Molecular structure and immune-stimulated transcriptional modulation of the first teleostean IFP35 counterpart from rockfish (Sebastes schlegelii)

Fish & Shellfish Immunology 56 (2016) 496e505

Contents lists available at ScienceDirect

Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi

Full length article

Molecular structure and immune-stimulated transcriptional modulation of the first teleostean IFP35 counterpart from rockfish (Sebastes schlegelii) N.C.N. Perera a, b, 1, G.I. Godahewa a, b, 1, Bo-Hye Nam c, Jehee Lee a, b, * a b c

Department of Marine Life Sciences, Jeju National University, Jeju Self-Governing Province 63243, Republic of Korea Fish Vaccine Research Center, Jeju National University, Jeju Self-Governing Province 63243, Republic of Korea Biotechnology Research Division, National Institute of Fisheries Science, 408-1 Sirang-ri, Gijang-up, Gijang-gun, Busan 46083, Republic of Korea

a r t i c l e i n f o

a b s t r a c t

Article history: Received 13 February 2016 Received in revised form 26 July 2016 Accepted 7 August 2016 Available online 8 August 2016

Interferons (IFNs) and IFN-inducible proteins play numerous physiological roles, particularly in antiviral defense mechanisms of the innate immune response with the presence of pathogens. IFN-induced protein-35 kDa (IFP35) is induced by Type II IFN (IFN-g); it is a cytoplasmic protein that can be translocated to the nucleus via the stimulation of IFN. In this study, we report the complete molecular characterization of the IFP35 cDNA sequence from the black rockfish in an effort to understand its role in the immune response. The coding sequence of RfIFP35 encoded a putative peptide of 371 amino acids containing two characteristic Nmi/IFP 35 domains (NIDs), which are highly conserved among its counterparts. The protein showed a molecular mass of 42.2 kDa with a theoretical pI of 5.05 and was predicted to be unstable because of its high instability index (49.37). Therefore, the protein-protein interaction is essential for its stability, which may be facilitated by the intrinsically disordered regions in this protein. According to cellular location prediction, the RfIFP35 protein is cytosolic. Phylogenetic analysis showed that RfIFP35 was cladded within the fish counterparts. Tissue distribution profiling revealed a ubiquitous presence of the protein in all examined tissues, with highest expression in the blood followed by the spleen tissues. The expression of RfIFP35 during immune challenge with poly I:C and lipopolysaccharide treatments affirms its putative importance in the first-line host defense system. RfIFN-g mRNA was significantly expressed at 6 h p.i. in blood and 3 h p.i. in the spleen following treatment with different immune stimulants, and its expression was higher compared to that of RfIFP35 mRNA. Therefore, the modulation patterns of both RfIFP35 and RfIFN-g suggest that RfIFP35 may be induced by RfIFN-g. © 2016 Elsevier Ltd. All rights reserved.

Keywords: Antiviral Interferon induced protein-35 kDa Immune response Rockfish

1. Introduction Viral diseases are a serious threat to both natural and cultured fish populations, which lead to significant reductions in livestock and cause massive economic losses to the global aquaculture industry. Because of the growing demand for seafood, the increasing number of aquaculture operations in worldwide has provided new sources and opportunities for the rapid transmission of viral infections, which is further stimulated by the high density of fish in a limited area. If a host can effectively recognize pathogenic nucleic

* Corresponding author. Department of Marine Life Sciences, Jeju National University, Jeju Self-Governing Province 63243, Republic of Korea. E-mail address: [email protected] (J. Lee). 1 These authors contributed equally to this work. http://dx.doi.org/10.1016/j.fsi.2016.08.010 1050-4648/© 2016 Elsevier Ltd. All rights reserved.

acids, the probability of organism survival is increased. Interferons (IFNs) comprise a group of signaling proteins that belong to the cytokine family and are made and released in response to the presence of pathogens. IFNs play a role in the antiviral defense mechanism of the innate immune response in vertebrates [1]. To date, three types of IFNs have been identified (I, II, and III) based on their amino acid (aa) sequences [2] and the cognates receptors with which they interact [3,4], and two types of IFNs have been identified (I and II) according to their different biological properties [5]. Type II IFN is encoded by a single gene, whereas types I and III are encoded by multiple genes. Once cells are infected by a virus, IFNs are synthesized and secreted into the extracellular matrix in order to bind to their cognate receptor on neighboring cells [6]. This activates a signal transduction cascade that stimulates a group of antiviral proteins. Such proteins are IFN-

