- Email: [email protected]
The Non-Coding RNA Llme23 Drives the Malignant Property of Human Melanoma Cells
Available online at www.sciencedirect.com
Journal of Genetics and Genomics 40 (2013) 179e188
JGG ORIGINAL RESEARCH
The Non-Coding RNA Llme23 Drives the Malignant Property of Human Melanoma Cells Chuan-Fang Wu a,1, Guang-Hong Tan b,1, Cheng-Chuan Ma a, Ling Li a,* a
Center for Functional Genomics and Bioinformatics, Ministry of Education, Key Laboratory for Bio-Resource and Eco-Environment, College of Life Science, Sichuan University, Chengdu 610064, China b Hainan Provincial Key Laboratory of Tropical Medicine, Hainan Medical College, Haikou 571101, China Received 17 October 2012; revised 25 February 2013; accepted 1 March 2013 Available online 8 March 2013
ABSTRACT Several lines of evidence support the notion that increased RNA-binding ability of polypyrimidine tract-binding (PTB) proteinassociated splicing factor (PSF) and aberrant expression of long non-coding RNAs (lncRNAs) are associated with mouse and human tumors. To identify the PSF-binding lncRNA involved in human oncogenesis, we screened a nuclear RNA repertoire of human melanoma cell line, YUSAC, through RNA-SELEX affinity chromatography. A previously unreported lncRNA, termed as Llme23, was found to bind immobilized PSF resin. The specific binding of Llme23 to both recombinant and native PSF protein was confirmed in vitro and in vivo. The expression of PSF-binding Llme23 is exclusively detected in human melanoma lines. Knocking down Llme23 remarkably suppressed the malignant property of YUSAC cells, accompanied by the repressed expression of proto-oncogene Rab23. These results may indicate that Llme23 can function as an oncogenic RNA and directly associate the PSF-binding lncRNA with human melanoma. KEYWORDS: LncRNA; Llme23; PSF; Melanoma; Rab23
INTRODUCTION Long non-coding RNAs (lncRNAs) are non-coding transcripts with a size larger than 200 nucleotides (nt) (Mercer et al., 2009; Ponting et al., 2009). Although the particular function and mechanism of lncRNAs in human physiological and pathological processes are not well understood, it seems to be unlikely that lncRNAs are functionally inert, because of their apparent development-dependent and tissue-specific expression patterns (Okazaki et al., 2002; Kapranov et al., 2005, 2007). A selective group of tumor-suppressor proteins (TSPs) function in oncogenesis by binding the proto-oncogenes and repressing their transcription (Hahn and Weinberg, 2002; Sherr, 2004). Polypyrimidine tract-binding (PTB) protein* Corresponding author. Tel/fax: þ86 28 8541 8926. E-mail address: [email protected] (L. Li). 1 These authors contributed equally to this work.
associated splicing factor (PSF), which contains one DNA binding domain (DBD) and two RNA binding domains (RBDs), was originally isolated from the splicesome and was thought to play roles in RNA splicing via its RBDs (Patton et al., 1993; Urban et al., 2000; Peng et al., 2002; Shav-Tal and Zipori, 2002). Subsequent studies showed that PSF can function as a TSP by repressing the transcription of protooncogenes, mediated by the binding of its DBD to the regulatory region (Song et al., 2005). The presence of RBDs in PSF is unexpected, because the DBD is sufficient for PSF to exert the tumor-suppression function. However, some studies indicated that the oncogenesis suppression activity of PSF is impaired with the enhancement of its RNA binding ability (Galietta et al., 2007; Figueroa et al., 2009). Other researches showed that the aberrant expression of lncRNAs is associated with mouse and human tumors (Anderson and Stoler, 1993; van der Houven van Oordt et al., 1999; Ji et al., 2003; Schulz, 2006; Lin et al., 2007). These findings suggest that the tumor-
1673-8527/$ - see front matter Copyright Ó 2013, Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, and Genetics Society of China. Published by Elsevier Limited and Science Press. All rights reserved. http://dx.doi.org/10.1016/j.jgg.2013.03.001
180
C.-F. Wu et al. / Journal of Genetics and Genomics 40 (2013) 179e188
suppression function of PSF, mediated by the DBD, could be neutralized by altering PSF’s RNA-binding ability and lncRNA might be involved in oncogenesis through the interplay with PSF. The direct linkage of gene transcription, PSF and lncRNA was explained by the discovery of a regulatory function of the RBDs in PSF, which involves the binding of VL30-1, a mouse retrotransposon lncRNA (French and Norton, 1997), to form a PSF-RNA complex that dissociates from a repressed gene and reverses the transcriptional repression (Song et al., 2002, 2004; Wang et al., 2009). Mouse and human PSF proteins share about 95% similarity at the amino acid levels. Because the VL30-1 is not found in human genome, it is likely that some other lncRNA is carrying out the function of VL30-1 in human cells. Here we reported the screening of a nuclear RNA repertoire of human melanoma line by RNA-SELEX affinity chromatography and the identification of a previously unreported human PSF-binding lncRNA, termed as Llme23. The expression of Llme23 is exclusively detectable in human melanoma lines. Our study provided evidence that Llme23 is involved in the etiology of human melanoma. RESULTS Recombinant His-tagged PSF protein and nuclear extract After IPTG induction, Escherichia coli cells harboring the pET28a-PSF plasmid was lysed by pulse sonication. SDSPAGE of the lysate supernatant showed an intense band at 100 kDa, corresponding to the predicted molecular weight of His-tagged PSF protein (Fig. 1A). The recombinant protein was purified by affinity chromatography and characterized by Western blot using anti-PSF monoclonal antibody. As shown in Fig. 1B, the band cross reacted with anti-PSF antibody had the expected molecular weight. These results demonstrated
Fig. 1. Recombinant His-tagged PSF and nuclear extract from YUSAC cells. A: His-tagged PSF induced by IPTG. Lane 1: protein marker; lane 2: lysate supernatant of E. coli (BL21) harboring pET-28a-PSF without IPTG induction; lane 3: lysate supernatant of E. coli (BL21) harboring pET-28a-PSF induced by IPTG. The arrow indicates the induced PSF recombinant protein. B: purified His-tagged PSF by affinity chromatography. Lane 1: protein marker; lane 2: purified protein product; lane 3: Western blot of the purified His-tagged PSF with anti-PSF antibody. C: nuclear extract from the YUSAC cells. Lane 1: protein marker; lane 2: nuclear extract from the YUSAC cells; lane 3: Western blot of native PSF contained in the nuclear extract.
that His-tagged PSF protein can be expressed in E. coli as a soluble form and purified to near homogeneity by one step affinity chromatography. Additionally, native PSF from the nuclear extract of YUSAC cells was also detectable by Western blot (Fig. 1C). Identification of a PSF-binding lncRNA from YUSAC cells Mouse VL30-1 lncRNA binds to PSF and functions in cell proliferation and oncogenesis. The absence of VL30-1 from human genome prompts the search for the human PSF-binding lncRNAs. A cDNA library encoding the nuclear RNAs of human melanoma line YUSAC was used to synthesize a panel of the RNA repertoire. After six cycles of RNA-SELEX affinity chromatograph, the RNAs bound to the immobilized His-tagged PSF were eluted from the immobilized PSF matrices and analyzed by agarose gel electrophoresis. The eluted RNAs presented mainly as a smear on the gel, with some discrete bands (Fig. 2A). With construction of a cDNA library from the enriched PSF-binding RNAs (lane 3 in Fig. 2A), 100 clones were randomly selected and sequenced. A 239 bp cDNA insert, which maps to a region on chromosome 6 at 165,533,548e165,533,786, has not been characterized previously and contains no functional open reading frame (Fig. 2B). Molecular assays revealed that this RNA, termed as Llme23, is a polyadenylated transcript with the size around 1600 nt (Fig. 2C and D). Binding of Llme23 to PSF in vitro and in vivo Recombinant PSF and PSF from the nuclear extract of YUSAC cells were used to test the binding activity of Llme23 to PSF in vitro through gel-shift and UV cross-linking assays. Result from gel-shift assay showed that the electrophoretic mobility of RNA probe was retarded significantly by the addition of recombinant PSF (Fig. 3A), and the addition of cold probe could release the radiolabeled RNA probe from recombinant PSF (Fig. 3B), indicating that Llme23 can interact with recombinant PSF in vitro. Consistent with the result from gel-shift assay, radiolabeled Llm23 RNA gave an intense band corresponding to the migration of PSF protein in UV cross-linking assay using the nuclear extract of YUSAC cells, suggesting the binding of native PSF protein to Llm23 (Fig. 3C). In addition to the test in vitro, the specific binding of Llme23 to PSF was further verified by RNAimmunoprecipitation (RIP) in vivo. Following the immunoprecipitation, the co-precipitated complex was subjected to RNA extraction and RT-PCR. As shown in Fig. 3D, Llme23 was only detectable when the antibody against PSF was used in the IP procedure, indicating that the cDNA band specifically came from the RNA sample co-precipitated with PSF protein. Moreover, the lack of amplification in the control reaction omitting the reverse transcriptase ruled out the possibility that co-precipitation product was contaminated by genome DNA.
C.-F. Wu et al. / Journal of Genetics and Genomics 40 (2013) 179e188
181
human cell lines (Fig. 4). Our data showed that Llme23 was exclusively detectable in melanoma lines, including A2058, SKmel28, YU-SIT1 and YUSAC. This finding suggests a pathological link between the Llme23 expression and human melanoma. Effect of Llme23 on the expression of proto-oncogene Rab23 The binding of VL30-1 to PSF releases PSF from mouse Rab23 and reverses the transcriptional repression by PSF (Wang et al., 2009). To study the effect of Llme23 on the expression of Rab23 human homolog, YUSAC cells were transfected with the Llme23-encoding plasmid, or with the empty pcDNA3.1 plasmid as a control. Cells were harvested 3 days after transfection, and then the RNA and protein extracts from the transfected cells were subjected to semi-quantitative RT-PCR and Western blot, respectively. As shown in Fig. 5A and B, the expression level of Rab23 is up-regulated by the overexpression of Llme23. In contrast, the depletion of endogenous Llme23 by RNAi repressed the expression of Rab23 (Fig. 5CeE). Effect of Llme23 on the malignant property of YUSAC cells
Fig. 2. Identification of a previously unreported PSF-binding lncRNA Llme23 by RNA-SELEX. A: selection of PSF-binding RNAs by RNA-SELEX affinity chromatography. Lane 1: RNA selected by one cycle of RNA-SELEX; lane 2: RNA selected by three cycles of RNA-SELEX; lane 3: RNA selected by six cycles of RNASELEX. B: location of Llme23 in human genome. The genomic region mapped by Llme23 does not encode any previously identified EST. C: Northern blot confirming Llme23 transcript. Llme23-specific anti-sense (AS-probe) and sense (S-probe) probes were used in Northern blot respectively. D: Llme23 is confirmed to be a polyadenylated transcript by RT-PCR. RT-PCR reaction omitting reverse transcriptase (RTase) was used as the negative control, and RT-PCR reaction initiated by random hexamers (RP6) was used as the positive control.
