The role of neuromedin U during inflammatory response in the common carp

Fish & Shellfish Immunology 32 (2012) 151e160

Contents lists available at SciVerse ScienceDirect

Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi

The role of neuromedin U during inflammatory response in the common carp Tomoya Kono a, *, Shogo Hamasuna b, Hiroki Korenaga b, Toshiyuki Iizasa a, Ryusuke Nagamine a, Takanori Ida a, Masahiro Sakai b a b

Interdisciplinary Research Organization, University of Miyazaki, 1-1 Gakuen kibanadai-nishi, Miyazaki 889-2192, Japan Department of Marine Biotechnology, Faculty of Agriculture, University of Miyazaki, 1-1 Gakuen kibanadai-nishi, Miyazaki 889-2192, Japan

a r t i c l e i n f o

a b s t r a c t

Article history: Received 12 August 2011 Received in revised form 2 November 2011 Accepted 9 November 2011 Available online 22 November 2011

In the current study, we cloned and characterized the neuromedin U (NMU) gene from the common carp Cyprinus carpio L., and identified its participation in immune responses in the teleost. Five isoforms of the preproNMU genes were generated by alternative splicing and isolated from carp. The longest form of the carp preproNMU1 (isoform 1) cDNA was composed of 803 bp, and contained an 18 bp 50 -UTR, a 212 bp 30 -UTR and a 573 bp open reading frame, which translates into a peptide comprising 190 amino acid (aa) residues. The remaining carp preproNMU isoforms were composed of 175 (preproNMU2), 158 (preproNMU3), 150 (preproNMU4) and 133 (preproNMU5) aa residues. Isoforms 1e3 contained four processing signals (KR or RR), while isoforms 4 and 5 contained only two processing signals. High homology was demonstrated among fish and other vertebral NMU at the biologically active C-terminal region (aa position 175e182). Carp preproNMU transcript variants were identified in various tissues, and the expression pattern has been shown to change depending on feeding status. Moreover, it was shown that the expression of preproNMU3 and preproNMU5 was increased following treatment with bacterial or viral mimics. Finally, we investigated the functional aspect of carp NMU using a synthetic NMU peptide. The peptide was found to increase the expression of inflammation-related cytokine genes in intestinal cells within 1 h of treatment. In addition, the activation of phagocytic cells was also stimulated by the NMU peptide. The discovery of NMU in carp allows for a further understanding of immune regulation by biologically active substances. Ó 2011 Elsevier Ltd. All rights reserved.

Keywords: Carp Neuromedin U Cloning Structural analysis mRNA expression Immune regulation Interaction with cytokines

1. Introduction Neuromedin U (NMU) is a neuropeptide that was first purified from porcine spinal cord in 1985 [1]. The first identified biological function of NMU was the control of smooth muscle contraction of the uterus and regulation of arterial blood pressure [1]. Following this initial identification and characterization of NMU, it was revealed that the peptide had various biological activities including the regulation of the stress response [2], alteration of ion transport in the jejunum [3], reduction of food intake and body weight [4] and immune regulation [5]. Recent studies regarding the role of NMU in the regulation of inflammation during immune response have shown that its regulation is under the control of cytokine release [6e8].

Abbreviations: NMU, neuromedin U; LPS, lipopolysaccharide; polyI:C, polyinosinic-polycytidylic acid; RT, reverse transcription; PCR, polymerase chain reaction; qPCR, quantitative real-time PCR. * Corresponding author. Tel./fax: þ81 985 587866. E-mail address: [email protected] (T. Kono). 1050-4648/$ e see front matter Ó 2011 Elsevier Ltd. All rights reserved. doi:10.1016/j.fsi.2011.11.004

Four molecular forms of NMU have been identified in mammals and are known as NMU-8, NMU-9, NMU-23 and NMU-25. These forms have been purified and sequenced from porcine (8 and 25) [1], dog (8 and 25) [9], pig (9) [10], rat (23) [11], rabbit (25) [12] and human (25) [13]. Among these peptides, octapeptides from porcine and dog have been shown to be generated by cleavage at a di-basic ArgeArg motif present in the longer NMU-25 form [9]. However, the source of the nonapeptides identified in the pig remains unclear, as larger NMU molecules have not been isolated. In nonmammalian species, nonapeptides have been identified in the chicken [14]. This peptide is thought to be produced independently of NMU-25, as the NMU-25 form lacks a di-basic ArgeArg cleavage motif. Among amphibian species, NMU-25 has been purified and sequenced from the frog [15]. It has also been shown that the Cterminus of the peptides from all species contains a conserved ArgeProeArgeAsneNH2 sequence that may be involved in the enhancement of NMU bioactivity [16]. The NMU gene has been recently isolated from goldfish Carassius auratus [17]. The goldfish NMU cDNA was found to encode four precursor/transcript variants that generate three NMU peptides

152

T. Kono et al. / Fish & Shellfish Immunology 32 (2012) 151e160

termed NMU-21, NMU-25 and NMU-38. Among these peptides, the henicosa peptide NMU-21 was able to potently inhibit food intake and locomotor activity. It was also shown that NMU-21 induced anorexigenic action that was mediated by the corticotrophinreleasing hormone 1/2 receptor-signalling pathway [18]. In addition, two NMU receptor genes have also been recently isolated and characterized from the goldfish [19]. Goldfish NMU receptors expressed on human embryonic kidney 293 cells responded to rat NMU-23 and goldfish NMU-21, -25, -28 but not to goldfish ghrelin. To date, studies on NMU and its receptor in teleost fish are limited to the above reports, and all other functional roles of fish NMU remain unclear. In this report, we have identified five transcriptional variants of the NMU gene expressed in the common carp, and investigated the tissue distribution of the transcriptional variants. Simultaneously, we analysed the expression of the carp NMU receptor genes to further our understanding of the ligandereceptor interaction. Next, we examined the expression of the transcriptional variants of the NMU gene by using quantitative real-time PCR (Q-PCR) to observe the involvement of NMU in intestinal cells stimulated with lipopolysaccharides (LPS), one of the most powerful bacterial virulence factors in terms of pro-inflammatory properties, or polyinosinic-polycytidylic acid (polyI:C), a substance that mimics innate immune responses elicited by viral infections. In addition, the gene expression levels of inflammatory cytokines including interleukin (IL)-1b [20], tumour necrosis factor (TNF)-a [21,22] and anti-inflammatory cytokine IL-10 [23] in intestinal cells treated with a synthetic 40-residue peptide derived from the NMU protein were analysed by Q-PCR. Finally, the activation of phagocytic cells treated with the synthetic 40-residue peptide was analysed using measurements of respiratory burst. To the best of our knowledge this is the first report to demonstrate the participation of NMU during inflammatory response in teleost fish. 2. Materials and methods 2.1. Fish maintenance and handling The common carp Cyprinus carpio L. (mean weight 100 g) was obtained from Mera Fisheries Farm (Miyazaki, Japan). The fish were firstly acclimatized in an aerated fresh water tank at 20  C and fed a commercial diet comprising min. 35% crude protein, min. 3% crude fat, max. 5% crude fibre, max. 10% moisture, max. 12% crude ash and 35% additional components (Hikari Staple, KYORIN Co. Ltd., Hyogo, Japan) at 1% body weight per day for two weeks under a natural photoperiod prior to their use in the study. For expression analysis of the NMU gene, two feeding status groups were defined in order to investigate the involvement of NMU in appetite regulation. The first group was termed hunger status, and comprised fish that were not fed for one week. The second group was termed repletion status, and comprised fish that were fed at 5% body weight per day for one week by force feeding using a disposable feeding needle (1.24  75 mm; Fuchigami, Kyoto, Japan). All experiments were conducted in accordance with the guidelines for the care and use of laboratory animals at the University of Miyazaki. 2.2. cDNA synthesis Fish were anaesthetized with 0.05% 2-phenoxyethanol (Sigma, MO, USA) and tissues, including the brain, gills, fore-gut, mid-gut, hind-gut, spleen, head kidney (HK), liver, skin and muscle, were dissected 12 h after feeding under sterile conditions. Tissues were collected from three individual fish for each feeding status group and each tissue type combined. Total RNA was then extracted using ISOGEN (Nippon Gene, Tokyo, Japan) in accordance to the manufacturer’s instructions.

