- Email: [email protected]
The sensing pattern and antitoxic response of Crassostrea gigas against extracellular products of Vibrio splendidus
Developmental and Comparative Immunology 102 (2020) 103467
Contents lists available at ScienceDirect
Developmental and Comparative Immunology journal homepage: www.elsevier.com/locate/devcompimm
The sensing pattern and antitoxic response of Crassostrea gigas against extracellular products of Vibrio splendidus
T ⁎
Weilin Wanga,b,c, Xiaojing Lva,c, Zhaoqun Liua,c, Xiaorui Songa,c, Qilin Yia,d, Lingling Wanga,b,c,d, , Linsheng Songa,b,c,d a
Liaoning Key Laboratory of Marine Animal Immunology, Dalian Ocean University, Dalian, 116023, China Functional Laboratory of Marine Fisheries Science and Food Production Process, Qingdao National Laboratory for Marine Science and Technology, Qingdao, 266200, China c Liaoning Key Laboratory of Marine Animal Immunology and Disease Control, Dalian Ocean University, Dalian, 116023, China d Dalian Key Laboratory of Aquatic Animal Diseases Prevention and Control, Dalian Ocean University, Dalian, 116023, China b
A R T I C LE I N FO
A B S T R A C T S
Keywords: Crassostrea gigas Immune defense Vibrio splendidus Extracellular products Anti-toxic activity
Serious juvenile oyster disease induced by pathogenic Vibrio splendidus has resulted in tremendous economic loss, but the molecular mechanisms underlying this killing mechanism remain unclear. The resistance of adult oyster to V. splendidus or its virulence factors might provide a possible access to cognize the interaction between pathogen and host. In the present study, the extracellular products (ECP) from less virulent V. splendidus JZ6 were injected into adult Pacific oyster Crassostrea gigas, and the cellular and humoral immune response induced by ECP were investigated. The phagocytosis rate of hemocytes was significantly up-regulated (30.57%) at 6 h after ECP injection compared with that (21%) of control groups. And significantly high level of ROS production was also observed from 3 h to 12 h in ECP-injected oysters, concomitant with increased apoptosis rate of hemocytes (16.4% in ECP-injected group, p < 0.01) compared with control group (6.7%). By RT-PCR analysis, the expression level of antioxidant CgSOD in hemocytes significantly increased to 6.41-fold of that in control groups (p < 0.01) at 12 h post ECP injection. The expression levels of anti-toxic metalloprotease inhibitors CgTIMP629 and CgTIMP628 were also significantly up-regulated at the early (3–6 h) and late (6–24 h) stage of immune response, respectively. Moreover, after the ECP were incubated with serum proteins isolated from the ECPinjected oysters in vitro, the metalloprotease activity of ECP significantly declined by 21.39%, and less degraded serum proteins were detected by SDS-PAGE. When the primarily cultured hemocytes were stimulated with heatinactivated ECP or fragments derived from ECP-degraded serum proteins, the expressions of CgTIMP629 (13.64 and 7.03-fold of that in saline group, respectively, p < 0.01) and CgTIMP628 (5.07 and 6.08-fold of that in saline group, respectively, p < 0.01) in hemocytes were all significantly induced. All the results indicated that the adult oysters could launch phagocytosis, antioxidant and anti-toxic response to resist the virulence of ECP, possibly by sensing heterologous ECP and ECP-induced endogenous alarm signals. These results provided a possible clue for the resistance mechanism of adult oysters towards the ECP of less virulent V. splendidus, which might be valuable for exploring strategies for the control of oyster disease.
1. Introduction Oyster, one of keystone taxons in coastal and estuarine ecology, has become the dominant economic bivalve mollusks worldwide. Unfortunately, large scales of summer mortality events have been reported for decades, which have been leading to tremendous economic loss of oyster aquaculture (De Lorgeril et al., 2018; Travers et al., 2015). Complex factors might be involved in this issue, including but not limited to water temperature, pathogens and the physiological status of
⁎
oyster (Garnier et al., 2007; Samain, 2011; Schmitt et al., 2011). In the past years, extensive attentions have been paid on the separation of pathogens lethal for summer mortality, and pathogenic strains related to Vibrio genus, such as Vibrio aestuarianus or V. splendidus have been successfully isolated (Garnier et al., 2007; Gay et al., 2004; Schmitt et al., 2011). The virulence of Vibrios was thought to be derived from the secretion of extracellular products (ECP), by which these pathogens impose toxicity on host cells (Labreuche et al., 2006). Among the previous reports, one phenomenon should not be
Corresponding author. Liaoning Key Laboratory of Marine Animal Immunology, Dalian Ocean University, Dalian, 116023, China. E-mail address: [email protected] (L. Wang).
https://doi.org/10.1016/j.dci.2019.103467 Received 20 April 2019; Accepted 12 August 2019 Available online 16 August 2019 0145-305X/ © 2019 Elsevier Ltd. All rights reserved.
Developmental and Comparative Immunology 102 (2020) 103467
W. Wang, et al.
animals were returned to aerated sea water after injection and maintained under static conditions. Fifteen oysters were randomly sampled from each group at each time point of 0, 3, 6, 12, 24 and 48 h post injection, and then the hemolymph was collected aseptically from the posterior adductor muscle sinus. One aliquot of hemolymph sample was centrifuged at 600 g at 4 °C for 10 min, with the supernatant as serum for detection of anti-ECP activity and pellet as hemocytes for RNA extraction. The rest aliquot of hemolymph was added with anticoagulant agent (glucose 20.8 g/L; sodium citrate 8.0 g/L; EDTA 3.36 g/L; sodium chloride 22.5 g/L; pH 7.5), centrifuged at 600 g to collect the hemocytes for detection of cellular immune indicators. Each assay was conducted in three parallels.
neglected is that, the high mortalities were mainly occurred in larvae and juvenile stage of oysters, known as juvenile oyster disease (JOD) (Garnier et al., 2007; Lacoste et al., 2001). Most larvae or juvenile stage oysters with JOD were infected and killed by Vibrio bacteria, while Vibrio-induced mortalities have been barely observed in adult oysters. These findings indicate the complex interaction between oyster and Vibrio in nature condition. As filter feeders living in microbe-rich habitats, oysters are naturally colonized by mass and diverse microbes such as Vibrio species, and it is difficult to determine the Vibrios resident in diseased oysters are symbiotic or opportunistic in latent state (Lemire et al., 2014; Mersni-Achour et al., 2015). Moreover, unexpected diversity of V. splendidus strains with varied virulence was separated during oyster mortality episodes (Lemire et al., 2014; Saulnier et al., 2010). In our previous study, a less virulent V. splendidus JZ6 was characterized, of which ECP exhibited significant metalloprotease like activity and obvious cytotoxicity to primary hemocytes of oyster Crassostrea gigas (Liu et al., 2013, 2016). But interestingly, both V. splendidus JZ6 and its ECP were not lethal for adult oysters, leaving the detailed mechanism of resistance in adult oysters puzzling. Understanding of how the adult oysters controlling the colonized Vibrio would be very curious and valuable for unveiling the competing host-pathogen interaction. As oysters are sessile marine invertebrates that inhabit estuarine and intertidal regions, they are subjected to extraordinary abundant microbial challenges from the surrounding environment (Le Roux et al., 2016; Zhang et al., 2012). Though lacking adaptive immune system, oysters have evolved primitive circulatory hemocytes and serum components which play key roles in innate immune defense (Wang et al., 2018). The study of immune response against Vibrios or its toxic ECP would be helpful for understanding the complex host-pathogen competing in adult oysters, and be valuable for disease control in oyster industry. In the present study, the ECP from V. splendidus JZ6 were employed as immunogens to inject into adult oyster C. gigas, with the purposes to: (1) investigate the in vivo cellular immune response of oysters; (2) examine the anti-ECP effect of serum proteins from ECPinjected oysters, and (3) explore the possible sensing patterns for ECP in the innate immune system of oysters.
2.3. Phagocytosis of fluorescent beads In vitro phagocytosis assay was performed according to previous reports (Wang et al., 2016). Briefly, hemocytes pellet was suspended by M-L15 medium at a final concentration of 2 × 106 cells/mL. Then 200 μL of the hemocytes were incubated with 10 μL of 109/mL FITClabeled V. splendidus at room temperature for 60 min with continuing blending. After centrifugation at 600g at 4 °C, for 10 min, the supernatant containing free FITC-labeled V. splendidus was removed, and the pellet was washed for one time and resuspended with M-L15 medium for flow cytometric analysis (BD FACSAria™ II flow cytometry). And 10,000 intact hemocytes were detected individually and the data were recorded to calculate the average percentage of phagocytic cells. Each experiment was conducted three times, and the values (keep one decimal place in the text) from three repetitive tests were used to plot figures (N = 3). 2.4. The detection of hemocyte apoptosis The apoptosis of hemocytes was determined by the manual of Annexin V-FITC Apoptosis Detection Kit (Beyotime biotechnology, China). Briefly, the collected hemocytes (about 106 cells) were washed twice with L15 medium, resuspended by Annexin V-FITC binding buffer, and then incubated with Annexin V-FITC and propidium iodide (PI) in dark at room temperature for 10 min. After washed for two times, the pellets were resuspended by Annexin V-FITC buffer, and analyzed under flow cytometry analysis (BD FACSAria™ II). And the average rate of apoptosis-cell was calculated depending on the data recorded individually from 10,000 intact hemocytes. Each experiment was conducted three times, and the values (keep one decimal place in the text) from three repetitive tests were used to plot figures (N = 3).
2. Materials and methods 2.1. Bacteria and preparation of the ECP of Vibrio spendidus Bacteria V. splendidus JZ6 were previously isolated from the lesions of moribund scallop Patinopecten yessoensis (Liu et al., 2013), which were also detected in oyster C. gigas. The ECP of V. splendidus JZ6 were prepared by the cellophane overlay method according to previous reports (Liu et al., 2016). Briefly, 200 μL overnight cultured bacteria were transferred onto a sterile cellophane film placed on the surface of 2216E agar plate. After incubation at 16 °C for 48 h, bacterial cells were washed off the cellophane film with cold saline (0.8% sodium chloride solution). Then the supernatant containing the ECP was collected after centrifugation at 10,000 g at 4 °C for 30 min, sterilized by filtration (0.22 μm), concentrated by ultrafiltration device (Millipore, Ultra 3K), and then quantified by the method of Bradford and stored at −80 °C as ECP (1 mg/mL) of V. splendidus JZ6.
2.5. Reactive oxygen species production analysis The ROS level in hemocyte was measured by using a commercialized kit (Beyotime biotechnology, China) according to the optimized manufacturer's instructions. Briefly, the collected hemocytes (about 106 cells) were suspended by diluted DCFH-DA (10 mM) with L15 medium, and incubated at room temperature for 20 min. After washing twice with L15 medium, the hemocytes suspension was detected by flow cytometry (BD FACSAria™ II) for the relative ROS production. And the average fluorescence value of hemocytes was calculated depending on the data recorded individually from 10,000 intact hemocytes. The ROS level was determined by relative fluorescence value per cell. Each experiment was conducted three times, and the values (keep one decimal place in the text) from three repetitive tests were used to plot figures (N = 3).