To confirm that the binding to PSF is specific for Llme23, the abundant b-actin mRNA was also analyzed by RT-PCR. As shown in Fig. 3D, although the b-actin band was easily amplified from the input sample, it was not detectable in various co-precipitation products. Taken together, our data impartially demonstrated that Llme23 specifically binds to PSF. Exclusive expression of Llme23 in human melanoma lines Because Llme23 was identified from human melanoma line YUSAC, it is likely that Llme23 functions in the etiology of human melanoma. To address this question, RT-PCR was applied to measure the expression level of Llme23 in various
Due to its exclusive expression in human melanoma lines and its ability to control the expression of proto-oncogene, the oncogenic role of Llme23 was further analyzed in YUSAC cells. As shown in Fig. 6, YUSAC cells expressing low level of Llme23, compared to the control YUSAC cells, exhibited weaker competency in forming colonies and tumors. DISCUSSION Because PSF protein is highly conserved from human to mice and the human homolog of VL30-1 is not found in human genome, it is of great interest to identify the lncRNA that is the functional equivalent of the mouse VL30-1 lncRNA. RNA-SELEX affinity chromatography was applied to select the human PSF-binding lncRNAs from the nuclear RNA repertoire of human melanoma line YUSAC. RNA-SELEX is a high performance procedure which can enrich the PSFbinding RNAs and subtract noisy transcripts. This was revealed by the agarose gel pattern of selected RNA product that was visualized as a smear containing some discrete bands (Fig. 2A). With the completion of sequencing and screening for vector contamination, containing no functional open reading frame was raised as a criterion to refine the selected RNAs. These procedures got a lncRNA previously unreported, which was termed Llme23. Although a method of RACE failed to get the full-length Llme23 because the RACE products were visualized as smear but not specific amplicon (data not shown), Llme23 transcript with the size of round 1600 nt was confirmed by Northern blot (Fig. 2C). Furthermore, the specific amplification band can be produced from cDNA reverse transcribed by oligo(dT)18 (Fig. 2D), indicating that
182
C.-F. Wu et al. / Journal of Genetics and Genomics 40 (2013) 179e188
Fig. 3. Binding of Llme23 to PSF protein. A: binding of Llme23 to PSF tested by gel-shift assay in vitro. B: cold probe releases the radiolabeled RNA probe from PSF. The molar ratio of cold RNA probe to radiolabeled RNA probe was 1, 3 and 10. C: binding of Llme23 to PSF tested by UV cross-linking assay in vitro. Nuclear extract from YUSAC cells was tested. A purified recombinant PSF was also assayed to show that the arrow pointed band is located at the predicted position of PSF. D: binding of Llme23 to PSF tested by RIP assay in vivo. The PAb (positive antibody) indicates anti-PSF antibody, and the NAb (negative antibody) indicates the anti-mouse IgG antibody.
Llme23 should belong to a mRNA-like lncRNA. Results from the gel-shift and UV cross-linking assays verified that Llme23 can bind to recombinant and native PSF proteins in vitro (Fig. 3AeC). The RNA-protein binding in living cells was further confirmed by RIP (Fig. 3D). In the UV cross-linking assay, an intense band was observed at the predicted position of PSF. Noticeably, some other bands were also detected (Fig. 3C). Because PSF interacts with many proteins and is thought to be a component of several nuclear complexes, such as nuclear speckles and paraspeckles (Bond and Fox, 2009; Clemson et al., 2009), it is likely that the bands larger than PSF are those PSF-containing macromolecular complexes binding to Llme23. Alternatively, it is feasible that Llme23 is a promiscuous lncRNA that also binds to RBD-containing proteins other than PSF.
Fig. 4. Expression level of Llme23 in different human cell lines. Lane1: BJ, human fibroblast line; lane 2: HEK293, human embryonic kidney line; lanes 3e6: A2058, YU-SIT1, YUSAC and Skmel28, human melanoma lines; lane 7: MCF10A, human mammary epithelium line; lanes 8 and 9: MCF7 and MDA-MB-231, human breast cancer lines; lane 10: L02, human hepatocyte line; lanes 11e14: SMMC-7402, SMMC-7721, HU-7 and HepG2, human hepatocellular carcinoma lines; lane 15: HCT116, human rectal cancer line; lanes 16 and 17: A549 and H292, human lung cancer lines. The RT-PCR test for Llme23 was performed by 30 cycles of amplification. Although more than 40 cycles of amplification was performed, Llme23 was undetectable in cell lines showed in lanes 1, 2, and 7e17 (data not shown).
A screen of several human normal and tumor lines showed that Llme23 is exclusively expressed in human melanoma lines (Fig. 4), indicating an association of Llme23 expression with the etiology of human melanoma. Depletion of endogenous Llme23 was carried out by stably transfecting YUSAC cells with a plasmid encoding Llme23-specific shRNA (Fig. 5CeE). The results from colony formation assay and in vivo tumor growth showed that YUSAC-shLlme23 cells, compared to YUSAC-shLUC cells, present the significant growth defects (Fig. 6). These results further suggest that PSFbinding Llme23 plays an oncogenic role in human melanoma. Earlier studies showed that PSF represses the transcription of mouse proto-oncogene Rab23 by selectively binding to a 237 bp sequence at its regulatory region (Wang et al., 2009). The identification of a conserved PSF-targeting sequence embedded in the promoter region of human Rab23 suggests that Rab23 might be the target gene for PSF in human cells. Indeed, the increased Llme23 level up-regulated Rab23 expression, and the decreased Llme23 level down-regulated Rab23 expression (Fig. 5). These results indicate that the activation of proto-oncogene is involved in the oncogenic role of PSF-binding Llme23. Development of human cancer is a multistep process governed by a series of genetic and cellular principles (Hahn and Weinberg, 2002; Whitfield et al., 2006). PSF is a multifunctional protein and its RNA-binding behavior has already been implicated in a variety of cellular processes including proliferation, differentiation, regulation of cell cycle and apoptosis (Chanas-Sacre et al., 1999; Shav-Tal et al., 2001; Shav-Tal and Zipori, 2002; Rosonina et al., 2005; Sutherland et al., 2005;
C.-F. Wu et al. / Journal of Genetics and Genomics 40 (2013) 179e188
183
Fig. 5. Effect of Llme23 on the expression of proto-oncogene Rab23. A: up-regulated transcription of Rab23 by increased amount of Llme23. b-actin mRNA was used to normalize the total RNA in samples. Lane 1: YUSAC-pcDNA 3.1; lane 2: YUSAC-Llme23. B: up-regulated translation of Rab23 by increased amount of Llme23. The cells for lanes 1 and 2 are the same as A. C: down-regulated transcription of Rab23 by decreased amount of Llme23. YUSAC cells were stably transfected with a plasmid encoding a luciferase shRNA (YUSAC-shLUC) or a specific shRNA that initiates degradation of Llme23 by RNAi (YUSAC-shLlme23a and YUSAC-shLlme23b). Lane 1: YUSAC-shLUC; lane 2: YUSACshLlme23a; lane 3: YUSAC-shLlme23b. The real-time RT-PCR data for the transcriptional levels of Llme23, PSF and Rab23 are also showed in D. E: downregulated translation of Rab23 by decreased amount of Llme23. The cells for lanes 1e3 are the same as C.
Figueroa et al., 2009; Lukong et al., 2009). We speculate that the interplay between Llme23 and PSF also affects certain PSF-associated cellular processes in addition to the regulation on proto-oncogene expression. Additionally, the details underlying the binding of Llme23 to proteins other than PSF, as shown in Fig. 3C, remain to be further addressed. In summary, the research reported here provides a new insight on the pathological role of PSF-binding lncRNA in human cancer. The etiological involvement of Llme23 in human melanoma is supported by two lines of evidence: the apparent melanoma-specific expression pattern and its contribution to maintain the malignant property of melanoma cell. Although the molecular details have yet to be studied, our present data reveal that PSF-binding Llme23 can function as a tumor activator in human melanoma, partially mediated by reversing repression of proto-oncogene by PSF.
(pH 7.9), 20% glycerol, 100 mmol/L KCl, 0.2 mmol/L EDTA, 0.2 mmol/L PMSF and 0.5 mmol/L DTT) and stored at 80 C. Cell culture Human fibroblast line BJ, human mammary epithelium line MCF10A, human hepatocyte line L02, human embryonic kidney line 293 (HEK293), human melanoma lines A2058, SKmel28, YU-SIT1 and YUSAC, human hepatocellular carcinoma lines SMMC-7402, SMMC-7721, HU-7 and HepG2, human breast cancer lines MCF7 and MDA-MB-231, human rectal cancer line HCT116, and human lung cancer lines A549 and H292 were cultured in DMEM or RPMI 1640 medium supplemented with 10% FBS in a 5% CO2 incubator at 37 C. Production of nuclear lysate
MATERIALS AND METHODS Production of recombinant His-tagged PSF protein His-tagged human PSF was produced from E. coli BL21 (DE3) transformed with pET28a-PSF plasmid. Transformed E. coli was cultured in LB medium supplemented with 50 mg/mL kanamycin at 37 C until OD600 reached 0.6. The temperature was then decreased to 25 C and induced by 1 mmol/L IPTG overnight. E. coli was lysed using pulse sonication for 5 min followed by 30 min centrifugation at 13,000 g. His-tagged PSF contained in the supernatant was purified using TALON metal affinity resin (BD Clontech, USA) following the manufacturer’s protocol. The purified protein was dialyzed against a 50-fold volume of dialysis buffer (20 mmol/L Hepes
Cultures of the YUSAC cells were grown to about 70% confluence, washed twice with PBS, removed from the plastic substrate by scraping in PBS, and pelleted by centrifugation. The cell pellets were resuspended in a hypotonic buffer (10 mmol/L Hepes (pH 7.9), 1.5 mmol/L MgCl2, 10 mmol/L KCl, 0.2 mmol/L PMSF and 0.5 mmol/L DTT) and disrupted by 20 strokes of a Dounce homogenizer. The nuclei were pelleted by centrifugation for 5 min at 3300 g, equilibrated for 30 min in extraction buffer (20 mmol/L Hepes (pH 7.9), 25% glycerol, 1.5 mmol/L MgCl2, 0.6 mol/L KCl, 0.2 mmol/L EDTA, 0.2 mmol/L PMSF and 0.5 mmol/L DTT) with continuous gentle mixing, and centrifuged at 25,000 g for 30 min. The supernatant was dialyzed against a 50-fold volume of dialysis buffer and the dialyzate was centrifuged at 25,000 g for 20 min.
184
C.-F. Wu et al. / Journal of Genetics and Genomics 40 (2013) 179e188
Fig. 6. Effect of Llme23 on malignant property of YUSAC cells. A: colony formation in soft agar. 1 104 cells were mixed with 0.3% agar in culture medium. After 4 weeks of incubation at 37 C in a 5% CO2 incubator, colonies were counted. Representative phase contrast images are shown. The data are represented as the average number of colonies per plate determined from three separate experiments. *P < 0.01, significantly different from control. B: tumor formation in nude mice. For each cell line, three mice were injected on bilateral sides of the neck, using 2 106 cells on each side. Proliferation and oncogenicity of injected cells were assessed by calculating tumor volume every 3 days. The finally formed tumors are shown, and the average volume of the tumors on each day is shown in the curves. The error bars are the SE (n ¼ 6).
C.-F. Wu et al. / Journal of Genetics and Genomics 40 (2013) 179e188
The supernatant was stored at 80 C and used as the nuclear lysate.
185
enriched PSF-binding RNAs. And then, the obtained cDNA clones were subjected to sequencing, screening for vector contamination, and the subsequent analysis.