Poly(A) mRNA was purified using the quick prep micro mRNA kit (Amersham Pharmacia Biotech, Uppsala, Sweden) and was treated with RNase-free DNase (Takara Bio, Shiga, Japan). cDNA was synthesized via reverse transcription from 2 mg mRNA using ReverTra Dash (Toyobo, Osaka, Japan). 2.3. Cloning and sequencing In order to isolate the carp NMU gene, we used PCR on brain cDNA prepared according to the method described above with the gzNMU Fw and Rv primers (Table 1). These primers were designed from a completely conserved region of the NMU genes identified in goldfish (Carassius auratus; AB499530) and zebrafish (Danio rerio; XM_002665712). Having isolated a partial carp NMU sequence, the 50 and 30 ends were then obtained by RACE-PCR using gene-specific primers (Table 1). For 50 -RACE, cDNA was transcribed from poly(A) mRNA using an oligo-dT primer (Invitrogen, CA, USA), treated with Escherichia coli RNase H (Promega, WI, USA), purified using a PCR purification kit (Qiagen, Netherlands) and tailed with poly(C) at the 30 end of the single strand cDNA using terminal deoxynucleotidyl transferase (TdT, Promega). PCR was then performed using Cyca NMU Rv, a carp NMU-specific reverse primer and the oligo(dG) primer (Table 1). For 30 -RACE, cDNA was transcribed from poly(A) mRNA using an oligo(dT) adapter primer (Table 1). PCR was then performed using Cyca NMU Fw (Table 1), a carp NMU-specific forward primer, and the adapter primer. PCR amplification was performed in a 50 ml reaction volume containing 5.0 ml dNTP mixture and 10 Gene Taq Universal buffer, 0.5 ml Taq polymerase (5 units/ml, Nippon Gene), 5.0 ml each primer set (F and R; 2.5 mM), 28.5 ml distilled water and 1.0 ml carp genomic DNA (300 ng). The amplification regime was 3 min at 94  C, followed by 35 cycles consisting of 94  C for 30 s, 53  C for 30 s and 72  C for 45 s. The products were cloned into the pGEM-T Easy vector (Promega) and transformed into DH5a (Promega). Recombinants were identified using red-white colour selection when grown on MacConkey agar (Sigma). Plasmid DNA from at least three independent clones was recovered using a QIAprep Spin Miniprep Kit (Qiagen) and sequenced using a CEQ 8000 Automated Sequencer (Beckman Coulter, Inc., CA, USA). Sequences generated were analysed for similarity with other known sequences using the BLAST and FASTA programs. 2.4. Structural analysis Multiple sequence alignments were generated using ClustalX version 1.81 [24] and homology analysis was performed using MatGat software version 2.02 [25]. Phylogenetic analysis was performed on the full-length amino acid sequences of the known NMU using the neighbour-joining method (NJ) [26]. MEGA4 was used to construct the tree with high confidence limits [27]. 2.5. Expression analysis in tissues (hunger and repletion) Initially, primers were designed to individually amplify the five transcript variants of the carp NMU gene analysed for the cloning step. RT-PCR with the primer combinations NMU1 (NMUex1345F-NMUex1R), NMU2 (NMUex2F-NMUex2R), NMU3 (NMUex1345F-NMUex3R), NMU4 (NMUex1345F-NMUex4R) and NMU5 (NMUex1345F-NMUex5R) (see Table 1) was performed using brain, gill, fore-gut, mid-gut, hind-gut, spleen, HK, liver, skin and muscle cDNA as prepared above (see Section 2.2). Expression in the gut and brain was confirmed in both cDNAs synthesized from mixed tissue and three individuals. Primers for the carp b-actin gene (Table 1) were used as an internal control for RT-PCR. PCR conditions were: 1 cycle at 94  C for 3 min, 40

T. Kono et al. / Fish & Shellfish Immunology 32 (2012) 151e160

153

Table 1 Primers and probes (MGB) designed for this study. Name

Sequence (50 to 30 )

Length (mer)

information

Adaptor oligo(dT) Oligo(dG) gzNMU Fw gzNMU Rv Cyca NMU Fw Cyca NMU Rv Cyca NMUex1345 F Cyca NMUex1 R Cyca NMUex2 F Cyca NMUex2 R Cyca NMUex3 R Cyca NMUex4 R Cyca NMUex5 R Cyca b-actin F Cyca b-actin R Cyca Ghrelin F Cyca Ghrelin R Cyca NMUR1 F Cyca NMUR1 R Cyca NMUR2 F Cyca NMUR2 R Cyca qNMU1 F Cyca qNMU1 R Cyca qNMU1 MGB Cyca qNMU2 F Cyca qNMU2 R Cyca qNMU2 MGB Cyca qNMU3 F Cyca qNMU3 R Cyca qNMU3 MGB Cyca qNMU4 F Cyca qNMU4 R Cyca qNMU4 MGB Cyca qNMU5 F Cyca qNMU5 R Cyca qNMU5 MGB Cyca qb-actin F Cyca qb-actin R Cyca qb-actin MGB Cyca qIL-1b F Cyca qIL-1b R Cyca qIL-1b MGB Cyca qIL-10 F Cyca qIL-10 R Cyca qIL-10 MGB Cyca qTNFa F Cyca qTNFa R Cyca qTNFa MGB