2.2. Oysters stimulating and hemolymph sampling Adult Pacific oysters C. gigas, with an average 10 cm of shell length, were collected from National Oceanographic Center (Qingdao, China), maintained in filtered and aerated seawater at 15–20 °C for a week before processing. The injection into oysters was conducted as described previously (Wang et al., 2016). One hundred and eighty oysters were randomly divided into two groups. Oysters in control group and treatment group received individually an injection of 100 μL sterile saline solution or ECP of V. splendidus (0.3 mg/mL), respectively. All
2.6. RNA isolation, cDNA synthesis and gene expression analysis Total RNA was isolated from hemocytes using Trizol reagent (Invitrogen) according to its manual. The first-strand cDNA synthesis 2
Developmental and Comparative Immunology 102 (2020) 103467
W. Wang, et al.
genes including superoxide dismutase (SOD) (CgSOD: CGI_10017958), tissue inhibitor of metalloproteinase (TIMP) (CgTIMP628: CGI_10020628 and CgTIMP629: CGI_10020629) were employed for expression detection, and oyster Elongation Factor (CgEF: CGI_10012474) was chosen as an internal control. Real-time PCR amplification was carried out in an ABI 7500 Real-time Thermal Cycler according to the manual (Applied Biosystems). Dissociation curve analysis of amplification products was performed at the end of each PCR to confirm that only one PCR product was amplified and detected. After the PCR program, data were analyzed using ABI 7500 SDS software V2.0 (Applied Biosystems). To maintain consistency, the baseline was set automatically by the software. The 2−ΔΔCT method was used to analyze the expression level of detected gene (Livak and Schmittgen, 2001), and all data were given in terms of relative mRNA expression of mean ± S.E. (N = 3).
Table 1 Primers used for RT-PCR in this study. Gene name
Primer Sequence(5′-3′)
CgSOD
Forward: AGATGTGGCTTTTGCTGGGTTT Reverse: AACAGGGCTACCTTCCCGCTAC Forward: GCTGAGGCTCTCCGTCGTAAC Reverse: GGGCACAAACCCACCACC Forward: CGGGAATGGAATATCGTCCGCAT Reverse: GAACCCCTCCTTCCTTCTTTAGA Forward: AGTCACCAAGGCTGCACAGAAAG Reverse: TCCGACGTATTTCTTTGCGATGT
CgTIMP628 CgTIMP629 CgEF
was carried out based on Promega M-MLV (Promega) RT Usage information using the DNase I (Promega)-treated total RNA as template and Oligo (dT)-adaptor as primer (Table 1). The reaction mixtures were incubated at 42 °C for 1 h, and then terminated by heating at 95 °C for 5 min. The cDNA mix was diluted to 1:50 and stored at −80 °C for following processing. Gene expression level was examined by SYBR Green fluorescent quantitative real-time PCR (RT-PCR). Specific primers (Table 1) for
2.7. The protease activity quantification of ECP incubated with serum proteins of ECP-injected oysters In order to qualitatively detecting the capacity of ECP as protease,
Fig. 1. The temporal change of phagocytic rate of hemocytes after the oysters received injection with saline or ECP. The phagocytic rates of hemocytes were detected by flow cytometry. A. The total hemocyte populations gated for cytometry analysis. B. The phagocytic rate of hemocytes at 24 h after saline stimulation. C. The phagocytic rate of hemocytes at 24 h after ECP stimulation. D. The temporal changes of phagocytic rate of hemocytes after saline or ECP stimulation. Each value is shown as mean ± S.D. (N = 3). (*: p < 0.05; **: p < 0.01). 3
Developmental and Comparative Immunology 102 (2020) 103467
W. Wang, et al.
(0.1 mg/mL) (ECP inactivated group) were added into the culture well, respectively, and incubated with primary hemocytes for 6 h. Then the hemocytes were collected from the 12-well plates with three parallels for each treatment to extract mRNA, and the mRNA expression levels of CgTIMP628, CgTIMP629 and CgSOD genes were detected as former mentioned. 2.9. Statistical analysis All data were given as means ± S.E, and subjected to one-way analysis of variance (one-way ANOVA) followed by an unpaired, twotailed t-test. Differences were considered significant at p < 0.05 and extremely significant at p < 0.01. 3. Results 3.1. Phagocytic activity of hemocytes after ECP injection The phagocytic capacity of oyster hemocytes against FITC-V. splendidus was detected by flow cytometry. The phagocytic rate of hemocytes was about 21.9 ± 0.2% at 0 h. After the oyster received injection with V. splendidus ECP, the phagocytic rate was significantly increased at 6 h (30.6 ± 0.8%, p < 0.05), 12 h (31.2 ± 3.6%, p < 0.05), 24 h (38.6 ± 0.9%, p < 0.01), and then reduced to the base level (22.1 ± 1.0%) after 48 h (Fig. 1). During the experiment, the phagocytic rate of hemocytes from oysters received saline injection (control group) didn't change significantly (varied from 21.6% to 25.1%).
Fig. 2. The temporal change of ROS level in hemocytes of oysters following injection with saline or ECP. The mean fluorescent intensity (MFI) of hemocytes was detected by flow cytometry with ROS fluorescent probe. Each value is shown as mean ± S.D. (N = 3). (*: p < 0.05; **: p < 0.01).
protease activity of ECP was determined using azocasein (Sigma A2765) as a substrate and qualitatively quantified as substrate consumption according to previous reports (Binesse et al., 2008). The protease activity of ECP was detected in the far-early stage (the first 20 min) of the reaction, which was deemed to follow the zero order kinetics. Briefly, an excessive substrate of 250 μL azocasein (5 mg/mL in 50 mM Tris-HCl buffer, pH 8.0) was incubated with prepared 250 μL of ECP (0.1 mg/mL) solution at 25 °C for 20 min. Then 1750 μL of 5% (v/ w) trichloroacetic acid (TCA) was added into the reaction mixture to precipitate the undigested substrate, which was separated by centrifugation at 4 °C 3000 g for 5 min. The supernatant (100 μL) was neutralized by an equal volume of 0.5 M NaOH and measured under OD440 for absorbance. The. For detection of anti-ECP activity in serum proteins from ECP-injected oysters, the serums were collected at 24 h post saline or ECP injection. The ECP (0.1 mg/mL) were incubated with either Ethylene Diamine Tetraacetic Acid EDTA-2Na (final concentration at 10 mM) or equal volume of oyster serum (0.5 mg/mL, from saline-injected group or ECP-injected group) at 20 °C for 60 min. Then the protease activity of the mixture was determined in the same reaction system as aforementioned. During the incubation of ECP with oyster serum, 10 μL of the mixture was collected at 5, 10, 20, 40 and 60 min post incubation for SDS-PAGE, which was further silver stained by Fast Silver Stain Kit (Beyotime biotechnology, China), and the proteolytic process of oyster serum was monitored.
3.2. ROS production level of hemocytes after ECP injection The impaction of V. splendidus ECP on ROS production of oyster hemocytes was evaluated with ROS detection kit by flow cytometry. ECP injection could significantly induce the production of ROS in hemocytes. The average fluorescence per hemocytes of ECP treatment group significantly increased to 1.5 and 1.4 times of that in saline group at 3 h and 6 h post injection (p < 0.05), and then declined to 1.2 times of that in saline group at 12 h post injection (p > 0.05) (Fig. 2). In comparison, there was no significant change of the average fluorescence per hemocytes (from 1.1 × 104 to 1.3 × 104) observed during 0 h–48 h after saline injection in the control group (Fig. 2). 3.3. Apoptosis rate of hemocytes after ECP injection The apoptosis rate of oyster hemocytes after V. splendidus ECP stimulation was evaluated with apoptosis detection kit by flow cytometry. The apoptosis rate of oyster hemocytes was 5.6 ± 0.3% at 0 h after ECP injection. It was significantly increased to 14.5 ± 0.6%, 16.8 ± 0.7% at 6 h and 12 h, which was 1.7-fold (p < 0.05), and 2.6fold (p < 0.01) of that in the control group, respectively. The apoptosis rate in ECP treatment group was then slightly reduced at 24 h (1.7-fold compared to the control group, p < 0.05), and reached 9.8 ± 0.7% at 48 h (p > 0.05) (Fig. 3). During the experiment, the apoptosis rate of hemocytes in the control oysters received saline injection wasn't changed significantly (varying from 5.6% to 8.4%).
2.8. The gene expression detection of cultured primary hemocytes after stimulation To explore how ECP induce immune response in oyster, the serum proteins from blank oysters (0.5 mg/mL) were firstly incubated with ECP (0.1 mg/mL) for 2 h, and then the serum fragments (≤3 kDa) of ECP-degraded serum proteins were separated by ultrafiltration device (Millipore, Ultra 3 kDa mass cut-off) and quantified by the method of Bradford. The natural ECP were heated at 100 °C for 10 min, which were employed as heat-inactivated ECP in the following experiment. The primary hemocytes of oysters were harvested and cultured with M-L15 at 18 °C by using Leibovitz's L-15 medium (Gibco, Life Technologies) supplemented with 10% fetal bovine serum (Gibco, Life Technologies) (Liu et al., 2016). Then the 20 μL of saline (Saline group), serum fragments of ECP-degraded serum proteins (0.1 mg/mL) (Fragment group), ECP (0.1 mg/mL) (ECP group) or inactivated ECP
3.4. The expression level of CgSOD after ECP injection The immune response of antioxidant enzyme SOD was monitored at mRNA level after ECP injection. The relative expression level of CgSOD in hemocytes was induced at 6 h (1.4-fold compared to that in control group, p > 0.05), significantly up-regulated and reached the highest level at 12 h (3.8-fold compared to that in control group, p < 0.01), then gently reduced at 24 h (1.9-fold compared to that in control group, p < 0.05) (Fig. 4). While the expression level of CgSOD in the control group did not change significantly during the whole experiment. 4
Developmental and Comparative Immunology 102 (2020) 103467
W. Wang, et al.
Fig. 3. The temporal change of apoptosis rate of hemocytes of oysters following injection with saline or ECP. The apoptosis rates of hemocytes were detected by flow cytometry with Annexin V-FITC and propidium iodide (PI) staining. A. The apoptosis rate of hemocytes at 12 h after saline stimulation. B. The apoptosis rate of hemocytes at 12 h after ECP stimulation. C. The temporal changes of apoptosis rate of hemocytes after saline or ECP stimulation. Each value is shown as mean ± S.D. (N = 3). (*: p < 0.05; **: p < 0.01).
proteolytic activity was detected in ECP (OD440 = 0.4), which could be completely inhibited by the chelator EDTA (OD440 = 0.0) (Fig. 6). After ECP were incubated with control serum proteins (serum from salineinjected oysters) for 1 h, the proteolytic activity of ECP was declined by 11.4% (p < 0.05). Furthermore, a sharper decline of proteolytic activity was witnessed in ECP incubated with serum from ECP-injected oyster (Fig. 6), which was reduced by 21.4% of that in pure ECP (p < 0.01). None proteolytic activity was detected in serum proteins from blank or ECP-injected oysters. The proteolytic activity of ECP on oyster serum proteins was also visualized by SDS-PAGE and silver staining. After SDS-PAGE, two main protein bands (about 66 kDa and 35 kDa) were observed in both ECP and oyster serum. After control serum from saline-injected oysters (Fig. 7A) or serum from ECP injected-oysters (Fig. 7B) were incubated with ECP, some additional bands with lower molecular weight (other than 66 kDa and 35 kDa) were witnessed, and even more bands with lower molecular weight were observed over time during co-incubation.