Western blot Northern blot Protein sample was fractionated by 7.5% (w/v) SDS-PAGE and electronically transferred to a PVDF membrane at 100 V for 1 h. The membrane was rinsed with PBST buffer, blocked for 2 h in PBST containing 5% non-fat milk, and incubated with mouse anti-PSF monoclonal antibody (Sigma, USA) or rabbit anti-RAB23 polyclonal antibody (Abcam, UK) for 1 h. The membrane was washed with PBST and then incubated for 1 h with HRP-conjugated anti-mouse or anti-rabbit IgG. Blots were visualized using an ECL detection kit (Amersham Pharmacia Biotech, USA) and exposed to X-ray film. Selection of human nuclear RNAs binding to PSF protein Nuclei of YUSAC cells were prepared as described above and were used to isolate nuclear RNA using TRIzol reagent (Invitrogen, USA). The first-strand cDNA was synthesized from 20 mg of nuclear RNA in a 40 mL reaction volume containing 10 mL of random hexamers (10 mmol/L), 8 mL of 5 reaction buffer, 1 mL of RNaseOUT recombinant ribonuclease inhibitor (40 U/mL, Invitrogen), 3 mL of dNTP mix (10 mmol/L each), 4 mL of 0.1 mol/L DTT, and 1 mL of SuperScript II reverse transcriptase (200 U/mL, Invitrogen). Double-stranded cDNA (ds-cDNA) was synthesized from the purified single-stranded cDNA in a 20 mL reaction volume containing 4 mL of 5 reaction buffer, 3 mL of dNTP mix, 1 mL of DNA polymerase Ⅰ (10 U/mL, NEB, USA), and 0.1 mL of RNase H (2 U/mL, Invitrogen). Following the doublestranded cDNA synthesis, blunt-end ds-cDNA was produced using Pfu DNA polymerase (Promega, USA) and then cloned into the PCR-blunt-TOPO vector (Invitrogen) to construct a cDNA library encoding the total nuclear RNA repertoire. The cDNA inserts included in the library were linearized by PCR using M13 forward and reverse primers mapped to the matching sequences within PCR-blunt-TOPO vector, and the encoded RNAs were synthesized using T7 RNA polymerase. A 200 mg of RNAs were incubated with 10 mg of His-tagged PSF in binding buffer (10 mmol/L Hepes (pH 7.6), 5 mmol/L MgCl2, 1 mmol/L DTT, 100 mmol/L KCl, 6% glycerol and 80 mg/mL poly(dI-dC)) and gently mixed at 4 C for 3 h to form the RNA-PSF complexes. The complexes were then collected, through the His-tag residing at the N-terminal of recombinant PSF, on affinity resin pre-equilibrated with binding buffer, and the collected RNA components were isolated using TRIzol reagent. The single-stranded cDNA corresponding to the collected RNA by the first cycle of SELEX was synthesized by reverse transcription using M13 reverse oligonucleotide. Following the ds-cDNA synthesis and endfilling as described above, the end-blunt ds-cDNA was cloned into PCR-blunt-TOPO vector. The selection procedure was repeated for five additional cycles, and the final cDNA product was cloned to construct a cDNA library encoding the
Total RNA of 20 mg purified from YUSAC cells was used for a Northern blot assay. To prepare the probes, synthetic oligonucleotides were end-labeled by T4 polynucleotide kinase in the presence of g-32P-ATP, and then purified by DNA probe purification kit (OMEGA, USA). The antisense and sense oligonucleotides were 50 -CACAGGACCTCTGAAAG AGAAAGCTCATCTAGC-30 and 50 -GCTAGATGAGCTTTC TCTTTCAGAGGTCCTGTG-30 . Following formaldehyde gel electrophoresis, electroblotting and immobilization by UV cross-linking, Northern blot was performed at a hybridization temperature of 42 C using ULTRAhyb-Oligo buffer (Invitrogen). At last, the blot was autoradiographed by 4 days of exposure to X-ray film at 80 C. Gel-shift and UV cross-linking assays cDNA clone included in the enriched cDNA library was linearized by restriction enzyme digestion. The encoded RNA was radiolabeled by in vitro transcription in the presence of a-32P-CTP, and purified by phenol-chloroform extraction and ethanol precipitation. The RNA-protein complex was allowed to form by mixing 10 fmol of 32P-labeled RNA with protein sample in binding buffer to a final volume of 15 mL and incubating the mixture at 25 C for 20 min. In gel-shift assay, RNA probe was mixed with 50 ng of purified recombinant PSF or total extract of E. coli. After the incubation at 25 C, samples were fractionated by 4% PAGE. In competitive gelshift assay, unlabeled RNA transcript was added to the incubated RNA probe and PSF mixture. After an additional incubation at 25 C, samples were fractionated by 4% PAGE. In UV cross-linking assay, RNA probe was mixed with 50 ng of purified recombinant PSF or 500 ng of nuclear extract from YUSAC cells. After the incubation at 25 C, the reaction mixture was exposed to 254 nm light on ice for 30 min using a UV cross-linker at a distance of about 5 cm, and then treated by RNase T1 (1 U) at 25 C for 10 min and fractionated by 7.5% SDS-PAGE. At last, the gel was autoradiographed by exposure to X-ray film at 80 C. RNA co-immunoprecipitation The YUSAC cells were cultured in 100-mm plates to about 70% confluence, crosslinked with 1% formaldehyde for 20 min at 25 C, washed and harvested from the plastic substrate by scraping in PBS. Cells were resuspended in 200 mL of Buffer A (5 mmol/L PIPES (pH 8.0), 85 mmol/L KCl, 0.5% NP40, 1 Roche protease inhibitors cocktail and 50 U/mL SUPERase-in) and incubated on ice for 10 min. The crude nuclei fraction was pelleted by centrifugation at 5000 r/min for 5 min at 4 C. The pellet was washed once in Buffer A without NP40, resuspended in 500 mL of Buffer B
186
C.-F. Wu et al. / Journal of Genetics and Genomics 40 (2013) 179e188
(1% SDS, 10 mmol/L EDTA, 50 mmol/L Tris-HCl (pH 8.1), 1 Roche protease inhibitors cocktail and 50 U/mL SUPERase-in) and then incubated on ice for 10 min. Lysates were homogenized by sonication, and cleared by centrifugation at 16,000 g for 10 min at 4 C. The sonicate was diluted 10-fold into IP buffer (0.01% SDS, 1.1% Triton X-100, 1.2 mmol/L EDTA, 16.7 mmol/L Tris-HCl (pH 8.1), 167 mmol/L NaCl, 1 Roche protease inhibitors cocktail and 50 U/mL SUPERase-in) to a final volume of 1 mL. The diluted sonicate was incubated with 3 mg of anti-PSF monoclonal antibody and immune complexes were allowed to form by slow mixing on a rotating platform at 4 C overnight. A 50 mL of protein A agarose beads (Invitrogen) were then added and slow mixing rotation continued for 2 h at 4 C. Beads were washed with low-salt buffer (0.1% SDS, 1% Triton X-100, 2 mmol/L EDTA, 20 mmol/L Tris-HCl (pH 8.1) and 150 mmol/L NaCl), high-salt buffer (the same with the component of low-salt buffer except 500 mmol/L NaCl), LiCl buffer (0.25 mol/L LiCl, 1% NP40, 1% deoxycholate, 1 mmol/ L EDTA and 10 mmol/L Tris-HCl (pH 8.1)), and TE buffer, respectively. And then, immune complexes were eluted by addition of 250 mL of fresh elution buffer (1% SDS, 0.1 mol/L NaHCO3 and 50 U/mL SUPERase-in). NaCl was added to a final concentration of 200 mmol/L and then placed at 65 C for 3 h to reverse crosslinking. Nucleic acid was extracted by TRIzol reagent, ethanol-precipitated with Glycoblue (Invitrogen) as a carrier, and treated with DNaseⅠ (Promega). Following another TRIzol extraction and ethanol precipitation, the recovered RNAs were detected by standard RT-PCR protocol. The primer sets were as follows: (1) Llme23: forward 50 -TTTGACACGAGTGACTGTATTTTGAA-30 and reverse 50 -ATTTATGAATTGTCACAGGACCTCT-30 ; (2) b-actin: forward 50 -CTCCTCCCTGGAGAAGAGCTA-30 and reverse 50 -CCTTCTGCATCCTGTCGGCAA-30 . Plasmid-mediated RNA interference The complementary sense and anti-sense oligonucleotides were synthesized, annealed, and cloned into BamH I/Hind III sites of pGenesil-1 plasmid (Genesil Biotechnology Co., Wuhan, China). The recombinant plasmid encodes shRNA with a 19-mer stem derived from the RNA target site, and initiates the RNAi in vivo. The sense and anti-sense oligonucleotides encoding Llme23-specific shRNA constructions were 50 -GATCCTGGTCTTCCTCAGCTCCATTTCAAGAG AATGGAGCTGAGGAAGACCATTTTTTA-30 and 50 -AGC TTAAAAAATGGTCTTCCTCAGCTCCATTCTCTTGAAAT GGAGCTGAGGAAGACCAG-30 , 50 -GATCCTTCCTACTTA AGCTAGATGTTCAAGAGACATCTAGCTTAAGTAGGAAT TTTTTA-30 and 50 -AGCTTAAAAAATTCCTACTTAAGCTA GATGTCTCTTGAACATCTAGCTTAAGTAGGAAG-30 , and the recombinant plasmids were termed as pGenesil-shLlme23a and pGenesil-shLlme23b. The sense and anti-sense oligonucleotides encoding luciferase-specific shRNA construction were 50 -GATCCGTAGCGCGGTGTATTATACTTCAAGAG AGTATAATACACCGCGCTACTTTTTTA-30 and 50 -AGCT TAAAAAAGTAGCGCGGTGTATTATACTCTCTTGAAGTA
TAATACACCGCGCTACG-30 , and the recombinant plasmid was termed as pGenesil-shLUC. To construct YUSAC lines expressing low level of Llme23 (YUSAC-shLlme23a and YUSAC-shLlme23b), YUSAC cells were transfected with the plasmid pGenesil-shLlme23a or pGenesil-shLlme23b, and then selected with 800 mg/mL G418. The control cell line (YUSAC-shLUC) was obtained by transfecting YUSAC cells with plasmid pGenesil-shLUC. The transfection reagent Lipofectamine 2000 (Invitrogen) was used for all transfections, and the transcription level of the target RNA was assayed by semi-quantitative and real-time RT-PCR. Semi-quantitative RT-PCR Cultures of the cells were grown to about 70% confluence in 6-well plates and were used to isolate total RNA by TRIzol reagent. The cDNAs were synthesized from the RNAs using random hexamers. The human cell lines listed above were tested for transcription level of Llme23, and the transfected cells were tested to investigate the effect of Llme23 on Rab23 transcription. The sense and anti-sense primer sets were as follows: (1) Llm23: 50 -TTTGACACGAGTGACTGTATTTTGAA-30 and 50 -ATTTATGAATTGTCACAGGACCTCT-30 ; (2) Rab23: 50 -C ATCTAACACCTTTTGCTGCTCA-30 and 50 -ATGATTCTGT ATGTGGGACTGAC-30 ; (3) PSF: 50 -GCGGAGGAGCAATG AACATGGGA-30 and 50 -CACTTCCCATCATGGAACCAC TC-30 ; (4) b-actin: 50 -CTCCTCCCTGGAGAAGAGCTA-30 and 50 -CCTTCTGCATCCTGTCGGCAA-30 . Real-time RT-PCR Cell culture and cDNA synthesis were performed as described above, and the PCR assay was performed using 2 Bio-Rad EvaGreen Supermix on a Bio-Rad CFX96 (USA). All reactions were done in a 10 mL reaction volume in triplicate. The specificity of amplification was verified by melt-curve analysis and agarose gel electrophoresis, and the data were collected and analyzed using Bio-Rad CFX Manager software. The relative amount of target gene RNA was normalized to a b-actin mRNA standard. All the primers used here were the same as those of semi-quantitative RT-PCR. Colony formation in soft-agar Cells were suspended in 1 mL of 0.3% melted agar in DMEM supplemented with 10% FBS and plated in 6-well plates overlayed with 0.5% agar in the same medium. The resulting colonies were scored and photographed using phase contrast microscope. Tumor formation in nude mice Cells were detached from the culture plates by a brief incubation with 2 mmol/L EDTA in PBS, suspended in DMEM supplemented with 10% FBS, washed, and resuspended in PBS. Six-week-old nude mice were anesthetized and injected subcutaneously into bilateral sites on the neck
C.-F. Wu et al. / Journal of Genetics and Genomics 40 (2013) 179e188
with cells in 0.1 mL PBS using a 25-guage needle. The diameters of the resulting tumors were measured every 3 days, and the tumor volume was calculated by the formula (ab2)/2, in which “a” is the longest diameter and “b” is the shortest diameter of the tumor. The mice were sacrificed at the end of the experiment, and the tumors were photographed.