N.C.N. Perera et al. / Fish & Shellfish Immunology 56 (2016) 496e505

induced proteins, which include antiviral proteins, antigen presentation proteins, chemokines, GTPases, signaling proteins, heat shock proteins, and apoptotic proteins [7], and can be categorized into three main groups [5]. For instance, interferon induced protein-35 kDa (IFP35) is an antiviral protein induced by Type II IFN (IFN-g) [5]. IFP35 was initially identified in the cytoplasmic fraction, where its protein level in the mitochondrial/lysosomal and microsomal fractions was increased by IFN treatments [8]. This protein can translocate via the stimulation of IFN from the cytoplasm to the nucleus [5]. To maintain its stability, the IFP35 protein binds to the N-Myc interacting protein (Nmi), and also the ratio of casein kinase 2 interacting protein-1 (CKIP-1) to Nmi further determines the stability of IFP35 [9]. To date, the pleiotropic effects of IFP35 have not been examined in teleosts, with only limited reports in mammals. Overexpression of IFP35 can efficiently inhibit the replication of bovine foamy virus and prototype foamy virus [10], while in zary syndrome patients, IFP35 is significantly down-regulated, Se indicating its involvement in tumor suppression [11]. Substantial progress has been made in the understanding the role of teleostean IFN [4]. However, the molecular and structural characteristics of other teleostean proteins induced by IFNs are not well understood. Rockfish (Sebastes schlegelii) is a highly demanded, economically important delicacy, particularly in the Asian-Pacific region, which includes the Republic of Korea. Its production has rapidly increased and is second only to olive flounder production [12] in the Republic of Korea. However, the prevalence of infectious diseases causes adverse effects to the marine aquaculture production of rockfish and limits the ability to achieve high-quality and high-quantity production. Therefore, infectious pathogen control via rockfish innate immunity may be a crucial factor for obtaining a satisfactory production. In this study, we report the molecular and structural characterization as well as immune-stimulated transcriptional expression in rockfish IFP35 (RfIFP35) as a novel study of teleost fish. 2. Methodology 2.1. Construction of black rockfish cDNA database A black rockfish cDNA sequence database was created by 454 GS-FLX™ sequencing [13]. Total RNA was extracted from blood, liver, head kidney, gill, intestine, and spleen tissues of three black rockfish and purified using the RNeasy Mini Kit (Qiagen, USA) following the manufacturer's instructions. The extracted RNA was quantified and its purity was assessed using an Agilent 2100 Bioanalyzer (Agilent Technologies, Canada), and an RNA integration score of 7.1 was obtained. A rockfish transcriptomic library was constructed by using the fragmented RNA (~1147 bases) samples (Macrogen, Korea). 2.2. RfIFP35 cDNA sequence identification and bioinformatics analysis In order to identify the RfIFP35 cDNA sequence from the constructed black rockfish cDNA library, BLAST analysis was performed by analyzing the full-length cDNA, using DNAssist (ver. 2.2) to identify the open reading frame (ORF) and the polypeptide sequences. Using the BLAST program (http://blast.ncbi.nlm.nih.gov/ Blast.cgi), a homology search for RfIFP35 was performed, while the domains and motifs of RfIFP35 were determined using the ExPASy PROSITE (http://prosite.expasy.org/), Motif Scan (http:// myhits.isb-sib.ch/cgi-bin/motif_scan), and SMART (http://smart. embl-heidelberg.de/) databases. SignalP (http://www.cbs.dtu.dk/ services/SignalP/) was used to predict the putative cleavage site

497

of the signal peptide, while the MultiLoc tool (http://abi.inf.unituebingen.de/Services/MultiLoc/) was used to predict the cellular location of the RfIFP35 peptide. To calculate the molecular mass, isoelectric point, and instability index of the putative RfIFP35 protein, the Prot-Param tool on ExPASy (http://web.expasy.org/ protparam/) was used. The transmembrane segments of RfIFP35 were predicted using the SACS MEMSAT2 tool (http://www.sacs. ucsf.edu/cgi-bin/memsat.py). Multiple sequence alignment was conducted using ClustalW (http://www.ebi.ac.uk/Tools/msa/ clustalw2/) and the phylogenetic analysis was predicted using the Neighbor-Joining (NJ) method at MEGA (ver. 5.0). Moreover, to predict the tertiary structure of the protein sequence by predicting its folding pattern or the degree of folding, the Fold index©, online bioinformatics tool (http://bip.weizmann.ac.il/fldbin/findex) [14] was used. 2.3. Experimental fish and tissue collection Healthy rockfish (200 ± 20 g) were obtained from the aquariums at the Marine Science Institute of Jeju National University (Jeju Self Governing Province, Republic of Korea) and were acclimatized to the laboratory conditions while maintaining them in 400 L laboratory aquarium tanks filled with aerated seawater at 22 ± 1
C. For the tissue collection, five healthy rockfish were dissected aseptically. Initially, blood samples were taken (~1 mL) from each fish using sterile syringes coated with 0.2% heparin sodium salt (USB, USA), and hematic cells were immediately harvested by centrifugation at 3000  g at 4
C for 10 min. The other tissues, including the head kidney, spleen, liver, gill, intestine, kidney, muscle, skin, and heart, were carefully dissected from the fish, snap-frozen in liquid nitrogen, and stored at 80
C until total RNA extraction. 2.4. Temporal transcriptional experiments In order to determine the transcriptional responses of RfIFN-g and RfIFP35 on viral or bacterial pathogens or stimulants, healthy rockfish were used for temporal transcriptional analysis. Each group of rockfish was injected intraperitoneally with polyinosinic:polycytidylic acid (poly I:C; 1.5 mg/mL, Sigma, USA), lipopolysaccharide (LPS; 1.25 mg/mL), and the gram-positive live bacterial pathogen Streptococcus iniae (1  105 colony-forming units/mL) after suspension in 1  phosphate buffered saline (PBS) in a total volume of 200 mL. Additionally, 200 mL of 1  PBS was injected to the control group. For each treatment, blood cells and spleen tissues from five individuals were sampled at 0, 3, 6, 12, 24, 48, and 72 h after injection (p.i.), and samples were snap-frozen in liquid nitrogen and stored at 80
C until total RNA extraction. 2.5. Total RNA extraction and cDNA synthesis From a pool of tissue samples from five individual fish (~40 mg from each fish), total RNA was extracted using QIAzol® (Qiagen), following the manufacturer's protocol. Briefly, the extracted RNA of liver tissues of healthy rockfish was further purified using the

