The toxic effects of ammonia exposure on antioxidant and immune responses in Rockfish, Sebastes schlegelii during thermal stress

Environmental Toxicology and Pharmacology 40 (2015) 954–959

Contents lists available at ScienceDirect

Environmental Toxicology and Pharmacology journal homepage: www.elsevier.com/locate/etap

The toxic effects of ammonia exposure on antioxidant and immune responses in Rockfish, Sebastes schlegelii during thermal stress Shin-Hu Kim a , Jun-Hwan Kim a , Myoung-Ae Park b , Seong Don Hwang b , Ju-Chan Kang a,∗ a b

Department of Aquatic Life Medicine, Pukyong National University, Busan 608-737, Republic of Korea Aquatic life disease control division, National Fisheries Research and Development Institute, Busan 619-902, Republic of Korea

a r t i c l e

i n f o

Article history: Received 25 July 2015 Received in revised form 15 October 2015 Accepted 16 October 2015 Available online 20 October 2015 Keywords: Ammonia Oxidative stress Immune responses Rockfish

a b s t r a c t Rockfish, Sebastes schlegelii (mean weight 14.53 ± 1.14 cm, and mean weight 38.36 ± 3.45 g) were exposed for 4 weeks (2 weeks and 4 weeks) with the different levels of ammonia in the concentrations of 0, 0.1, 0.5, 1.0 mg/L at 19 and 24 ◦ C. The ammonia exposure induced significant alterations in antioxidant responses. The activities of SOD, CAT, and GST were considerably increased by the ammonia exposure depending on water temperature, whereas the GSH level was notably decreased after 2 and 4 weeks. In the stress indicators, the cortisol and HSP 70 were significantly elevated by the exposure to ammonia depending on water temperature. In innate immune responses, the phagocytosis and lysozyme activity were notably decreased by ammonia exposure depending on water temperature after 2 and 4 weeks. The results suggest that ammonia exposure depending on water temperature can induce the considerable alterations in antioxidant responses, stress, and immune inhibition. © 2015 Elsevier B.V. All rights reserved.

1. Introduction Ammonia is ubiquitous in the environment, especially in aquatic ecosystem, which is excreted by the fertilizers and volcanic activity as well as plants and animals (Randall and Tsui, 2002). However, the high level of ammonia exposure in aquatic environment occurs by industrial and agricultural wastes as a result of the product that destroys nitrogenous organic matters (Miron et al., 2008). The increased concentrations of ammonia in aquatic environment can induce the deleterious effects in aquatic animals, due to its toxicity on the central nervous system of aquatic animals (Ip et al., 2001). In addition, the acute ammonia exposure causes the increased gill ventilation, loss of equilibrium, convulsions, ionic balance failure, and hyperexcitability in aquatic animals (Pan et al., 2011; Roumieh et al., 2013). Generally, ammonia in aquatic environment exists in two forms (ionized form, NH4 + and un-ionized form, NH3 ). Given that it is able to easily diffuse across the epithelial membranes of aquatic animals due to easily dissolve in lipids, the form of NH3 is considered much more toxic to aquatic animals than NH4 + (Armstrong et al., 2012). Ammonia toxicity is influenced by environmental indicators such as temperature, pH, salinity, and oxygen concentration

∗ Corresponding author. Tel.: +82 51 629 5944; fax: +82 51 629 5938. E-mail address: [email protected] (J.-C. Kang). http://dx.doi.org/10.1016/j.etap.2015.10.006 1382-6689/© 2015 Elsevier B.V. All rights reserved.

(Lemarie et al., 2004). Among the various components, temperature is one of the most important factors to determine the degree of ammonia toxicity, because it affects the ammonia form and bioavailability (Delos and Erickson, 1999). The higher temperature generally induces the higher toxicity in aquatic animals due to the increase in diffusion rate and chemical reactions (Takasusuki et al., 2004). The exposure to toxicants causes the production of reactive oxygen species (ROS) such as hydrogen peroxide, hydroxyl radicals, and superoxide radicals, and the oxidative stress can occur when the ROS production exceeds the ability of antioxidant defenses (Kim and Kang, 2015a). As one of the critical oxidative stress triggers, ammonia induces the production of ROS in aquatic animals, which results in the oxidative stress (Sun et al., 2011). In response to the production of ROS by the ammonia exposure, superoxide dismutase (SOD) is an antioxidant defense mechanism in aquatic animals that catalyzes the conversion of reactive superoxide anions to hydrogen peroxide (H2 O2 ), and catalase (CAT) play a critical role in detoxification mechanism of hydrogen peroxide (H2 O2 ) into oxygen (O2 ) and water (H2 O) (Felicio et al., 2015). Glutathione S-transferase (GST) is also one of antioxidant enzymes, which is associated to the conjugation and elimination of xenobiotics (Atli and Canli, 2010). Glutathione (GSH), a non-enzymatic antioxidant, decreases both H2 O2 and lipid hydroperoxides involved in glutathione peroxidases (GPx) and glutathione reductase (GR) through the reaction of oxidation–reduction (Paulino et al., 2012). Therefore, the analysis