ACKNOWLEDGEMENTS This work was supported by the grants from the National Natural Science Foundation of China (Nos. 31000579 and 30971634), the Provincial Natural Science Foundation of Hainan of China (No. 310045), the Ph.D. Programs Foundation of the Ministry of Education of China (No. 20090181120076), and the Provincial Youth Science and Technology Innovation Team Foundation of Sichuan of China (No. 2011JTD0026). REFERENCES Anderson, G.R., Stoler, D.L., 1993. Anoxia, wound healing, VL30 elements, and the molecular basis of malignant conversion. Bioessays 15, 265e272. Bond, C.S., Fox, A.H., 2009. Paraspeckles: nuclear bodies built on long noncoding RNA. J. Cell Biol. 186, 637e644. Chanas-Sacre, G., Mazy-Servais, C., Wattiez, R., Pirard, S., Rogister, B., Patton, J.G., Belachew, S., Malgrange, B., Moonen, G., Leprince, P., 1999. Identification of PSF, the polypyrimidine tract-binding protein-associated splicing factor, as a developmentally regulated neuronal protein. J. Neurosci. Res. 57, 62e73. Clemson, C.M., Hutchinson, J.N., Sara, S.A., Ensminger, A.W., Fox, A.H., Chess, A., Lawrence, J.B., 2009. An architectural role for a nuclear noncoding RNA: NEAT1 RNA is essential for the structure of paraspeckles. Mol. Cell 33, 717e726. Figueroa, A., Fujita, Y., Gorospe, M., 2009. Hacking RNA: Hakai promotes tumorigenesis by enhancing the RNA-binding function of PSF. Cell Cycle 8, 3648e3651. French, N.S., Norton, J.D., 1997. Structure and functional properties of mouse VL30 retrotransposons. Biochim. Biophys. Acta 1352, 33e47. Galietta, A., Gunby, R.H., Redaelli, S., Stano, P., Carniti, C., Bachi, A., Tucker, P.W., Tartari, C.J., Huang, C.J., Colombo, E., Pulford, K., Puttini, M., Piazza, R.G., Ruchatz, H., Villa, A., Donella-Deana, A., Marin, O., Perrotti, D., Gambacorti-Passerini, C., 2007. NPM/ALK binds and phosphorylates the RNA/DNA-binding protein PSF in anaplastic large-cell lymphoma. Blood 110, 2600e2609. Hahn, W.C., Weinberg, R.A., 2002. Rules for making human tumor cells. N. Engl. J. Med. 347, 1593e1603. Ji, P., Diederichs, S., Wang, W., Boing, S., Metzger, R., Schneider, P.M., Tidow, N., Brandt, B., Buerger, H., Bulk, E., Thomas, M., Berdel, W.E., Serve, H., Muller-Tidow, C., 2003. MALAT-1, a novel noncoding RNA, and thymosin beta4 predict metastasis and survival in early-stage nonsmall cell lung cancer. Oncogene 22, 8031e8041. Kapranov, P., Cheng, J., Dike, S., Nix, D.A., Duttagupta, R., Willingham, A.T., Stadler, P.F., Hertel, J., Hackermuller, J., Hofacker, I.L., Bell, I., Cheung, E., Drenkow, J., Dumais, E., Patel, S., Helt, G., Ganesh, M., Ghosh, S., Piccolboni, A., Sementchenko, V., Tammana, H., Gingeras, T.R., 2007. RNA maps reveal new RNA classes and a possible function for pervasive transcription. Science 316, 1484e1488. Kapranov, P., Drenkow, J., Cheng, J., Long, J., Helt, G., Dike, S., Gingeras, T.R., 2005. Examples of the complex architecture of the human transcriptome revealed by RACE and high-density tiling arrays. Genome Res. 15, 987e997.
187
Lin, R., Maeda, S., Liu, C., Karin, M., Edgington, T.S., 2007. A large noncoding RNA is a marker for murine hepatocellular carcinomas and a spectrum of human carcinomas. Oncogene 26, 851e858. Lukong, K.E., Huot, M.E., Richard, S., 2009. BRK phosphorylates PSF promoting its cytoplasmic localization and cell cycle arrest. Cell. Signal. 21, 1415e1422. Mercer, T.R., Dinger, M.E., Mattick, J.S., 2009. Long non-coding RNAs: insights into functions. Nat. Rev. Genet. 10, 155e159. Okazaki, Y., Furuno, M., Kasukawa, T., Adachi, J., Bono, H., Kondo, S., Nikaido, I., Osato, N., Saito, R., Suzuki, H., Yamanaka, I., Kiyosawa, H., Yagi, K., Tomaru, Y., Hasegawa, Y., Nogami, A., Schonbach, C., Gojobori, T., Baldarelli, R., Hill, D.P., Bult, C., Hume, D.A., Quackenbush, J., Schriml, L.M., Kanapin, A., Matsuda, H., Batalov, S., Beisel, K.W., Blake, J.A., Bradt, D., Brusic, V., Chothia, C., Corbani, L.E., Cousins, S., Dalla, E., Dragani, T.A., Fletcher, C.F., Forrest, A., Frazer, K.S., Gaasterland, T., Gariboldi, M., Gissi, C., Godzik, A., Gough, J., Grimmond, S., Gustincich, S., Hirokawa, N., Jackson, I.J., Jarvis, E.D., Kanai, A., Kawaji, H., Kawasawa, Y., Kedzierski, R.M., King, B.L., Konagaya, A., Kurochkin, I.V., Lee, Y., Lenhard, B., Lyons, P.A., Maglott, D.R., Maltais, L., Marchionni, L., McKenzie, L., Miki, H., Nagashima, T., Numata, K., Okido, T., Pavan, W.J., Pertea, G., Pesole, G., Petrovsky, N., Pillai, R., Pontius, J.U., Qi, D., Ramachandran, S., Ravasi, T., Reed, J.C., Reed, D.J., Reid, J., Ring, B.Z., Ringwald, M., Sandelin, A., Schneider, C., Semple, C.A., Setou, M., Shimada, K., Sultana, R., Takenaka, Y., Taylor, M.S., Teasdale, R.D., Tomita, M., Verardo, R., Wagner, L., Wahlestedt, C., Wang, Y., Watanabe, Y., Wells, C., Wilming, L.G., Wynshaw-Boris, A., Yanagisawa, M., Yang, I., Yang, L., Yuan, Z., Zavolan, M., Zhu, Y., Zimmer, A., Carninci, P., Hayatsu, N., Hirozane-Kishikawa, T., Konno, H., Nakamura, M., Sakazume, N., Sato, K., Shiraki, T., Waki, K., Kawai, J., Aizawa, K., Arakawa, T., Fukuda, S., Hara, A., Hashizume, W., Imotani, K., Ishii, Y., Itoh, M., Kagawa, I., Miyazaki, A., Sakai, K., Sasaki, D., Shibata, K., Shinagawa, A., Yasunishi, A., Yoshino, M., Waterston, R., Lander, E.S., Rogers, J., Birney, E., Hayashizaki, Y., 2002. Analysis of the mouse transcriptome based on functional annotation of 60,770 full-length cDNAs. Nature 420, 563e573. Patton, J.G., Porro, E.B., Galceran, J., Tempst, P., Nadal-Ginard, B., 1993. Cloning and characterization of PSF, a novel pre-mRNA splicing factor. Genes Dev. 7, 393e406. Peng, R., Dye, B.T., Perez, I., Barnard, D.C., Thompson, A.B., Patton, J.G., 2002. PSF and p54nrb bind a conserved stem in U5 snRNA. RNA 8, 1334e1347. Ponting, C.P., Oliver, P.L., Reik, W., 2009. Evolution and functions of long noncoding RNAs. Cell 136, 629e641. Rosonina, E., Ip, J.Y., Calarco, J.A., Bakowski, M.A., Emili, A., McCracken, S., Tucker, P., Ingles, C.J., Blencowe, B.J., 2005. Role for PSF in mediating transcriptional activator-dependent stimulation of pre-mRNA processing in vivo. Mol. Cell. Biol. 25, 6734e6746. Schulz, W.A., 2006. L1 retrotransposons in human cancers. J. Biomed. Biotechnol. 2006, 83672. Shav-Tal, Y., Cohen, M., Lapter, S., Dye, B., Patton, J.G., Vandekerckhove, J., Zipori, D., 2001. Nuclear relocalization of the pre-mRNA splicing factor PSF during apoptosis involves hyperphosphorylation, masking of antigenic epitopes, and changes in protein interactions. Mol. Biol. Cell 12, 2328e2340. Shav-Tal, Y., Zipori, D., 2002. PSF and p54(nrb)/NonOemulti-functional nuclear proteins. FEBS Lett. 531, 109e114. Sherr, C.J., 2004. Principles of tumor suppression. Cell 116, 235e246. Song, X., Sui, A., Garen, A., 2004. Binding of mouse VL30 retrotransposon RNA to PSF protein induces genes repressed by PSF: effects on steroidogenesis and oncogenesis. Proc. Natl. Acad. Sci. USA 101, 621e626. Song, X., Sun, Y., Garen, A., 2005. Roles of PSF protein and VL30 RNA in reversible gene regulation. Proc. Natl. Acad. Sci. USA 102, 12189e12193. Song, X., Wang, B., Bromberg, M., Hu, Z., Konigsberg, W., Garen, A., 2002. Retroviral-mediated transmission of a mouse VL30 RNA to human
188
C.-F. Wu et al. / Journal of Genetics and Genomics 40 (2013) 179e188
melanoma cells promotes metastasis in an immunodeficient mouse model. Proc. Natl. Acad. Sci. USA 99, 6269e6273. Sutherland, L.C., Rintala-Maki, N.D., White, R.D., Morin, C.D., 2005. RNA binding motif (RBM) proteins: a novel family of apoptosis modulators? J. Cell. Biochem. 94, 5e24. Urban, R.J., Bodenburg, Y., Kurosky, A., Wood, T.G., Gasic, S., 2000. Polypyrimidine tract-binding protein-associated splicing factor is a negative regulator of transcriptional activity of the porcine p450scc insulin-like growth factor response element. Mol. Endocrinol. 14, 774e782.
van der Houven van Oordt, C.W., Schouten, T.G., van der Eb, A.J., Breuer, M.L., 1999. Differentially expressed transcripts in X-ray-induced lymphomas identified by dioxygenin-labeled differential display. Mol. Carcinog. 24, 29e35. Wang, G., Cui, Y., Zhang, G., Garen, A., Song, X., 2009. Regulation of protooncogene transcription, cell proliferation, and tumorigenesis in mice by PSF protein and a VL30 noncoding RNA. Proc. Natl. Acad. Sci. USA 106, 16794e16798. Whitfield, M.L., George, L.K., Grant, G.D., Perou, C.M., 2006. Common markers of proliferation. Nat. Rev. Cancer 6, 99e106.