Table 1 Oligos used in the present study. Amplification

Primer sequence

RfIFP35, qPCR forward RfIFP35, qPCR reverse RfIFN-g, qPCR forward RfIFN-g, qPCR reverse RfEFA, qPCR forward RfEFA, qPCR reverse

AGGATGAGAAGGAACTGACGAAGGAGATAC TCGGGAACACTACACTTGGCTTCA AATCGGGAGCAACAAGCTTTCCG TTCGTGCAGAATCTTCGCCTGCT AACCTGACCACTGAGGTGAAGTCTG TCCTTGACGGACACGTTCTTGATGTT

498

N.C.N. Perera et al. / Fish & Shellfish Immunology 56 (2016) 496e505

Fig. 1. Domain architecture of rockfish IFP35. The nucleotide sequence (upper) and the deduced amino acid sequence (lower) are numbered. The start codon (ATG) and stop codon (TAG) are bold. Conserved domains are denoted by different symbols within the coding region. Putative ORF is denoted by a green box. Blue and red lines correspond to the two conserved NID domains. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

RNeasy Mini Kit (Qiagen). RNA purity was determined by 1.5% agarose gel electrophoresis and the absorbance was measured at 260 nm in a mDrop™ Plate (Thermo Scientific, Waltham, MA, USA)

to determine the concentration of the extracted RNA samples. Single-strand cDNA was synthesized using the PrimeScript™ firststrand cDNA synthesis kit (TaKaRa, Shiga, Japan) with purified RNA

N.C.N. Perera et al. / Fish & Shellfish Immunology 56 (2016) 496e505

499

Table 2 Homology analysis of RfIFP35 with percentage identity and similarity. Scientific name

Accession number

AA

Identity %

Similarity %

Gap %

Larimichthys crocea Fundulus heteroclitus Oryzias latipes Salmo salar Anolis carolinensis Gallus gallus Columba livia Tauraco erythrolophus Corvus brachyrhynchos Mus musculus Bos taurus Sus scrofa Homo sapiens

XP_010744566 XP_012707383 XP_011476163 NP_001135293 XP_008111379 XP_418132 XP_005513634 KFU99492 KFO52657 NP_081596 NP_001068930 XP_003358072 NP_005524

371 374 331 376 357 383 418 255 255 286 263 284 288

63.5 59.5 54.3 53.7 29.3 32.5 30.8 26.8 26.0 25.8 25.1 25.0 24.5

81.6 80.5 70.9 74.6 53.6 54.5 48.5 41.7 42.2 41.2 39.9 42.2 43.1

2.1 1.3 12.3 2.4 14.3 11.5 18.6 37.0 37.0 32.0 34.5 29.4 27.9

Fig. 2. Multiple sequence alignment of rockfish IFP35 with its vertebrate counterparts. The two orange arrows correspond to the two conserved NID domains. Residues that are identically conserved in fish species are shaded in black and the residues similarly conserved in all representative animals are shaded in pink. Identical among fish but similarly conserved among the others are denoted by a “*” mark, whereas the “:” mark denoted identical residues in all animals. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

500

N.C.N. Perera et al. / Fish & Shellfish Immunology 56 (2016) 496e505

Fig. 3. Phylogenetic analysis of RfIFP35 with its known orthologs. IFP35 sequences were aligned with representative IFP35 members from other species using MEGA5. Numbers at the nodes indicate percent bootstrap confidence values derived from 5000 replications.

Table 3 Summary of the fold index of RfIFP35 and its counterparts. Organism (IFP35)

Sebastes schelegelii Oreochromis niloticus Danio rerio Mus musculus

No. of disordered regions

No. of disordered residues (aa)

Length of the protein (aa)

Percentage of the disordered residues

Disordered/intrinsically unfolded aa percentage (%) 1st NID

2nd NID

4 6 4 1

177 117 196 15

371 374 392 286

47.70 31.28 50.00 5.24

0.00 5.74 27.58 16.85

30.68 29.88 22.98 0.00

samples in a 20 mL reaction mixture containing 2.5 mg RNA as previously described [15]. Next, the synthesized cDNA was diluted 40-fold in nuclease-free water and stored at 20
C until use in quantitative real-time polymerase chain reaction (qPCR) assays. 2.6. Expressional analysis Differential expression patterns of RfIFN-g and RfIFP35 following immune challenges were assessed by qPCR in a Thermal Cycler Dice™ Real Time System (TaKaRa, Japan). Reactions were carried out in a 10 mL volume containing 3 mL diluted cDNA template, 5 mL 2  TaKaRa Ex Taq™ SYBR premix, 0.4 mL each of the forward and reverse primers (10 mM), and 1.2 mL H2O. Briefly, the reaction was performed using the following profile: one cycle at 95
C for 10 s, followed by 35 cycles at 95
C for 5 s, 58
C for 10 s, and 72
C for 20 s, and a final single cycle at 95
C for 15 s, 60
C for 30 s, and 95
C for 15 s. Assays were conducted in triplicate. The relative expression of RfIFN-g and RfIFP35 were determined using the Livak method [16], with the rockfish elongation factor 1a (RfEF1A) gene as an internal reference (GenBank ID: KF430623). The gene-specific primers used for qPCR analysis are listed in Table 1. All data are presented in terms of RfIFN-g and RfIFP35 mRNA expression relative to RfEF1A mRNA expression and are expressed as the mean ± standard deviation (SD). In RfIFP35 spatial expressional analysis, the muscle was considered as basal expression, and the relative level of RfIFP35 tissue expression was determined in each tissue. In temporal expressional analysis of RfIFN-g