3.5. The expression level of CgTIMP628 and CgTIMP629 after ECP injection The mRNA expression of anti-virulence factor CgTIMP628 and CgTIMP629 was also detected after ECP injection. The relative expression level of CgTIMP628 was significantly induced at 6 h, 12 h and 24 h (2.1, 6.4 and 8.0-fold of that in control group, respectively, p < 0.01), and then recovered to the original level (0.9-fold of that in control group, p > 0.05) at 48 h after ECP injection (Fig. 5A). The relative expression level of CgTIMP629 was significantly up-regulated at 3 h and 6 h (2.4 and 3.1-fold of that in control group, respectively, p < 0.01), and then decreased at 12 h (1.1-fold of that in control group, p > 0.05) after ECP injection (Fig. 5B). 3.6. The inhibitory effect of serum on protease activity of ECP The protease activity of ECP was tested by azocasein assay. Strong 5
Developmental and Comparative Immunology 102 (2020) 103467
W. Wang, et al.
fragments of ECP-degraded serum proteins could also significantly induce the expression of CgTIMP628 (5.1 ± 0.3, p < 0.05; 6.1 ± 1.0, p < 0.05) and CgTIMP629 (13.6 ± 1.0, p < 0.05; 7.0 ± 1.0, p < 0.05). And only a slight increase was observed on the expression of CgSOD after inactive ECP (2.3 ± 0.2, p > 0.05) and fragments of ECPdegraded serum proteins (3.7 ± 0.1, p < 0.05) stimulation. 4. Discussion The complex host-pathogen interaction is considered as one of the key areas in research of infectious disease. Microorganisms utilize varied strategies to evade host defenses, while host cells, in turn, have evolved mechanisms to suppress pathogenic processes and destroy microbial invaders (Hooper et al., 2012). In the oyster C. gigas, the pathogenic V. splendidus could induce serious disease in larvae and juvenile individuals, but adult oysters could successfully defend against infection of the same strain and avoid disease. The immune activities the hosts responding to the invaders or their virulence factors might determine the solution of host-pathogen competing. The present study attempted to investigate the cellular and humoral immune response in adult oyster C. gigas against the ECP of V. splendidus JZ6, to explore possible resistance mechanisms in oysters. Although lacking the antibody-dependent adaptive immunity, oysters could mount sophisticated cellular and humoral innate immune response against invading pathogens (Wang et al., 2018). Previous work has shown that hemocytes function as the main cellular executors of immune defense in oysters, which are responsible for activities such as non-self recognition, phagocytosis and production of reactive oxygen species (ROS) (Schmitt et al., 2011). The phagocytosis is considered as an effective strategy for invertebrates to eliminate invaders and a particularly active process in bivalve immunity. In the present study, the phagocytic rate of oyster hemocytes was significantly increased since 6 h after the injection of V. splendidus ECP (Fig. 1), indicating that ECP could intensively induce cellular immune response in oysters. As foreign proteins, ECP might act as effective antigens to trigger the immune response of oysters, and they could be recognized by the immune receptors on hemocytes. The expansive pattern recognition receptor (PRR) genes have been reported in oysters (Wang et al., 2019), and many of them, such as lectins (Jia et al., 2016), Toll like receptors (Wang et al., 2016), were validated to recognize and bind various microbes. The PRRs expressed on hemocytes might sense the invasion of
Fig. 4. The temporal mRNA expression level of CgSOD in hemocytes of oysters following injection with saline or ECP. The hemocytes were collected at 0, 3, 6, 12, 24 and 48 h after saline or ECP injection, respectively. Each value is shown as mean ± S.D. (N = 3). (*: p < 0.05; **: p < 0.01).
However, compared with control serum proteins, serum proteins from ECP injected-oysters were degraded with a slower rate by proteolytic activity of ECP (Fig. 7). 3.7. The gene expression changes in hemocytes after stimulation with inactivated ECP or fragments of ECP-degraded serum proteins To explore how ECP induce immune response in oyster, the cultured primary hemocytes were incubated with saline, ECP, inactive ECP or fragments of ECP-degraded serum proteins for 6 h, and expression of CgTIMP628, CgTIMP629 and CgSOD mRNA in hemocytes was validated. During the incubation, the cultured hemocytes in the four treatments did not change obviously in morphology (Fig. 8A). The relative expression levels of CgTIMP628, CgTIMP629 and CgSOD in cultured hemocytes were significantly induced by ECP (10.8 ± 1.2, p < 0.05; 16.5 ± 2.0, p < 0.05; 7.8 ± 0.9, p < 0.05, respectively) compared with that of saline treatment group. The inactive ECP and
Fig. 5. The mRNA expression level of CgTIMP629 and CgTIMP628 in hemocytes of oysters after saline or ECP injection. The hemocytes were collected at 0, 3, 6, 12, 24 and 48 h after saline or ECP injection, respectively. A: Relative mRNA expression level of CgTIMP629, B: Relative mRNA expression level of CgTIMP629. Each value is shown as mean ± S.D. (N = 3). (*: p < 0.05; **: p < 0.01). 6
Developmental and Comparative Immunology 102 (2020) 103467
W. Wang, et al.
high level of ROS is also rather harmful to host cells, such as inducing protein peroxidation, DNA damage and even cell apoptosis (Moustafa et al., 2004). After ECP injection, the apoptosis rate of hemocytes was significantly increased at 6 h after ECP injection, which was just 3 h later of high-level ROS production. It has been reported that ECP of V. splendidus strain LGP32 could induce high level of ROS production in hemocytes of juvenile oysters, which might be partial reasons for the strong toxic effect of ECP to juvenile oysters (Labreuche et al., 2006). However, in adult oysters, the ROS level in hemocytes declined gradually (from 12 h after ECP injection) to nearly normal level at 24 h, and the apoptosis rate was also reduced since 24 h to a normal level at 48 h. That might be the reason for less toxic effects of ECP in adult oysters. To further explore how the high level ROS was monitored, the temporal alteration of CgSOD expression in hemocytes was detected after ECP injection. The transcripts of CgSOD were significantly induced at 6–12 h after ECP injection. As vital antioxidant enzyme, the upregulated CgSOD could help to eliminate the excessive ROS and enlighten intracellular stress (Yu et al., 2011), which might result in less apoptosis of hemocytes. The sharp up-regulation of ROS level followed by the increasing expression of antioxidant SOD in hemocytes might be effective defense mechanism of adult oysters to resist the toxicity of ECP. Pathogenic bacteria have evolved several unique virulence strategies to successfully infect their hosts. For the virulence factors of pathogenic V. splendidus, it has been reported that the possible toxicity of the ECP from V. splendidus was related to the metalloprotease like activity (Saulnier et al., 2010). In our previous report, the ECP of Vibrio splendidus strain JZ6 have been separated by SDS-PAGE and all the bands were analyzed by mass spectrometry. Two main bands were identified as metalloprotease Vsm in different forms (Liu et al., 2016). The band with higher molecular weight was the inactive form zymogen of metalloprotease Vsm, while the band with lower molecular weight was the active form of metalloprotease Vsm, which exhibited significant cleavage activity and was deemed as the major extracellular virulence factor of V. splendidus. Some animals could produce anti-virulence factors, such as metalloprotease inhibitor to inhibit metalloprotease activity. For example, an inducible metalloprotease inhibitor could be detected in the hemolymph of greater wax moth Galleria mellonella after immune stimulation, which could result in reduced or delayed mortality of G. mellonella larvae (Altincicek et al., 2007; Griesch et al., 2000). There were nine metalloproteinase inhibitors screened from oyster genome (Montagnani et al., 2007; Zhang et al., 2012). Two metalloproteinase inhibitors, CgTIMP629 and CgTIMP628 were found highly expressed in hemocytes, and their expression after ECP immune stimulation was further evaluated in the present study. The mRNA expression levels of CgTIMP629 and CgTIMP628 were both significantly induced by ECP injection. In our previous study, ECP from V. splendidus JZ6 displayed metalloprotease like activity and cytotoxicity to primary hemocytes of oyster (Liu et al., 2016). The rapid induction of CgTIMP629 expression and long lasting induction of CgTIMP628 expression after ECP injection indicated that they might collaborate to inhibit the metalloprotease activity of ECP and neutralize the toxicity of ECP towards oysters. To confirm this observation, the inhibitory effect of serum to metalloprotease activity of ECP was further detected. The natural ECP displayed obvious metalloprotease activity which could be almost totally inhibited by chelant EDTA. After ECP was incubated with control serum or serum from ECP-injected oysters in vitro, the metalloprotease activity of ECP was significantly inhibited, and a stronger inhibitory effect was observed in serum from ECP-injected oysters (Fig. 6). Moreover, during incubation, the serum protein could be degraded by ECP due to their proteolysis activity, which was detected and visualized by SDS-PAGE and silver staining. These results indicated that the serum from ECP-stimulated oysters could inhibit the protease activity of ECP, while its kinetics needs further investigation for the understanding of enzymological property and functional mechanism of ECP. The serum proteins could be proteolyzed by ECP in a time
Fig. 6. The inhibitory effect of serum from ECP-stimulated oysters on protease activity of ECP. The ECP was incubated with EDTA, serum proteins from salineinjected oysters or ECP-injected oysters for 1 h, respectively, and then the protease activity of ECP was determined. (*: p < 0.05; **: p < 0.01).
Fig. 7. The inhibition effect of serum from immune-stimulated oysters against protease activity of ECP. The serum proteins from saline-injected oysters (control serum) (A) or ECP-injected oysters (B) were incubated with ECP, respectively, and degradation of serum proteins was analyzed over time by SDSPAGE and silver staining. The protease activity of ECP was reflected by the degradation rate of serum proteins, and the two protein bands of serum were gradually reduced, with a faster rate in control serum.