Journal of Genetics and Genomics 40 (2013) 179e188
JGG ORIGINAL RESEARCH
The Non-Coding RNA Llme23 Drives the Malignant Property of Human Melanoma Cells Chuan-Fang Wu a,1, Guang-Hong Tan b,1, Cheng-Chuan Ma a, Ling Li a,* a
Center for Functional Genomics and Bioinformatics, Ministry of Education, Key Laboratory for Bio-Resource and Eco-Environment, College of Life Science, Sichuan University, Chengdu 610064, China b Hainan Provincial Key Laboratory of Tropical Medicine, Hainan Medical College, Haikou 571101, China Received 17 October 2012; revised 25 February 2013; accepted 1 March 2013 Available online 8 March 2013
ABSTRACT Several lines of evidence support the notion that increased RNA-binding ability of polypyrimidine tract-binding (PTB) proteinassociated splicing factor (PSF) and aberrant expression of long non-coding RNAs (lncRNAs) are associated with mouse and human tumors. To identify the PSF-binding lncRNA involved in human oncogenesis, we screened a nuclear RNA repertoire of human melanoma cell line, YUSAC, through RNA-SELEX affinity chromatography. A previously unreported lncRNA, termed as Llme23, was found to bind immobilized PSF resin. The specific binding of Llme23 to both recombinant and native PSF protein was confirmed in vitro and in vivo. The expression of PSF-binding Llme23 is exclusively detected in human melanoma lines. Knocking down Llme23 remarkably suppressed the malignant property of YUSAC cells, accompanied by the repressed expression of proto-oncogene Rab23. These results may indicate that Llme23 can function as an oncogenic RNA and directly associate the PSF-binding lncRNA with human melanoma. KEYWORDS: LncRNA; Llme23; PSF; Melanoma; Rab23
INTRODUCTION Long non-coding RNAs (lncRNAs) are non-coding transcripts with a size larger than 200 nucleotides (nt) (Mercer et al., 2009; Ponting et al., 2009). Although the particular function and mechanism of lncRNAs in human physiological and pathological processes are not well understood, it seems to be unlikely that lncRNAs are functionally inert, because of their apparent development-dependent and tissue-specific expression patterns (Okazaki et al., 2002; Kapranov et al., 2005, 2007). A selective group of tumor-suppressor proteins (TSPs) function in oncogenesis by binding the proto-oncogenes and repressing their transcription (Hahn and Weinberg, 2002; Sherr, 2004). Polypyrimidine tract-binding (PTB) protein* Corresponding author. Tel/fax: þ86 28 8541 8926. E-mail address: [email protected] (L. Li). 1 These authors contributed equally to this work.
associated splicing factor (PSF), which contains one DNA binding domain (DBD) and two RNA binding domains (RBDs), was originally isolated from the splicesome and was thought to play roles in RNA splicing via its RBDs (Patton et al., 1993; Urban et al., 2000; Peng et al., 2002; Shav-Tal and Zipori, 2002). Subsequent studies showed that PSF can function as a TSP by repressing the transcription of protooncogenes, mediated by the binding of its DBD to the regulatory region (Song et al., 2005). The presence of RBDs in PSF is unexpected, because the DBD is sufficient for PSF to exert the tumor-suppression function. However, some studies indicated that the oncogenesis suppression activity of PSF is impaired with the enhancement of its RNA binding ability (Galietta et al., 2007; Figueroa et al., 2009). Other researches showed that the aberrant expression of lncRNAs is associated with mouse and human tumors (Anderson and Stoler, 1993; van der Houven van Oordt et al., 1999; Ji et al., 2003; Schulz, 2006; Lin et al., 2007). These findings suggest that the tumor-
1673-8527/$ - see front matter Copyright Ó 2013, Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, and Genetics Society of China. Published by Elsevier Limited and Science Press. All rights reserved. http://dx.doi.org/10.1016/j.jgg.2013.03.001
180
C.-F. Wu et al. / Journal of Genetics and Genomics 40 (2013) 179e188
suppression function of PSF, mediated by the DBD, could be neutralized by altering PSF’s RNA-binding ability and lncRNA might be involved in oncogenesis through the interplay with PSF. The direct linkage of gene transcription, PSF and lncRNA was explained by the discovery of a regulatory function of the RBDs in PSF, which involves the binding of VL30-1, a mouse retrotransposon lncRNA (French and Norton, 1997), to form a PSF-RNA complex that dissociates from a repressed gene and reverses the transcriptional repression (Song et al., 2002, 2004; Wang et al., 2009). Mouse and human PSF proteins share about 95% similarity at the amino acid levels. Because the VL30-1 is not found in human genome, it is likely that some other lncRNA is carrying out the function of VL30-1 in human cells. Here we reported the screening of a nuclear RNA repertoire of human melanoma line by RNA-SELEX affinity chromatography and the identification of a previously unreported human PSF-binding lncRNA, termed as Llme23. The expression of Llme23 is exclusively detectable in human melanoma lines. Our study provided evidence that Llme23 is involved in the etiology of human melanoma. RESULTS Recombinant His-tagged PSF protein and nuclear extract After IPTG induction, Escherichia coli cells harboring the pET28a-PSF plasmid was lysed by pulse sonication. SDSPAGE of the lysate supernatant showed an intense band at 100 kDa, corresponding to the predicted molecular weight of His-tagged PSF protein (Fig. 1A). The recombinant protein was purified by affinity chromatography and characterized by Western blot using anti-PSF monoclonal antibody. As shown in Fig. 1B, the band cross reacted with anti-PSF antibody had the expected molecular weight. These results demonstrated
Fig. 1. Recombinant His-tagged PSF and nuclear extract from YUSAC cells. A: His-tagged PSF induced by IPTG. Lane 1: protein marker; lane 2: lysate supernatant of E. coli (BL21) harboring pET-28a-PSF without IPTG induction; lane 3: lysate supernatant of E. coli (BL21) harboring pET-28a-PSF induced by IPTG. The arrow indicates the induced PSF recombinant protein. B: purified His-tagged PSF by affinity chromatography. Lane 1: protein marker; lane 2: purified protein product; lane 3: Western blot of the purified His-tagged PSF with anti-PSF antibody. C: nuclear extract from the YUSAC cells. Lane 1: protein marker; lane 2: nuclear extract from the YUSAC cells; lane 3: Western blot of native PSF contained in the nuclear extract.
that His-tagged PSF protein can be expressed in E. coli as a soluble form and purified to near homogeneity by one step affinity chromatography. Additionally, native PSF from the nuclear extract of YUSAC cells was also detectable by Western blot (Fig. 1C). Identification of a PSF-binding lncRNA from YUSAC cells Mouse VL30-1 lncRNA binds to PSF and functions in cell proliferation and oncogenesis. The absence of VL30-1 from human genome prompts the search for the human PSF-binding lncRNAs. A cDNA library encoding the nuclear RNAs of human melanoma line YUSAC was used to synthesize a panel of the RNA repertoire. After six cycles of RNA-SELEX affinity chromatograph, the RNAs bound to the immobilized His-tagged PSF were eluted from the immobilized PSF matrices and analyzed by agarose gel electrophoresis. The eluted RNAs presented mainly as a smear on the gel, with some discrete bands (Fig. 2A). With construction of a cDNA library from the enriched PSF-binding RNAs (lane 3 in Fig. 2A), 100 clones were randomly selected and sequenced. A 239 bp cDNA insert, which maps to a region on chromosome 6 at 165,533,548e165,533,786, has not been characterized previously and contains no functional open reading frame (Fig. 2B). Molecular assays revealed that this RNA, termed as Llme23, is a polyadenylated transcript with the size around 1600 nt (Fig. 2C and D). Binding of Llme23 to PSF in vitro and in vivo Recombinant PSF and PSF from the nuclear extract of YUSAC cells were used to test the binding activity of Llme23 to PSF in vitro through gel-shift and UV cross-linking assays. Result from gel-shift assay showed that the electrophoretic mobility of RNA probe was retarded significantly by the addition of recombinant PSF (Fig. 3A), and the addition of cold probe could release the radiolabeled RNA probe from recombinant PSF (Fig. 3B), indicating that Llme23 can interact with recombinant PSF in vitro. Consistent with the result from gel-shift assay, radiolabeled Llm23 RNA gave an intense band corresponding to the migration of PSF protein in UV cross-linking assay using the nuclear extract of YUSAC cells, suggesting the binding of native PSF protein to Llm23 (Fig. 3C). In addition to the test in vitro, the specific binding of Llme23 to PSF was further verified by RNAimmunoprecipitation (RIP) in vivo. Following the immunoprecipitation, the co-precipitated complex was subjected to RNA extraction and RT-PCR. As shown in Fig. 3D, Llme23 was only detectable when the antibody against PSF was used in the IP procedure, indicating that the cDNA band specifically came from the RNA sample co-precipitated with PSF protein. Moreover, the lack of amplification in the control reaction omitting the reverse transcriptase ruled out the possibility that co-precipitation product was contaminated by genome DNA.
C.-F. Wu et al. / Journal of Genetics and Genomics 40 (2013) 179e188
181
human cell lines (Fig. 4). Our data showed that Llme23 was exclusively detectable in melanoma lines, including A2058, SKmel28, YU-SIT1 and YUSAC. This finding suggests a pathological link between the Llme23 expression and human melanoma. Effect of Llme23 on the expression of proto-oncogene Rab23 The binding of VL30-1 to PSF releases PSF from mouse Rab23 and reverses the transcriptional repression by PSF (Wang et al., 2009). To study the effect of Llme23 on the expression of Rab23 human homolog, YUSAC cells were transfected with the Llme23-encoding plasmid, or with the empty pcDNA3.1 plasmid as a control. Cells were harvested 3 days after transfection, and then the RNA and protein extracts from the transfected cells were subjected to semi-quantitative RT-PCR and Western blot, respectively. As shown in Fig. 5A and B, the expression level of Rab23 is up-regulated by the overexpression of Llme23. In contrast, the depletion of endogenous Llme23 by RNAi repressed the expression of Rab23 (Fig. 5CeE). Effect of Llme23 on the malignant property of YUSAC cells
Fig. 2. Identification of a previously unreported PSF-binding lncRNA Llme23 by RNA-SELEX. A: selection of PSF-binding RNAs by RNA-SELEX affinity chromatography. Lane 1: RNA selected by one cycle of RNA-SELEX; lane 2: RNA selected by three cycles of RNA-SELEX; lane 3: RNA selected by six cycles of RNASELEX. B: location of Llme23 in human genome. The genomic region mapped by Llme23 does not encode any previously identified EST. C: Northern blot confirming Llme23 transcript. Llme23-specific anti-sense (AS-probe) and sense (S-probe) probes were used in Northern blot respectively. D: Llme23 is confirmed to be a polyadenylated transcript by RT-PCR. RT-PCR reaction omitting reverse transcriptase (RTase) was used as the negative control, and RT-PCR reaction initiated by random hexamers (RP6) was used as the positive control.