S.-H. Kim et al. / Environmental Toxicology and Pharmacology 40 (2015) 954–959

of antioxidant responses can offer a reliable biomarker to assess the antioxidant status in aquatic animals against oxidative stress (Sun et al., 2012). The ammonia exposure also induces the stress in aquatic animals, the defense mechanisms under stress such as cortisol and heat shock protein 70 (HSP 70) can be used as a good indicator to assess the stress level of aquatic animals (Smith et al., 1999; Israeli-Weinstein and Kimmel, 1998). The immune responses can be stimulated by the stress in aquatic animals (Carballo et al., 1995). The innate immune system in fish is regarded as the first line of defense against toxicants (Saurabh and Sahoo, 2008). Among the innate immune responses, lysozyme is a critical factor in fish, which functions as a bacteriolytic agent against microbial invasion in fish, and the lysozyme activity is affected by toxicants (Kim and Kang, 2015a). Phagocytosis is also one of the innate immune responses, which engulfs large particles into intracellular vacuoles to eliminate pathogenic microbes (Nagasawa et al., 2015), and it has been used as an immunological parameter to assess the health status and immune ability in fish against toxicants (Risjani et al., 2014). Cho and Hur (1998) reported the LC50 of ammonia exposure of rockfish, Sebastes schlgelii (mean weight 3.6 g and mean length 6.6 cm) at 22 ◦ C (96 h: 2.61 mg/L, 3 h: 3.94 mg/L) and red seabream, Pagrus major (mean weight 2 g and mean length 5.0 cm) at 22 ◦ C (3 h: 3.75 mg/L). Rockfish, S. schlegelii, is one of the most largely cultured fish of marine net cages in South Korea due to its high demand, appreciated flesh, and rapid growth. However, the insufficient study about the exposure to ammonia toxicity depending on water temperature. Therefore, the aim of the present study was to assess the toxic effects of ammonia exposure depending on water temperature to the S. schlegelii on antioxidant and immune responses. 2. Materials and methods 2.1. Experimental animals and conditions Rockfish, S. schlegelii (mean weight 14.53 ± 1.14 cm, and mean weight 38.36 ± 3.45 g) were obtained from a commercial farm (Tongyeong, Korea). Fish were held for 3 weeks in seawater at 19 ◦ C to ensure that all individuals were healthy and feeding, and also to reset the thermal history (19 and 24 ◦ C) of the animals prior to initiating temperature acclimations (Table 1). The fish were fed a commercial diet twice daily (Woosungfeed, Daejeon City, Korea). The water temperature was adjusted from ambient at a rate of ±1 ◦ C/day until a final temperature of 24 ◦ C was reached. The acclimation period commenced once the final temperature had been sustained for 24 h and animals were feeding, while showing no sign of stress. Ammonia exposure took place in 20 L glass tanks containing 13 fish per treatment group. Ammonia chloride (NH4 Cl) (Sigma, St. Louis, MO, USA) solution was dissolved in the respective glass tanks. The ammonia concentrations in the glass tanks were 0, 0.1, 0.5, 1.0 mg/L, and the actual ammonia concentration is demonstrated in Table 2. The glass tank water was thoroughly exchanged once per 2 days, and made the same concentration in the respective glass tank. At the end of each period (at 2 and 4 weeks),

955

Table 2 Analyzed waterborne ammonia concentration from treatment group. Ammonia concentration (mg/L) Ammonia levels Actual ammonia levels