GGCCACGCGTCGACTAGTAC(Dt)17 GGGGGGIGGGIIGGGIIG GGAGGACCTGTGTTTCCTAAT TCTCGAGCTGTGATCTCCTT GCTGGGATCACTGCAAAAATC CGATTTTTGCAGTGATCCCAG TGTGCTCGTTCTACCTCTCT TGAAGGTAAGCATGCAGGATA AGATGGGACGTCTACTGTGT CTGAAGGTCAACATTTAATTTCA CACAGTAGACCTTTTGCTGAT GAAGGTCAACCGTCCCATCT AGGTCAACCCTTTTGCTGATC ACCTCATGAAGATCCTGACC TGCTAATCCACATCTGCTGG CCTCTCCTTGTGTGTTGAGT TTCTGCAGAACAGGACCATAT TCCTCTTTGAGACGGTATGTT AGCATGCAGGTGGCAGAAGT TTGGGTTCTGTCCCTGATCT TTCCAGCTGTCGTGGTTCTT TTCATTCAGACTTCATTAG CTTCCATTTCGTGGC AATGAAGTATCCTCTGCTCTGGATC GTGCAGGATTGTCAGATG CCTGAAGGTCATCATTTAATTTC CTCCTGCTTCTTCTTCTGGCAAG ACCTGTGTTTCCTAATGC CACAGTAGACCTTTTGCTG CGAGCTGTGATCTCCTCCGATT CAGGATTGTCAGATGGGA CGTGGCCGATAAATGAAG CCTCTGCTCTGGATCCGTCC ACCTGTGTTTCCTAATGC GAAGGTCATCCCTTTTGC TCGAGCTGTGATCTCCTCCG CCCATGGAGCACGGTATTG AAGGTGTGATGCCAGATCTTCTC CACCAACTGGGATGAC GCCGGTGACCCGAATGA AACGTGTGCCGGTTTCTTTC AGCCTCCTCTTCTTC CAGTGCGCAGTGCAGAAGAG CCCTCCACAAATGAGCAACA CGACTGCAAGACTG TGCTGCCGCTGCTGTCT CTCATTTCCACCTTCCTGATTGT CTTCACGCTCAACAAG

37 18 21 20 21 21 20 21 20 23 21 20 21 20 20 20 21 21 20 20 20 19 15 25 18 23 23 18 19 22 18 18 20 18 18 20 19 23 16 17 20 15 20 20 14 17 23 16

Cloning (30 -RACE) Cloning (50 -RACE) Cloning Cloning Cloning (30 -RACE) Cloning (50 -RACE) Expression analysis Expression analysis Expression analysis Expression analysis Expression analysis Expression analysis Expression analysis Expression analysis Expression analysis Expression analysis Expression analysis Expression analysis Expression analysis Expression analysis Expression analysis Expression analysis Expression analysis Expression analysis Expression analysis Expression analysis Expression analysis Expression analysis Expression analysis Expression analysis Expression analysis Expression analysis Expression analysis Expression analysis Expression analysis Expression analysis Expression analysis Expression analysis Expression analysis Expression analysis Expression analysis Expression analysis Expression analysis Expression analysis Expression analysis Expression analysis Expression analysis Expression analysis

(RT-PCR) (RT-PCR) (RT-PCR) (RT-PCR) (RT-PCR) (RT-PCR) (RT-PCR) (RT-PCR) (RT-PCR) (RT-PCR) (RT-PCR) (RT-PCR) (RT-PCR) (RT-PCR) (RT-PCR) (qPCR) (qPCR) (qPCR) (qPCR) (qPCR) (qPCR) (qPCR) (qPCR) (qPCR) (qPCR) (qPCR) (qPCR) (qPCR) (qPCR) (qPCR) (qPCR) (qPCR) (qPCR) (qPCR) (qPCR) (qPCR) (qPCR) (qPCR) (qPCR) (qPCR) (qPCR) (qPCR)

(NMU’s) or 25 (b-actin) cycles at 94  C for 30 s, 60  C for 30 s and 72  C for 45 s, followed by 1 cycle at 72  C for 5 min. The carp NMU receptor 1 (GenBank Acc. No. AB626133) and 2 (GenBank Acc. No. AB626134) genes (35 cycles, see Table 1 for primers) were also analysed to further understand the receptoreligand interaction. PCR products were separated on a 1.5% agarose gel and visualized with ethidium bromide (Sigma).

through a 40 mm nylon mesh cell strainer (Becton, Dickinson and Company, NJ, USA). The number of prepared cells was adjusted to 1  107 cells/ml, and the cells were stimulated with the bacterial mimic lipopolysaccharide (LPS; Sigma; 10 mg/ml) or the viral mimic polyI:C (Sigma; 10 mg/ml) for 0, 1, 3, 6, 9, 12 and 24 h at 22  C. The cDNA from the stimulated cells was synthesized as above (see 2.2) and diluted with 10 mM Tris buffer (pH 8.0).

2.6. Quantification of carp NMU gene expression in gut cells stimulated with bacterial or viral mimics (qPCR)

2.6.2. Quantitative real-time PCR Q-PCR on cDNA specimens was performed using the TaqMan Universal PCR Master Mix (Applied Biosystems, CA, USA). All realtime PCR was performed in a reaction mixture containing 25 ml of 2 TaqMan Universal PCR Master Mix, 5 ml of 5 mM primer set (Cyca qNMU1-Cyca qNMU5 or Cyca qb-actin), 5 ml of 2.5 mM Cyca qNMU (for each variant) MGB probe or Cyca qb-actin MGB probe (Table 1), 5 ml of template DNA (50 ng) and 5 ml of distilled water. Amplification was carried out as follows: 2 min at 50  C, 10 min at 95  C, 40 cycles of 15 s at 95  C and 60 s at 60  C. Thermal cycling and fluorescence detection was conducted using the 7300 Fast RealTime PCR System (Applied Biosystems) with detection run in

2.6.1. cDNA synthesis from stimulated tissue Gut tissue was extracted from freshly killed carp using the method outlined in Section 2.2, and the internal surface of the tissue was washed gently with sterilized PBS (Invitrogen). The washed gut tissues were then pushed through a 100 mm nylon mesh (John Staniar, Manchester, UK) with RPMI 1640 medium (Invitrogen) supplemented with 5% foetal bovine serum (FBS; Invitrogen) and 1% streptomycin/penicillin (S/P, Invitrogen). After washing with the above medium, the cells were then pushed