and RfIFP35, the untreated (0 h) control was considered to indicate the basal transcriptional level, and post-immune challenge expression was compared with the corresponding PBS-injected controls. The significance of the obtained data were determined by statistical analysis with the two-tailed un-paired t-test by using the GraphPad program (GraphPad Software, Inc., La Jolla, CA, USA). Significant differences were defined as P < 0.05.

3. Results 3.1. Rockfish cDNA library and RfIFP35 gene identification The constructed black rockfish cDNA library revealed the putative full-length cDNA sequence of RfIFP35 (GenBank accession No: KU665492), which contained an ORF of 1113 nucleotides and a 50 untranslated region (UTR) of 23 nucleotides and 30 UTR of 868 nucleotides. Protparam results revealed that the protein contained 371 aa with a predicted molecular mass of 42.2 kDa. The deduced mature RfIFP35 protein had a theoretical pI of 5.05 and was predicted to be unstable because of its high instability index (49.37). Cellular location prediction showed that the RfIFP35 protein was a cytosolic with an accuracy of 93%. According to signal peptide analysis, there was no putative signal peptide in the RfIFP35 protein; additionally, the transmembrane prediction program predicted no transmembrane region in this protein.

N.C.N. Perera et al. / Fish & Shellfish Immunology 56 (2016) 496e505

501

Fig. 4. Graphical representation of folding predictions of RfIFP35 (A) and its counterparts O. niloticus (B), D. rerio (C), and Mus musculus (D). The two NID domains are marked accordingly.

3.2. Biological computational analysis of RfIFP35: sequence and molecular characterization In silico analysis showed that the RfIFP35 aa sequence contains two characteristic Nmi/IFP 35 domains (NIDs) at 162e248 and 259e346, which is a common feature shared by other IFP35 homologs (Fig. 1). According to the 2Zip server (http://2zip.molgen. mpg.de/index.html), there are no leucine zipper domains in the RfIFP35 protein. Pairwise comparison of the RfIFP35 protein with other homologs showed identity of 63.5% with Larimichthys crocea (fish), 32.5% with Gallus gallus (bird), 29.3% with Anolis carolinensis (reptile), and 25.8% with Mus musculus (mammal). The similarities were 81.6, 54.5, 53.6, and 41.2%, respectively (Table 2). Results of multiple sequence alignment analysis reveal that the two NID domains of RfIFP35 were mostly conserved among the other IFP35 counterparts (Fig. 2). In order to determine the evolutionary relationship of RfIFP35, the phylogenetic tree was analyzed including the other homologs of IFP35 (Fig. 3). The phylogenetic tree consisted of two main clusters, separating the higher vertebrates and lower vertebrates. One cluster contained the IFP35 counterparts from aves and mammals, whereas the other cluster contained IFP35s counterparts

from fish and reptiles. Moreover, RfIFP35 belongs to the fish IFP35 group, as it was positioned with the corresponding fish counterparts. Interestingly, all the other IFP35 counterparts from different taxa formed separate sub clusters according to their orthodox taxonomy.

3.3. Protein folding prediction of RfIFP35 and its homologs Based on the average hydrophobicity and the absolute net charge of the amino acids, the foldability of the given amino acid sequence was determined using Foldindex©. This simple tool can be used to predict whether a given protein sequence is intrinsically unfolded. Four disordered regions were identified in RfIFP35, which were composed of 177 aa residues, accounting for 47.7% of the sequence (Table 3). Additionally, the two NID domains of RfIFP35 were located among the mostly folded region (Fig. 4) where there were no intrinsically unfolded residues in the first NID domain, but 30.68% of the disordered residues were in the second NID domain. Similarly, two NID domains of O. niloticus IFP35 and D. rerio IFP35 and single NID domain of M. musculus IFP35 were positioned near the mostly folded region.

502

N.C.N. Perera et al. / Fish & Shellfish Immunology 56 (2016) 496e505

Fig. 5. Constitutive mRNA expression of rockfish IFP35 in tissues of healthy juveniles. Tissue distribution of RfIFP35 tissue-specific expression in blood (Bl), spleen (Sp), liver (Li), intestine (In), heart (Ht), head kidney (HK), kidney (Ki), gill (Gl), skin (Sk), and muscle (Ms) collected from unchallenged rockfish were analyzed using qPCR. The calculation was performed using the Livak method and the values were calibrated against the mRNA level in the skin. Data are presented as mean values (N ¼ 3), with error bars representing standard deviation (SD).

