Liu et al. / Developmental and Comparative Immunology 63 (2016) 163e170

and cell adhesion, such as EcSODs from Pacifastacus leniusculus (Johansson et al., 1999), Onchocerca volvulus (James et al., 1994) and Caenorhabditis elegans (Fujii et al., 1998). R/KGD motif was reported to recognize and bind to Integrin family members, and it had been described as the essential cell attachment site for fibronectin, fibrinogen and vitronectin to bind to Integrins (Takagi, 2004). Moreover, many R/KGD motif containing proteins were evidenced with specific binding ability to a wide range of foreign invaders (Hostetter, 2000; Narasimhan et al., 1994). As a consequence of the adhesion interaction of R/KGD motif containing proteins with Integrins, pathogenic microbes are internalized by nonprofessional phagocytes (Hauck et al., 2012). Conversely, the R/ KGD-mediated adhesion is also utilized by a variety of foreign microbes to hide from the immune system to establish an effective infection in normally nonphagocytic cells and then possess a protected niche (He et al., 2004; Kline et al., 2009; Patti et al., 1994). On account of the dual binding ability to both host Integrins and invading microbes, the RGD containing protein had been adopted as a model to investigate the host-pathogen interaction, and vitronectin, for example, was depicted as bridge between bacteria and epithelial cells and benefit the pathogen eventually (Singh et al., 2010). CgEcSOD, the major protein of Pacific oyster Crassostrea gigas plasma, was characterized in 2005 for the first time with affinity to lipopolysaccharides (LPS) and binding ability to Integrin through a RGD motif (Gonzalez et al., 2005). Besides the LPS and Integrin binding ability, CgEcSOD was also reported to play a key role in the immune response of Vibrio splendidus (Duperthuy et al., 2011). The internalization of V. splendidus was significantly promoted in an OmpU (a virulence factor of V. splendidus) -CgEcSOD-CgIntegrin manner during the invasion process, and CgEcSOD acted as a bridge molecule between OmpU and the specific ligands of CgIntegrin (Duperthuy et al., 2011). Additionally, a paradoxical role of CgEcSOD was also revealed in the immune response against Vibrio aestuarianus 01/32, and a reduction of CgEcSOD was reported instead of a postulated transcriptional activation after V. aestuarianus 01/32 challenge (Labreuche et al., 2006). The mechanism underlying this confliction is still obscure and it has been speculated as a particular strategy to benefit the host of surviving from the invasion of V. aestuarianus 01/32 (Labreuche et al., 2006). Similarly, the downregulation of EcSOD after the repeat immune challenge also suggested its important role during the specific immune priming (Bolte et al., 2013). For example, extracellular Cu-Zn SOD in ctenophore was down-regulated after a secondary homologous bacterial challenge, which was inferred as a tactics to reduce inflammatory response, saving resources and cutting down selfdamage (Bolte et al., 2013). Specifically cellular immune priming was also reported in the oysters upon the secondary challenge of live V. splendidus (Zhang et al., 2014). Further research on the roles of CgEcSOD in V. splendidus internalization and the specific priming would provide new insights into the cellular and molecular bases of the host-microorganism interactions in C. gigas. The objectives of the present study were to (1) investigate the temporal expression of CgEcSOD after primary and secondary V. splendidus challenge, (2) examine its binding activity to PAMPs and microorganisms, and (3) inspect the possible role in the immune priming of oyster. 2. Materials and methods 2.1. Oysters and microbes Oysters C. gigas (average shell length of 13.0 cm) were obtained from a local farm in Qingdao, Shandong Province, China. Oysters were cultured in aerated freshwater tanks with continuously