0 0.05

0.1 0.18

0.5 0.67

1.0 1.21

animals were anesthetized in buffered 3-aminobenzoic acid ethyl ester methanesulfonate (Sigma Chemical, St. Louis, MO). 2.2. Antioxidant responses Liver tissues were excised and homogenized with 10 volumes of ice-cold homogenization buffer using Teflon-glass homogenizer (099CK4424, Glass-Col, Germany). The homogenate was centrifuged at 10,000 × g for 30 min under refrigeration and the obtained supernatants were stored at −80 ◦ C for analysis. Protein content was determined at 595 nm by the Bio-Rad Protein Assay Kit (Bio-Rad Laboratories GmbH, Munich, Germany) based on the Bradford dye-binding procedure, using bovine serum albumin (Sigma, USA) as standard. Superoxide dismutase (SOD) activity was measured with 50% inhibitor rate about the reduction reaction of WST-1 using SOD Assay kit (Dojindo Molecular Technologies, Inc.). One unit of SOD is defined as the amount of the enzyme in 20 ␮L of sample solution that inhibits the reduction reaction of WST1 (2-(4-lodophenyl)-3-(4-nitrophenyl)-5-(2,4-disulfophenyl)-2Htetrazolium, monosodium salt) with superoxide anion by 50%. SOD activity was measured at 450 nm and expressed as unit mg protein−1 . The catalase (CAT) activity was measured using the OxiSelectTM Catalase Assay Kit (Cell biolabs, Inc.). The quinoneimine dye coupling product is measured at 520 nm, which correlated to the amount of hydrogen peroxide remaining in the reaction mixture. The CAT activity was expressed as unit/mg protein and one unit of CAT is the amount of enzyme that will decompose 1 ␮M of H2 O2 per minute at 25 ◦ C. Glutathione-S-transferase(GST) activity was measured according to the method of modified Habig et al. (1974). The reaction mixture consisted of 0.2 M phosphate buffer (pH 6.5), 10 mM GSH (Sigma) and 10 mM 1-chloro-2-dinitrobenzene, CDNB (Sigma). The change in absorbance at 25 ◦ C was recorded at 340 nm and the enzyme activity was calculated as 340 nm and the enzyme activity was calculated as nmol min−1 mg protein−1 . Reduced glutathione was measured following the method of Beutler and Kelly (1963). Briefly, 0.2 mL fresh supernatant was added to 1.8 mL distilled water. Three mL of the precipitating solution (1.67 g metaphosphoric acid, 0.2 g EDTA and 30 g NaCl in 100 mL distilled water) was mixed with supernatants. The mixture was centrifuged at 4500 × g for 10 min. 1.0 mL of supernatant was added to 4.0 mL of 0.3 M NaHPO4 solution and 0.5 mL DTNB (5,5 -dithiobis-2-nitrobenzoic acid) was then added to this solution. Reduced glutathione was measured as the difference in the absorbance values of samples in the presence and the absence of DTNB at 412 nm. GSH value was calculated as nmol mg protein−1 in the tissues. 2.3. Plasma cortisol

Table 1 The chemical components of seawater and experimental condition used in the experiments. Item

Value

Temperature (◦ C) pH Salinity (‰) Dissolved oxygen (mg/L)

19.0 ± 0.6, 23 ± 0.5 7.9 ± 0.6 33.1 ± 0.5 7.4 ± 0.5

Plasma cortisol concentration was measured with a monoclonal antibody enzyme-linked immunosorbent assay (ELISA) quantification kit (Enzo Life Sciences, Inc., Farmingdale, NY, USA). Briefly, add 100 ␮L standard (156, 313, 625, 1250, 2500, and 5000 pg/mL) and 100 ␮L samples in anti-Mouse IgG microtiter plate. Add 50 ␮L assay buffer, 50 ␮L blue conjugate, and 50 ␮L yellow antibody, successively. After that, incubate the plate at room temperature on a plate

956

S.-H. Kim et al. / Environmental Toxicology and Pharmacology 40 (2015) 954–959

Table 3 The primers used in this study for real-time qPCR. Gene

Sequence

Product size

18s rRNA

Fw: TGAGAAACGGCTACCACATC Rv: CAATTACAGGGCCTCGAAAG Fw: GATGCAGCCAAGAACCAGGTGG Rv: GCTTCCCTCCATCTCCGATCACC

100 bp

HSP 70

144 bp

shaker for 2 h at 500 rpm. And then, empty the contents of the wells and wash by adding 400 ␮L wash solution three times, and dry until no moisture appears. After the final wash, add 5 ␮L blue conjugate and 200 ␮L pNpp substrate solution. Incubate at room temperature for 1 h without shaking. After that, add 50 ␮L stop solution, and read the optical density at 405 nm. The measurements were performed in triplicate. 2.4. Heat shock protein 70 gene expression Total RNA was extracted from liver samples using RNA purification kit (Real Biotech Corporation, Taipei, Taiwan), and the quantity and quality of the total RNA were assessed using the Ultrospec 3100 pro (Amersham Bioscience, Amersham, UK). The 260/280 nm absorbance ratios of all samples ranged from 1.80 to 2.00, indicating a satisfactory purify of the RNA samples. Purified RNA was subjected to reverse transcription to cDNA by cDNA synthesis kit (Enzo Life Sciences Inc., NY, USA) according to the reagent’s instructions. For real-time quantitative PCR analysis of HSP 70 gene expression, the real-time qPCR primer of HSP 70 gene and 18s rRNA gene are shown in Table 3. Real-time PCR assay were carried out in a quantitative thermal cycler (LightCycler® 480 II, Roche Diagnostics Ltd., Rotkreuz, Switzerland) in a final volume of 20 ␮L containing 10 ␮L 2× Master Mix (LightCycler® 480 SYBR Green I Master, Roche Diagnostics Ltd., Rotkreuz, Switzerland), 1 ␮L of cDNA mix. HSP 70 gene-specific primers were applied to evaluate the mRNA levels of HSP 70 in liver. Reference 18s rRNA gene was used as internal control. The real-time qPCR amplification began with 5 min at 95 ◦ C, followed by 45 cycles of denaturation of 10 s at 95 ◦ C, annealing of 10 s at 60 ◦ C, and extension of 10 s at 72 ◦ C. To analyze the mRNA expression level, the comparative CT methods (2−CT method) was used. 2.5. Lysozyme activity The plasma for analysis was separated from the blood sample. Protein content was determined by the Bio-Rad Protein Assay Kit (Bio-Rad Laboratories GmbH, Munich, Germany) based on the Bradford dye-binding procedure, using bovine serum albumin as standard. Lysozyme concentration was calculated through the measure of its enzyme activity. Lysozyme activity was determined by a turbidimetric method (Ellis, 1990) using Micrococcus lysodeikticus (Sigma) as substrate (0.2 mg/mL 0.05 M phosphate buffer, pH 6.6 for kidney sample and pH 7.4 for plasma). A standard curve was made with lyophilized hen egg white lysozyme (sigma) and the rate of change in turbidity was measured at 0.5-min and 4.5-min intervals at 530 nm. The results were expressed as ␮g/mL equivalent of hen egg white lysozyme activity (Anderson and Siwicki, 1994). 2.6. Phagocytosis The plasma for analysis was separated from the blood sample. Phagocytosis was measured using the phagocytosis assay kit (Cell biolabs, Inc.). Add 200 ␮L of cold 1× PBS to each well, and promptly remove the PBS solution. Add 100 ␮L of fixation solution to each well, and incubate 5 min. Promptly remove the fixation solution, and wash twice with 1× PBS. Add 100 ␮L of pre-diluted one