3.4. Quantitative analysis of transcriptional distribution of RfIFP35 The RfIFP35 mRNA tissue distribution in healthy rockfish was analyzed by qPCR in order to determine the abundance of the transcripts in different tissues. The ubiquitous expression in each tissue was observed (including in the blood, spleen, liver, intestine, heart, head kidney, kidney, gill, skin, and muscle). RfIFP35 expression was significantly higher (P < 0.05) in the blood tissue (162fold), followed by the spleen and liver (Fig. 5). 3.5. Transcriptional response of RfIFN-g and RfIFP35 against immune stimulants and live pathogens Because the blood tissue followed by the spleen showed the highest relative RfIFP35 mRNA expression levels, temporal expression was analyzed in the blood tissue (Fig. 6A) and in the spleen tissue (Fig. 6B) to examine the immune response of RfIFN-g and RfIFP35 with live pathogens and immune stimulants. According to the temporal transcription profiles of both RfIFN-g and RfIFP35, significant expressions were observed from 6 h p.i. in blood tissue. Yet RfIFP35 transcripts were shown lower magnitude compared to the RfIFN-g. When considering the temporal transcriptional profiles in spleen tissue, significant upregulation of both RfIFN-g and RfIFP35 were observed from 3 h p.i. upon each immune stimulant. Similar to the transcriptional expression in blood tissue, the RfIFP35 transcripts were shown lower magnitude compared to the RfIFN-g in spleen tissue as well. Nonetheless, S. iniae stimulation showed much lower transcriptional levels of RfIFP35 in both blood and spleen tissues but, expression levels of RfIFN-g upon S. iniae were not lowered as RfIFP35 expression. 4. Discussion Studies focusing on defense mechanisms in innate immune system have important industrial applications, where severe

problems have been created by the spread of pathogenic infections caused by intensive culturing conditions of marine organisms. Therefore, it is essential to understand the immune responses of teleosts in order to maintain immunological balance. In the innate immune response, IFP35 plays a crucial role as an antiviral protein that interferes with viral transcription by interacting with viral regulatory proteins [10]. Though several IFP35 proteins from mammals have been studied, the fish IFP35 proteins have not been well characterized yet. In the present study, we have characterized and investigated the immunomodulatory effects of IFP35 from rockfish. RfIFP35 is a pleiotropic protein composed of 371 aa, and corresponding polypeptides in most organisms range from 371 to 382 aa. In accordance with the IFP35 immunolocalization results [10,17,18] the RfIFP35 can be identified as a cytosolic protein where the absence of signal sequence also indicates its intracellular antiviral role in rockfish. The presence of two NID domains in RfIFP35 suggested its ability to participate in Nmi-Nmi protein interactions, which likely contributes to its subcellular localization, as previously described by Chen J. et al. [8]. In addition, the stability of IFP35 upholds via the interactions with Nmi proteins, which are facilitated by the presence of NID domains in the IFP35 molecule [8]. Moreover, Zhang L. et al. [9] reported that IFP35 could regulate cytokine signaling by interacting with CKIP-1 and Nmi through the NID domains. In fact, the presence of two NID domains in RfIFP35 suggests that there is an as yet unidentified cytokine signaling response in teleosts. Therefore, these conserved NID domains are important for the interactions and biochemical mechanisms of IFP35 in rockfish, including protein stability. According to the leucine zipper analysis, there are no leucine zipper motifs in RfIFP35, even though this is a predominant characteristic feature identified in IFP35 mammalian counterparts in several studies [5,10]. Homodomain leucine zipper proteins typically function as transcription factors that regulate genes involved in various interactions with other proteins [19], including in abiotic stress responses [20]. Several studies have examined the structural characteristics of IFP35, demonstrating that it contains a leucine zipper motif in an alpha-helical configuration [5]. No leucine motif was identified in RfIFP35; likewise, the available fish IFP35 sequences in the NCBI database (XP_003442654, XP_007562168, KKF31655, XP_688060, NP_001135293, and KPP71121) also do not possess a leucine zipper motif. Therefore, the leucine zipper motif might not exist in teleosts. However, the biological functions that are mediated by leucine zipper motifs have yet to be examined in teleosts. RfIFP35 showed a relatively high aa sequence identity with other fish homologs but low identity with homologs in reptiles, birds, and mammals, indicating the uniqueness of teleost IFP35. In the phylogenetic analysis, the clustering pattern confirmed that the RfIFP35 homolog has diverged from a common ancestor of other fish IFP35s. The comparative analysis in the current study also demonstrated the unique characteristics of RfIFP35, as evidenced by its distinct position in a cluster with other fish homologs, and confirmed that this rockfish protein is an IFP35 protein. The results of the pairwise alignment, multiple sequence alignment, and phylogenetic analysis showed that RfIFP35 is closely related to its teleost counterparts, suggesting that their structures and functions may be similar. However, further studies are needed to examine the function of teleostean IFP35 proteins. The folding index showed that RfIFP35 has the second highest percentage of disordered residues compared to mammals. In addition, the second NID domain in all teleost IFP35 proteins except for Danio rerio showed a very high percentage of disordered or intrinsically unfolded regions (Table 3). Disordered regions of a protein function by forming different protein complexes via

N.C.N. Perera et al. / Fish & Shellfish Immunology 56 (2016) 496e505

503

Fig. 6. Transcriptional levels of RfIFN-g and IFP35 in blood (A) and spleen (B) tissues after in vivo challenge with polyI:C, LPS, and S. iniae. Data are presented as mean values (N ¼ 3), with error bars representing the SD. *represents a significant difference at P < 0.05.