154

T. Kono et al. / Fish & Shellfish Immunology 32 (2012) 151e160

triplicate. The threshold cycle (CT) represents the PCR cycle at which an increase in reporter fluorescence above a baseline signal was first detected. The comparative CT method (2DDCt method) [28] was used to analyse the expression level of the carp NMU gene. All data are given in terms of relative mRNA expressed as mean  SE. Assessment of statistical significance was analysed by one-way analysis of variance (ANOVA), followed by Tukey’s test. Values were considered to be significant when P < 0.01. 2.7. Expression of inflammation-related cytokine genes in gut cells treated with NMU1 peptide 2.7.1. cDNA synthesis from treated tissue The NMU1 peptide (isoform 1, aa position 143e183) was synthesized by Operon Biotechnologies (Tokyo, Japan) with amidation of the C-terminus at HPLC >95% grade. This is the isoform which include proNMU-derived peptides (aa position 105e137) at the front of NMU and the characteristic sequences (aa position 147e161) of fish. Gut tissue was extracted using the method shown above (see Section 2.6.1) and was adjusted to 1  107 cells/ml. The cells were treated with 1 nmol/ml of NMU peptide dissolved in sterilized PBS for 0, 0.5, 1, 2, 3, 4, 8, 12 and 24 h at 22  C. After

treatment, the synthesis of cDNA from the cells was conducted as described above (see Section 2.2) and diluted with 10 mM Tris buffer (pH 8.0). 2.7.2. Quantitative real-time PCR Real-time PCR on cDNA was performed using the methods and conditions outlined in Section 2.6.2 and using the TaqMan Universal PCR Master Mix (Applied Biosystems). The primers and MGB probes specific for inflammation-related cytokine genes including IL-1b, TNF-a, IL-10 and the internal control gene bactin are presented in Table 1. The expression levels of these genes were analysed following the methods described in Section 2.6.2. 2.8. Activation of phagocytic cells by NMU peptide treatment 2.8.1. Isolation of phagocytic cells The HK phagocytic cells of carp were isolated according to the method described by Braun-Nesje et al. [29] with some minor modifications. Firstly, fish were anaesthetized with 0.05% 2phenoxyethanol (Sigma) prior to tissue collection. The cells were then removed and filtered through a 100 mm nylon mesh (John

Fig. 1. Compiled full-length carp preproNMU1 cDNA sequence. Open reading frame and 50 - and 30 -UTR are shown in upper case and lower case, respectively. The processing signals (RR/KR) and Gly residue which contribute to C-terminal amide structure are boxed and circled, respectively. Double underline indicates the mature NMU peptide sequence. In the 30 UTR the polyadenylation signals (AATAAA) is underlined. (A) nucleotide and amino acid sequences of open reading frame with 50 and 30 UTR. (B) amino acid sequence of isolated five isoforms (between 1st and 4th processing signal). Identical amino acid residues are indicated by dots (.). Bars (-) indicate gaps that are introduced for optimal alignment.

T. Kono et al. / Fish & Shellfish Immunology 32 (2012) 151e160

155

Fig. 2. Multiple alignment of deduced amino acid sequence of carp preproNMU with those of other vertebrates. Identical amino acid residues are indicated by dots (.). Bars (-) indicate gaps that are introduced for optimal alignment. The mature NMU is in shaded area. The four potential processing signals are boxed. The accession numbers (DDBJ, EMBL and GeneBank) of sequences retrieved in this analysis are as follow: human, NP_006672; cow, NP_001178082; pig, XP_003129080; rat, NP_071575; mouse, NP_062388; chimpanzee, XP_001142975; orangutan, XP_002814827; chicken, XP_420701; frog, CAD29882; zebrafish, AAS00643; goldfish, BAH57726; carp, AB626135.

Staniar) with RPMI 1640 medium (Invitrogen) containing 1% S/P (Invitrogen), 0.2% heparin (Sigma) and 5% FBS (Invitrogen). The cell suspension was then placed on a Percoll (GE Healthcare, Buckinghamshire, UK) gradient and centrifuged at 400  g for 40 min at 4  C. The macrophage-enriched cells from the Percoll interface were then centrifuged at 500  g for 5 min and washed three times with medium. Viable phagocytic cells including neutrophils (approximately 10%) and macrophages (approximately 90%) were counted by trypan blue exclusion (MP Biomedicals, LLC, CA, USA). 2.8.2. Detection of superoxide anion in phagocytic cells The superoxide anion from phagocytic cells was determined using the reduction of nitroblue tetrazolium (NBT) method described by Sakai et al. [30]. The viable cells were adjusted to 1  107 cells/ml in HBSS (Invitrogen). 100 ml of this suspension was then added to wells of a 96 microwell plate (167008, Nalge Nunc, NY, USA). After 2 h incubation at 20  C, the unattached cells were removed from the plates with HBSS. Cell monolayers were then fed

with 0.9 ml RPMI 1640 supplemented with 10% FBS, 1% S/P with PBS (control) or NMU peptides (0.1, 1.0 and 10 nmol/ml) and incubated at 20  C overnight. The total cell number in the monolayer was approximately 5  107 cells/ml. The phagocytic cell monolayers were then washed twice with HBSS and 100 ml of NBT solution (Sigma; 1 mg/ml in RPMI 1640 medium), and 1 mg/ml of phorbol myristate acetate (PMA; Calbiochem, CA, USA) was added to each well and incubated for 60 min at 20  C. The NBT reduction was halted by the addition of 100 ml of methanol, following the removal of the medium from the cells. A blank test was also carried out in the absence of cells. Formazan was then dissolved in 120 ml of 2 M KOH (Wako, Osaka, Japan) and 140 ml of DMSO (Sigma) was added to each well before the optical density was measured using a multiscan spectrophotometer (MULTISCAN FC, Thermo Fisher Scientific, MA, USA) operated at 620 nm. Triplicate wells were used for each variable that was analysed. Assessment of statistical significance was analysed by ANOVA, followed by Tukey’s test. Values were considered to be significant when P < 0.01.

Fig. 3. Multiple alignment of deduced amino acid sequence of carp NMU with those of other vertebrates (A). The amino acid (lower triangle) and nucleotide (upper triangle) identity (%) among vertebrates NMU-25 (B). The C-terminal of all peptides is shown in an amidated form.

156

T. Kono et al. / Fish & Shellfish Immunology 32 (2012) 151e160

3. Results

preproNMU was confirmed at the two region (105e137 aa: proNMU-derived peptide and 143e183 aa: NMU) located between the 1st and 4th processing signal at the C-terminus. In the NMU region, carp preproNMU1 demonstrated a conserved characteristic sequence and a C-terminal core structure at amino acid residues 147e161 and 176e182, respectively (Fig. 2). A comparison between fish NMU and proNMU-NMU hybrid [NMU-38: derived from preproNMU lacking of 2nd and 3rd processing signal, Fig. 3A (NMU4)] with other vertebrate NMU (-8, -23 and -25) revealed that NMU21, NMU-38 and NMU-40 were unique peptide forms identified in cyprinid fish. The nucleotide and amino acid identity of the common NMU-25 among cyprinid fish and other vertebrates was found to be 52e68% and 48e68%, respectively (Fig. 3B). Phylogenetic analysis revealed that NMU identified in cyprinid fish formed a cluster with NMU identified in mammalian, amphibian and avian species away from the NMS and NMB (Fig. 4).