V. splendidus through recognizing of the ECP and activate phagocytosis processes to degrade the virulent proteins. The phagocytosis of hemocytes might play a key role in ECP resistance in adult oysters. The redox system plays important roles in immune defense and hemostasis. In the present study, a sharp up-regulation of ROS level was observed in hemocytes at 3–6 h after ECP injection (Fig. 2), even before the phagocytosis defense. The ROS production is an important and conserved bactericidal mechanism to kill invaders. But the long-lasting 7
Developmental and Comparative Immunology 102 (2020) 103467
W. Wang, et al.
Fig. 8. Relative mRNA expression level of CgTIMP629, CgTIMP628 and CgSOD in in vitro cultured hemocytes. The hemocytes were incubated with ECP (ECP group), heat-inactivated ECP (ECP inactivated group), ECP-degraded serum protein fragments (Fragment group) or saline (Saline group), respectively. The morphologies (bar = 20 μm) of hemocytes were witnessed under microscope (A) and their gene expression change was detected by RT-PCR (B). Each value is shown as mean ± S.D. (N = 3). (*: p < 0.05).
that the metalloprotease activity of ECP could results in lesion in host, in which the damaged proteins could act as alarm signals and also be recognized by host and trigger immune responses (De Lorenzo et al., 2018). For example, in G. mellonella, the small-sized (< 3 kDa) protein fragments yielded from thermolysin-degraded hemolymph proteins, could act as endogenous alarm signals and activate innate immune responses (Altincicek et al., 2007). In the present study, the extra smaller proteins were detected in ECP-incubated serum proteins by SDS-PAGE (Fig. 7), indicating that the serum proteins could be degraded by ECP. The small fragments (< 3 kDa) of ECP-degraded serum proteins were isolated and further incubated with in vitro cultured hemocytes. After incubation, the expressions of CgTIMP629 and CgTIMP628 were significantly up-regulated, but a slightly lower level than that of natural ECP group, implying that degraded fragments could induce the activation of immune response in oyster hemocytes. These results indicated that both the heterologous ECP and ECP-yielded endogenous alarm signals could be detected by host, which might activate immune responses against virulence of ECP in adult oysters. However, whether it is the same mode for ECP recognition in juvenile oysters needs further investigation. In conclusion, the phagocytosis activity of hemocytes in adult oysters could be significantly up-regulated by the ECP derived from V. splendidus JZ6. Though high levels of ROS production and apoptosis rate were induced by ECP, these effects could be enlightened by latterly up-regulated expression of CgSOD. Moreover, the enhanced expression
dependent manner, and the degradation rate of serum from immunestimulated oysters was much slower than that of control serum, indicating an inhibitory mechanism existed in serum from immune-stimulated oysters. In serum of greater wax moth G. mellonella, an inducible metalloprotease inhibitor could reduce toxic metalloproteinase activity from invading pathogens (Altincicek et al., 2007; Griesch et al., 2000). It could be inferred that, the increased CgTIMP629 and CgTIMP628 after injection of ECP might inhibit the metalloprotease activity of ECP, which could reduce the virulence of ECP towards adult oysters. The possible resistant mechanism in adult oysters might also provide clues for exploring the missing strategies towards juvenile oyster disease. The pattern for ECP inducing immune response in host is a quite important aspect for understanding the virulence-resistance in adult oysters. As heterologous antigens, the ECP from bacteria could be recognized by immune receptors of host and directly induce immune response in hosts. In the present study, the ECP and heat-inactivated ECP were incubated with in vitro cultured hemocytes to explore the possible recognition patterns. Both ECP and inactivated ECP could significantly induce the expression of CgTIMP629 and CgTIMP628 in hemocytes. These results indicated that oyster hemocytes could directly recognize heterogeneous ECP and mount effective anti-ECP immune responses, though the corresponding receptors still missing. Moreover, natural ECP showed a stronger effect on inducing the expressions of CgTIMP628 and CgSOD than inactivated ECP. It was recently reported
8
Developmental and Comparative Immunology 102 (2020) 103467
W. Wang, et al.
of anti-toxic genes CgTIMP629 and CgTIMP628 might inhibit the metalloprotease activity of ECP to reduce their damages towards hosts. Both the inactivated-ECP (heterologous antigens) and ECP-degraded serum protein fragments (endogenous alarm signals) could activate immune responses in adult oysters. All the results provided a possible clue for the mechanism of adult-resistance towards the ECP of less virulent V. splendidus, which might be valuable for understanding the development of juvenile oyster disease.
gigas. Fish Shellfish Immunol. 59, 220–232. Labreuche, Y., Soudant, P., Goncalves, M., Lambert, C., Nicolas, J.L., 2006. Effects of extracellular products from the pathogenic Vibrio aestuarianus strain 01/32 on lethality and cellular immune responses of the oyster Crassostrea gigas. Dev. Comp. Immunol. 30 (4), 367–379. Lacoste, A., Jalabert, F., Malham, S., Cueff, A., Gelebart, F., Cordevant, C., et al., 2001. A Vibrio splendidus strain is associated with summer mortality of juvenile oysters Crassostrea gigas in the Bay of Morlaix (North Brittany, France). Dis. Aquat. Org. 46 (2), 139–145. Le Roux, F., Wegner, K.M., Polz, M.F., 2016. Oysters and Vibrios as a model for disease dynamics in wild animals. Trends Microbiol. 24 (7), 568–580. Lemire, A., Goudenege, D., Versigny, T., Petton, B., Calteau, A., Labreuche, Y., Le Roux, F., 2014. Populations, not clones, are the unit of vibrio pathogenesis in naturally infected oysters. ISME 9 (7), 1523–1531. Liu, R., Chen, H., Zhang, R., Zhou, Z., Hou, Z., Gao, D., Zhang, H., Wang, L., Song, L., 2016. Comparative transcriptome analysis of Vibrio splendidus JZ6 reveals the mechanism of its pathogenicity at low temperatures. Appl. Environ. Microbiol. 82 (7), 2050–2061. Liu, R., Qiu, L., Yu, Z., Zi, J., Yue, F., Wang, L., et al., 2013. Identification and characterisation of pathogenic Vibrio splendidus from Yesso scallop (Patinopecten yessoensis) cultured in a low temperature environment. J. Invertebr. Pathol. 114 (2), 144–150. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2−ΔΔCT method. Methods 25 (4), 402–408. Mersni-Achour, R., Cheikh, Y.B., Pichereau, V., Doghri, I., Etien, C., Dégremont, L., et al., 2015. Factors other than metalloprotease are required for full virulence of French Vibrio tubiashii isolates in oyster larvae. Microbiology 161 (5), 997–1007. Montagnani, C., Avarre, J.D., De Lorgeril, J., Quiquand, M., Boulo, V., Escoubas, J.M., 2007. First evidence of the activation of Cg-timp, an immune response component of Pacific oysters, through a damage-associated molecular pattern pathway. Dev. Comp. Immunol. 31 (1), 1–11. Moustafa, M.H., Sharma, R.K., Thornton, J., Mascha, E., Abdel-Hafez, M.A., Thomas, A.J., Agarwal, A., 2004. Relationship between ROS production, apoptosis and DNA denaturation in spermatozoa from patients examined for infertility. Hum. Reprod. 19 (1), 129–138. Samain, J.-F., 2011. Review and perspectives of physiological mechanisms underlying genetically-based resistance of the Pacific oyster Crassostrea gigas to summer mortality. Aquat. Living Resour. 24 (3), 227–236. Saulnier, D., De Decker, S., Haffner, P., Cobret, L., Robert, M., Garcia, C., 2010. A largescale epidemiological study to identify bacteria pathogenic to Pacific oyster Crassostrea gigas and correlation between virulence and metalloprotease-like activity. Microb. Ecol. 59 (4), 787–798. Schmitt, P., Duperthuy, M., Montagnani, C., Bachère, E., Destoumieux-Garzón, D., 2011. Immune Responses in the Pacific Oyster Crassostrea gigas an Overview with Focus on Summer Mortalities. Oysters Physiology, Ecological Distribution and Mortality. Travers, M.A., Miller, K.B., Roque, A., Friedman, C.S., 2015. Bacterial diseases in marine bivalves. J. Invertebr. Pathol. 131, 11–31. Wang, L., Song, X., Song, L., 2018. The oyster immunity. Dev. Comp. Immunol. 80, 99–118. Wang, L., Zhang, H., Wang, M., Zhou, Z., Wang, W., Liu, R., et al., 2019. The transcriptomic expression of pattern recognition receptors: insight into molecular recognition of various invading pathogens in Oyster Crassostrea gigas. Dev. Comp. Immunol. 91, 1–7. Wang, W., Zhang, T., Wang, L., Xu, J., Li, M., Zhang, A., et al., 2016. A new non-phagocytic TLR6 with broad recognition ligands from Pacific oyster Crassostrea gigas. Dev. Comp. Immunol. 65, 182–190. Yu, Z., He, X., Fu, D., Zhang, Y., 2011. Two superoxide dismutase (SOD) with different subcellular localizations involved in innate immunity in Crassostrea hongkongensis. Fish Shellfish Immunol. 31 (4), 533–539 (S). Zhang, G., Fang, X., Guo, X., Li, L., Luo, R., Xu, F., et al., 2012. The oyster genome reveals stress adaptation and complexity of shell formation. Nature 490 (7418), 49.