oxygenated and filtered seawater at 15 ± 2  C for two weeks before processing. Bacteria Micrococcus luteus (Microbial Culture Collection Center, Beijing, China) were cultured in LB medium at 37  C for 20 h. Staphylococcus aureus (Microbial Culture Collection Center, Beijing, China) was grown in LB medium at 28  C for 20 h. Vibrio anguillarum (provided by Dr. Mo) and V. splendidus (Liu et al., 2013) were grown in 2116E medium at 28  C for 20 h. Fungi Pichia pastoris GS115 (Invitrogen) and Yarrowia lipolytica (provided by Dr. Chi) were grown in YPD medium at 28  C for 20 h. All microbes used in this study were harvested and re-suspended in filter sterilized (0.22 mm pore size) sea water (FSSW) and adjusted to the final concentration of 1  108 CFU mL1. 2.2. Immune challenge and hemolymph collection The primary and secondary immune challenges were performed according to the previous description (Zhang et al., 2014). Ninety oysters were equally divided into two subgroups designed as FSSW (received an injection of 100 mL FSSW) and Vs (received an injection of 100 mL V. splendidus at the concentration of 2  108 CFU mL1). For the secondary immune challenge, two hundred and forty oysters were employed and divided equally into four different subgroups designed as FSSW þ FSSW, FSSW þ Vs, HK-Vs þ FSSW, HKVs þ Vs, meaning that oysters received an 100 mL injection with FSSW (filtered-sterilized seawater, 0.22 mm pore size) or HK-Vs (heat-killed V. splendidus) for the primary stimulation at 0 h and an 100 mL injection with FSSW or Vs (live V. splendidus) for the secondary stimulation at 168 h,respectively. All the animals were returned to seawater tanks and maintained under static conditions after handling. Hemolymph samples were randomly collected at time points of 0, 6, 9, 12, 24 and 48 h after the first and secondary stimulations from each group. Five hundred microliter hemolymph of each oyster was aseptically withdrawn from the posterior adductor muscle sinus using a 23-gauge needle attached to a 2 mL syringe containing 1 mL anti-aggregant solution (0.5% g mL1 EDTA in PBS). The hemolymph from three oysters were pooled together (about 4.5 mL) as one sample, and three samples (including nine oysters) were collected for each sampling time points. The hemolymphs were centrifuged at 800 g, 4  C for 10 min to harvest the hemocytes and the plasma. All these hemocytes samples were stored at 80  C after addition of 1 mL TRIzol reagent (Takara) for subsequent RNA extraction. 2.3. mRNA expression analysis of CgEcSOD Total RNA was extracted from hemocytes using Trizol reagent (Takara) according to its manufacture’s protocol. The first strand synthesis was carried out based on Promega M-MLV RT Usage information using the DNase I (Promega) treated total RNA as template and oligo (dT)-adaptor as primer (Table 1). The reaction mixtures were incubated at 42  C for 1 h, terminated by heating at 95  C for 5 min cDNA mix was diluted to 1:100 and stored at 80  C for subsequent processing. The quantitative real-time PCR was carried out in a total volume of 25.0 mL, containing 12.5 mL of 2  SYBR Green Master Mix (Takara), 2.0 mL of the 100 times diluted cDNA, 0.5 mL of each primers (10 mmol L1), and 9.5 mL of DEPC-water. A fragment of 221 bp was amplified using two sequence-specific primers (Table 1), and the PCR products were sequenced to verify the PCR specificity. Elongation factors (CgEF1-a) primers (Table 1) were used to amplify a 94 bp fragment as an internal control to verify the successful reverse transcription and calibrate the cDNA template. The SYBR Green real-time PCR assay was carried out in an ABI

C. Liu et al. / Developmental and Comparative Immunology 63 (2016) 163e170 Table 1 Primers used in this study. Primer name Clone primers CgEcSOD-Cl-Fw CgEcSOD-Cl-Rv RT-PCR primers Oligo (dT)-adaptor CgEF1-a-rtFw CgEF1-a-rtRv CgEcSOD-rt-Fw CgEcSOD-rt-Rv Recombination primes CgEcSOD-Re-Fw CgEcSOD-Re-Rv

Sequence (50 e30 ) ATGAACGCCCTGATTGTTCTTAG TTAGTGGGCGTGAGAGCGAC GGCCACGCGTCGACTAGTACT17 AGTCACCAAGGCTGCACAGAAAG TCCGACGTATTTCTTTGCGATGT TGTTCTTAGTTTGGCTGCTCT ATGGTCCGTCTCCCCGTT GGGGTACCATGAACGCCCTGATTGTTCTTAG CGGGATCCTTAGTGGGCGTGAGAGCGAC

PRISM 7500 Sequence Detection System (Applied Biosystems). All data was given in terms of relative mRNA expression using the 2△△t method (Livak and Schmittgen, 2001). 2.4. Preparation of recombinant protein of CgEcSOD and polyclonal antibody The cDNA fragment encoding the mature peptide of CgEcSOD (AAY60161.1) was amplified with specific primers CgEcSOD-Cl-Fw and CgEcSOD- Cl -Rv (Table 1). A KpnI site and a BamH I site were added to the 50 end of sense primer CgEcSOD-Re-Fw and antisense primer CgEcSOD-Re-Rv with the stop codon deleted, respectively. The PCR fragments were digested completely by restriction enzymes KpnI and BamH I (NEB), and then cloned into the KpnI/BamH I sites of expression vector pET-32a (Novagen). The strain E. coli Transetta (DE3) with recombinant plasmid (pET-32a-CgEcSOD) was incubated in LB medium (100 mg mL1 ampicillin) at 37  C with shaking at 220 rpm. The control strain with pET-32a-Trx-6 His-tag was incubated in the same condition with 100 mg mL1 ampicillin. When the culture mediums reached OD600 of 0.5e0.7, the cells were incubated for an additional 4 h with the induction of IPTG at the final concentration of 1 mmol L1. The recombinant protein CgEcSOD (designated rCgEcSOD) and the recombinant tag protein Trx (thioredoxin, designated rTrx) were purified by a Ni2þ chelating Sepharose column and refolded in gradient urea-TBS glycerol buffer as described by Zhang et al. (Zhang et al., 2010). The resultant proteins were detected by SDSPAGE and their concentration was quantified by BCA kit (Beyotime). For the preparation of polyclonal antibody anti-CgEcSOD, rCgEcSOD was immunized to 6 weeks old rats to acquire polyclonal antibody as described in a previous report (Cheng et al., 2006).