3.1. Structural analysis of carp NMU cDNA The cloned full length preproNMU1 cDNA (AB626135) was found to comprise 803 bp. The open reading frame contained 573 nucleotides which translated into a putative peptide of 190 amino acid residues (Fig. 1A). The transcript also contained a 50 -UTR of 18 nucleotides and a 30 -UTR of 573 nucleotides that contained a single typical polyadenylation signal (AATAAA). The carp preproNMU1 sequence contained four potential processing signals (RR/KR) at the C-terminal region. Moreover, the five isoforms generated by alternative splicing were confirmed between the first (KR, 103e104 aa) and fourth (RR, 184e185 aa) putative processing signals. The isoforms of the carp preproNMU were composed of 190 (preproNMU1), 175 (preproNMU2, AB26136), 158 (preproNMU3, AB26137), 150 (preproNMU4, AB26138) and 133 (preproNMU5, AB26139) amino acid residues, respectively (Fig. 1B). Multiple alignments with other known preproNMU molecules in vertebrates revealed some conservation between the mammalian, chicken, frog and fish amino acid sequences (Fig. 2). High identity between carp preproNMU and other vertebrate

3.2. Tissue distribution of carp preproNMU and NMUR mRNAs Constitutive expression of the preproNMU1 mRNA was observed in the brain and gut tissue from fish in the repletion status group, but not the hunger status group. In addition, expression was confirmed

92 humanNMU 99

chimpanzeeNMU orangutanNMU

70

cowNMU 92

pigNMU

85

mouseNMU

56 76

NMU

ratNMU

100

chickenNMU 98

frogNMU zebrafishNMU 100

goldfishNMU1

teleos t NMU

carpNMU1

51

frogNMS ratNMS

78 90

mouseNMS cowNMS

100

NMS

humanNMS

94 98

chimpanzeeNMS

chickenNMB

33

frogNMB 51

100

ratNMB mouseNMB

NMB

cowNMB

85

chimpanzeeNMB

56

humanNMB1

92 68

humanNMB2

0.2

Fig. 4. Phylogenetic analysis of carp NMU with NMU, NMS and NMB of other vertebrates. Phylogenetic analysis was done by NJ analysis using CLUSTAL X software (v. 1.81). The numbers indicate the bootstrap confidence values obtained for each node after 1000 replications. The accession numbers of the NMU, NMS and NMB sequences retrieved in this study are as follow: human NMU, NP_006672; cow NMU, NP_001178082; pig NMU, XP_003129080; rat NMU, NP_071575; mouse NMU, NP_062388; chimpanzee NMU, XP_001142975; orangutan NMU, XP_002814827; chicken NMU, XP_420701; frog NMU, CAD29882; zebrafish NMU, AAS00643; goldfish NMU, BAH57726; carp NMU, AB626135; human NMS, NP_001011717; cow NMS, DAA24931; rat NMS, NP_001012233; mouse NMS, NP_001011684; chimpanzee NMS, XP_001161586; frog NMS, CAJ40970; human NMB1, NP_066563; human NMB2, NP_995580; cow NMB, NP_001068738; rat NMB, NP_001102619; mouse NMB, NP_080799; chimpanzee NMB, XP_001162171; chicken NMB, NP_001072944; frog NMB, NP_001079342.

T. Kono et al. / Fish & Shellfish Immunology 32 (2012) 151e160

in the hind-gut of all individuals in the repletion status group. The preproNMU2 mRNA was weakly expressed in the hind-gut (1 of 3 individuals) of fish in the repletion status group. In the repletion status fish, the preproNMU3 mRNA was expressed in various tissues including the brain, gill, fore-gut, mid-gut, hind-gut, HK, liver and muscle. Expression was also confirmed in all brain and gut tissues of three repletion status fish. In contrast, expression of the preproNMU3 mRNA in hunger status fish was only weakly observed in the gut, liver and skin. The preproNMU4 mRNA was highly expressed in conjunction with preproNMU3 in various tissues including the brain, fore-gut and mid-gut, while its expression was not observed in the HK, skin or muscle of repletion status fish. PreproNMU4 mRNA expression was only observed in the brain, foregut, HK and skin in hunger status fish. The expression of the preproNMU5 mRNA was confirmed in all examined tissues, with the exception of the brain (1/3 individuals) and gut (fore-gut: 1/3, midgut: 0, hind-gut: 1/3 individuals) in repletion status fish. In hunger status fish, the preproNMU5 mRNA was expressed in the brain (1/3 individuals) and gut tissues (fore-gut: 2/3, mid and hind-gut: mixed tissue), and was also observed in the gill and liver. Moreover, expression of the NMUR1 and NMUR2 mRNAs was detected in all tissues examined in this analysis (Fig. 5).

157

increase in the preproNMU1, 2 and 4 mRNAs was identified (Fig. 6A). Stimulation with the viral mimic polyI:C resulted in an increase in the expression of the preproNMU3, 4 and 5 mRNAs in the intestinal cells. This increase was observed at all stimulation time periods, and the maximum expression was recorded at 9 h post-stimulation. No increase in the preproNMU1 and 2 mRNAs expression was identified following treatment with polyI:C (Fig. 6B). 3.4. The expression of inflammation-related cytokine genes in gut cells treated with NMU1 peptide The expression of pro-inflammatory cytokines such as TNF-

a and IL-1b was remarkably increased following treatment with the NMU1 peptide. Expression levels were found to be increased three(TNF-a) and five- (IL-1b) fold when compared with that of the control stimulated cells at 30 min post-treatment. In contrast, the anti-inflammatory cytokine IL-10 was found to be gradually increased by the treatment, and reached a peak expression level at 2 h post-treatment. This expression was found to be decreased at 3 h post-treatment, and returned to normal levels at 12 h (Fig. 7). 3.5. The activation of phagocytic cells by NMU1 peptide

3.3. Expression of the NMU mRNAs in gut tissue stimulated with immunostimulants Stimulation of carp intestinal cells with LPS resulted in an increased expression of the preproNMU3 and preproNMU5 mRNAs. The peak increase was observed at 9 h post-LPS stimulation. No

The production of superoxide anion in HK phagocytic cells treated with NMU1 peptide (0, 0.1, 1.0 and 10 nmol/ml) overnight is presented in Fig. 8. Superoxide anion production was significantly increased following treatment with NMU1 peptide at all concentrations. The highest increase was observed in the 1 nmol/ml

Fig. 5. Expression analysis of carp preproNMU and NMUR genes in tissues from a healthy fish under different feeding condition. RT-PCR was performed using primers specific for carp preproNMU, NMUR and b-actin genes with cDNA synthesized from a variety of tissues (Brn: brain, Gl: gill, Fg: fore-gut, Mg: mid-gut. Hg: hind-gut, Sp: spleen, HK: head kidney, Liv: liver, Sk: skin, Mu: muscle). Tissues were extracted from fish under different conditions: (A) repletion and (B) hunger. Alphabet A, B and C indicated in (A)-2 and (B)-2 indicate individual fish.