blocking solution to each well, incubate the plate for 30 min. Promptly remove the blocking solution, and wash three times with 1× PBS. Add 100 ␮L of pre-diluted 1× permeabilization solution to each well, and incubate 5 min, and promptly remove the PBS. Initiate the reaction by adding 100 ␮L of substrate, and incubate for 10–30 min. Stop the reaction by adding 100 ␮L of the stop solution, and read the absorbance at 450 nm. 2.7. Statistical analysis The experiment was conducted in exposure periods for 4 weeks (2 weeks and 4 weeks) and performed triplicate. Statistical analyses were performed using the SPSS/PC + statistical package (SPSS Inc, Chicago, IL, USA). Significant differences between groups were identified using one-way ANOVA and Duncan’s test for multiple comparisons or Student’s t-test for two groups (Duncan, 1955). The significance level was set at P < 0.05. 3. Results 3.1. Antioxidant responses Antioxidant response analysis (SOD, CAT, GST, and GSH) in liver of S. schlegelii is demonstrated in Fig. 1. The SOD activity after 2 weeks was considerably increased in the concentration of 1.0 mg/L at 19 ◦ C and over 0.5 mg/L at 24 ◦ C. After 4 weeks, the SOD activity was significantly increased over 0.5 mg/L both at 19 and 24 ◦ C. The CAT activity was notably increased in the concentration of 1.0 mg/L at 19 ◦ C and over 0.5 mg/L at 24 ◦ C both after 2 and 4 weeks. The GST activity after 2 weeks was notably increased in the concentration of 1.0 mg/L at 19 ◦ C and over 0.5 mg/L at 24 ◦ C. After 4 weeks, the GST activity was substantially increased over 0.5 mg/L both at 19 and 24 ◦ C. The GSH level was considerably decreased over 0.1 mg/L after 2 and 4 weeks (Figs. 2–4). 3.2. Stress indicators To assess the stress level by ammonia exposure depending on water temperature, the plasma cortisol and heat shock protein 70 (HSP 70) of S. schlegelii were analyzed. The plasma cortisol of S. schlegelii was substantially increased over 0.1 mg/L at 19 and 24 ◦ C both after 2 and 4 weeks. The HSP 70 of S. schlegelii was significantly increased in the concentration of 1.0 mg/L at 19 ◦ C after 2 and 4 weeks. At 24 ◦ C, a considerable increase was observed at 1.0 mg/L after 2 weeks and over 0.5 mg/L after 4 weeks. The HSP 70 was notably increased by the temperature as well as the ammonia concentrations. 3.3. Immune responses The plasma lysozyme activity of S. schlegelii was considerably decreased over 0.5 mg/L at 19 ◦ C and in the concentration of 1.0 mg/L at 24 ◦ C after 2 weeks. A significant decrease in the lysozyme activity after 4 weeks was observed in the concentration of 1.0 mg/L at 19 ◦ C and over 0.1 mg/L at 24 ◦ C. The phagocytosis of S. schlegelii was notably decreased in the concentration of 1.0 mg/L at 19 ◦ C and over 0.5 mg/L at 24 ◦ C after 2 weeks. A considerable decrease in the phagocytosis after 4 weeks was shown over 0.5 mg/L both at 19 and 24 ◦ C. 4. Discussion The metal exposure to aquatic animals in marine environment induces the production of reactive oxygen species (ROS), which causes the oxidative stress in aquatic animals (Kim and Kang,

S.-H. Kim et al. / Environmental Toxicology and Pharmacology 40 (2015) 954–959

957

Fig. 1. Change of Antioxidant enzymes activity in rockfish, S. schlegelii exposed to the different ammonia concentration and water temperature. Values with different superscript are significantly different in 2 and 4 weeks (P < 0.05) as determined by Duncan’s multiple range test.