165

Ig-AP conjugate (ABclonal) secondary antibody (diluted 1:2000) was added and incubated at 37  C for 1 h. After the last washing, 100 mL of 0.1% (w/v) p-nitrophenyl phosphate (pNPP, Sigma) in 50 mM carbonate bicarbonate buffer (pH 9.8) containing 0.5 mmol L1 MgCl2 was added and incubated at room temperature in dark for 30 min. The reaction was stopped by adding 2 mol L1 NaOH and the absorbance was measured at 405 nm. The wells with 100 mL of TBS were used as blank. 2.6. Microorganisms binding assay Gram-positive bacteria (M. luteus and S. aureus), Gram-negative bacteria (V. anguillarum and V. splendidus) and fungi (P. pastoris and Y. lipolytica) were used to investigate the binding spectrum of rCgEcSOD following the method described by Lee (Lee and € derh€ So all, 2001). One hundred microliters of purified rCgEcSOD in TBS (100 mg mL1) was incubated with microorganisms under rotation at room temperature for 30 min. Four parallel groups were employed designed as CgEcSOD, CgEcSOD þ Cu2þZn2þ, CgEcSOD þ Cu2þ, CgEcSOD þ plasma, meaning CgEcSOD with microorganisms, CgEcSOD with microorganisms in presence of 10 mmol L1 Cu2þ and Zn2þ, CgEcSOD with microorganisms in presence of 10 mmol L1 Cu2þ, and CgEcSOD with microorganisms in presence of 1 mg lyophilized plasma, respectively. The microorganisms were pelleted, washed three times with TBS, resuspended in 50 mL of TBS, and finally subjected to elution with 8% SDS. The supernatant was collected, and the binding spectrum of rCgEcSOD was determined by western-blot as described. rCgEcSOD were employed as positive control for western-blot of each group. 2.7. Western-blot analysis After separation by SDS-PAGE, protein preparations were transferred to nitrocellulose (NC) membranes (Amersham) by use of a Trans-Blot apparatus (Bio-Rad), and detected with antiCgEcSOD polyclonal antibody followed by horseradish peroxidase-conjugated goat anti mouse IgG (Tiangen) (diluted 1/ 2000). The proteins of interest were analyzed by 3, 30 -Diaminobenzidine tetra-hydrochloride (Sangon) enhancement and the pre-stained protein markers (NEB) were employed as standards. 2.8. Statistical analysis All data were given as means ± S.E. and subjected to one-way analysis of variance (one-way ANOVA) followed by an unpaired, two-tailed t-test. Differences were considered significant at p < 0.05 and extremely significant at p < 0.01.

2.5. PAMPs binding assay 3. Results The PAMPs binding assay was performed according to previous report with modification (Yu et al., 2007). Briefly, 100 mL (20 mg) of lipopolysaccharides (LPS) from E. coli (Sigma-Aldrich), peptidoglycan (PGN) from S. aureus (Sigma-Aldrich) and poly (I:C) (SigmaAldrich) were adopted to coat 96-well microtiter plate (Costar). The wells were blocked with 3% BSA (w/v) in PBS at 37  C for 1 h. After washed with PBST (1% tween-20 in PBS) for three times, 1/2-fold serial dilution concentrations of rCgEcSOD in TBS (50 mmol L1 Tris-HCl, 50 mmol L1 NaCl, pH 7.6) were added in the presence of 0.1 mg mL1 BSA and 10 mmol L1 Cu2þ. The same concentration of rTRX was used as control. After incubating at 18  C for 2 h and three times’ wash, 100 mL mouse anti-His tag monoclonal antibody (ABclonal) diluted to 1:2000 was added and incubated at 37  C for 1 h. The plate was washed again and 100 mL of rabbit-anti-mouse

3.1. The temporal mRNA expression of CgEcSOD post V. splendidus stimulation The temporal mRNA expression of CgEcSOD in hemocytes was analyzed after the oysters were stimulated by V. splendidus (Fig. 1). An acute significant up-regulation as well as a later reduction of CgEcSOD transcripts was observed after the challenge. In the V. splendidus challenged group, the expression level of CgEcSOD was significantly up-regulated at 9 h post injection, which was 1.5fold higher than that in control group (p < 0.05), and reached the peak at 24 h (9.4-fold, p < 0.05) and decreased sharply afterwards. A significant reduction was observed at 48 h post injection (0.52-fold, p < 0.05) (Fig. 1).

166

C. Liu et al. / Developmental and Comparative Immunology 63 (2016) 163e170

directly at the presence of Cu2þ (10 mmol L1). After incubation with anti-His tag monoclonal antibody, positive P/N values to LPS, PGN and poly (I:C) were obtained at the rCgEcSOD concentration of 1.8375 mg mL1, 3.675 mg mL1 and 3.675 mg mL1, respectively (Fig. 3). For LPS and PGN, the values were increased corresponding with the increasing of the concentration. While in the MAN group and control group (rTRX as negative control), no positive P/N value was detected after the incubation (Fig. 3).

3.4. Microorganisms binding assay of rCgEcSOD

Fig. 1. Temporal mRNA expression profile of CgEcSOD relative to CgEF1-a after V. splendidus challenge. Oyster hemocytes were employed to analyze CgEcSOD expression after V. splendidus challenged for 6, 9, 12, 24 and 48 h. The values were shown as mean ± SE (n ¼ 4), different letters over bars indicating significantly differences were employed by all samples (p < 0.05).