To confirm that the binding to PSF is specific for Llme23, the abundant b-actin mRNA was also analyzed by RT-PCR. As shown in Fig. 3D, although the b-actin band was easily amplified from the input sample, it was not detectable in various co-precipitation products. Taken together, our data impartially demonstrated that Llme23 specifically binds to PSF. Exclusive expression of Llme23 in human melanoma lines Because Llme23 was identified from human melanoma line YUSAC, it is likely that Llme23 functions in the etiology of human melanoma. To address this question, RT-PCR was applied to measure the expression level of Llme23 in various
Due to its exclusive expression in human melanoma lines and its ability to control the expression of proto-oncogene, the oncogenic role of Llme23 was further analyzed in YUSAC cells. As shown in Fig. 6, YUSAC cells expressing low level of Llme23, compared to the control YUSAC cells, exhibited weaker competency in forming colonies and tumors. DISCUSSION Because PSF protein is highly conserved from human to mice and the human homolog of VL30-1 is not found in human genome, it is of great interest to identify the lncRNA that is the functional equivalent of the mouse VL30-1 lncRNA. RNA-SELEX affinity chromatography was applied to select the human PSF-binding lncRNAs from the nuclear RNA repertoire of human melanoma line YUSAC. RNA-SELEX is a high performance procedure which can enrich the PSFbinding RNAs and subtract noisy transcripts. This was revealed by the agarose gel pattern of selected RNA product that was visualized as a smear containing some discrete bands (Fig. 2A). With the completion of sequencing and screening for vector contamination, containing no functional open reading frame was raised as a criterion to refine the selected RNAs. These procedures got a lncRNA previously unreported, which was termed Llme23. Although a method of RACE failed to get the full-length Llme23 because the RACE products were visualized as smear but not specific amplicon (data not shown), Llme23 transcript with the size of round 1600 nt was confirmed by Northern blot (Fig. 2C). Furthermore, the specific amplification band can be produced from cDNA reverse transcribed by oligo(dT)18 (Fig. 2D), indicating that
182
C.-F. Wu et al. / Journal of Genetics and Genomics 40 (2013) 179e188
Fig. 3. Binding of Llme23 to PSF protein. A: binding of Llme23 to PSF tested by gel-shift assay in vitro. B: cold probe releases the radiolabeled RNA probe from PSF. The molar ratio of cold RNA probe to radiolabeled RNA probe was 1, 3 and 10. C: binding of Llme23 to PSF tested by UV cross-linking assay in vitro. Nuclear extract from YUSAC cells was tested. A purified recombinant PSF was also assayed to show that the arrow pointed band is located at the predicted position of PSF. D: binding of Llme23 to PSF tested by RIP assay in vivo. The PAb (positive antibody) indicates anti-PSF antibody, and the NAb (negative antibody) indicates the anti-mouse IgG antibody.
Llme23 should belong to a mRNA-like lncRNA. Results from the gel-shift and UV cross-linking assays verified that Llme23 can bind to recombinant and native PSF proteins in vitro (Fig. 3AeC). The RNA-protein binding in living cells was further confirmed by RIP (Fig. 3D). In the UV cross-linking assay, an intense band was observed at the predicted position of PSF. Noticeably, some other bands were also detected (Fig. 3C). Because PSF interacts with many proteins and is thought to be a component of several nuclear complexes, such as nuclear speckles and paraspeckles (Bond and Fox, 2009; Clemson et al., 2009), it is likely that the bands larger than PSF are those PSF-containing macromolecular complexes binding to Llme23. Alternatively, it is feasible that Llme23 is a promiscuous lncRNA that also binds to RBD-containing proteins other than PSF.
Fig. 4. Expression level of Llme23 in different human cell lines. Lane1: BJ, human fibroblast line; lane 2: HEK293, human embryonic kidney line; lanes 3e6: A2058, YU-SIT1, YUSAC and Skmel28, human melanoma lines; lane 7: MCF10A, human mammary epithelium line; lanes 8 and 9: MCF7 and MDA-MB-231, human breast cancer lines; lane 10: L02, human hepatocyte line; lanes 11e14: SMMC-7402, SMMC-7721, HU-7 and HepG2, human hepatocellular carcinoma lines; lane 15: HCT116, human rectal cancer line; lanes 16 and 17: A549 and H292, human lung cancer lines. The RT-PCR test for Llme23 was performed by 30 cycles of amplification. Although more than 40 cycles of amplification was performed, Llme23 was undetectable in cell lines showed in lanes 1, 2, and 7e17 (data not shown).
A screen of several human normal and tumor lines showed that Llme23 is exclusively expressed in human melanoma lines (Fig. 4), indicating an association of Llme23 expression with the etiology of human melanoma. Depletion of endogenous Llme23 was carried out by stably transfecting YUSAC cells with a plasmid encoding Llme23-specific shRNA (Fig. 5CeE). The results from colony formation assay and in vivo tumor growth showed that YUSAC-shLlme23 cells, compared to YUSAC-shLUC cells, present the significant growth defects (Fig. 6). These results further suggest that PSFbinding Llme23 plays an oncogenic role in human melanoma. Earlier studies showed that PSF represses the transcription of mouse proto-oncogene Rab23 by selectively binding to a 237 bp sequence at its regulatory region (Wang et al., 2009). The identification of a conserved PSF-targeting sequence embedded in the promoter region of human Rab23 suggests that Rab23 might be the target gene for PSF in human cells. Indeed, the increased Llme23 level up-regulated Rab23 expression, and the decreased Llme23 level down-regulated Rab23 expression (Fig. 5). These results indicate that the activation of proto-oncogene is involved in the oncogenic role of PSF-binding Llme23. Development of human cancer is a multistep process governed by a series of genetic and cellular principles (Hahn and Weinberg, 2002; Whitfield et al., 2006). PSF is a multifunctional protein and its RNA-binding behavior has already been implicated in a variety of cellular processes including proliferation, differentiation, regulation of cell cycle and apoptosis (Chanas-Sacre et al., 1999; Shav-Tal et al., 2001; Shav-Tal and Zipori, 2002; Rosonina et al., 2005; Sutherland et al., 2005;
C.-F. Wu et al. / Journal of Genetics and Genomics 40 (2013) 179e188
183
Fig. 5. Effect of Llme23 on the expression of proto-oncogene Rab23. A: up-regulated transcription of Rab23 by increased amount of Llme23. b-actin mRNA was used to normalize the total RNA in samples. Lane 1: YUSAC-pcDNA 3.1; lane 2: YUSAC-Llme23. B: up-regulated translation of Rab23 by increased amount of Llme23. The cells for lanes 1 and 2 are the same as A. C: down-regulated transcription of Rab23 by decreased amount of Llme23. YUSAC cells were stably transfected with a plasmid encoding a luciferase shRNA (YUSAC-shLUC) or a specific shRNA that initiates degradation of Llme23 by RNAi (YUSAC-shLlme23a and YUSAC-shLlme23b). Lane 1: YUSAC-shLUC; lane 2: YUSACshLlme23a; lane 3: YUSAC-shLlme23b. The real-time RT-PCR data for the transcriptional levels of Llme23, PSF and Rab23 are also showed in D. E: downregulated translation of Rab23 by decreased amount of Llme23. The cells for lanes 1e3 are the same as C.
Figueroa et al., 2009; Lukong et al., 2009). We speculate that the interplay between Llme23 and PSF also affects certain PSF-associated cellular processes in addition to the regulation on proto-oncogene expression. Additionally, the details underlying the binding of Llme23 to proteins other than PSF, as shown in Fig. 3C, remain to be further addressed. In summary, the research reported here provides a new insight on the pathological role of PSF-binding lncRNA in human cancer. The etiological involvement of Llme23 in human melanoma is supported by two lines of evidence: the apparent melanoma-specific expression pattern and its contribution to maintain the malignant property of melanoma cell. Although the molecular details have yet to be studied, our present data reveal that PSF-binding Llme23 can function as a tumor activator in human melanoma, partially mediated by reversing repression of proto-oncogene by PSF.
(pH 7.9), 20% glycerol, 100 mmol/L KCl, 0.2 mmol/L EDTA, 0.2 mmol/L PMSF and 0.5 mmol/L DTT) and stored at 80 C. Cell culture Human fibroblast line BJ, human mammary epithelium line MCF10A, human hepatocyte line L02, human embryonic kidney line 293 (HEK293), human melanoma lines A2058, SKmel28, YU-SIT1 and YUSAC, human hepatocellular carcinoma lines SMMC-7402, SMMC-7721, HU-7 and HepG2, human breast cancer lines MCF7 and MDA-MB-231, human rectal cancer line HCT116, and human lung cancer lines A549 and H292 were cultured in DMEM or RPMI 1640 medium supplemented with 10% FBS in a 5% CO2 incubator at 37 C. Production of nuclear lysate
MATERIALS AND METHODS Production of recombinant His-tagged PSF protein His-tagged human PSF was produced from E. coli BL21 (DE3) transformed with pET28a-PSF plasmid. Transformed E. coli was cultured in LB medium supplemented with 50 mg/mL kanamycin at 37 C until OD600 reached 0.6. The temperature was then decreased to 25 C and induced by 1 mmol/L IPTG overnight. E. coli was lysed using pulse sonication for 5 min followed by 30 min centrifugation at 13,000 g. His-tagged PSF contained in the supernatant was purified using TALON metal affinity resin (BD Clontech, USA) following the manufacturer’s protocol. The purified protein was dialyzed against a 50-fold volume of dialysis buffer (20 mmol/L Hepes
Cultures of the YUSAC cells were grown to about 70% confluence, washed twice with PBS, removed from the plastic substrate by scraping in PBS, and pelleted by centrifugation. The cell pellets were resuspended in a hypotonic buffer (10 mmol/L Hepes (pH 7.9), 1.5 mmol/L MgCl2, 10 mmol/L KCl, 0.2 mmol/L PMSF and 0.5 mmol/L DTT) and disrupted by 20 strokes of a Dounce homogenizer. The nuclei were pelleted by centrifugation for 5 min at 3300 g, equilibrated for 30 min in extraction buffer (20 mmol/L Hepes (pH 7.9), 25% glycerol, 1.5 mmol/L MgCl2, 0.6 mol/L KCl, 0.2 mmol/L EDTA, 0.2 mmol/L PMSF and 0.5 mmol/L DTT) with continuous gentle mixing, and centrifuged at 25,000 g for 30 min. The supernatant was dialyzed against a 50-fold volume of dialysis buffer and the dialyzate was centrifuged at 25,000 g for 20 min.
184
C.-F. Wu et al. / Journal of Genetics and Genomics 40 (2013) 179e188
Fig. 6. Effect of Llme23 on malignant property of YUSAC cells. A: colony formation in soft agar. 1 104 cells were mixed with 0.3% agar in culture medium. After 4 weeks of incubation at 37 C in a 5% CO2 incubator, colonies were counted. Representative phase contrast images are shown. The data are represented as the average number of colonies per plate determined from three separate experiments. *P < 0.01, significantly different from control. B: tumor formation in nude mice. For each cell line, three mice were injected on bilateral sides of the neck, using 2 106 cells on each side. Proliferation and oncogenicity of injected cells were assessed by calculating tumor volume every 3 days. The finally formed tumors are shown, and the average volume of the tumors on each day is shown in the curves. The error bars are the SE (n ¼ 6).
C.-F. Wu et al. / Journal of Genetics and Genomics 40 (2013) 179e188
The supernatant was stored at 80 C and used as the nuclear lysate.
185
enriched PSF-binding RNAs. And then, the obtained cDNA clones were subjected to sequencing, screening for vector contamination, and the subsequent analysis.