Acknowledgements We are grateful to all the laboratory members for their technical advice and helpful discussions. This research was supported by National Science Foundation of China (Nos. U1706204, 31802330), National Key R&D Project (2018YFD0900502), AoShan Talents Cultivation Program Supported by Qingdao National Laboratory for Marine Science and Technology (No. 2017ASTCP-OS13), earmarked fund (CARS-49) from Modern Agro-industry Technology Research System, the Fund for Outstanding Talents and Innovative Team of Agricultural Scientific Research, the Distinguished Professor of Liaoning (to L. S.), Key R&D Program of Liaoning Province (2017203001 to L. W.), and Natural Science Foundation of Liaoning, China (20170520056), Dalian High Level Talent Innovation Support Program (2015R020), and Talented Scholars in Dalian Ocean University. References Altincicek, B., Linder, M., Linder, D., Preissner, K.T., Vilcinskas, A., 2007. Microbial metalloproteinases mediate sensing of invading pathogens and activate innate immune responses in the lepidopteran model host Galleria mellonella. Infect. Immun. 75 (1), 175–183. Binesse, J., Delsert, C., Saulnier, D., Champomier-Verges, M.C., Zagorec, M., MunierLehmann, et al., 2008. Metalloprotease vsm is the major determinant of toxicity for extracellular products of Vibrio splendidus. Appl. Environ. Microbiol. 74 (23), 7108–7117. De Lorgeril, J., Lucasson, A., Petton, B., Toulza, E., Montagnani, C., Clerissi, C., et al., 2018. Immune-suppression by OsHV-1 viral infection causes fatal bacteraemia in Pacific oysters. Nat. Commun. 9 (1), 4215. De Lorenzo, G., Ferrari, S., Cervone, F., Okun, E., 2018. Extracellular DAMPs in plants and mammals: immunity, tissue damage and repair. Trends Immunol. 39 (11), 937–950. Garnier, M., Labreuche, Y., Garcia, C., Robert, M., Nicolas, J.L., 2007. Evidence for the involvement of pathogenic bacteria in summer mortalities of the Pacific oyster Crassostrea gigas. Microb. Ecol. 53 (2), 187–196. Gay, M., Renault, T., Pons, A.-M., Le Roux, F., 2004. Two Vibrio splendidus related strains collaborate to kill Crassostrea gigas: taxonomy and host alterations. Dis. Aquat. Org. 62, 65–74. Griesch, J., Wedde, M., Vilcinskas, A., 2000. Recognition and regulation of metalloproteinase activity in the haemolymph of Galleria mellonella: a new pathway mediating induction of humoral immune responses. Insect Biochem. Mol. 30 (6), 461–472. Hooper, L.V., Littman, D.R., Macpherson, A.J., 2012. Interactions between the microbiota and the immune system. Science 336, 1268–1273. Jia, Z., Zhang, H., Jiang, S., Wang, M., Wang, L., Song, L., 2016. Comparative study of two single CRD C-type lectins, CgCLec-4 and CgCLec-5, from pacific oyster Crassostrea
9
Contents lists available at ScienceDirect
Developmental and Comparative Immunology journal homepage: www.elsevier.com/locate/devcompimm
The sensing pattern and antitoxic response of Crassostrea gigas against extracellular products of Vibrio splendidus
T ⁎
Weilin Wanga,b,c, Xiaojing Lva,c, Zhaoqun Liua,c, Xiaorui Songa,c, Qilin Yia,d, Lingling Wanga,b,c,d, , Linsheng Songa,b,c,d a
Liaoning Key Laboratory of Marine Animal Immunology, Dalian Ocean University, Dalian, 116023, China Functional Laboratory of Marine Fisheries Science and Food Production Process, Qingdao National Laboratory for Marine Science and Technology, Qingdao, 266200, China c Liaoning Key Laboratory of Marine Animal Immunology and Disease Control, Dalian Ocean University, Dalian, 116023, China d Dalian Key Laboratory of Aquatic Animal Diseases Prevention and Control, Dalian Ocean University, Dalian, 116023, China b
A R T I C LE I N FO
A B S T R A C T S
Keywords: Crassostrea gigas Immune defense Vibrio splendidus Extracellular products Anti-toxic activity
Serious juvenile oyster disease induced by pathogenic Vibrio splendidus has resulted in tremendous economic loss, but the molecular mechanisms underlying this killing mechanism remain unclear. The resistance of adult oyster to V. splendidus or its virulence factors might provide a possible access to cognize the interaction between pathogen and host. In the present study, the extracellular products (ECP) from less virulent V. splendidus JZ6 were injected into adult Pacific oyster Crassostrea gigas, and the cellular and humoral immune response induced by ECP were investigated. The phagocytosis rate of hemocytes was significantly up-regulated (30.57%) at 6 h after ECP injection compared with that (21%) of control groups. And significantly high level of ROS production was also observed from 3 h to 12 h in ECP-injected oysters, concomitant with increased apoptosis rate of hemocytes (16.4% in ECP-injected group, p < 0.01) compared with control group (6.7%). By RT-PCR analysis, the expression level of antioxidant CgSOD in hemocytes significantly increased to 6.41-fold of that in control groups (p < 0.01) at 12 h post ECP injection. The expression levels of anti-toxic metalloprotease inhibitors CgTIMP629 and CgTIMP628 were also significantly up-regulated at the early (3–6 h) and late (6–24 h) stage of immune response, respectively. Moreover, after the ECP were incubated with serum proteins isolated from the ECPinjected oysters in vitro, the metalloprotease activity of ECP significantly declined by 21.39%, and less degraded serum proteins were detected by SDS-PAGE. When the primarily cultured hemocytes were stimulated with heatinactivated ECP or fragments derived from ECP-degraded serum proteins, the expressions of CgTIMP629 (13.64 and 7.03-fold of that in saline group, respectively, p < 0.01) and CgTIMP628 (5.07 and 6.08-fold of that in saline group, respectively, p < 0.01) in hemocytes were all significantly induced. All the results indicated that the adult oysters could launch phagocytosis, antioxidant and anti-toxic response to resist the virulence of ECP, possibly by sensing heterologous ECP and ECP-induced endogenous alarm signals. These results provided a possible clue for the resistance mechanism of adult oysters towards the ECP of less virulent V. splendidus, which might be valuable for exploring strategies for the control of oyster disease.
1. Introduction Oyster, one of keystone taxons in coastal and estuarine ecology, has become the dominant economic bivalve mollusks worldwide. Unfortunately, large scales of summer mortality events have been reported for decades, which have been leading to tremendous economic loss of oyster aquaculture (De Lorgeril et al., 2018; Travers et al., 2015). Complex factors might be involved in this issue, including but not limited to water temperature, pathogens and the physiological status of
⁎
oyster (Garnier et al., 2007; Samain, 2011; Schmitt et al., 2011). In the past years, extensive attentions have been paid on the separation of pathogens lethal for summer mortality, and pathogenic strains related to Vibrio genus, such as Vibrio aestuarianus or V. splendidus have been successfully isolated (Garnier et al., 2007; Gay et al., 2004; Schmitt et al., 2011). The virulence of Vibrios was thought to be derived from the secretion of extracellular products (ECP), by which these pathogens impose toxicity on host cells (Labreuche et al., 2006). Among the previous reports, one phenomenon should not be
Corresponding author. Liaoning Key Laboratory of Marine Animal Immunology, Dalian Ocean University, Dalian, 116023, China. E-mail address: [email protected] (L. Wang).
https://doi.org/10.1016/j.dci.2019.103467 Received 20 April 2019; Accepted 12 August 2019 Available online 16 August 2019 0145-305X/ © 2019 Elsevier Ltd. All rights reserved.
Developmental and Comparative Immunology 102 (2020) 103467
W. Wang, et al.
animals were returned to aerated sea water after injection and maintained under static conditions. Fifteen oysters were randomly sampled from each group at each time point of 0, 3, 6, 12, 24 and 48 h post injection, and then the hemolymph was collected aseptically from the posterior adductor muscle sinus. One aliquot of hemolymph sample was centrifuged at 600 g at 4 °C for 10 min, with the supernatant as serum for detection of anti-ECP activity and pellet as hemocytes for RNA extraction. The rest aliquot of hemolymph was added with anticoagulant agent (glucose 20.8 g/L; sodium citrate 8.0 g/L; EDTA 3.36 g/L; sodium chloride 22.5 g/L; pH 7.5), centrifuged at 600 g to collect the hemocytes for detection of cellular immune indicators. Each assay was conducted in three parallels.
neglected is that, the high mortalities were mainly occurred in larvae and juvenile stage of oysters, known as juvenile oyster disease (JOD) (Garnier et al., 2007; Lacoste et al., 2001). Most larvae or juvenile stage oysters with JOD were infected and killed by Vibrio bacteria, while Vibrio-induced mortalities have been barely observed in adult oysters. These findings indicate the complex interaction between oyster and Vibrio in nature condition. As filter feeders living in microbe-rich habitats, oysters are naturally colonized by mass and diverse microbes such as Vibrio species, and it is difficult to determine the Vibrios resident in diseased oysters are symbiotic or opportunistic in latent state (Lemire et al., 2014; Mersni-Achour et al., 2015). Moreover, unexpected diversity of V. splendidus strains with varied virulence was separated during oyster mortality episodes (Lemire et al., 2014; Saulnier et al., 2010). In our previous study, a less virulent V. splendidus JZ6 was characterized, of which ECP exhibited significant metalloprotease like activity and obvious cytotoxicity to primary hemocytes of oyster Crassostrea gigas (Liu et al., 2013, 2016). But interestingly, both V. splendidus JZ6 and its ECP were not lethal for adult oysters, leaving the detailed mechanism of resistance in adult oysters puzzling. Understanding of how the adult oysters controlling the colonized Vibrio would be very curious and valuable for unveiling the competing host-pathogen interaction. As oysters are sessile marine invertebrates that inhabit estuarine and intertidal regions, they are subjected to extraordinary abundant microbial challenges from the surrounding environment (Le Roux et al., 2016; Zhang et al., 2012). Though lacking adaptive immune system, oysters have evolved primitive circulatory hemocytes and serum components which play key roles in innate immune defense (Wang et al., 2018). The study of immune response against Vibrios or its toxic ECP would be helpful for understanding the complex host-pathogen competing in adult oysters, and be valuable for disease control in oyster industry. In the present study, the ECP from V. splendidus JZ6 were employed as immunogens to inject into adult oyster C. gigas, with the purposes to: (1) investigate the in vivo cellular immune response of oysters; (2) examine the anti-ECP effect of serum proteins from ECPinjected oysters, and (3) explore the possible sensing patterns for ECP in the innate immune system of oysters.
2.3. Phagocytosis of fluorescent beads In vitro phagocytosis assay was performed according to previous reports (Wang et al., 2016). Briefly, hemocytes pellet was suspended by M-L15 medium at a final concentration of 2 × 106 cells/mL. Then 200 μL of the hemocytes were incubated with 10 μL of 109/mL FITClabeled V. splendidus at room temperature for 60 min with continuing blending. After centrifugation at 600g at 4 °C, for 10 min, the supernatant containing free FITC-labeled V. splendidus was removed, and the pellet was washed for one time and resuspended with M-L15 medium for flow cytometric analysis (BD FACSAria™ II flow cytometry). And 10,000 intact hemocytes were detected individually and the data were recorded to calculate the average percentage of phagocytic cells. Each experiment was conducted three times, and the values (keep one decimal place in the text) from three repetitive tests were used to plot figures (N = 3). 2.4. The detection of hemocyte apoptosis The apoptosis of hemocytes was determined by the manual of Annexin V-FITC Apoptosis Detection Kit (Beyotime biotechnology, China). Briefly, the collected hemocytes (about 106 cells) were washed twice with L15 medium, resuspended by Annexin V-FITC binding buffer, and then incubated with Annexin V-FITC and propidium iodide (PI) in dark at room temperature for 10 min. After washed for two times, the pellets were resuspended by Annexin V-FITC buffer, and analyzed under flow cytometry analysis (BD FACSAria™ II). And the average rate of apoptosis-cell was calculated depending on the data recorded individually from 10,000 intact hemocytes. Each experiment was conducted three times, and the values (keep one decimal place in the text) from three repetitive tests were used to plot figures (N = 3).
2. Materials and methods 2.1. Bacteria and preparation of the ECP of Vibrio spendidus Bacteria V. splendidus JZ6 were previously isolated from the lesions of moribund scallop Patinopecten yessoensis (Liu et al., 2013), which were also detected in oyster C. gigas. The ECP of V. splendidus JZ6 were prepared by the cellophane overlay method according to previous reports (Liu et al., 2016). Briefly, 200 μL overnight cultured bacteria were transferred onto a sterile cellophane film placed on the surface of 2216E agar plate. After incubation at 16 °C for 48 h, bacterial cells were washed off the cellophane film with cold saline (0.8% sodium chloride solution). Then the supernatant containing the ECP was collected after centrifugation at 10,000 g at 4 °C for 30 min, sterilized by filtration (0.22 μm), concentrated by ultrafiltration device (Millipore, Ultra 3K), and then quantified by the method of Bradford and stored at −80 °C as ECP (1 mg/mL) of V. splendidus JZ6.
2.5. Reactive oxygen species production analysis The ROS level in hemocyte was measured by using a commercialized kit (Beyotime biotechnology, China) according to the optimized manufacturer's instructions. Briefly, the collected hemocytes (about 106 cells) were suspended by diluted DCFH-DA (10 mM) with L15 medium, and incubated at room temperature for 20 min. After washing twice with L15 medium, the hemocytes suspension was detected by flow cytometry (BD FACSAria™ II) for the relative ROS production. And the average fluorescence value of hemocytes was calculated depending on the data recorded individually from 10,000 intact hemocytes. The ROS level was determined by relative fluorescence value per cell. Each experiment was conducted three times, and the values (keep one decimal place in the text) from three repetitive tests were used to plot figures (N = 3).