3.2. The recombinant protein of CgEcSOD and anti-CgEcSOD antibody In order to investigate the immunocompetence of CgEcSOD in vitro, the recombinant plasmid (pET-32a-CgEcSOD) was constructed and transformed into E. coli Transetta (DE3). After IPTG induction for 4 h, the whole cell lysate was analyzed by SDS-PAGE and a distinct band was observed with a molecular mass of 46 kDa, which was in accordance with the predicted molecular mass of fusion recombinant CgEcSOD protein with Trx-tag (Fig. 2). Two clear strips were detected in oyster plasma after incubation with antibodies (Fig. 2). Besides the targeted band of 50 kDa, another strip of 20 kDa was also revealed. In subsequent mass spectrometry analysis (BGI), both strips were identified as EcSODs with high expression level in oyster plasma (EKC39002.1 for 50 kDa and EKC26563.1 for 20 kDa). 3.3. PAMPs binding assay of CgEcSOD PAMPs binding assay based on the P/N signal value of fluorescence at 405 nm was employed to examine the immunocompetence of CgEcSOD. The samples with P/N > 2.1 were considered as positive. rCgEcSOD was adopted to analyze the binding activity

Fig. 2. SDS-PAGE and Western-blot analysis of CgEcSOD. Lane M: protein molecular standard; lane 1: negative control for rCgEcSOD (without induction); lane 2: IPTG induced rCgEcSOD; lane 3: purified rCgEcSOD; lane 4: Western-blot based on the sample in Lane 3; lane 5: Western-blot based on the oyster plasma sample.

A direct binding assay was carried out to analyze the binding ability of rCgEcSOD to microorganisms, including Gram-negative bacteria (V. splendidus and Vibrio auguillarum), Gram-positive bacteria (M. luteus and S. aureus), and fungi (P. pastoris and Y. lipolytica). In the CgEcSOD group, no band was observed except the positive control (Fig. 4). In the CgEcSOD þ Cu2þZn2þ group, rCgEcSOD could bind all six species of microbe at the presence of Cu2þ (10 mmol L1) and Zn2þ (10 mmol L1) (Fig. 4). In CgEcSOD þ Cu2þ group, strong binding activity to all microbe of rCgEcSOD was only observed with the presence Cu2þ (Fig. 4). Furthermore, in the CgEcSOD þ plasma group, when the metal ions were replaced with 1 mg lyophilized oyster plasma, faint binding activity of CgEcSOD was detected in the V. splendidus, M. luteus, S. aureus, P. pastoris and Y. lipolytica groups (Fig. 4).

3.5. The alternation of CgEcSOD expression level after the secondary challenge with live V. splendidus In order to validate the role of CgEcSOD in the specifically enhanced cellular immune responses, the mRNA expression of CgEcSOD after secondary challenge with live V. splendidus was investigated by real-time PCR. Consistently with the temporal mRNA expression post V. splendidus stimulation, CgEcSOD displayed an initial significant up-regulation as well as a later reduction post the primary challenge. In the FSSW þ Vs group, the relative mRNA expression level of CgEcSOD increased significantly at 6 h (2.6-fold, p < 0.05), peaked at 24 h (5.8-fold, p < 0.05) and showed no significant variance afterwards, compared with that of the FSSW þ FSSW group. Upon the secondary challenge, CgEcSOD displayed a specific down-regulation compared with the primary challenge. The relative mRNA expression level of CgEcSOD in the HK-Vs þ Vs group was lower than that in the FSSW þ Vs group at 6 (0.23-fold, p < 0.05) and 24 h (0.64-fold, p < 0.05), and lower than that in the FSSW þ FSSW group at 12 h (0.39-fold, p < 0.05) and 48 h (0.61-fold, p < 0.05) (Fig. 5). Western-blot assay was performed to confirm the expression level of CgEcSOD protein in oyster plasma after secondary challenge. For the sake of specificity, only targeted CgEcSOD of 50 kDa in plasma were quantified based on the grayscale of western-blot band (Fig. 6). In accordance with the RT-PCR assay, the expression level of CgEcSOD protein showed up-regulation after the primary challenge. The relative expression level in FSSW þ Vs group decreased in the initial phase and increased sharply at 48 h (1.7fold, p < 0.05), compared with FSSW þ FSSW group (Fig. 6B). Furthermore, the expression level of CgEcSOD protein was specifically down-regulated upon the secondary challenge compared with that of the primary challenge. In HK-Vs þ Vs group, the relative expression level of CgEcSOD was significantly lower than that in the FSSW þ Vs group at 12 (0.62-fold, p < 0.05) and 48 h (0.52fold, p < 0.05) and lower than that in the FSSW þ FSSW group at 12 (0.40-fold, p < 0.05) and 24 h (0.65-fold, p < 0.05).

C. Liu et al. / Developmental and Comparative Immunology 63 (2016) 163e170

167

Fig. 3. ELISA analysis of the interaction between rCgEcSOD and the PAMPs. Plates were coated with four PAMPs, and then incubated with a series of concentrations of rCgEcSOD and rTrx at the presence of Cu2þ (10 mmol L1). After incubated with mouse anti-His tag monoclonal antibody, the P/N values for (A) LPS, (B) PGN, (C) Poly (I:C) and (D) MAN were detected with rabbit-anti-mouse Ig-alkaline phosphatase conjugate at 405 nm. Samples with P/N > 2.1 were considered positive. Results are representative of the mean of three replicates ± SE.

Fig. 4. Microorganisms binding spectrum of rCgEcSOD revealed by western-blot. The binding spectrum to microorganisms of rCgEcSOD was detected by western-blot. Four parallel groups were employed designed as CgEcSOD, CgEcSOD þ Cu2þZn2þ, CgEcSOD þ Cu2þ, CgEcSOD þ plasma, which are CgEcSOD with microorganisms, CgEcSOD with microorganisms in presence of 10 mM Cu2þ and Zn2þ, CgEcSOD with microorganisms in presence of 10 mM Cu2þ, and CgEcSOD with microorganisms in presence of 1 mg lyophilized plasma, respectively.