Western blot Northern blot Protein sample was fractionated by 7.5% (w/v) SDS-PAGE and electronically transferred to a PVDF membrane at 100 V for 1 h. The membrane was rinsed with PBST buffer, blocked for 2 h in PBST containing 5% non-fat milk, and incubated with mouse anti-PSF monoclonal antibody (Sigma, USA) or rabbit anti-RAB23 polyclonal antibody (Abcam, UK) for 1 h. The membrane was washed with PBST and then incubated for 1 h with HRP-conjugated anti-mouse or anti-rabbit IgG. Blots were visualized using an ECL detection kit (Amersham Pharmacia Biotech, USA) and exposed to X-ray film. Selection of human nuclear RNAs binding to PSF protein Nuclei of YUSAC cells were prepared as described above and were used to isolate nuclear RNA using TRIzol reagent (Invitrogen, USA). The first-strand cDNA was synthesized from 20 mg of nuclear RNA in a 40 mL reaction volume containing 10 mL of random hexamers (10 mmol/L), 8 mL of 5 reaction buffer, 1 mL of RNaseOUT recombinant ribonuclease inhibitor (40 U/mL, Invitrogen), 3 mL of dNTP mix (10 mmol/L each), 4 mL of 0.1 mol/L DTT, and 1 mL of SuperScript II reverse transcriptase (200 U/mL, Invitrogen). Double-stranded cDNA (ds-cDNA) was synthesized from the purified single-stranded cDNA in a 20 mL reaction volume containing 4 mL of 5 reaction buffer, 3 mL of dNTP mix, 1 mL of DNA polymerase Ⅰ (10 U/mL, NEB, USA), and 0.1 mL of RNase H (2 U/mL, Invitrogen). Following the doublestranded cDNA synthesis, blunt-end ds-cDNA was produced using Pfu DNA polymerase (Promega, USA) and then cloned into the PCR-blunt-TOPO vector (Invitrogen) to construct a cDNA library encoding the total nuclear RNA repertoire. The cDNA inserts included in the library were linearized by PCR using M13 forward and reverse primers mapped to the matching sequences within PCR-blunt-TOPO vector, and the encoded RNAs were synthesized using T7 RNA polymerase. A 200 mg of RNAs were incubated with 10 mg of His-tagged PSF in binding buffer (10 mmol/L Hepes (pH 7.6), 5 mmol/L MgCl2, 1 mmol/L DTT, 100 mmol/L KCl, 6% glycerol and 80 mg/mL poly(dI-dC)) and gently mixed at 4 C for 3 h to form the RNA-PSF complexes. The complexes were then collected, through the His-tag residing at the N-terminal of recombinant PSF, on affinity resin pre-equilibrated with binding buffer, and the collected RNA components were isolated using TRIzol reagent. The single-stranded cDNA corresponding to the collected RNA by the first cycle of SELEX was synthesized by reverse transcription using M13 reverse oligonucleotide. Following the ds-cDNA synthesis and endfilling as described above, the end-blunt ds-cDNA was cloned into PCR-blunt-TOPO vector. The selection procedure was repeated for five additional cycles, and the final cDNA product was cloned to construct a cDNA library encoding the
Total RNA of 20 mg purified from YUSAC cells was used for a Northern blot assay. To prepare the probes, synthetic oligonucleotides were end-labeled by T4 polynucleotide kinase in the presence of g-32P-ATP, and then purified by DNA probe purification kit (OMEGA, USA). The antisense and sense oligonucleotides were 50 -CACAGGACCTCTGAAAG AGAAAGCTCATCTAGC-30 and 50 -GCTAGATGAGCTTTC TCTTTCAGAGGTCCTGTG-30 . Following formaldehyde gel electrophoresis, electroblotting and immobilization by UV cross-linking, Northern blot was performed at a hybridization temperature of 42 C using ULTRAhyb-Oligo buffer (Invitrogen). At last, the blot was autoradiographed by 4 days of exposure to X-ray film at 80 C. Gel-shift and UV cross-linking assays cDNA clone included in the enriched cDNA library was linearized by restriction enzyme digestion. The encoded RNA was radiolabeled by in vitro transcription in the presence of a-32P-CTP, and purified by phenol-chloroform extraction and ethanol precipitation. The RNA-protein complex was allowed to form by mixing 10 fmol of 32P-labeled RNA with protein sample in binding buffer to a final volume of 15 mL and incubating the mixture at 25 C for 20 min. In gel-shift assay, RNA probe was mixed with 50 ng of purified recombinant PSF or total extract of E. coli. After the incubation at 25 C, samples were fractionated by 4% PAGE. In competitive gelshift assay, unlabeled RNA transcript was added to the incubated RNA probe and PSF mixture. After an additional incubation at 25 C, samples were fractionated by 4% PAGE. In UV cross-linking assay, RNA probe was mixed with 50 ng of purified recombinant PSF or 500 ng of nuclear extract from YUSAC cells. After the incubation at 25 C, the reaction mixture was exposed to 254 nm light on ice for 30 min using a UV cross-linker at a distance of about 5 cm, and then treated by RNase T1 (1 U) at 25 C for 10 min and fractionated by 7.5% SDS-PAGE. At last, the gel was autoradiographed by exposure to X-ray film at 80 C. RNA co-immunoprecipitation The YUSAC cells were cultured in 100-mm plates to about 70% confluence, crosslinked with 1% formaldehyde for 20 min at 25 C, washed and harvested from the plastic substrate by scraping in PBS. Cells were resuspended in 200 mL of Buffer A (5 mmol/L PIPES (pH 8.0), 85 mmol/L KCl, 0.5% NP40, 1 Roche protease inhibitors cocktail and 50 U/mL SUPERase-in) and incubated on ice for 10 min. The crude nuclei fraction was pelleted by centrifugation at 5000 r/min for 5 min at 4 C. The pellet was washed once in Buffer A without NP40, resuspended in 500 mL of Buffer B
186
C.-F. Wu et al. / Journal of Genetics and Genomics 40 (2013) 179e188
(1% SDS, 10 mmol/L EDTA, 50 mmol/L Tris-HCl (pH 8.1), 1 Roche protease inhibitors cocktail and 50 U/mL SUPERase-in) and then incubated on ice for 10 min. Lysates were homogenized by sonication, and cleared by centrifugation at 16,000 g for 10 min at 4 C. The sonicate was diluted 10-fold into IP buffer (0.01% SDS, 1.1% Triton X-100, 1.2 mmol/L EDTA, 16.7 mmol/L Tris-HCl (pH 8.1), 167 mmol/L NaCl, 1 Roche protease inhibitors cocktail and 50 U/mL SUPERase-in) to a final volume of 1 mL. The diluted sonicate was incubated with 3 mg of anti-PSF monoclonal antibody and immune complexes were allowed to form by slow mixing on a rotating platform at 4 C overnight. A 50 mL of protein A agarose beads (Invitrogen) were then added and slow mixing rotation continued for 2 h at 4 C. Beads were washed with low-salt buffer (0.1% SDS, 1% Triton X-100, 2 mmol/L EDTA, 20 mmol/L Tris-HCl (pH 8.1) and 150 mmol/L NaCl), high-salt buffer (the same with the component of low-salt buffer except 500 mmol/L NaCl), LiCl buffer (0.25 mol/L LiCl, 1% NP40, 1% deoxycholate, 1 mmol/ L EDTA and 10 mmol/L Tris-HCl (pH 8.1)), and TE buffer, respectively. And then, immune complexes were eluted by addition of 250 mL of fresh elution buffer (1% SDS, 0.1 mol/L NaHCO3 and 50 U/mL SUPERase-in). NaCl was added to a final concentration of 200 mmol/L and then placed at 65 C for 3 h to reverse crosslinking. Nucleic acid was extracted by TRIzol reagent, ethanol-precipitated with Glycoblue (Invitrogen) as a carrier, and treated with DNaseⅠ (Promega). Following another TRIzol extraction and ethanol precipitation, the recovered RNAs were detected by standard RT-PCR protocol. The primer sets were as follows: (1) Llme23: forward 50 -TTTGACACGAGTGACTGTATTTTGAA-30 and reverse 50 -ATTTATGAATTGTCACAGGACCTCT-30 ; (2) b-actin: forward 50 -CTCCTCCCTGGAGAAGAGCTA-30 and reverse 50 -CCTTCTGCATCCTGTCGGCAA-30 . Plasmid-mediated RNA interference The complementary sense and anti-sense oligonucleotides were synthesized, annealed, and cloned into BamH I/Hind III sites of pGenesil-1 plasmid (Genesil Biotechnology Co., Wuhan, China). The recombinant plasmid encodes shRNA with a 19-mer stem derived from the RNA target site, and initiates the RNAi in vivo. The sense and anti-sense oligonucleotides encoding Llme23-specific shRNA constructions were 50 -GATCCTGGTCTTCCTCAGCTCCATTTCAAGAG AATGGAGCTGAGGAAGACCATTTTTTA-30 and 50 -AGC TTAAAAAATGGTCTTCCTCAGCTCCATTCTCTTGAAAT GGAGCTGAGGAAGACCAG-30 , 50 -GATCCTTCCTACTTA AGCTAGATGTTCAAGAGACATCTAGCTTAAGTAGGAAT TTTTTA-30 and 50 -AGCTTAAAAAATTCCTACTTAAGCTA GATGTCTCTTGAACATCTAGCTTAAGTAGGAAG-30 , and the recombinant plasmids were termed as pGenesil-shLlme23a and pGenesil-shLlme23b. The sense and anti-sense oligonucleotides encoding luciferase-specific shRNA construction were 50 -GATCCGTAGCGCGGTGTATTATACTTCAAGAG AGTATAATACACCGCGCTACTTTTTTA-30 and 50 -AGCT TAAAAAAGTAGCGCGGTGTATTATACTCTCTTGAAGTA
TAATACACCGCGCTACG-30 , and the recombinant plasmid was termed as pGenesil-shLUC. To construct YUSAC lines expressing low level of Llme23 (YUSAC-shLlme23a and YUSAC-shLlme23b), YUSAC cells were transfected with the plasmid pGenesil-shLlme23a or pGenesil-shLlme23b, and then selected with 800 mg/mL G418. The control cell line (YUSAC-shLUC) was obtained by transfecting YUSAC cells with plasmid pGenesil-shLUC. The transfection reagent Lipofectamine 2000 (Invitrogen) was used for all transfections, and the transcription level of the target RNA was assayed by semi-quantitative and real-time RT-PCR. Semi-quantitative RT-PCR Cultures of the cells were grown to about 70% confluence in 6-well plates and were used to isolate total RNA by TRIzol reagent. The cDNAs were synthesized from the RNAs using random hexamers. The human cell lines listed above were tested for transcription level of Llme23, and the transfected cells were tested to investigate the effect of Llme23 on Rab23 transcription. The sense and anti-sense primer sets were as follows: (1) Llm23: 50 -TTTGACACGAGTGACTGTATTTTGAA-30 and 50 -ATTTATGAATTGTCACAGGACCTCT-30 ; (2) Rab23: 50 -C ATCTAACACCTTTTGCTGCTCA-30 and 50 -ATGATTCTGT ATGTGGGACTGAC-30 ; (3) PSF: 50 -GCGGAGGAGCAATG AACATGGGA-30 and 50 -CACTTCCCATCATGGAACCAC TC-30 ; (4) b-actin: 50 -CTCCTCCCTGGAGAAGAGCTA-30 and 50 -CCTTCTGCATCCTGTCGGCAA-30 . Real-time RT-PCR Cell culture and cDNA synthesis were performed as described above, and the PCR assay was performed using 2 Bio-Rad EvaGreen Supermix on a Bio-Rad CFX96 (USA). All reactions were done in a 10 mL reaction volume in triplicate. The specificity of amplification was verified by melt-curve analysis and agarose gel electrophoresis, and the data were collected and analyzed using Bio-Rad CFX Manager software. The relative amount of target gene RNA was normalized to a b-actin mRNA standard. All the primers used here were the same as those of semi-quantitative RT-PCR. Colony formation in soft-agar Cells were suspended in 1 mL of 0.3% melted agar in DMEM supplemented with 10% FBS and plated in 6-well plates overlayed with 0.5% agar in the same medium. The resulting colonies were scored and photographed using phase contrast microscope. Tumor formation in nude mice Cells were detached from the culture plates by a brief incubation with 2 mmol/L EDTA in PBS, suspended in DMEM supplemented with 10% FBS, washed, and resuspended in PBS. Six-week-old nude mice were anesthetized and injected subcutaneously into bilateral sites on the neck
C.-F. Wu et al. / Journal of Genetics and Genomics 40 (2013) 179e188
with cells in 0.1 mL PBS using a 25-guage needle. The diameters of the resulting tumors were measured every 3 days, and the tumor volume was calculated by the formula (ab2)/2, in which “a” is the longest diameter and “b” is the shortest diameter of the tumor. The mice were sacrificed at the end of the experiment, and the tumors were photographed.