2.2. Oysters stimulating and hemolymph sampling Adult Pacific oysters C. gigas, with an average 10 cm of shell length, were collected from National Oceanographic Center (Qingdao, China), maintained in filtered and aerated seawater at 15–20 °C for a week before processing. The injection into oysters was conducted as described previously (Wang et al., 2016). One hundred and eighty oysters were randomly divided into two groups. Oysters in control group and treatment group received individually an injection of 100 μL sterile saline solution or ECP of V. splendidus (0.3 mg/mL), respectively. All
2.6. RNA isolation, cDNA synthesis and gene expression analysis Total RNA was isolated from hemocytes using Trizol reagent (Invitrogen) according to its manual. The first-strand cDNA synthesis 2
Developmental and Comparative Immunology 102 (2020) 103467
W. Wang, et al.
genes including superoxide dismutase (SOD) (CgSOD: CGI_10017958), tissue inhibitor of metalloproteinase (TIMP) (CgTIMP628: CGI_10020628 and CgTIMP629: CGI_10020629) were employed for expression detection, and oyster Elongation Factor (CgEF: CGI_10012474) was chosen as an internal control. Real-time PCR amplification was carried out in an ABI 7500 Real-time Thermal Cycler according to the manual (Applied Biosystems). Dissociation curve analysis of amplification products was performed at the end of each PCR to confirm that only one PCR product was amplified and detected. After the PCR program, data were analyzed using ABI 7500 SDS software V2.0 (Applied Biosystems). To maintain consistency, the baseline was set automatically by the software. The 2−ΔΔCT method was used to analyze the expression level of detected gene (Livak and Schmittgen, 2001), and all data were given in terms of relative mRNA expression of mean ± S.E. (N = 3).
Table 1 Primers used for RT-PCR in this study. Gene name
Primer Sequence(5′-3′)
CgSOD
Forward: AGATGTGGCTTTTGCTGGGTTT Reverse: AACAGGGCTACCTTCCCGCTAC Forward: GCTGAGGCTCTCCGTCGTAAC Reverse: GGGCACAAACCCACCACC Forward: CGGGAATGGAATATCGTCCGCAT Reverse: GAACCCCTCCTTCCTTCTTTAGA Forward: AGTCACCAAGGCTGCACAGAAAG Reverse: TCCGACGTATTTCTTTGCGATGT
CgTIMP628 CgTIMP629 CgEF
was carried out based on Promega M-MLV (Promega) RT Usage information using the DNase I (Promega)-treated total RNA as template and Oligo (dT)-adaptor as primer (Table 1). The reaction mixtures were incubated at 42 °C for 1 h, and then terminated by heating at 95 °C for 5 min. The cDNA mix was diluted to 1:50 and stored at −80 °C for following processing. Gene expression level was examined by SYBR Green fluorescent quantitative real-time PCR (RT-PCR). Specific primers (Table 1) for
2.7. The protease activity quantification of ECP incubated with serum proteins of ECP-injected oysters In order to qualitatively detecting the capacity of ECP as protease,
Fig. 1. The temporal change of phagocytic rate of hemocytes after the oysters received injection with saline or ECP. The phagocytic rates of hemocytes were detected by flow cytometry. A. The total hemocyte populations gated for cytometry analysis. B. The phagocytic rate of hemocytes at 24 h after saline stimulation. C. The phagocytic rate of hemocytes at 24 h after ECP stimulation. D. The temporal changes of phagocytic rate of hemocytes after saline or ECP stimulation. Each value is shown as mean ± S.D. (N = 3). (*: p < 0.05; **: p < 0.01). 3
Developmental and Comparative Immunology 102 (2020) 103467
W. Wang, et al.
(0.1 mg/mL) (ECP inactivated group) were added into the culture well, respectively, and incubated with primary hemocytes for 6 h. Then the hemocytes were collected from the 12-well plates with three parallels for each treatment to extract mRNA, and the mRNA expression levels of CgTIMP628, CgTIMP629 and CgSOD genes were detected as former mentioned. 2.9. Statistical analysis All data were given as means ± S.E, and subjected to one-way analysis of variance (one-way ANOVA) followed by an unpaired, twotailed t-test. Differences were considered significant at p < 0.05 and extremely significant at p < 0.01. 3. Results 3.1. Phagocytic activity of hemocytes after ECP injection The phagocytic capacity of oyster hemocytes against FITC-V. splendidus was detected by flow cytometry. The phagocytic rate of hemocytes was about 21.9 ± 0.2% at 0 h. After the oyster received injection with V. splendidus ECP, the phagocytic rate was significantly increased at 6 h (30.6 ± 0.8%, p < 0.05), 12 h (31.2 ± 3.6%, p < 0.05), 24 h (38.6 ± 0.9%, p < 0.01), and then reduced to the base level (22.1 ± 1.0%) after 48 h (Fig. 1). During the experiment, the phagocytic rate of hemocytes from oysters received saline injection (control group) didn't change significantly (varied from 21.6% to 25.1%).
Fig. 2. The temporal change of ROS level in hemocytes of oysters following injection with saline or ECP. The mean fluorescent intensity (MFI) of hemocytes was detected by flow cytometry with ROS fluorescent probe. Each value is shown as mean ± S.D. (N = 3). (*: p < 0.05; **: p < 0.01).
protease activity of ECP was determined using azocasein (Sigma A2765) as a substrate and qualitatively quantified as substrate consumption according to previous reports (Binesse et al., 2008). The protease activity of ECP was detected in the far-early stage (the first 20 min) of the reaction, which was deemed to follow the zero order kinetics. Briefly, an excessive substrate of 250 μL azocasein (5 mg/mL in 50 mM Tris-HCl buffer, pH 8.0) was incubated with prepared 250 μL of ECP (0.1 mg/mL) solution at 25 °C for 20 min. Then 1750 μL of 5% (v/ w) trichloroacetic acid (TCA) was added into the reaction mixture to precipitate the undigested substrate, which was separated by centrifugation at 4 °C 3000 g for 5 min. The supernatant (100 μL) was neutralized by an equal volume of 0.5 M NaOH and measured under OD440 for absorbance. The. For detection of anti-ECP activity in serum proteins from ECP-injected oysters, the serums were collected at 24 h post saline or ECP injection. The ECP (0.1 mg/mL) were incubated with either Ethylene Diamine Tetraacetic Acid EDTA-2Na (final concentration at 10 mM) or equal volume of oyster serum (0.5 mg/mL, from saline-injected group or ECP-injected group) at 20 °C for 60 min. Then the protease activity of the mixture was determined in the same reaction system as aforementioned. During the incubation of ECP with oyster serum, 10 μL of the mixture was collected at 5, 10, 20, 40 and 60 min post incubation for SDS-PAGE, which was further silver stained by Fast Silver Stain Kit (Beyotime biotechnology, China), and the proteolytic process of oyster serum was monitored.
3.2. ROS production level of hemocytes after ECP injection The impaction of V. splendidus ECP on ROS production of oyster hemocytes was evaluated with ROS detection kit by flow cytometry. ECP injection could significantly induce the production of ROS in hemocytes. The average fluorescence per hemocytes of ECP treatment group significantly increased to 1.5 and 1.4 times of that in saline group at 3 h and 6 h post injection (p < 0.05), and then declined to 1.2 times of that in saline group at 12 h post injection (p > 0.05) (Fig. 2). In comparison, there was no significant change of the average fluorescence per hemocytes (from 1.1 × 104 to 1.3 × 104) observed during 0 h–48 h after saline injection in the control group (Fig. 2). 3.3. Apoptosis rate of hemocytes after ECP injection The apoptosis rate of oyster hemocytes after V. splendidus ECP stimulation was evaluated with apoptosis detection kit by flow cytometry. The apoptosis rate of oyster hemocytes was 5.6 ± 0.3% at 0 h after ECP injection. It was significantly increased to 14.5 ± 0.6%, 16.8 ± 0.7% at 6 h and 12 h, which was 1.7-fold (p < 0.05), and 2.6fold (p < 0.01) of that in the control group, respectively. The apoptosis rate in ECP treatment group was then slightly reduced at 24 h (1.7-fold compared to the control group, p < 0.05), and reached 9.8 ± 0.7% at 48 h (p > 0.05) (Fig. 3). During the experiment, the apoptosis rate of hemocytes in the control oysters received saline injection wasn't changed significantly (varying from 5.6% to 8.4%).
2.8. The gene expression detection of cultured primary hemocytes after stimulation To explore how ECP induce immune response in oyster, the serum proteins from blank oysters (0.5 mg/mL) were firstly incubated with ECP (0.1 mg/mL) for 2 h, and then the serum fragments (≤3 kDa) of ECP-degraded serum proteins were separated by ultrafiltration device (Millipore, Ultra 3 kDa mass cut-off) and quantified by the method of Bradford. The natural ECP were heated at 100 °C for 10 min, which were employed as heat-inactivated ECP in the following experiment. The primary hemocytes of oysters were harvested and cultured with M-L15 at 18 °C by using Leibovitz's L-15 medium (Gibco, Life Technologies) supplemented with 10% fetal bovine serum (Gibco, Life Technologies) (Liu et al., 2016). Then the 20 μL of saline (Saline group), serum fragments of ECP-degraded serum proteins (0.1 mg/mL) (Fragment group), ECP (0.1 mg/mL) (ECP group) or inactivated ECP
3.4. The expression level of CgSOD after ECP injection The immune response of antioxidant enzyme SOD was monitored at mRNA level after ECP injection. The relative expression level of CgSOD in hemocytes was induced at 6 h (1.4-fold compared to that in control group, p > 0.05), significantly up-regulated and reached the highest level at 12 h (3.8-fold compared to that in control group, p < 0.01), then gently reduced at 24 h (1.9-fold compared to that in control group, p < 0.05) (Fig. 4). While the expression level of CgSOD in the control group did not change significantly during the whole experiment. 4
Developmental and Comparative Immunology 102 (2020) 103467
W. Wang, et al.
Fig. 3. The temporal change of apoptosis rate of hemocytes of oysters following injection with saline or ECP. The apoptosis rates of hemocytes were detected by flow cytometry with Annexin V-FITC and propidium iodide (PI) staining. A. The apoptosis rate of hemocytes at 12 h after saline stimulation. B. The apoptosis rate of hemocytes at 12 h after ECP stimulation. C. The temporal changes of apoptosis rate of hemocytes after saline or ECP stimulation. Each value is shown as mean ± S.D. (N = 3). (*: p < 0.05; **: p < 0.01).
proteolytic activity was detected in ECP (OD440 = 0.4), which could be completely inhibited by the chelator EDTA (OD440 = 0.0) (Fig. 6). After ECP were incubated with control serum proteins (serum from salineinjected oysters) for 1 h, the proteolytic activity of ECP was declined by 11.4% (p < 0.05). Furthermore, a sharper decline of proteolytic activity was witnessed in ECP incubated with serum from ECP-injected oyster (Fig. 6), which was reduced by 21.4% of that in pure ECP (p < 0.01). None proteolytic activity was detected in serum proteins from blank or ECP-injected oysters. The proteolytic activity of ECP on oyster serum proteins was also visualized by SDS-PAGE and silver staining. After SDS-PAGE, two main protein bands (about 66 kDa and 35 kDa) were observed in both ECP and oyster serum. After control serum from saline-injected oysters (Fig. 7A) or serum from ECP injected-oysters (Fig. 7B) were incubated with ECP, some additional bands with lower molecular weight (other than 66 kDa and 35 kDa) were witnessed, and even more bands with lower molecular weight were observed over time during co-incubation.