4. Discussion In vertebrate, EcSOD regulates extracellular concentrations of reactive oxygen species and reactive nitrogen species (Fridovich, 1995), and consequently involves in immune response during inflammatory insults (Morales et al., 2015). Whereas invertebrate EcSOD is of great interest for its distinct RGD-motif which is absent in vertebrate (Gonzalez et al., 2005). The homologs of EcSOD in

oyster were identified and characterized successively named dominin (Itoh et al., 2011), cavortin (Scotti et al., 2007) or EcSOD (Gonzalez et al., 2005; Green et al., 2009). The LPS binding affinity of CgEcSOD has been evidenced in previous reports (Gonzalez et al., 2005), but its role in host-microorganism reaction remains controversy. In the present study, the functions of CgEcSOD in immune recognition and immune priming to V. splendidus were investigated.

168

C. Liu et al. / Developmental and Comparative Immunology 63 (2016) 163e170

Fig. 5. Temporal mRNA expression profile of CgEcSOD relative to secondary V. splendidus challenge. The mRNA expressions of CgEcSOD were measured in oysters collected 0, 6, 12 24, 48 h following the secondary challenge with live V. splendidus. Significant differences comparison of the level of mRNA was performed by ANOVA (mean ± SD, n ¼ 4; the letters (a, b, c etc.) presented significant differences, p < 0.05).

the reported expression patterns were in controversy (Bao et al., 2009; Labreuche et al., 2006; Yu et al., 2011). In bay scallop and Hong Kong oyster, the mRNA expression level of EcSOD increased post the challenges with microorganisms (Bao et al., 2009; Yu et al., 2011). Whereas a deduction of CgEcSOD mRNA in Pacific oyster was revealed one day post V. aestuarianus 01/32 stimulus (Labreuche et al., 2006). In the present study, the relative mRNA expression profile of CgEcSOD after V. splendidus stimulation shed lights on this argument. An up-regulation in initial phase as well as a later decline of CgEcSOD mRNA was revealed in hemocytes after V. splendidus stimulation. The up-regulation in initial phase was in accordance with the results of EcSODs in bay scallop (Bao et al., 2009) and Hong Kong oyster (Yu et al., 2011). Likewise, the same manner of the later decline of CgEcSOD was found in oyster post V. aestuarianus 01/32 stimulus. The complex mRNA expression pattern of CgEcSOD provided evidence that the role of CgEcSOD was paradoxical in the immune response to V. splendidus. The rise of CgEcSOD mRNA transcripts at the initial phase was speculated to be required for the scavenging excess ROS and protect the tissues from oxidative damage (Yu et al., 2011). While the activity of EcSOD was reported to negatively affect host survival and bacterial clearance

Fig. 6. Temporal protein expression profile of CgEcSOD relative to secondary V. splendidus challenge. The protein expressions of (A) 50 kDa CgEcSOD in plasma were measured in oysters collected 0, 6, 12, 24, 48 h following the secondary challenge with live V. splendidus by western-blot. The grayscale of (B) CgEcSOD strips were measured and qualified with quality one software. Significant differences comparison of the level of protein was performed by ANOVA (mean ± SD, n ¼ 4; the letters (a, b, c etc.) presented significant differences, p < 0.05).

The transcriptional expressions of EcSOD in mollusk after stimulation with foreign invaders were well studied previously, but

(Break et al., 2012), and it could also benefit the V. splendidus invasion through a RGD motif-dependent manner (Duperthuy et al.,