ACKNOWLEDGEMENTS This work was supported by the grants from the National Natural Science Foundation of China (Nos. 31000579 and 30971634), the Provincial Natural Science Foundation of Hainan of China (No. 310045), the Ph.D. Programs Foundation of the Ministry of Education of China (No. 20090181120076), and the Provincial Youth Science and Technology Innovation Team Foundation of Sichuan of China (No. 2011JTD0026). REFERENCES Anderson, G.R., Stoler, D.L., 1993. Anoxia, wound healing, VL30 elements, and the molecular basis of malignant conversion. Bioessays 15, 265e272. Bond, C.S., Fox, A.H., 2009. Paraspeckles: nuclear bodies built on long noncoding RNA. J. Cell Biol. 186, 637e644. Chanas-Sacre, G., Mazy-Servais, C., Wattiez, R., Pirard, S., Rogister, B., Patton, J.G., Belachew, S., Malgrange, B., Moonen, G., Leprince, P., 1999. Identification of PSF, the polypyrimidine tract-binding protein-associated splicing factor, as a developmentally regulated neuronal protein. J. Neurosci. Res. 57, 62e73. Clemson, C.M., Hutchinson, J.N., Sara, S.A., Ensminger, A.W., Fox, A.H., Chess, A., Lawrence, J.B., 2009. An architectural role for a nuclear noncoding RNA: NEAT1 RNA is essential for the structure of paraspeckles. Mol. Cell 33, 717e726. Figueroa, A., Fujita, Y., Gorospe, M., 2009. Hacking RNA: Hakai promotes tumorigenesis by enhancing the RNA-binding function of PSF. Cell Cycle 8, 3648e3651. French, N.S., Norton, J.D., 1997. Structure and functional properties of mouse VL30 retrotransposons. Biochim. Biophys. Acta 1352, 33e47. Galietta, A., Gunby, R.H., Redaelli, S., Stano, P., Carniti, C., Bachi, A., Tucker, P.W., Tartari, C.J., Huang, C.J., Colombo, E., Pulford, K., Puttini, M., Piazza, R.G., Ruchatz, H., Villa, A., Donella-Deana, A., Marin, O., Perrotti, D., Gambacorti-Passerini, C., 2007. NPM/ALK binds and phosphorylates the RNA/DNA-binding protein PSF in anaplastic large-cell lymphoma. Blood 110, 2600e2609. Hahn, W.C., Weinberg, R.A., 2002. Rules for making human tumor cells. N. Engl. J. Med. 347, 1593e1603. Ji, P., Diederichs, S., Wang, W., Boing, S., Metzger, R., Schneider, P.M., Tidow, N., Brandt, B., Buerger, H., Bulk, E., Thomas, M., Berdel, W.E., Serve, H., Muller-Tidow, C., 2003. MALAT-1, a novel noncoding RNA, and thymosin beta4 predict metastasis and survival in early-stage nonsmall cell lung cancer. Oncogene 22, 8031e8041. Kapranov, P., Cheng, J., Dike, S., Nix, D.A., Duttagupta, R., Willingham, A.T., Stadler, P.F., Hertel, J., Hackermuller, J., Hofacker, I.L., Bell, I., Cheung, E., Drenkow, J., Dumais, E., Patel, S., Helt, G., Ganesh, M., Ghosh, S., Piccolboni, A., Sementchenko, V., Tammana, H., Gingeras, T.R., 2007. RNA maps reveal new RNA classes and a possible function for pervasive transcription. Science 316, 1484e1488. Kapranov, P., Drenkow, J., Cheng, J., Long, J., Helt, G., Dike, S., Gingeras, T.R., 2005. Examples of the complex architecture of the human transcriptome revealed by RACE and high-density tiling arrays. Genome Res. 15, 987e997.
187
Lin, R., Maeda, S., Liu, C., Karin, M., Edgington, T.S., 2007. A large noncoding RNA is a marker for murine hepatocellular carcinomas and a spectrum of human carcinomas. Oncogene 26, 851e858. Lukong, K.E., Huot, M.E., Richard, S., 2009. BRK phosphorylates PSF promoting its cytoplasmic localization and cell cycle arrest. Cell. Signal. 21, 1415e1422. Mercer, T.R., Dinger, M.E., Mattick, J.S., 2009. Long non-coding RNAs: insights into functions. Nat. Rev. Genet. 10, 155e159. Okazaki, Y., Furuno, M., Kasukawa, T., Adachi, J., Bono, H., Kondo, S., Nikaido, I., Osato, N., Saito, R., Suzuki, H., Yamanaka, I., Kiyosawa, H., Yagi, K., Tomaru, Y., Hasegawa, Y., Nogami, A., Schonbach, C., Gojobori, T., Baldarelli, R., Hill, D.P., Bult, C., Hume, D.A., Quackenbush, J., Schriml, L.M., Kanapin, A., Matsuda, H., Batalov, S., Beisel, K.W., Blake, J.A., Bradt, D., Brusic, V., Chothia, C., Corbani, L.E., Cousins, S., Dalla, E., Dragani, T.A., Fletcher, C.F., Forrest, A., Frazer, K.S., Gaasterland, T., Gariboldi, M., Gissi, C., Godzik, A., Gough, J., Grimmond, S., Gustincich, S., Hirokawa, N., Jackson, I.J., Jarvis, E.D., Kanai, A., Kawaji, H., Kawasawa, Y., Kedzierski, R.M., King, B.L., Konagaya, A., Kurochkin, I.V., Lee, Y., Lenhard, B., Lyons, P.A., Maglott, D.R., Maltais, L., Marchionni, L., McKenzie, L., Miki, H., Nagashima, T., Numata, K., Okido, T., Pavan, W.J., Pertea, G., Pesole, G., Petrovsky, N., Pillai, R., Pontius, J.U., Qi, D., Ramachandran, S., Ravasi, T., Reed, J.C., Reed, D.J., Reid, J., Ring, B.Z., Ringwald, M., Sandelin, A., Schneider, C., Semple, C.A., Setou, M., Shimada, K., Sultana, R., Takenaka, Y., Taylor, M.S., Teasdale, R.D., Tomita, M., Verardo, R., Wagner, L., Wahlestedt, C., Wang, Y., Watanabe, Y., Wells, C., Wilming, L.G., Wynshaw-Boris, A., Yanagisawa, M., Yang, I., Yang, L., Yuan, Z., Zavolan, M., Zhu, Y., Zimmer, A., Carninci, P., Hayatsu, N., Hirozane-Kishikawa, T., Konno, H., Nakamura, M., Sakazume, N., Sato, K., Shiraki, T., Waki, K., Kawai, J., Aizawa, K., Arakawa, T., Fukuda, S., Hara, A., Hashizume, W., Imotani, K., Ishii, Y., Itoh, M., Kagawa, I., Miyazaki, A., Sakai, K., Sasaki, D., Shibata, K., Shinagawa, A., Yasunishi, A., Yoshino, M., Waterston, R., Lander, E.S., Rogers, J., Birney, E., Hayashizaki, Y., 2002. Analysis of the mouse transcriptome based on functional annotation of 60,770 full-length cDNAs. Nature 420, 563e573. Patton, J.G., Porro, E.B., Galceran, J., Tempst, P., Nadal-Ginard, B., 1993. Cloning and characterization of PSF, a novel pre-mRNA splicing factor. Genes Dev. 7, 393e406. Peng, R., Dye, B.T., Perez, I., Barnard, D.C., Thompson, A.B., Patton, J.G., 2002. PSF and p54nrb bind a conserved stem in U5 snRNA. RNA 8, 1334e1347. Ponting, C.P., Oliver, P.L., Reik, W., 2009. Evolution and functions of long noncoding RNAs. Cell 136, 629e641. Rosonina, E., Ip, J.Y., Calarco, J.A., Bakowski, M.A., Emili, A., McCracken, S., Tucker, P., Ingles, C.J., Blencowe, B.J., 2005. Role for PSF in mediating transcriptional activator-dependent stimulation of pre-mRNA processing in vivo. Mol. Cell. Biol. 25, 6734e6746. Schulz, W.A., 2006. L1 retrotransposons in human cancers. J. Biomed. Biotechnol. 2006, 83672. Shav-Tal, Y., Cohen, M., Lapter, S., Dye, B., Patton, J.G., Vandekerckhove, J., Zipori, D., 2001. Nuclear relocalization of the pre-mRNA splicing factor PSF during apoptosis involves hyperphosphorylation, masking of antigenic epitopes, and changes in protein interactions. Mol. Biol. Cell 12, 2328e2340. Shav-Tal, Y., Zipori, D., 2002. PSF and p54(nrb)/NonOemulti-functional nuclear proteins. FEBS Lett. 531, 109e114. Sherr, C.J., 2004. Principles of tumor suppression. Cell 116, 235e246. Song, X., Sui, A., Garen, A., 2004. Binding of mouse VL30 retrotransposon RNA to PSF protein induces genes repressed by PSF: effects on steroidogenesis and oncogenesis. Proc. Natl. Acad. Sci. USA 101, 621e626. Song, X., Sun, Y., Garen, A., 2005. Roles of PSF protein and VL30 RNA in reversible gene regulation. Proc. Natl. Acad. Sci. USA 102, 12189e12193. Song, X., Wang, B., Bromberg, M., Hu, Z., Konigsberg, W., Garen, A., 2002. Retroviral-mediated transmission of a mouse VL30 RNA to human
188
C.-F. Wu et al. / Journal of Genetics and Genomics 40 (2013) 179e188
melanoma cells promotes metastasis in an immunodeficient mouse model. Proc. Natl. Acad. Sci. USA 99, 6269e6273. Sutherland, L.C., Rintala-Maki, N.D., White, R.D., Morin, C.D., 2005. RNA binding motif (RBM) proteins: a novel family of apoptosis modulators? J. Cell. Biochem. 94, 5e24. Urban, R.J., Bodenburg, Y., Kurosky, A., Wood, T.G., Gasic, S., 2000. Polypyrimidine tract-binding protein-associated splicing factor is a negative regulator of transcriptional activity of the porcine p450scc insulin-like growth factor response element. Mol. Endocrinol. 14, 774e782.
van der Houven van Oordt, C.W., Schouten, T.G., van der Eb, A.J., Breuer, M.L., 1999. Differentially expressed transcripts in X-ray-induced lymphomas identified by dioxygenin-labeled differential display. Mol. Carcinog. 24, 29e35. Wang, G., Cui, Y., Zhang, G., Garen, A., Song, X., 2009. Regulation of protooncogene transcription, cell proliferation, and tumorigenesis in mice by PSF protein and a VL30 noncoding RNA. Proc. Natl. Acad. Sci. USA 106, 16794e16798. Whitfield, M.L., George, L.K., Grant, G.D., Perou, C.M., 2006. Common markers of proliferation. Nat. Rev. Cancer 6, 99e106.