18

160

19 oC 24 oC 4 W eeks

2 W eeks 16

Cortisol (µ µg/ml)

d

d

14

cd

12

c

c

bc

c

10 b b

8

b

b

6 4

a a

a

ab

0 0.1

0.5

1.0

0

0.1

0.5

4 Weeks

140

c

1.0

NH 4 Concentration (mg/L) Fig. 2. Change of plasma cortisol in rockfish, S. schlegelii exposed to the different ammonia concentration and water temperature. Values with different superscript are significantly different in 2 and 4 weeks (P < 0.05) as determined by Duncan’s multiple range test.

2015b). In this study, the activity of SOD of S. schlegelii was significantly increased by the ammonia exposure depending on water temperature. Hari and Neeraja (2012) also reported a significant increase in the SOD activity of common carp, Cyprinus carpio by ammonia exposure. Temperature is also one of the most critical factors to affect the oxidative stress in aquatic animals. The high temperature to aquatic animals induces the increased lipid peroxidation in tissues, which is linked to the production of O2 − and tissue damage (Halliwell, 1994). In this study, the higher temperature as

c

19 oC 120

24 oC

c

100 bc 80 60 b

b

40 20

2

0

2 Weeks

d

HSP70 relative expression

20

b

b

b

b b

a

a

a

a

a

0 0

0.1

0.5

1.0

0

0.1

0.5

1.0

NH4 Conce ntration (mg/L) Fig. 3. HSP70 relative expression in rockfish, S. schlegelii exposed to the different ammonia concentration and water temperature. Values with different superscript are significantly different in 2 and 4 weeks (P < 0.05) as determined by Duncan’s multiple range test.

well as ammonia exposure catalyzed the increase in the SOD activity of S. schlegelii. Hegazi et al. (2010) reported a significant increase in the CAT activity of Nile tilapia, Oreochromis niloticus exposed to ammonia. Meanwhile, Ji et al. (2008) reported that the high water temperature induced the increase in the CAT activity of sea cucumber Apostichopus japonicas Selenka, which is associated with the oxygen consumption rate depending on water temperature. In this study, the CAT activity of S. schlegelii was notably increased by the

958

S.-H. Kim et al. / Environmental Toxicology and Pharmacology 40 (2015) 954–959 80

0.5

19 oC

a a ab

ab b

a a

ab

ab

b

0.4

ab

c c

bc c

40

c

20

Phagocytosis (O.D)

Lysozyme activity (µ µ g/mL)

4 Weeks

2 Weeks

60

o

19 C 24 oC

24 oC

0.3

4 W eeks

2 W eeks

a

a

a a

a ab

a

ab

b

ab

b

b

0.2

c

c

c

c

0.1

0.0

0 0

0.1

0.5

1.0

0

0.1

0.5

0

1.0

0.1

NH4 Conce ntration (mg/L)

0.5

1.0

0

0.1

0.5

1.0

NH 4 Concentration (mg/L)

Fig. 4. Change of immuneactivities in rockfish, S. schlegelii exposed to the different ammonia concentration and water temperature. Values with different superscript are significantly different in 2 and 4 weeks (P < 0.05) as determined by Duncan’s multiple range test.