C. Liu et al. / Developmental and Comparative Immunology 63 (2016) 163e170

2011). The deduction of CgEcSOD at 48 h post stimulus was supposed to be a possible tactics for the oysters to enhance the innate immune response in V. splendidus clearance. Immune recognition is the first and crucial step in the innate immunity to discriminate self from non-self (Yang et al., 2011). In the present study, CgEcSOD could bind several PAMPs and microorganisms, indicating its role in immune recognition. In the previous reports, CgEcSOD was evidenced to bind LPS (Gonzalez et al., 2005) and bacteria V. splendidus (Duperthuy et al., 2011). Similarly, the ability of CgEcSOD to bind LPS was also revealed by PAMPs binding assay in the present study. Furthermore, CgEcSOD exhibited affinity to PGN and poly (I:C), which had not been reported previously. The PGN and poly (I:C) binding ability of CgEcSOD was similar to other reported RGD containing proteins in mammals (Clarke et al., 2002; Hoffmann et al., 2011). The broad PAMP ligands binding spectrum indicated a possible pattern recognition receptor (PRR) role of CgEcSOD in immunity of oyster. Meanwhile, CgEcSOD also displayed broader microorganisms binding spectrum, and it could bind V. splendidus, M. luteus, S. aureus, P. pastoris and Y. lipolytica at the presence of divalent metal ion (especially Cu2þ) or plasma. The requirement of Cu2þ for CgEcSOD activity was similar to other reported EcSODs (Kinnula and Crapo, 2003), indicating Cu2þ could contribute to the electron transporting around the active sites of CgEcSOD. Additionally, metal-ion dependent adhesion was also found in the direct binding interaction between CgEcSOD and multiple ligands, which indicated the Cu2þ dependent manner might be ubiquitous in the binding interaction of CgEcSOD (Valdramidou et al., 2008). Since the broad binding activity to PAMPs and microorganisms, CgEcSOD was conceivably presumed to function in bacterial sequestration as other R/KGDcontaining proteins, such as hemolin (Zhao and Kanost, 1996) and vitronectin (Henderson et al., 2011). Specific immune priming, as some forms of immune memory in protection upon secondary pathogen, was reported in various invertebrate (Little and Kraaijeveld, 2004). In oyster, a specifically enhanced cellular immune response was also reported upon the secondary challenge of live V. splendidus (Zhang et al., 2014). As a major protein in the plasma, the concentration fluctuation and the possible roles of CgEcSOD in immune priming were investigated after twice immune stimulations in the present study. A significant down-regulation of CgEcSOD was revealed after the secondary V. splendidus stimulation by both real-time PCR and western-blot, indicating that the deduction of CgEcSOD should be a strategy responding to the secondary challenge. Likewise, recent reports in ctenophore evidenced that the expression of superoxide dismutase (Cu-Zn SOD) was reduced upon homologous bacterial challenge but not for the heterologous (Bolte et al., 2013). Although EcSOD was though to protect tissues from over expressed ROS production, its inhibition on innate immune response was also reported (Edwards et al., 2001; Witter et al., 2014). In mice, EcSOD possesses a detrimental impact during L. monocytogenes infection by decreasing host survival, bacterial clearance, TNF-a and peroxynitrite productions, and neutrophil function (Break et al., 2012). CuZn-SOD was also reported as a cofactor to activate the phospholipase activity of the Pseudomonas type III toxin, ExoU (Sato et al., 2006). The activation of ExoU by CuZn-SOD provides a powerful weapon for P. aeruginosa which can damage host macrophages and promote dissemination (Sato et al., 2006). Similarly, CgEcSOD has been proved to be a target substrate for the V. splendidus virulence factor, OmpU (Duperthuy et al., 2011). It was suspected that CgEcSOD might serve as a receptor for bacteria adhesion factor, like syndecan or glypican, and set up the first step towards establishing an efficient infection (Rostand and Esko, 1997). In human epidermis, the invasion of melanoma cells was inhibited by the down-regulation of invasion-related adhesion receptors (Hsu et al., 2000). Upon

169

the secondary challenge, CgEcSOD displayed a specific downregulation compared with the primary challenge. In the same manner, the specific deduction of CgEcSOD upon the secondary V. splendidus challenge could probably inhibit the invasion of this bacteria and benefit to develop a specifically enhanced cellular immune response. The results provided a novel explanation to the specifically enhanced cellular immune responses upon the secondary challenge of V. splendidus in the previous report (Zhang et al., 2014). In conclusion, a broad PAMP binding ability of CgEcSOD was revealed in the present study, indicating it might function as a PRR in the immune recognition. Moreover, CgEcSOD could act as not only an enzyme protecting tissues from free radicals, but also a possible inhibiting factor to the innate immune response. Both the initial up-regulation and later decline in the expression of CgEcSOD were employed as a subtle strategy to protect from ROS and to inhibit the microbe invasion. The specific decline was also employed by oyster in the immune priming to reduce the invasion of V. splendidus. This result would provide new insights to understanding the in vivo interaction between V. splendidus and the oyster immune system. Acknowledgements The authors are grateful to the kindly provision of V. Anguillarum and M. luteus by Professor Zhaolan Mo, Yellow Sea Fisheries Research Institute, Chinese Academy of Fishery Science, and Y. lipolytica by Professor Zhenming Chi, the Ocean University of China. This research was supported by High Technology Project (863 Program, No. 2014AA093501) from the Chinese Ministry of Science and Technology, National Natural Science Foundation of China (No. 31530069, 31402337), earmarked fund (CARS-48) from Modern Agro-industry Technology Research System, and funds from National & Local Joint Engineering Laboratory of Ecological Mariculture and the Taishan Scholar Program of Shandong, China. References Ahl, I.M., 2010. Protein Engineering of Extracellular Superoxide Dismutase: Char€ ping University acterization of Binding to Heparin and Cellular Surfaces. Linko Electronic Press. Bao, Y., Li, L., Wu, Q., Zhang, G., 2009. Cloning, characterization, and expression analysis of extracellular copper/zinc superoxide dismutase gene from bay scallop Argopecten irradians. Fish Shellfish Immun. 27, 17e25. €rster, J., Rosenstiel, P., Reusch, T.B., 2013. Bolte, S., Roth, O., Philipp, E.E., Sapho Specific immune priming in the invasive ctenophore Mnemiopsis leidyi. Biol. Lett. U. K. 9, 20130864. Break, T.J., Jun, S., Indramohan, M., Carr, K.D., Sieve, A.N., Dory, L., Berg, R.E., 2012. Extracellular superoxide dismutase inhibits innate immune responses and clearance of an intracellular bacterial infection. J. Immunol. 188, 3342e3350. Cheng, D., Hoogenraad, C.C., Rush, J., Ramm, E., Schlager, M.A., Duong, D.M., Xu, P., Wijayawardana, S.R., Hanfelt, J., Nakagawa, T., 2006. Relative and absolute quantification of postsynaptic density proteome isolated from rat forebrain and cerebellum. Mol. Cell. ProteomicProteomic.s 5, 1158e1170. Clarke, S.R., Harris, L.G., Richards, R.G., Foster, S.J., 2002. Analysis of Ebh, a 1.1megadalton cell wall-associated fibronectin-binding protein of Staphylococcus aureus. Infect. Immun. 70, 6680e6687.  n, E., Caro, A., Rosa, R.D., Le Roux, F., Lautre douDuperthuy, M., Schmitt, P., Garzo Audouy, N., Got, P., Romestand, B., De Lorgeril, J., 2011. Use of OmpU porins for attachment and invasion of Crassostrea gigas immune cells by the oyster pathogen Vibrio splendidus. P. Natl. Acad. Sci. 108, 2993e2998. Edwards, K.M., Cynamon, M.H., Voladri, R.K., Hager, C.C., DeSTEFANO, M.S., Tham, K.T., Lakey, D.L., Bochan, M.R., Kernodle, D.S., 2001. Iron-cofactored superoxide dismutase inhibits host responses to Mycobacterium tuberculosis. Am. J. Resp. Crit. Care Med. 164, 2213e2219. Fridovich, I., 1986. Biological effects of the superoxide radical. Arch. Biochem. Biophys. 247, 1e11. Fridovich, I., 1995. Superoxide radical and superoxide dismutases. Annu. Rev. Biochem. 64, 97e112. Fujii, M., Ishii, N., Joguchi, A., Yasuda, K., Ayusawa, D., 1998. A novel superoxide dismutase gene encoding membrane-bound and extracellular isoforms by alternative splicing in Caenorhabditis elegans. DNA Res. 5, 25e30. Getzoff, E.D., Tainer, J.A., Stempien, M.M., Bell, G.I., Hallewell, R.A., 1989. Evolution of