disorder-to-order transitions; for example, in enzymes that bind substrates and in receptor-ligand, protein-protein, protein-RNA, and protein-DNA interactions [21]. Moreover, protein phosphorylation in intrinsically disordered regions serves to regulate a large

number of protein interactions facilitated by intrinsically disordered proteins [22,23]. According to Chen J. et al. [8], the NID domain interacts with different proteins, and these intrinsically disordered regions may be important for these protein-protein

504

N.C.N. Perera et al. / Fish & Shellfish Immunology 56 (2016) 496e505

interactions and activity. Therefore, the flexibility of RfIFP35 when associated with other proteins or domains is quite high, which may reduce the entropic cost of protein interactions [24]. Thus, this structural feature is more important for RfIFP35, as it interacts with many other proteins to exert its biological functions. The basal tissue expression experiment showed ubiquitous expression of RfIFP35 transcripts in black rockfish where highest RfIFP35 expression was in blood. Some peripheral blood mononuclear cells can activate IFN production as response to engulfed foreign DNA [2]. In addition, IFP35 has been shown to be expressed in cells of human peripheral blood mononuclear cells after treatment with IFN-g [5]. Thus, IFP35 may be highly expressed in blood cells. Additionally, blood contains a pool of immune-related cells that can assist in defense mechanisms against blood-borne pathogens [25]. Because IFP35 is a well-known immune gene, RfIFP35 may be highly expressed in blood tissue. The tissue with the second highest RfIFP35 expression levels was the spleen, which was followed by the liver. The spleen is involved in both the innate and adaptive immune responses, and its structure enables removal of older erythrocytes from circulation; thus, it also efficiently removes blood-borne microorganisms [26]. In addition, the liver is a vital immune organ in vertebrates, and also intrahepatic immune cells in the teleost liver are important for the immune response as well [27]. In fact, these results suggest that RfIFP35 is an immune-related gene expressed in immune organs. To understand the innate immune response and explore the possible biological activities of RfIFP35 upon pathogen stress, we examined the modulation of RfIFP35 transcription in the blood and spleen following exposure to an immune stimulant during viral and bacterial invasion. Additionally, to determine the relationship between RfIFN-g and RfIFP35, the transcriptional modulation of RfIFNg was also analyzed in blood and spleen tissues. RfIFN-g and RfIFP35 mRNA expression levels were significantly upregulated in the blood and spleen during the early phase after poly I:C treatment, indicating that these genes have pleiotropic effects in response to viral mimics. Other studies showed that poly I:C is a synthetic analog and potent inducer of IFN [28,29] that is used as a viral mimic. Poly I:C binds to viral sensors and induces immunoinflammatory responses, similar to those that occur during viral infection, and may promote the production of IFN through activation of NF-kB [30]. Moreover, studies on the anatomical context of IFP35 showed IFP35 mRNA induction in diverse populations of cells, such as fibroblasts, macrophages, and epithelial cells, and increased IFP35 expression in HeLa cells following IFN-g treatment [5]. Indeed, blood and spleen are rich in fibroblasts and macrophages [26,31], and RfIFP35 transcripts were induced in rockfish blood and spleen by poly I:C. Interestingly, previous studies showed that IFN-inducible genes like Mx are rapidly and transiently induced by poly I:C treatment in European perch and rainbow trout [32,33]. Therefore, these findings show that poly I:C increased the expressions of RfIFN-g and IFN-inducible RfIFP35 as an antiviral response. LPS is a well-known in vivo and in vitro IFN-inducer in higher vertebrates [34]. S. iniae is a well-recognized gram-positive fish pathogen that causes an invasive disease, with out-breaks in aquaculture farms [35]. It can cause deadly infectious diseases in farmed marine fin fish species [36]. In addition, streptococcicosis is currently prevalent disease in cultured rockfish in Republic of Korea [37]. Therefore, LPS (immune-stimulant) and S. iniae (live pathogen) were also used in the time-course experiment examining the immune-responsive expression of RfIFN-g and RfIFP35, which was classified as an antibacterial response. The results of the LPS and S. iniae experiment for RfIFN-g and RfIFP35 in the current study were the same as those observed for Type I IFN gene induction in rock bream [38]. This suggests the IFP35 may function in teleost bacterial immune responses as well. In the LPS challenge