ammonia exposure depending on water temperature, which may be a response to oxidative stress by the ammonia exposure depending on water temperature. The CAT increase depending on water temperature of S. schlegelii was caused by the enhancement of the tissue oxygen consumption resulting in the increased production of ROS. Sayeed et al. (2003) reported a significant increase in the GST activity of Channa punctatus (Bloch) exposed to deltamethrin to provide protection against ROS damage. In this study, the GST activity of S. schlegelii was substantially increased by the ammonia exposure depending on water temperature, which may be induced in the process of xexnobiotic detoxification for the ammonia exposure depending on water temperature. Glutathione (GSH) is a cosubstrate for the GST, which is associated with the conjugation and elimination of xenobiotics (Almar et al., 1998). Yang et al. (2011) observed a substantial decrease in the GSH of crucian carp, Carassius auratus exposed to the ammonia exposure. Monteiro et al. (2006) indicated that GSH level can be decreased by negative feedback from excess substrate or by damage induced by oxidative modification. In this study, the level of GSH of S. schlegelii was also considerably depleted by the ammonia exposure depending on water temperature, which may reflect the oxidative damage caused by the ammonia exposure depending on water temperature. Temperature was also a factor to affect the GSH level of S. schlegelii. Considering the alterations in antioxidant responses against the ammonia exposure depending on water temperature, the ammonia exposure to S. schlegelii depending on water temperature induced the alterations in antioxidant responses against oxidative stress. The ammonia exposure to aquatic animals acts as a stressor and causes adaptive endocrine responses, which can induce the chronically increased cortisol levels leading to physiological function damage (Ruyet et al., 2003). As one of the toxic substances, the ammonia exposure can induce the stress of aquatic animals; Ruyet et al. (1998) observed the notable elevation in plasma cortisol of turbot, Scophthalmus maximus by the ammonia exposure. The increasing water temperature also induced the increase in the plasma cortisol of rainbow trout, Oncorhynchus mykiss (Meka and McCormick, 2005). In this study, the plasma cortisol of S. schlegelii was significantly increased by the ammonia exposure depending on water temperature. Cheng et al. (2015) reported a considerable increase in the HSP 70 gene expression of pufferfish, Takifugu obscurus by the ammonia stress, which reflects a protective mechanism against ammonia stress. The increased temperature caused the induction of the HSP 70 gene expression of rainbow trout, O. mykiss by thermal stress (Currie et al., 2000). In this study, a considerable gene expression in HSP 70 of S. schlegelii was observed by the ammonia exposure depending on water temperature. Given that the increased plasma cortisol and HSP 70 by the ammonia

exposure depending on water temperature, the ammonia exposure depending on water temperature should affect S. schlegelii as stress factor. The stress induced by the environmental toxicants has been known to restrain the immunological ability in fish (Small, 2004). Yue et al. (2010) reported the ammonia exposure induced the reduced lysozyme activity of swimming crab Portunus trituberculatus by ammonia stress. Vega et al. (2007) reported the inhibited lysozyme activity of black tiger shrimp, Penaeus monodon by high water temperature. In this study, the lysozyme activity of S. schlegelii was considerably decreased by the ammonia exposure depending on water temperature. Cheng et al. (2003) reported the inhibited phagocytosis of giant freshwater prawn Macrobrachium rosenbergii by the ammonia exposure. Cheng et al. (2004) also reported that the higher water temperature induced a reduced phagocytosis of Taiwan abalone Haliotis diversicolor supertexta. The ammonia exposure of S. schlegelii depending on water temperature also caused a significant decrease in phagocytosis. Therefore, the ammonia exposure depending on water temperature induced the inhibited immune responses such as lysozyme activity and phagocytosis of S. schlegelii, which may reflect the immunosuppression of ammonia toxicity. In conclusion, the group at 24 ◦ C was more vulnerable to the ammonia toxicity than the group at 19 ◦ C, which means the higher temperature can induce the more ammonia toxic effects. The ammonia exposure to S. schlegelii depending on water temperature results in significant alterations in antioxidant responses (SOD, CAT, GST, and GSH), increased stress indicators (cortisol and HSP 70), and inhibited immune responses (lysozyme activity and phagocytosis). Given that the results of the present study, the ammonia depending on water temperature should inversely affect the experimental fish, S. schlegelii. Conflict of interest No conflict of interest. Acknowledgment This work was supported by a grant from the National Fisheries Research and Development Institute(R2015071) References Almar, M., Otero, L., Santos, C., Gallego, J.G., 1998. Liver glutathione content and glutathione dependent enzymes of two species of freshwater fish as bioindicators of chemical pollution. J. Environ. Sci. Health B33 (6), 769–783.