158

T. Kono et al. / Fish & Shellfish Immunology 32 (2012) 151e160

NMU1

relative to GAPDH

Carp NMU gene expression

A

NMU2

NMU5

40

40

40

40

35

35

35

35

35

30

30

30

30

30

25

25

25

25

25

20

20

20

20

20

15

15

15

15

15

10

10

10

10

10

5

5 0

5

5

5

0 1 3 6 9 12 24

0 1 3 6 9 12 24

NMU1

0 1 3 6 9 12 24

0 1 3 6 9 12 24

NMU2

NMU3

0 1 3 6 9 12 24 (h)

NMU5

NMU4

70

70

70

70

70

60

60

60

60

60

50

50

50

50

50

40

40

40

40

40

30

30

30

30

**

relative to GAPDH

Carp NMU gene expression

NMU4

40

UDL

B

NMU3

20

20

20

10

10

10

** ** **

30 **

20

** **

10

**

* **

** *

**

20 **

10

**

* *

UDL

0 1 3 6 9 12 24

0 1 3 6 9 12 24

0 1 3 6 9 12 24

0 1 3 6 9 12 24

0 1 3 6 9 12 24 (h)

Fig. 6. Quantitative real-time PCR analysis of five isoforms of preproNMU gene in gut cells treated with bacterial mimic (LPS) or viral mimic (polyI:C). Real-time PCR was performed using primers and probes specific for each preproNMU gene isoforms and b-actin gene with cDNA synthesized from gut cells treated with LPS (A) or polyI:C (B). Data are 2DDCt levels calculated relative to the un-treated gut (0 h) set to 1, normalized against the b-actin mRNA levels. Data are presented as mean  S.D. in triplicates. Significant increase to the control: *P < 0.05 and **P < 0.01.

treatment group. Statistical differences were recorded between the NMU-treated and control groups (NMU1 0.1 and 1.0 nmol/ml: P < 0.01, NMU1 10 nmol/ml: P < 0.05). 4. Discussion The preproNMU gene has been recently isolated from goldfish [17]. In addition, the full length preproNMU gene in zebrafish (XM_002665712) was predicted by computational analysis of genomic sequences supported by EST evidence. The functional importance of NMU has been well characterized in many mammalian species [1e8], but knowledge regarding fish NMU is very limited at present [17]. It has been reported in mammals that NMU plays a role in immune regulation by interacting with

6 5 4 3 2 1 0 0 0.5 1 2 3 4 8 12 24 (h)

C

7 6

Carp IL-10 gene expression relative to GAPDH

B

7

Carp IL-1β gene expression relative to GAPDH

Carp TNF-α gene expression relative to GAPDH

A

cytokines as an immune mediator [6e8]. To date, a number of fish cytokines have been discovered using in silico searches of available genomic databases. These discoveries were achieved by exploiting the chromosomal synteny that has been identified between the human and fish genomes. In regards to the fish interleukin family, IL-1, -2, -4, -6, -7, -8, -10, -11, -12, -13, -15, -16, -17, -18, -19, -20, -21, -22 and -26 have been isolated [31e36] in conjunction with some ILs that appear to be fish-specific, including IL-15 [37] and IL-17 [38]. In regard to the fish tumour necrosis factor family, TNFa and TNF-N have been isolated from several fish species [39]. However, there are no reports identifying immune regulation through the interaction of these cytokines and the neuropeptide in fish. In the present study, the pro-inflammatory cytokines IL-1b and TNF-a, and the anti-inflammatory cytokine IL-10 were selected and

5 4 3 2 1 0

7 6 5 4 3 2 1 0

0 0.5 1 2 3 4 8 12 24 (h)

0 0.5 1 2 3 4 8 12 24 (h)

Fig. 7. Quantitative real-time PCR analysis of five isoforms of inflammatory-related genes: (A) TNF-a, (B) IL-1b and (C) IL-10 in gut cells treated with carp NMU peptide (1 nmol/ml). Real-time PCR was performed using primers and probes specific for each cytokine gene and b-actin genes. Data are 2DDCt levels calculated relative to the un-treated gut (0 h) set to 1, normalized against the b-actin mRNA levels. Data are presented as mean  S.D. in triplicates. Significant increase to the control: *P < 0.05 and **P < 0.01.

T. Kono et al. / Fish & Shellfish Immunology 32 (2012) 151e160 0.12

**

O.D. at 620 nm

0.10

**

0.08

**

0.06 0.04 0.02 0

cont.

0.1

1

10

(nmol/ml)

Fig. 8. The activation of phagocytic cells by treatment of NMU peptide. The production of superoxide anion in the NMU treated cells as measured by nitroblue tetrazolium (NBT). The NBT reduction was examined at 18 h post-treatment. Values are presented as mean  S.E. at 620 nm of five fish in triplicate. Significant increase to the control: **P < 0.01.

analysed for understanding immune regulation through the interaction of NMU and cytokines. Structural analysis of the isolated carp preproNMU gene revealed that the sequence was very similar to that of preproNMU in cyprinid fish, and that the deduced primary structure of NMU isolated from cyprinid fish was similar to that of mammalian and amphibian species [1,9,40]. Moreover, we found that the isolated carp preproNMU1, 2 and 3 genes contained four di-basic cleavage signals (KR/RR), and that these signals may produce the proNMU-derived peptides reported in mammals [41,42] or the proNMU-NMU hybrid peptides (NMU-38). Central administration of the proNMUderived peptides is known to cause potent prolactin-releasing activity in the rat [41] and modification of feeding behaviour, body weight and metabolic rate in mice [42]. As little information regarding this peptide in the fish is known to date, future studies will be required for a greater understanding of peptide function during energy modulation and to determine whether these functions are similar in fish and mammals. In addition, the specific amino acid region 147e161 confirmed in carp NMU1 was not identified in other cyprinid fish [17], but the isoform may exist because there are other isoforms in carp and goldfish that are well conserved. At a gene level, it was found that the cyprinid fish expressed more than four isoforms. The functional difference among these isoforms has not been previously described and thus, a detailed gene expression investigation was conducted in the present study. The analysis of tissue distribution of the preproNMU gene isoforms revealed that the expression pattern was altered by feeding conditions. Therefore, it was hypothesized that carp NMU plays a role in appetite regulation, similar to that in the goldfish [17] and mammals [4]. Moreover, the expression pattern among isoforms under repletion and hunger conditions appeared quite different. In the goldfish, the expression of preproNMU gene isoforms 1 and 2 (corresponding to carp preproNMU gene isoforms 2 and 3) was identified in the brain, gut and testis. PreproNMU4 mRNA (corresponding to carp preproNMU5) was also expressed in the brain, gut, heart, liver, kidney, testis and ovary [17]. By comparing the expression between carp and goldfish, it was found that the shortest isoform of NMU (NMU5) was widely expressed in various tissues. In addition, it was identified that the fish preproNMU gene was expressed in the liver, spleen, kidney, skin and muscle, regions that demonstrate no or only weak expression in mammals [43]. Moreover, both the carp NMUR1 and 2 mRNAs were expressed in all tissues examined in this study. In goldfish, the expression pattern of NMUR1 and NMUR2 was found to differ slightly; however, there was some overlap with brain, pituitary and ovary expressing both NMUR genes [19]. These differences in expression