experiment, the highest RfIFN-g and RfIFP35 transcript inductions were observed in the early phase of the response in the spleen, whereas for the S. iniae treatment, the highest inductions were observed in late phase. Similar to what were observed for RfIFN-g and RfIFP35 in the present study, it was previously reported that rainbow trout RTS-11 cells showed significant induction of IFN (2C- and 4C-IFNs) following short-term LPS stimulation [39]. However, RfIFP35 was poorly transcribed in both the blood and spleen tissues after S. iniae challenge compared to after LPS challenge. This difference in RfIFP35 modulation upon these stimulants may be due to the biological difference between gram-positive (S. iniae) and gram-negative (LPS) bacterial stimulants. Interestingly, RfIFN-g mRNA expression was observed with the expression of RfIFP35, but the higher magnitudes of RfIFN-g expression suggest that RfIFP35 may be induced by RfIFN-g. However, the roles of IFNs and interferon-induced genes in the host response to bacterial infection are not fully understood. The transcriptional modulation results for RfIFP35 suggest that it may respond to both viral and bacterial infections with a differential pattern in a challenge dependent manner. 5. Conclusions In conclusions, the RfIFP35 putative complete cDNA sequence was identified from the cDNA database and fully characterized as the first teleostean IFP35 counterpart. Characterization on the molecular levels revealed the typical features reported in previous publications as well as contrary features. The relatively higher expression of RfIFP35 mRNA observed in the blood, followed by spleen tissues, indicates the importance of the blood and spleen in the immune system of rockfish. In addition, transcriptional modulation under immune stimulants and live pathogens indicated a possible signaling role in the antiviral defense mechanism. Moreover, the induced immune responsive profiles of RfIFN-g and RfIFP35 suggested that RfIFP35 may be induced by RfIFN-g. Furthermore, we discussed the induction of RfIFP35 following LPS treatment, providing a direction for future studies of the functional roles of interferon-inducible genes in antibacterial defense mechanism. Acknowledgements This research was a part of the project titled ‘Fish Vaccine Research Center’, funded by the Ministry of Oceans and Fisheries, Korea and supported by a grant from Marine Biotechnology Program (PJT200620, Genome Analysis of Marine Organisms and Development of Functional Applications) funded by Ministry of Oceans and Fisheries, Korea References [1] M. De Andrea, R. Ravera, D. Gioia, M. Gariglio, S. Landolfo, The interferon system: an overview, Eur. J. Paediatr. Neurol. 6 (Suppl A) (2002). A41e6;discussion A55e8. [2] R.E. Randall, S. Goodbourn, Interferons and viruses: an interplay between induction, signalling, antiviral responses and virus countermeasures, J. Gen. Virol. 89 (2008) 1e47. [3] A.J. Sadler, B.R. Williams, Interferon-inducible antiviral effectors, Nat. Rev. Immunol. 8 (2008) 559e568. [4] J. Zou, C.J. Secombes, Teleost fish interferons and their role in immunity, Dev. Comp. Immunol. 35 (2011) 1376e1387. [5] F.C. Bange, U. Vogel, T. Flohr, M. Kiekenbeck, B. Denecke, E.C. Bottger, IFP 35 is an interferon-induced leucine zipper protein that undergoes interferonregulated cellular redistribution, J. Biol. Chem. 269 (1994) 1091e1098. [6] S.M. Altmann, M.T. Mellon, D.L. Distel, C.H. Kim, Molecular and functional analysis of an interferon gene from the zebrafish, Danio rerio, J. Virol. 77 (2003) 1992e2002. [7] G.C. Sen, Novel functions of interferon-induced proteins, Semin. Cancer Biol. 10 (2000) 93e101.

N.C.N. Perera et al. / Fish & Shellfish Immunology 56 (2016) 496e505 [8] J. Chen, R.L. Shpall, A. Meyerdierks, M. Hagemeier, E.C. Bottger, L. Naumovski, Interferon-inducible Myc/STAT-interacting protein Nmi associates with IFP 35 into a high molecular mass complex and inhibits proteasome-mediated degradation of IFP 35, J. Biol. Chem. 275 (2000) 36278e36284. [9] L. Zhang, Y. Tang, Y. Tie, C. Tian, J. Wang, Y. Dong, et al., The PH domain containing protein CKIP-1 binds to IFP35 and Nmi and is involved in cytokine signaling, Cell Signal 19 (2007) 932e944. [10] J. Tan, W. Qiao, J. Wang, F. Xu, Y. Li, J. Zhou, et al., IFP35 is involved in the antiviral function of interferon by association with the viral tas transactivator of bovine foamy virus, J. Virol. 82 (2008) 4275e4283. [11] R.G. Pomerantz, E.D. Mirvish, G. Erdos, L.D. Falo Jr., L.J. Geskin, Novel approach to gene expression profiling in Sezary syndrome, Br. J. Dermatol. 163 (2010) 1090e1094. [12] S.-M. Lee, I.G. Jeon, J.Y. Lee, Effects of digestible protein and lipid levels in practical diets on growth, protein utilization and body composition of juvenile rockfish (Sebastes schlegeli), Aquaculture 211 (2001) 227e239. [13] M. Droege, B. Hill, The Genome Sequencer FLX Systemelonger reads, more applications, straight forward bioinformatics and more complete data sets, J. Biotechnol. 136 (2008) 3e10. [14] J. Prilusky, C.E. Felder, T. Zeev-Ben-Mordehai, E.H. Rydberg, O. Man, J.S. Beckmann, et al., FoldIndex: a simple tool to predict whether a given protein sequence is intrinsically unfolded, Bioinformatics 21 (2005) 3435e3438. [15] G.I. Godahewa, W.D. Wickramaarachchi, I. Whang, S.D. Bathige, B.S. Lim, C.Y. Choi, et al., Two carboxypeptidase counterparts from rock bream (Oplegnathus fasciatus): molecular characterization, genomic arrangement and immune responses upon pathogenic stresses, Vet. Immunol. Immunopathol. 162 (2014) 180e191. [16] K.J. Livak, T.D. Schmittgen, Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method, Methods 25 (2001) 402e408. [17] A. Das, P.X. Dinh, D. Panda, A.K. Pattnaik, Interferon-inducible protein IFI35 negatively regulates RIG-I antiviral signaling and supports vesicular stomatitis virus replication, J. Virol. 88 (2014) 3103e3113. [18] X. Zhou, J. Liao, A. Meyerdierks, L. Feng, L. Naumovski, E.C. Bottger, et al., Interferon-alpha induces nmi-IFP35 heterodimeric complex formation that is affected by the phosphorylation of IFP35, J. Biol. Chem. 275 (2000) 21364e21371. [19] D. Garcia de Viedma, R. Giraldo, G. Rivas, E. Fernandez-Tresguerres, R. DiazOrejas, A leucine zipper motif determines different functions in a DNA replication protein, EMBO J. 15 (1996) 925e934. [20] M. Elhiti, C. Stasolla, Structure and function of homodomain-leucine zipper (HD-Zip) proteins, Plant Signal. Behav. 4 (2009) 86e88. [21] P. Romero, Z. Obradovic, C.R. Kissinger, J.E. Villafranca, E. Garner, S. Guilliot, et al., Thousands of proteins likely to have long disordered regions, Pac Symp. Biocomput (1998) 437e448. [22] P.E. Wright, H.J. Dyson, Intrinsically unstructured proteins: re-assessing the protein structure-function paradigm, J. Mol. Biol. 293 (1999) 321e331. [23] M.O. Collins, L. Yu, I. Campuzano, S.G. Grant, J.S. Choudhary, Phosphoproteomic