S.-H. Kim et al. / Environmental Toxicology and Pharmacology 40 (2015) 954–959 Anderson, D.P., Siwicki, A.K., 1994. Simplified assays for measuring nonspecific defense mechanisms in fish. , Fish Health Section. Am. Fisheries Soc. Meeting, Seattle, WA, p. 26. Armstrong, B.M., Lazorchak, J.M., Murphy, C.A., Haring, H.J., Jensen, K.M., Smith, M.E., 2012. Determining the effects of ammonia on fathead minnow (Pimephales promelas) reproduction. Sci. Total Environ. 420, 127–133. Atli, G., Canli, M., 2010. Response of antioxidant system of freshwater fish Oreochromis niloticus to acute and chronic metal(Cd,Cu,Cr,Zn Fe) exposures. Ecotoxicol. Environ. Saf. 73, 1884–1889. Beutler, E., Kelly, B.M., 1963. The effect of sodium nitrite on red cell GSH. Experientia 19, 96–97. Carballo, M., Munoz, M.J., Cuellar, M., Tarazona, J.V., 1995. Effects of waterborne copper, cyanide, ammonia, and nitrite on stress parameters and changes in susceptibility to saprolegniosis in rainbow trout (Oncorhynchus mykiss). Appl. Environ. Microb. 61, 2108–2112. Cheng, C.H., Yang, F.F., Ling, R.Z., Liao, S.A., Miao, Y.T., Ye, C.X., Wang, A.L., 2015. Effects of ammonia exposure on apoptosis, oxidative stress and immune response in pufferfish (Takifugu obscurus). Aquat. Toxicol. 164, 61–71. Cheng, W., Chen, S.M., Wang, F.I., Hsu, P.I., Liu, C.H., Chen, J.C., 2003. Effects of temperature, pH, salinity and ammonia on the phagocytic activity and clearance efficiency of giant freshwater prawn Macrobrachium rosenbergii to Lactococcus garvieae. Aquaculture 219, 111–121. Cheng, W., Hsiao, I.S., Hsu, C.H., Chen, J.C., 2004. Change in water temperature on the immune response of Taiwan abalone Haliotis diversicolor supertexta and its susceptibility to Vibrio parahaemolyticus. Fish Shellfish Immunol. 17, 235e243. Cho, S.H., Hur, S.B., 1998. Comparison of acute toxicity of ammonia in juvenile rockfish and red sea bream. J. Aquacult. 11, 429–435. Currie, S., Moyes, C.D., Tufts, B.L., 2000. The effects of heat shock and acclimation temperature on hsp70 and hsp30 mRNA expression in rainbow trout: in vivo and in vitro comparisons. J. Fish Biol. 56, 398–408. Delos, C., Erickson, R., 1999. Update of Ambient Water Quality Criteria for Ammonia. EPA/822/R-99/014. Final/Technical Report. Environmental Protection Agency, Washington, DC: U.S. Duncan, B.D., 1955. Multiple range and multiple F tests. Biometrics 11, 1–42. Ellis, A.E., 1990. Lysozyme assay. In: Stolen, J.S., Fletcher, T.C., Anderson, D.P., Roberson, B.S., van Muiswinkel, W.B. (Eds.), Techniques in fish immunology. ISOS Publications, NJ, pp. 101–103. Felicio, A.A., Parente, T.E.M., Maschio, L.R., Nogueira, L., Venancio, L.P.R., Rebelo, M.F., Schlenk, D., Almeida, E.A., 2015. Biochemical responses, morphometric changes, genotoxic effects and CYP1A expression in the armored catfish Pterygoplichthys anisitsi after 15 days of exposure to mineral diesel and biodiesel. Ecotoxicol. Environ. Saf. 115, 26–32. Habig, W.H., Pabst, M.J., Jakoby, W.B., 1974. Glutathione S-transferase The first enzymatic step in mercapturic acid formation. J. Biol. Chem. 249, 7130–7139. Halliwell, B., 1994. Free radicals, antioxidants, and human disease: curiosity, cause, or consequence. Lancer 344, 721–724. Hari, P., Neeraja, P., 2012. Ambient ammonia stress on certain metabolic aspects in liver tissue of fish Cyprinus carpio. Int. Q. J. Life Sci. 7 (1), 111–113. Hegazi, M.M., Attia, Z.I., Ashour, O.A., 2010. Oxidative stress and antioxidant enzymes in liver and white muscle of Nile tilapia juveniles in chronic ammonia exposure. Aquat. Toxicol. 99, 118–125. Ip, Y.K., Chew, S.F., Leung, I.A.W., Jin, Y., Lim, C.B., Wu, R.S.S., 2001. The sleeper Bostrichthys sinensis (Family Eleotridae) stores glutamine and reduces ammonia production during aerial exposure. J. Comp. Physiol. B 171, 357–367. Israeli-Weinstein, D., Kimmel, E., 1998. Behavioral response of carp, Cyprinus carpio to ammonia stress. Aquaculture 165, 81–93. Ji, T., Dong, Y., Dong, S., 2008. Growth and physiological responses in the sea cucumber, Apostichopus japonicus Selenka. Aestivat. Temp. Aquacult. 283, 180–187. Kim, J.H., Kang, J.C., 2015a. Oxidative stress, neurotoxicity, and non-specific immune responses in juvenile red sea bream, Pagrus major, exposed to different waterborne selenium concentrations. Chemosphere 135, 46–52. Kim, J.H., Kang, J.C., 2015b. The arsenic accumulation and its effect onoxidative stress responses in juvenile rockfish, Sebastes schlegelii, exposed to waterborne arsenic (As3+). Environ. Toxicol. Pharmacol. 39, 668–676.