159

have also been reported in the rat, where expression of the NMUR1 and NMUR2 genes was identified in leucocytes [44]. The reason for these differences in tissue expression of preproNMU and NMUR genes remain poorly understood. We suggest that these differences may be caused by physiological constraints imposed on the fish, such as their maturation, repletion, hunger and stress status, in addition to cell type and other factors related to NMU/NMUR transcription. Determination of the precise cellular identity of cells expressing the NMU/NMUR genes will be essential in future studies. The expression of preproNMU genes was analysed in order to increase our understanding of the relationship between immune response and NMU. In these studies we found that mRNA transcription of the preproNMU3, 4 and 5 genes was increased following treatment with bacterial or viral mimics. Moreover, we found that the carp NMU peptide increased the transcription of inflammatory cytokines, including IL-1b and TNF-a, and the anti-inflammatory cytokine IL-10. The expression of IL-10 was gradually increased when compared with the expression of IL-1b and TNF-a. This late increase indicated a down-regulation in inflammatory response following cytokine interaction [45]. Although immune response regulation by different isoforms is yet to be reported, there are published reports showing that in mammals: (1) NMU promotes the production of inflammatory cytokines in macrophages and enhances endotoxin shock [7], (2) NMUR1 is expressed in peripheral tissues including immune cells such as lymphocytes, monocytes and mast cells [5,8] and (3) NMU elicits cytokine release in murine T helper 2 (Th2) cells [6]. In this study, the expression of the NMUR1 and NMUR2 genes was confirmed in various tissues including lymphoid organs such as the HK and spleen. Moreover, the expression of the preproNMU gene was altered following treatment with pathogen mimics, and NMU1 peptide increased the expression of inflammatory-related cytokine genes. In addition to the expression analyses, the activation of phagocytic cells by carp NMU1 synthetic peptide was also confirmed. The longer form of the peptide used in this study was derived from preproNMU1. Although the expression of the isoform did not change following stimulation of pathogen mimics at a genetic level, NMU1 peptide increased expression of inflammation-related genes and the activity of phagocytic cells. The activation of phagocytic cells following treatment with NMU1 (1.0 and 10 nmol/ml) was also confirmed in the analysis of phagocytosis using latex particles (data not shown). These findings suggest that (1) the C-terminal core structure (seven amino acid residues [1,11]) of NMU may activate NMUR and promote an immune response and that (2) the different length isoforms are used independently in the body. The further study analysing the differences of bioactivity among isoforms will be required in the future. Although it remains unclear which cells produce NMU and NMUR in fish, it may be suggested that fish NMU acts as an inflammatory mediator through its interaction with cytokines, a process that has been observed in mammals. In conclusion, this paper presents the first evidence of the participation of NMU in immune regulation of teleost. Carp preproNMU is expressed in a variety of tissues, and its expression is up-regulated by bacterial and viral mimics. In addition, carp NMU1 increased the expression of pro-inflammatory cytokines and the activity of phagocytic cells. More detailed investigation into the regulatory mechanisms underlying fish immunity and the crosstalk of biologically active peptides in immunity is required in the future. Acknowledgements This work was financially supported by a Grant-in-Aid for Young Scientists (23780199), The Program to Disseminate Tenure Tracking System from the Japanese Ministry of Education, Culture, Sports,

160

T. Kono et al. / Fish & Shellfish Immunology 32 (2012) 151e160

Science and Technology, and a grant for Scientific Research on Priority Areas from the University of Miyazaki. References [1] Minamino N, Kangawa K, Matsuo H. Neuromedin U-8 and U-25: novel uterus stimulating and hypertensive peptides identified in porcine spinal cord. Biochem Biophys Res Commun 1985;130:1078e85. [2] Malendowicz LK, Nussdorfer GG, Nowak KW, Mazzocchi G. Effects of neuromedin U-8 on the rat pituitary-adrenocortical axis. In Vivo 1993;7:419e22. [3] Brown DR, Quito FL. Neuromedin U octapeptide alters ion transport in porcine jejunum. Eur J Pharmacol 1988;155:159e62. [4] Howard AD, Wang R, Pong SS, Mellin TN, Strack A, Guan XM, et al. Identification of receptors for neuromedin U and its role in feeding. Nature 2000;406:70e4. [5] Hedrick JA, Morse K, Shan L, Qiao X, Pang L, Wang S, et al. Identification of a human gastrointestinal tract and immune system receptor for the peptide neuromedin U. Mol Pharmacol 2000;58:870e5. [6] Johnson EN, Appelbaum ER, Carpenter DC, Cox RF, Disa J, Foley JJ, et al. Neuromedin U elicits cytokine release in murine Th2-type T cell clone D10.G4.1. J Immunol 2004;173:7230e8. [7] Moriyama M, Matsukawa A, Kudoh S, Takahashi T, Sato T, Kano T, et al. The neuropeptide neuromedin U promotes IL-6 production from macrophages and endotoxin shock. Biochem Biophys Res Commun 2006;341:1149e54. [8] Moriyama M, Sato T, Inoue H, Fukuyama S, Teranishi H, Kangawa K, et al. The neuropeptide neuromedin U promotes inflammation by direct activation of mast cells. J Exp Med 2005;202:217e24. [9] O’Harte F, Bockman CS, Abel PW, Conlon JM. Isolation, structural characterization and pharmacological activity of dog neuromedin U. Peptides 1991;12: 11e5. [10] Murphy R, Turner CA, Furness JB, Parker L, Giraud A. Isolation and microsequence analysis of a novel form of neuromedin U from guinea pig small intestine. Peptides 1990;11:613e7. [11] Minamino N, Kangawa K, Honzawa M, Matsuo H. Isolation and structural determination of rat neuromedin U. Biochem Biophys Res Commun 1988;156: 355e60. [12] Kage R, O’Harte F, Thim L, Conlon JM. Rabbit neuromedin U-25: lack of conservation of a posttranslational processing site. Regul Pept 1991;33: 191e8. [13] Austin C, Lo G, Nandha KA, Meleagros L, Bloom SR. Cloning and characterization of the cDNA encoding the human neuromedin U (NmU) precursor: NmU expression in the human gastrointestinal tract. J Mol Endocrinol 1995; 14:157e69. [14] O’Harte F, Bockman CS, Zeng W, Abel PW, Harvey S, Conlon JM. Primary structure and pharmacological activity of a nonapeptide related to neuromedin U isolated from chicken intestine. Peptides 1991;12:809e12. [15] Domin J, Yiangou YG, Spokes RA, Aitken A, Parmar KB, Chrysanthou BJ, et al. The distribution, purification, and pharmacological action of an amphibian neuromedin U. J Biol Chem 1989;264:20881e5. [16] Brighton PJ, Szekeres PG, Willars GB. Neuromedin U and its receptors: structure, function, and physiological roles. Pharmacol Rev 2004;56:231e48. [17] Maruyama K, Konno N, Ishiguro K, Wakasugi T, Uchiyama M, Shioda S, et al. Isolation and characterisation of four cDNAs encoding neuromedin U (NMU) from the brain and gut of goldfish, and the inhibitory effect of a deduced NMU on food intake and locomotor activity. J Neuroendocrinol 2008;20:71e8. [18] Maruyama K, Wada K, Ishiguro K, Shimakura S, Wakasugi T, Uchiyama M, et al. Neuromedin U-induced anorexigenic action is mediated by the corticotropin-releasing hormone receptor-signaling pathway in goldfish. Peptides 2009;30:2483e6. [19] Maruyama K, Kaiya H, Miyazato M, Konno N, Wakasugi T, Uchiyama M, et al. Isolation and characterisation of two cDNAs encoding the neuromedin U receptor from goldfish brain. J Neuroendocrinol 2011;23:282e91. [20] Fujiki K, Shin DH, Nakao M, Yano T. Molecular cloning and expression analysis of carp (Cyprinus carpio) interleukin-1 beta, high affinity immunoglobulin E Fc receptor gamma subunit and serum amyloid A. Fish Shellfish Immunol 2000; 10:229e42. [21] Saeij JP, Stet RJ, de Vries BJ, van Muiswinkel WB, Wiegertjes GF. Molecular and functional characterization of carp TNF: a link between TNF polymorphism and trypanotolerance? Dev Comp Immunol 2003;27:29e41.