[24] [25] [26] [27]

[28] [29]

[30]

[31]

[32]

[33] [34]

[35]

[36]

[37] [38]

[39]

505

analysis of the mouse brain cytosol reveals a predominance of protein phosphorylation in regions of intrinsic sequence disorder, Mol. Cell Proteom. 7 (2008) 1331e1348. C. Bracken, NMR spin relaxation methods for characterization of disorder and folding in proteins, J. Mol. Graph Model. 19 (2001) 3e12. J. Parkin, B. Cohen, An overview of the immune system, Lancet 357 (2001) 1777e1789. R.E. Mebius, G. Kraal, Structure and function of the spleen, Nat. Rev. Immunol. 5 (2005) 606e616. A.M. Moller, T. Korytar, B. Kollner, H. Schmidt-Posthaus, H. Segner, The teleostean liver as an immunological organ: intrahepatic immune cells (IHICs) in healthy and benzo[a]pyrene challenged rainbow trout (Oncorhynchus mykiss), Dev. Comp. Immunol. 46 (2014) 518e529. A.E. Ellis, Innate host defense mechanisms of fish against viruses and bacteria, Dev. Comp. Immunol. 25 (2001) 827e839. A.K. Field, A.A. Tytell, G.P. Lampson, M.R. Hilleman, Inducers of interferon and host resistance. II. Multistranded synthetic polynucleotide complexes, Proc. Natl. Acad. Sci. U. S. A. 58 (1967) 1004e1010. K. Li, Z. Chen, N. Kato, M. Gale Jr., S.M. Lemon, Distinct poly(I-C) and virusactivated signaling pathways leading to interferon-beta production in hepatocytes, J. Biol. Chem. 280 (2005) 16739e16747. S. Zanussi, C. Simonelli, M.T. Bortolin, M. D'Andrea, C. Crepaldi, E. Vaccher, et al., Immunological changes in peripheral blood and in lymphoid tissue after treatment of HIV-infected subjects with highly active anti-retroviral therapy (HAART) or HAART þ IL-2, Clin. Exp. Immunol. 116 (1999) 486e492. P. Staeheli, Y.X. Yu, R. Grob, O. Haller, A double-stranded RNA-inducible fish gene homologous to the murine influenza virus resistance gene Mx, Mol. Cell Biol. 9 (1989) 3117e3121. G.D. Trobridge, J.A. Leong, Characterization of a rainbow trout Mx gene, J. Interferon Cytokine Res. 15 (1995) 691e702. N.B. Finter, Interferons and Interferon Inducers, North-Holland Publishing Company/American Elsevier Publishing Company, Amsterdame-London/New York, 1975. D.E. Low, E. Liu, R.J. Fulle, A. McGeer, Streptococcus iniae: an Emerging Pathogen in the Aquaculture Industry. Washington, ASM Press, Washington, DC, 2009. W. Agnew, A.C. Barnes, Streptococcus iniae: an aquatic pathogen of global veterinary significance and a challenging candidate for reliable vaccination, Vet. Microbiol. 122 (2007) 1e15. S.I. Park, Disease control in Korean aquaculture, Fish. Pathol. 44 (2009) 19e23. Q. Wan, W.D. Wicramaarachchi, I. Whang, B.S. Lim, M.J. Oh, S.J. Jung, et al., Molecular cloning and functional characterization of two duplicated twocysteine containing type I interferon genes in rock bream Oplegnathus fasciatus, Fish. Shellfish Immunol. 33 (2012) 886e898. M. Chang, P. Nie, B. Collet, C.J. Secombes, J. Zou, Identification of an additional two-cysteine containing type I interferon in rainbow trout Oncorhynchus mykiss provides evidence of a major gene duplication event within this gene family in teleosts, Immunogenetics 61 (2009) 315e325.