959

Lemarie, G., Dosdat, A., Coves, D., Dutto, G., Gasset, E., Person-Le Ruyet, J., 2004. Effect of chronic ammonia exposure on growth of European seabass (Dicentrarchus labrax) juveniles. Aquaculture 229, 479–491. Meka, J.M., McCormick, S.D., 2005. Physiological response of wild rainbow trout to angling: impact of angling duration, fish size, body condition, and temperature. Fish. Res. 72, 311–322. Miron, D.S., Moraes, B., Becker, A.G., Crestani, M., Spanevello, R., Loro, V.L., Baldisserotto, B., 2008. Ammonia and pH effects on some metabolic parameters and gill histology of silver catfish, Rhamdia quelen (Heptapteridae). Aquaculture 277, 192–196. Monteiro, D.A., Almeida, J.A., Rantin, F.T., Kalinin, A.L., 2006. Oxidative stress biomarkers in the freshwater characid fish, Brycon cephalus, exposed to organophosphorus insecticide Folisuper 600 (methyl parathion). Compar. Biochem. Physiol. C 143, 141–149. Nagasawa, T., Somamoto, T., Nakao, M., 2015. Carp thrombocyte phagocytosis requires activation factors secreted from other leukocytes. Dev. Comp. Immunol. 52, 107–111. Pan, C.H., Chien, Y.H., Wang, Y.J., 2011. Antioxidant defence to ammonia stress of characins (hyphessobrycon eques Steindachner) fed diets supplemented with carotenoids. Aquacult. Nutr. 17, 258–266. Paulino, M.G., Souza, N.E.S., Fernandes, M.N., 2012. Subchronic exposure to atrazine induces biochemical and histopathological changes in the gills of a Neotropical freshwater fish, Prochilodus lineatus. Ecotoxicol. Environ. Saf. 80, 6–13. Randall, D.J., Tsui, T.K.N., 2002. Ammonia toxicity in fish. Mar. Pollut. Bull. 45, 17–23. Risjani, Y., Yunianta, Couteau, J., Minier, C., 2014. Cellular immune responses and phagocytic activity of fishes exposed to pollution of volcano mud. Mar. Environ. Res. 96, 73e80. Roumieh, R., Barakat, A., Abdelmeguid, N.E., Ghanawi, J., Saoud, I.P., 2013. Acute and chronic effects of aqueous ammonia on marbled spinefoot rabbitfish, Siganus rivulatus (Forsskal 1775). Aquacult. Res. 44, 1777–1790. Ruyet, J.P.L., Boeuf, G., Infante, J.Z., Helgason, S., Roux, A.L., 1998. Short-term physiological changes in turbot and seabream juveniles exposed to exogenous ammonia. Comp. Biochem. Physiol. A 119A (2), 511–518. Ruyet, J.P., Lamers, A., Roux, A.L., Severe, A., Boeuf, G., Gostan, N.M., 2003. Longterm ammonia exposure of turbot: effects on plasma parameters. J. Fish Biol. 62, 879–894. Sayeed, I., Parvez, S., Pandey, S., Bin-Hafeez, B., Haque, R., Raisuddin, S., 2003. Oxidative stress biomarkers of exposure to deltamethrin in freshwater fish, Channa punctatus Bloch. Ecotoxicol. Environ. Saf. 56, 295–301. Saurabh, S., Sahoo, P.K., 2008. Lysozyme: an important defence molecule of fish innate immune system. Aquacult. Res. 39, 223–239. Small, B.C., 2004. Effect of isoeugenol sedation on plasma cortisol, glucose, and lactate dynamics in channel catfish Ictalurus punctatus exposed to three stressors. Aquaculture 238, 469–481. Smith, T.R., Tremblay, G.C., Bradley, T.M., 1999. Hsp70 and a 54 kDa protein (Osp54) are induced in Salmon (Salmo salar) in response to hyperosmotic stress. J. Exp. Zool. 284, 286–298. Sun, H., Yang, W., Chen, Y., Yang, Z., 2011. Effect of purified microcystin on oxidative stress of silver carp Hypophthalmichthys molitrix larvae under different ammonia concentrations. Biochem. System. Ecol. 39, 536–543. Sun, H., Lu, K., Minter, E.J.A., Chen, Y., Yanga, Z., David, J.S.M., 2012. Combined effects of ammonia and microcystin on survival, growth, antioxidant responses, and lipid peroxidation of bighead carp Hypophthalmythys nobilis larvae. J. Hazard. Mater. 221–222, 213–219. Takasusuki, J., Araujo, M.M.R., Fernandes, M.N., 2004. Effect of water pH on copper toxicity in the neotropical fish, Prochilodus scrofa (Prochilodondidae). Bull. Environ. Contam. Toxicol. 72, 1075–1082. Vega, E.D.L., Hall, M.R., Wilson, K.J., Reverter, A., Woods, R.G., Degnan, B.M., 2007. Stress-induced gene expression profiling in the black tiger shrimp Penaeus monodon. Physiol. Genomics 31 (1), 126–138. Yang, W., Sun, H., Xiang, F., Yang, Z., Chen, Y., 2011. Response of juvenile crucian carp (Carassius auratus) to long-term ammonia exposure: feeding, growth, and antioxidant defenses. J. Freshw. Ecol. 26 (4), 563–570. Yue, F., Pan, L., Xie, P., Zheng, D., Li, J., 2010. Immune responses and expression of immune-related genes in swimming crab Portunus trituberculatus exposed to elevated ambient ammonia-N stress. Comp. Biochem. Physiol. A 157, 246–251.