3.5. The expression level of CgTIMP628 and CgTIMP629 after ECP injection The mRNA expression of anti-virulence factor CgTIMP628 and CgTIMP629 was also detected after ECP injection. The relative expression level of CgTIMP628 was significantly induced at 6 h, 12 h and 24 h (2.1, 6.4 and 8.0-fold of that in control group, respectively, p < 0.01), and then recovered to the original level (0.9-fold of that in control group, p > 0.05) at 48 h after ECP injection (Fig. 5A). The relative expression level of CgTIMP629 was significantly up-regulated at 3 h and 6 h (2.4 and 3.1-fold of that in control group, respectively, p < 0.01), and then decreased at 12 h (1.1-fold of that in control group, p > 0.05) after ECP injection (Fig. 5B). 3.6. The inhibitory effect of serum on protease activity of ECP The protease activity of ECP was tested by azocasein assay. Strong 5
Developmental and Comparative Immunology 102 (2020) 103467
W. Wang, et al.
fragments of ECP-degraded serum proteins could also significantly induce the expression of CgTIMP628 (5.1 ± 0.3, p < 0.05; 6.1 ± 1.0, p < 0.05) and CgTIMP629 (13.6 ± 1.0, p < 0.05; 7.0 ± 1.0, p < 0.05). And only a slight increase was observed on the expression of CgSOD after inactive ECP (2.3 ± 0.2, p > 0.05) and fragments of ECPdegraded serum proteins (3.7 ± 0.1, p < 0.05) stimulation. 4. Discussion The complex host-pathogen interaction is considered as one of the key areas in research of infectious disease. Microorganisms utilize varied strategies to evade host defenses, while host cells, in turn, have evolved mechanisms to suppress pathogenic processes and destroy microbial invaders (Hooper et al., 2012). In the oyster C. gigas, the pathogenic V. splendidus could induce serious disease in larvae and juvenile individuals, but adult oysters could successfully defend against infection of the same strain and avoid disease. The immune activities the hosts responding to the invaders or their virulence factors might determine the solution of host-pathogen competing. The present study attempted to investigate the cellular and humoral immune response in adult oyster C. gigas against the ECP of V. splendidus JZ6, to explore possible resistance mechanisms in oysters. Although lacking the antibody-dependent adaptive immunity, oysters could mount sophisticated cellular and humoral innate immune response against invading pathogens (Wang et al., 2018). Previous work has shown that hemocytes function as the main cellular executors of immune defense in oysters, which are responsible for activities such as non-self recognition, phagocytosis and production of reactive oxygen species (ROS) (Schmitt et al., 2011). The phagocytosis is considered as an effective strategy for invertebrates to eliminate invaders and a particularly active process in bivalve immunity. In the present study, the phagocytic rate of oyster hemocytes was significantly increased since 6 h after the injection of V. splendidus ECP (Fig. 1), indicating that ECP could intensively induce cellular immune response in oysters. As foreign proteins, ECP might act as effective antigens to trigger the immune response of oysters, and they could be recognized by the immune receptors on hemocytes. The expansive pattern recognition receptor (PRR) genes have been reported in oysters (Wang et al., 2019), and many of them, such as lectins (Jia et al., 2016), Toll like receptors (Wang et al., 2016), were validated to recognize and bind various microbes. The PRRs expressed on hemocytes might sense the invasion of
Fig. 4. The temporal mRNA expression level of CgSOD in hemocytes of oysters following injection with saline or ECP. The hemocytes were collected at 0, 3, 6, 12, 24 and 48 h after saline or ECP injection, respectively. Each value is shown as mean ± S.D. (N = 3). (*: p < 0.05; **: p < 0.01).
However, compared with control serum proteins, serum proteins from ECP injected-oysters were degraded with a slower rate by proteolytic activity of ECP (Fig. 7). 3.7. The gene expression changes in hemocytes after stimulation with inactivated ECP or fragments of ECP-degraded serum proteins To explore how ECP induce immune response in oyster, the cultured primary hemocytes were incubated with saline, ECP, inactive ECP or fragments of ECP-degraded serum proteins for 6 h, and expression of CgTIMP628, CgTIMP629 and CgSOD mRNA in hemocytes was validated. During the incubation, the cultured hemocytes in the four treatments did not change obviously in morphology (Fig. 8A). The relative expression levels of CgTIMP628, CgTIMP629 and CgSOD in cultured hemocytes were significantly induced by ECP (10.8 ± 1.2, p < 0.05; 16.5 ± 2.0, p < 0.05; 7.8 ± 0.9, p < 0.05, respectively) compared with that of saline treatment group. The inactive ECP and
Fig. 5. The mRNA expression level of CgTIMP629 and CgTIMP628 in hemocytes of oysters after saline or ECP injection. The hemocytes were collected at 0, 3, 6, 12, 24 and 48 h after saline or ECP injection, respectively. A: Relative mRNA expression level of CgTIMP629, B: Relative mRNA expression level of CgTIMP629. Each value is shown as mean ± S.D. (N = 3). (*: p < 0.05; **: p < 0.01). 6
Developmental and Comparative Immunology 102 (2020) 103467
W. Wang, et al.
high level of ROS is also rather harmful to host cells, such as inducing protein peroxidation, DNA damage and even cell apoptosis (Moustafa et al., 2004). After ECP injection, the apoptosis rate of hemocytes was significantly increased at 6 h after ECP injection, which was just 3 h later of high-level ROS production. It has been reported that ECP of V. splendidus strain LGP32 could induce high level of ROS production in hemocytes of juvenile oysters, which might be partial reasons for the strong toxic effect of ECP to juvenile oysters (Labreuche et al., 2006). However, in adult oysters, the ROS level in hemocytes declined gradually (from 12 h after ECP injection) to nearly normal level at 24 h, and the apoptosis rate was also reduced since 24 h to a normal level at 48 h. That might be the reason for less toxic effects of ECP in adult oysters. To further explore how the high level ROS was monitored, the temporal alteration of CgSOD expression in hemocytes was detected after ECP injection. The transcripts of CgSOD were significantly induced at 6–12 h after ECP injection. As vital antioxidant enzyme, the upregulated CgSOD could help to eliminate the excessive ROS and enlighten intracellular stress (Yu et al., 2011), which might result in less apoptosis of hemocytes. The sharp up-regulation of ROS level followed by the increasing expression of antioxidant SOD in hemocytes might be effective defense mechanism of adult oysters to resist the toxicity of ECP. Pathogenic bacteria have evolved several unique virulence strategies to successfully infect their hosts. For the virulence factors of pathogenic V. splendidus, it has been reported that the possible toxicity of the ECP from V. splendidus was related to the metalloprotease like activity (Saulnier et al., 2010). In our previous report, the ECP of Vibrio splendidus strain JZ6 have been separated by SDS-PAGE and all the bands were analyzed by mass spectrometry. Two main bands were identified as metalloprotease Vsm in different forms (Liu et al., 2016). The band with higher molecular weight was the inactive form zymogen of metalloprotease Vsm, while the band with lower molecular weight was the active form of metalloprotease Vsm, which exhibited significant cleavage activity and was deemed as the major extracellular virulence factor of V. splendidus. Some animals could produce anti-virulence factors, such as metalloprotease inhibitor to inhibit metalloprotease activity. For example, an inducible metalloprotease inhibitor could be detected in the hemolymph of greater wax moth Galleria mellonella after immune stimulation, which could result in reduced or delayed mortality of G. mellonella larvae (Altincicek et al., 2007; Griesch et al., 2000). There were nine metalloproteinase inhibitors screened from oyster genome (Montagnani et al., 2007; Zhang et al., 2012). Two metalloproteinase inhibitors, CgTIMP629 and CgTIMP628 were found highly expressed in hemocytes, and their expression after ECP immune stimulation was further evaluated in the present study. The mRNA expression levels of CgTIMP629 and CgTIMP628 were both significantly induced by ECP injection. In our previous study, ECP from V. splendidus JZ6 displayed metalloprotease like activity and cytotoxicity to primary hemocytes of oyster (Liu et al., 2016). The rapid induction of CgTIMP629 expression and long lasting induction of CgTIMP628 expression after ECP injection indicated that they might collaborate to inhibit the metalloprotease activity of ECP and neutralize the toxicity of ECP towards oysters. To confirm this observation, the inhibitory effect of serum to metalloprotease activity of ECP was further detected. The natural ECP displayed obvious metalloprotease activity which could be almost totally inhibited by chelant EDTA. After ECP was incubated with control serum or serum from ECP-injected oysters in vitro, the metalloprotease activity of ECP was significantly inhibited, and a stronger inhibitory effect was observed in serum from ECP-injected oysters (Fig. 6). Moreover, during incubation, the serum protein could be degraded by ECP due to their proteolysis activity, which was detected and visualized by SDS-PAGE and silver staining. These results indicated that the serum from ECP-stimulated oysters could inhibit the protease activity of ECP, while its kinetics needs further investigation for the understanding of enzymological property and functional mechanism of ECP. The serum proteins could be proteolyzed by ECP in a time
Fig. 6. The inhibitory effect of serum from ECP-stimulated oysters on protease activity of ECP. The ECP was incubated with EDTA, serum proteins from salineinjected oysters or ECP-injected oysters for 1 h, respectively, and then the protease activity of ECP was determined. (*: p < 0.05; **: p < 0.01).
Fig. 7. The inhibition effect of serum from immune-stimulated oysters against protease activity of ECP. The serum proteins from saline-injected oysters (control serum) (A) or ECP-injected oysters (B) were incubated with ECP, respectively, and degradation of serum proteins was analyzed over time by SDSPAGE and silver staining. The protease activity of ECP was reflected by the degradation rate of serum proteins, and the two protein bands of serum were gradually reduced, with a faster rate in control serum.