170

C. Liu et al. / Developmental and Comparative Immunology 63 (2016) 163e170

CuZn superoxide dismutase and the Greek key b-barrel structural motif. Proteins 5, 322e336. Gonzalez, M., Romestand, B., Fievet, J., Huvet, A., Lebart, M.-C., Gueguen, Y., re, E., 2005. Evidence in oyster of a plasma extracellular superoxide disBache mutase which binds LPS. Biochem. Bioph. Res. Co. 338, 1089e1097. Green, T.J., Dixon, T.J., Devic, E., Adlard, R.D., Barnes, A.C., 2009. Differential expression of genes encoding anti-oxidant enzymes in Sydney rock oysters, Saccostrea glomerata (Gould) selected for disease resistance. Fish Shellfish Immun. 26, 799e810. Hauck, C.R., Borisova, M., Muenzner, P., 2012. Exploitation of integrin function by pathogenic microbes. Curr. Opin. Cell Biol. 24, 637e644. He, Y.-W., Li, H., Zhang, J., Hsu, C.-L., Lin, E., Zhang, N., Guo, J., Forbush, K.A., Bevan, M.J., 2004. The extracellular matrix protein mindin is a patternrecognition molecule for microbial pathogens. Nat. Immunol. 5, 88e97. Henderson, B., Nair, S., Pallas, J., Williams, M.A., 2011. Fibronectin: a multidomain host adhesin targeted by bacterial fibronectin-binding proteins. FEMS Microbiol. Rev. 35, 147e200. Hoffmann, C., Ohlsen, K., Hauck, C.R., 2011. Integrin-mediated uptake of fibronectinbinding bacteria. Eur. J. Cell Biol. 90, 891e896. Hostetter, M.K., 2000. RGD-mediated adhesion in fungal pathogens of humans, plants and insects. Curr. Opin. Microbiol. 3, 344e348. Hsu, M.-Y., Meier, F.E., Nesbit, M., Hsu, J.-Y., Van Belle, P., Elder, D.E., Herlyn, M., 2000. E-cadherin expression in melanoma cells restores keratinocyte-mediated growth control and down-regulates expression of invasion-related adhesion receptors. Am. J. Pathol. 156, 1515e1525. Itoh, N., Xue, Q.-G., Schey, K.L., Li, Y., Cooper, R.K., La Peyre, J.F., 2011. Characterization of the major plasma protein of the eastern oyster, Crassostrea virginica, and a proposed role in host defense. Comp. Biochem. Phys. B 158, 9e22. James, E.R., McLean, D., Perler, F., 1994. Molecular cloning of an Onchocerca volvulus extracellular Cu-Zn superoxide dismutase. Infect. Immun. 62, 713e716. Johansson, M.W., Holmblad, T., Thornqvist, P.-O., Cammarata, M., Parrinello, N., Soderhall, K., 1999. A cell-surface superoxide dismutase is a binding protein for peroxinectin, a cell-adhesive peroxidase in crayfish. J. Cell Sci. 112, 917e925. € derh€ Johansson, M.W., Keyser, P., Sritunyalucksana, K., So all, K., 2000. Crustacean haemocytes and haematopoiesis. Aquaculture 191, 45e52. Kinnula, V.L., Crapo, J.D., 2003. Superoxide dismutases in the lung and human lung diseases. Am. J. Resp. Crit. Care Med. 167, 1600e1619. Kline, K.A., F€ alker, S., Dahlberg, S., Normark, S., Henriques-Normark, B., 2009. Bacterial adhesins in host-microbe interactions. Cell Host Microbe 5, 580e592. Labreuche, Y., Lambert, C., Soudant, P., Boulo, V., Huvet, A., Nicolas, J.-L., 2006. Cellular and molecular hemocyte responses of the Pacific oyster, Crassostrea gigas, following bacterial infection with Vibrio aestuarianus strain 01/32. Microbes Infect. 8, 2715e2724. €derha €ll, K., 2001. Characterization of a pattern recognition protein, a Lee, S.Y., So masquerade-like protein, in the freshwater crayfish Pacifastacus leniusculus. J. Immunol. 166, 7319e7326. Little, T.J., Kraaijeveld, A.R., 2004. Ecological and evolutionary implications of immunological priming in invertebrates. Trends Ecol. Evol. 19, 58e60. Liu, R., Qiu, L., Yu, Z., Zi, J., Yue, F., Wang, L., Zhang, H., Teng, W., Liu, X., Song, L., 2013. Identification and characterisation of pathogenic Vibrio splendidus from Yesso scallop (Patinopecten yessoensis) cultured in a low temperature environment. J. Invertebr. Pathol. 114, 144e150. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2 DDCT method. Methods 25, 402e408. Marklund, S.L., 1984. Extracellular superoxide dismutase in human tissues and