[22] Savan R, Sakai M. Presence of multiple isoforms of TNF alpha in carp (Cyprinus carpio L.): genomic and expression analysis. Fish Shellfish Immunol 2004;17: 87e94. [23] Savan R, Igawa D, Sakai M. Cloning, characterization and expression analysis of interleukin-10 from the common carp, Cyprinus carpio L. Eur J Biochem 2003;270:4647e54. [24] Thompson JD, Higgins DG, Gibson TJ. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 1994;22:4673e80. [25] Campanella JJ, Bitincka L, Smalley J. MatGAT: an application that generates similarity/identity matrices using protein or DNA sequences. BMC Bioinform 2003;4:29. [26] Saitou N, Nei M. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol Biol Evol 1987;4:406e25. [27] Felsenstein J. Confidence-limits on phylogenies e an approach using the bootstrap. Evolution 1985;39:783e91. [28] Livak KJ, Schmittgen TD. Analysis of relative gene expression data using realtime quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001;25: 402e8. [29] Braun-Nesje R, Kaplan G, Seljelid R. Rainbow trout macrophages in vitro: morphology and phagocytic activity. Dev Comp Immunol 1982;6:281e91. [30] Sakai M, Kobayashi M, Kawauchi H. In vitro activation of fish phagocytic cells by GH, prolactin and somatolactin. J Endocrinol 1996;151:113e8. [31] Savan R, Sakai M. Genomics of fish cytokines. Comp Biochem Physiol Part D Genomics Proteomics 2006;1:89e101. [32] Ohtani M, Hayashi N, Hashimoto K, Nakanishi T, Dijkstra JM. Comprehensive clarification of two paralogous interleukin 4/13 loci in teleost fish. Immunogenetics 2008;60:383e97. [33] Kono T, Bird S, Sonoda K, Savan R, Secombes CJ, Sakai M. Characterization and expression analysis of an interleukin-7 homologue in the Japanese pufferfish, Takifugu rubripes. Febs J 2008;275:1213e26. [34] Corripio-Miyar Y, Bird S, Tsamopoulos K, Secombes CJ. Cloning and expression analysis of two pro-inflammatory cytokines, IL-1b and IL-8, in haddock (Melanogrammus aeglefinus). Mol Immunol 2007;44:1361e73. [35] Wen Y, Shao JZ, Xiang LX, Fang W. Cloning, characterization and expression analysis of two Tetraodon nigroviridis interleukin-16 isoform genes. Comp Biochem Physiol B Biochem Mol Biol 2006;144:159e66. [36] Igawa D, Sakai M, Savan R. An unexpected discovery of two interferon gamma-like genes along with interleukin (IL)-22 and -26 from teleost: IL-22 and -26 genes have been described for the first time outside mammals. Mol Immunol 2006;43:999e1009. [37] Gunimaladevi I, Savan R, Sato K, Yamaguchi R, Sakai M. Characterization of an interleukin-15 like (IL-15L) gene from zebrafish (Danio rerio). Fish Shellfish Immunol 2007;22:351e62. [38] Korenaga H, Kono T, Sakai M. Isolation of seven IL-17 family genes from the Japanese pufferfish Takifugu rubripes. Fish Shellfish Immunol 2010;28: 809e18. [39] Glenney GW, Wiens GD. Early diversification of the TNF superfamily in teleosts: genomic characterization and expression analysis. J Immunol 2007;178: 7955e73. [40] Chen T, Farragher S, Bjourson AJ, Orr DF, Rao P, Shaw C. Granular gland transcriptomes in stimulated amphibian skin secretions. Biochem J 2003;371: 125e30. [41] Mori K, Miyazato M, Ida T, Murakami N, Serino R, Ueta Y, et al. Identification of neuromedin S and its possible role in the mammalian circadian oscillator system. EMBO J 2005;24:325e35. [42] Bechtold DA, Ivanov TR, Luckman SM. Appetite-modifying actions of proneuromedin U-derived peptides. Am J Physiol Endocrinol Metab 2009;297: E545e51. [43] Fujii R, Hosoya M, Fukusumi S, Kawamata Y, Habata Y, Hinuma S, et al. Identification of neuromedin U as the cognate ligand of the orphan G proteincoupled receptor FM-3. J Biol Chem 2000;275:21068e74. [44] Gartlon J, Szekeres P, Pullen M, Sarau HM, Aiyar N, Shabon U, et al. Localisation of NMU1R and NMU2R in human and rat central nervous system and effects of neuromedin-U following central administration in rats. Psychopharmacology (Berl) 2004;177:1e14. [45] Batista Jr ML, Lopes RD, Seelaender MC, Lopes AC. Anti-inflammatory effect of physical training in heart failure: role of TNF-a and IL-10. Arq Bras Cardiol 2009;93:643e51.