V. splendidus through recognizing of the ECP and activate phagocytosis processes to degrade the virulent proteins. The phagocytosis of hemocytes might play a key role in ECP resistance in adult oysters. The redox system plays important roles in immune defense and hemostasis. In the present study, a sharp up-regulation of ROS level was observed in hemocytes at 3–6 h after ECP injection (Fig. 2), even before the phagocytosis defense. The ROS production is an important and conserved bactericidal mechanism to kill invaders. But the long-lasting 7
Developmental and Comparative Immunology 102 (2020) 103467
W. Wang, et al.
Fig. 8. Relative mRNA expression level of CgTIMP629, CgTIMP628 and CgSOD in in vitro cultured hemocytes. The hemocytes were incubated with ECP (ECP group), heat-inactivated ECP (ECP inactivated group), ECP-degraded serum protein fragments (Fragment group) or saline (Saline group), respectively. The morphologies (bar = 20 μm) of hemocytes were witnessed under microscope (A) and their gene expression change was detected by RT-PCR (B). Each value is shown as mean ± S.D. (N = 3). (*: p < 0.05).
that the metalloprotease activity of ECP could results in lesion in host, in which the damaged proteins could act as alarm signals and also be recognized by host and trigger immune responses (De Lorenzo et al., 2018). For example, in G. mellonella, the small-sized (< 3 kDa) protein fragments yielded from thermolysin-degraded hemolymph proteins, could act as endogenous alarm signals and activate innate immune responses (Altincicek et al., 2007). In the present study, the extra smaller proteins were detected in ECP-incubated serum proteins by SDS-PAGE (Fig. 7), indicating that the serum proteins could be degraded by ECP. The small fragments (< 3 kDa) of ECP-degraded serum proteins were isolated and further incubated with in vitro cultured hemocytes. After incubation, the expressions of CgTIMP629 and CgTIMP628 were significantly up-regulated, but a slightly lower level than that of natural ECP group, implying that degraded fragments could induce the activation of immune response in oyster hemocytes. These results indicated that both the heterologous ECP and ECP-yielded endogenous alarm signals could be detected by host, which might activate immune responses against virulence of ECP in adult oysters. However, whether it is the same mode for ECP recognition in juvenile oysters needs further investigation. In conclusion, the phagocytosis activity of hemocytes in adult oysters could be significantly up-regulated by the ECP derived from V. splendidus JZ6. Though high levels of ROS production and apoptosis rate were induced by ECP, these effects could be enlightened by latterly up-regulated expression of CgSOD. Moreover, the enhanced expression
dependent manner, and the degradation rate of serum from immunestimulated oysters was much slower than that of control serum, indicating an inhibitory mechanism existed in serum from immune-stimulated oysters. In serum of greater wax moth G. mellonella, an inducible metalloprotease inhibitor could reduce toxic metalloproteinase activity from invading pathogens (Altincicek et al., 2007; Griesch et al., 2000). It could be inferred that, the increased CgTIMP629 and CgTIMP628 after injection of ECP might inhibit the metalloprotease activity of ECP, which could reduce the virulence of ECP towards adult oysters. The possible resistant mechanism in adult oysters might also provide clues for exploring the missing strategies towards juvenile oyster disease. The pattern for ECP inducing immune response in host is a quite important aspect for understanding the virulence-resistance in adult oysters. As heterologous antigens, the ECP from bacteria could be recognized by immune receptors of host and directly induce immune response in hosts. In the present study, the ECP and heat-inactivated ECP were incubated with in vitro cultured hemocytes to explore the possible recognition patterns. Both ECP and inactivated ECP could significantly induce the expression of CgTIMP629 and CgTIMP628 in hemocytes. These results indicated that oyster hemocytes could directly recognize heterogeneous ECP and mount effective anti-ECP immune responses, though the corresponding receptors still missing. Moreover, natural ECP showed a stronger effect on inducing the expressions of CgTIMP628 and CgSOD than inactivated ECP. It was recently reported
8
Developmental and Comparative Immunology 102 (2020) 103467
W. Wang, et al.
of anti-toxic genes CgTIMP629 and CgTIMP628 might inhibit the metalloprotease activity of ECP to reduce their damages towards hosts. Both the inactivated-ECP (heterologous antigens) and ECP-degraded serum protein fragments (endogenous alarm signals) could activate immune responses in adult oysters. All the results provided a possible clue for the mechanism of adult-resistance towards the ECP of less virulent V. splendidus, which might be valuable for understanding the development of juvenile oyster disease.
gigas. Fish Shellfish Immunol. 59, 220–232. Labreuche, Y., Soudant, P., Goncalves, M., Lambert, C., Nicolas, J.L., 2006. Effects of extracellular products from the pathogenic Vibrio aestuarianus strain 01/32 on lethality and cellular immune responses of the oyster Crassostrea gigas. Dev. Comp. Immunol. 30 (4), 367–379. Lacoste, A., Jalabert, F., Malham, S., Cueff, A., Gelebart, F., Cordevant, C., et al., 2001. A Vibrio splendidus strain is associated with summer mortality of juvenile oysters Crassostrea gigas in the Bay of Morlaix (North Brittany, France). Dis. Aquat. Org. 46 (2), 139–145. Le Roux, F., Wegner, K.M., Polz, M.F., 2016. Oysters and Vibrios as a model for disease dynamics in wild animals. Trends Microbiol. 24 (7), 568–580. Lemire, A., Goudenege, D., Versigny, T., Petton, B., Calteau, A., Labreuche, Y., Le Roux, F., 2014. Populations, not clones, are the unit of vibrio pathogenesis in naturally infected oysters. ISME 9 (7), 1523–1531. Liu, R., Chen, H., Zhang, R., Zhou, Z., Hou, Z., Gao, D., Zhang, H., Wang, L., Song, L., 2016. Comparative transcriptome analysis of Vibrio splendidus JZ6 reveals the mechanism of its pathogenicity at low temperatures. Appl. Environ. Microbiol. 82 (7), 2050–2061. Liu, R., Qiu, L., Yu, Z., Zi, J., Yue, F., Wang, L., et al., 2013. Identification and characterisation of pathogenic Vibrio splendidus from Yesso scallop (Patinopecten yessoensis) cultured in a low temperature environment. J. Invertebr. Pathol. 114 (2), 144–150. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2−ΔΔCT method. Methods 25 (4), 402–408. Mersni-Achour, R., Cheikh, Y.B., Pichereau, V., Doghri, I., Etien, C., Dégremont, L., et al., 2015. Factors other than metalloprotease are required for full virulence of French Vibrio tubiashii isolates in oyster larvae. Microbiology 161 (5), 997–1007. Montagnani, C., Avarre, J.D., De Lorgeril, J., Quiquand, M., Boulo, V., Escoubas, J.M., 2007. First evidence of the activation of Cg-timp, an immune response component of Pacific oysters, through a damage-associated molecular pattern pathway. Dev. Comp. Immunol. 31 (1), 1–11. Moustafa, M.H., Sharma, R.K., Thornton, J., Mascha, E., Abdel-Hafez, M.A., Thomas, A.J., Agarwal, A., 2004. Relationship between ROS production, apoptosis and DNA denaturation in spermatozoa from patients examined for infertility. Hum. Reprod. 19 (1), 129–138. Samain, J.-F., 2011. Review and perspectives of physiological mechanisms underlying genetically-based resistance of the Pacific oyster Crassostrea gigas to summer mortality. Aquat. Living Resour. 24 (3), 227–236. Saulnier, D., De Decker, S., Haffner, P., Cobret, L., Robert, M., Garcia, C., 2010. A largescale epidemiological study to identify bacteria pathogenic to Pacific oyster Crassostrea gigas and correlation between virulence and metalloprotease-like activity. Microb. Ecol. 59 (4), 787–798. Schmitt, P., Duperthuy, M., Montagnani, C., Bachère, E., Destoumieux-Garzón, D., 2011. Immune Responses in the Pacific Oyster Crassostrea gigas an Overview with Focus on Summer Mortalities. Oysters Physiology, Ecological Distribution and Mortality. Travers, M.A., Miller, K.B., Roque, A., Friedman, C.S., 2015. Bacterial diseases in marine bivalves. J. Invertebr. Pathol. 131, 11–31. Wang, L., Song, X., Song, L., 2018. The oyster immunity. Dev. Comp. Immunol. 80, 99–118. Wang, L., Zhang, H., Wang, M., Zhou, Z., Wang, W., Liu, R., et al., 2019. The transcriptomic expression of pattern recognition receptors: insight into molecular recognition of various invading pathogens in Oyster Crassostrea gigas. Dev. Comp. Immunol. 91, 1–7. Wang, W., Zhang, T., Wang, L., Xu, J., Li, M., Zhang, A., et al., 2016. A new non-phagocytic TLR6 with broad recognition ligands from Pacific oyster Crassostrea gigas. Dev. Comp. Immunol. 65, 182–190. Yu, Z., He, X., Fu, D., Zhang, Y., 2011. Two superoxide dismutase (SOD) with different subcellular localizations involved in innate immunity in Crassostrea hongkongensis. Fish Shellfish Immunol. 31 (4), 533–539 (S). Zhang, G., Fang, X., Guo, X., Li, L., Luo, R., Xu, F., et al., 2012. The oyster genome reveals stress adaptation and complexity of shell formation. Nature 490 (7418), 49.
Acknowledgements We are grateful to all the laboratory members for their technical advice and helpful discussions. This research was supported by National Science Foundation of China (Nos. U1706204, 31802330), National Key R&D Project (2018YFD0900502), AoShan Talents Cultivation Program Supported by Qingdao National Laboratory for Marine Science and Technology (No. 2017ASTCP-OS13), earmarked fund (CARS-49) from Modern Agro-industry Technology Research System, the Fund for Outstanding Talents and Innovative Team of Agricultural Scientific Research, the Distinguished Professor of Liaoning (to L. S.), Key R&D Program of Liaoning Province (2017203001 to L. W.), and Natural Science Foundation of Liaoning, China (20170520056), Dalian High Level Talent Innovation Support Program (2015R020), and Talented Scholars in Dalian Ocean University. References Altincicek, B., Linder, M., Linder, D., Preissner, K.T., Vilcinskas, A., 2007. Microbial metalloproteinases mediate sensing of invading pathogens and activate innate immune responses in the lepidopteran model host Galleria mellonella. Infect. Immun. 75 (1), 175–183. Binesse, J., Delsert, C., Saulnier, D., Champomier-Verges, M.C., Zagorec, M., MunierLehmann, et al., 2008. Metalloprotease vsm is the major determinant of toxicity for extracellular products of Vibrio splendidus. Appl. Environ. Microbiol. 74 (23), 7108–7117. De Lorgeril, J., Lucasson, A., Petton, B., Toulza, E., Montagnani, C., Clerissi, C., et al., 2018. Immune-suppression by OsHV-1 viral infection causes fatal bacteraemia in Pacific oysters. Nat. Commun. 9 (1), 4215. De Lorenzo, G., Ferrari, S., Cervone, F., Okun, E., 2018. Extracellular DAMPs in plants and mammals: immunity, tissue damage and repair. Trends Immunol. 39 (11), 937–950. Garnier, M., Labreuche, Y., Garcia, C., Robert, M., Nicolas, J.L., 2007. Evidence for the involvement of pathogenic bacteria in summer mortalities of the Pacific oyster Crassostrea gigas. Microb. Ecol. 53 (2), 187–196. Gay, M., Renault, T., Pons, A.-M., Le Roux, F., 2004. Two Vibrio splendidus related strains collaborate to kill Crassostrea gigas: taxonomy and host alterations. Dis. Aquat. Org. 62, 65–74. Griesch, J., Wedde, M., Vilcinskas, A., 2000. Recognition and regulation of metalloproteinase activity in the haemolymph of Galleria mellonella: a new pathway mediating induction of humoral immune responses. Insect Biochem. Mol. 30 (6), 461–472. Hooper, L.V., Littman, D.R., Macpherson, A.J., 2012. Interactions between the microbiota and the immune system. Science 336, 1268–1273. Jia, Z., Zhang, H., Jiang, S., Wang, M., Wang, L., Song, L., 2016. Comparative study of two single CRD C-type lectins, CgCLec-4 and CgCLec-5, from pacific oyster Crassostrea
9