human cell lines. J. Clin. Invest. 74, 1398. McCord, J.M., Edeas, M.A., 2005. SOD, oxidative stress and human pathologies: a brief history and a future vision. Biomed. Pharmacother. 59, 139e142. Morales, K., Olesen, M.N., Poulsen, E.T., Larsen, U.G., Enghild, J.J., Petersen, S.V., 2015. The effects of hypochlorous acid and neutrophil proteases on the structure and function of extracellular superoxide dismutase. Free Radic. Bio. Med. 81, 38e46. Narasimhan, S., Armstrong, M., Rhee, K., Edman, J.C., Richards, F.F., Spicer, E., 1994. Gene for an extracellular matrix receptor protein from Pneumocystis carinii. P. Natl. Acad. Sci. 91, 7440e7444. Patti, J.M., Allen, B.L., McGavin, M.J., Hook, M., 1994. MSCRAMM-mediated adherence of microorganisms to host tissues. Annu. Rev. Microbiol. 48, 585e617. Rostand, K.S., Esko, J.D., 1997. Microbial adherence to and invasion through proteoglycans. Infect. Immun. 65, 1. Sato, H., Feix, J.B., Frank, D.W., 2006. Identification of superoxide dismutase as a cofactor for the pseudomonas type III toxin, ExoU. Biochemistry 45, 10368e10375. Scotti, P.D., Dearing, S.C., Greenwood, D.R., 2007. Characterisation of cavortin, the major haemolymph protein of the Pacific oyster (Crassostrea gigas). New Zeal. J. Mar. Fresh 41, 91e101. Singh, B., Su, Y.C., Riesbeck, K., 2010. Vitronectin in bacterial pathogenesis: a host protein used in complement escape and cellular invasion. Mol. Microbiol. 78, 545e560. Takagi, J., 2004. Structural basis for ligand recognition by RGD (Arg-Gly-Asp)dependent integrins. Biochem. Soc. T 32, 403e406. Valdramidou, D., Humphries, M.J., Mould, A.P., 2008. Distinct roles of b1 metal iondependent adhesion site (MIDAS), adjacent to MIDAS (ADMIDAS), and ligandassociated metal-binding site (LIMBS) cation-binding sites in ligand recognition by integrin a2b1. J. Biol. Chem. 283, 32704e32714. Witter, A.R., Break, T.J., Indramohan, M., Berg, R.E., 2014. Extracellular superoxide dismutase enhances neutrophil recruitment to the liver by modulating the extracellular environment. Immunology 5. Yang, J., Wang, L., Zhang, H., Qiu, L., Wang, H., Song, L., 2011. C-type lectin in Chlamys farreri (CfLec-1) mediating immune recognition and opsonization. PLoS One 6, e17089. Yao, H., Arunachalam, G., Hwang, J.-W., Chung, S., Sundar, I.K., Kinnula, V.L., Crapo, J.D., Rahman, I., 2010. Extracellular superoxide dismutase protects against pulmonary emphysema by attenuating oxidative fragmentation of ECM. P. Natl. Acad. Sci. 107, 15571e15576. Yu, Y., Yu, Y., Huang, H., Feng, K., Pan, M., Yuan, S., Huang, S., Wu, T., Guo, L., Dong, M., 2007. A short-form C-type lectin from amphioxus acts as a direct microbial killing protein via interaction with peptidoglycan and glucan. J. Immunol. 179, 8425e8434. Yu, Z., He, X., Fu, D., Zhang, Y., 2011. Two superoxide dismutase (SOD) with different subcellular localizations involved in innate immunity in Crassostrea hongkongensis. Fish Shellfish Immun. 31, 533e539. Zhang, H., Kong, P., Wang, L., Zhou, Z., Yang, J., Zhang, Y., Qiu, L., Song, L., 2010. Cflec5, a pattern recognition receptor in scallop Chlamys farreri agglutinating yeast Pichia pastoris. Fish Shellfish Immun. 29, 149e156. Zhang, T., Qiu, L., Sun, Z., Wang, L., Zhou, Z., Liu, R., Yue, F., Sun, R., Song, L., 2014. The specifically enhanced cellular immune responses in Pacific oyster (Crassostrea gigas) against secondary challenge with Vibrio splendidus. Dev. Comp. Immunol. 45, 141e150. Zhao, L., Kanost, M.R., 1996. In search of a function for hemolin, a hemolymph protein from the immunoglobulin superfamily. J. Insect. Physiol. 42, 73e79.