Transcriptional profiling, molecular cloning, and functional analysis of C1 inhibitor, the main regulator of the complement system in black rockfish, Sebastes schlegelii

Fish and Shellfish Immunology 75 (2018) 263–273

Contents lists available at ScienceDirect

Fish and Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi

Full length article

Transcriptional profiling, molecular cloning, and functional analysis of C1 inhibitor, the main regulator of the complement system in black rockfish, Sebastes schlegelii

T

Jehanathan Nilojana, S.D.N.K. Bathigeb, W.S. Thulasithac, Hyukjae Kwona, Sumi Junga, Myoung-Jin Kima, Bo-Hye Namd, Jehee Leea,∗ a

Department of Marine Life Sciences & Fish Vaccine Research Center, Jeju National University, Jeju Self-Governing Province, 63243, Republic of Korea Sri Lanka Institute of Nanotechnology (SLINTEC), Nanotechnology and Science Park, Mahenwatta, Pitipana, Homagama, Sri Lanka Department of Zoology, University of Jaffna, Jaffna, 40000, Sri Lanka d Biotechnology Research Division, National Institute of Fisheries Science, 408-1 Sirang-ri, Gijang-up, Gijang-gun, Busan, 46083, Republic of Korea b c

A R T I C L E I N F O

A B S T R A C T

Keywords: Complement system C1-inhibitor Anti-protease activity Serpin Black rockfish

C1-inhibitor (C1inh) plays a crucial role in assuring homeostasis and is the central regulator of the complement activation involved in immunity and inflammation. A C1-inhibitor gene from Sebastes schlegelii was identified and designated as SsC1inh. The identified genomic DNA and cDNA sequences were 6837 bp and 2161 bp, respectively. The genomic DNA possessed 11 exons, interrupted by 10 introns. The amino acid sequence possessed two immunoglobulin-like domains and a serpin domain. Multiple sequence alignment revealed that the serpin domain of SsC1inh was highly conserved among analyzed species where the two immunoglobulin-like domains showed divergence. The distinctiveness of teleost C1inh from other homologs was indicated by the phylogenetic analysis, genomic DNA organization, and their extended N-terminal amino acid sequences. Under normal physiological conditions, SsC1inh mRNA was most expressed in the liver, followed by the gills. The involvement of SsC1inh in homeostasis was demonstrated by modulated transcription profiles in the liver and spleen upon pathogenic stress by different immune stimulants. The protease inhibitory potential of recombinant SsC1inh (rSsC1inh) and the potentiation effect of heparin on rSsC1inh was demonstrated against C1esterase and thrombin. For the first time, the anti-protease activity of the teleost C1inh against its natural substrates C1r and C1s was proved in this study. The protease assay conducted with recombinant black rockfish C1r and C1s proteins in the presence or absence of rSsC1inh showed that the activities of both proteases were significantly diminished by rSsC1inh. Taken together, results from the present study indicate that SsC1inh actively plays a significant role in maintaining homeostasis in the immune system of black rock fish.

1. Introduction

and receptors that inhibit complement activation, named regulators of complement activation (RCA) [7]. The complement system can be activated by three pathways, termed the classical, alternative, and lectin pathways. Activation of the classical pathway is initiated by antibody binding to the corresponding antigen [8]. The alternative pathway is triggered by microbial surfaces and a variety of complex polysaccharides leading to spontaneous hydrolysis of the putative thioester bond in complement component 3 (C3) [9,10]. The lectin pathway is activated by binding of mannan-binding lectins or ficolins to pathogen associated molecular patterns (PAMP) present on the surface of microorganisms in an antibody independent manner [11]. Complement reactions proceed in a sequential manner through the proteolytic cleavage of a series of inactive protease zymogens that are linked and

The complement system plays a significant role in eradicating pathogenic infections as a central component of innate immunity, and also acts as a bridge between the innate and adaptive immune systems [1,2]. Complement activation is an efficient mode of clearing invading pathogens. At the same time, the role of inappropriate complement activation in pathogenesis has been demonstrated using both knockout [3,4] and transgenic [5,6] animal models. As uncontrolled activation may cause tissue damage leading to serious pathological conditions arising from bio-incompatibility, it is crucial to limit this activity through tight regulation in assuring homeostasis [7]. For this purpose, the complement system consists of an array of soluble plasma proteins

∗

Corresponding author. Marine Molecular Genetics Lab, Department of Marine Life Sciences, Jeju National University, Jeju Self-Governing Province 63243, Republic of Korea. E-mail address: [email protected] (J. Lee).

https://doi.org/10.1016/j.fsi.2018.02.018 Received 15 December 2017; Received in revised form 6 February 2018; Accepted 8 February 2018 Available online 11 February 2018 1050-4648/ © 2018 Published by Elsevier Ltd.

Fish and Shellfish Immunology 75 (2018) 263–273

J. Nilojan et al.

(BLAST) algorithm (https://blast.ncbi.nlm.nih.gov/Blast.cgi).

activated as a cascade. This leads to the generation of active products that mediate various biological activities, such as inflammation and vascular permeability, through their interaction with specific cellular receptors and other serum proteins [12]. The complement component 1 inhibitor (C1inh) is a protease inhibitor of the serpin family, which contorts the active site of target proteinases, making them inactive by the conformational change actuated in the serpin upon peptide bond cleavage [13]. It is one of the major regulators of the classical complement pathway, controlling vascular permeability and suppressing inflammation by inactivating C1r and C1s proteases. It inhibits the activated form of these initial proteases through the classical complement pathway by forming a stable complex, and is the only inhibitor to act on these proteases [14]. Additionally, C1inh regulates the lectin pathway by inhibiting mannanbinding lectin-associated serine proteases (MASPs) [15]. It also controls contact activation by regulating plasma kallikrein and activated factor XII, an intrinsic coagulation system, by inhibiting activated factor XI and fibrinolytic proteases such as plasmin and tissue plasminogen activator [16]. The therapeutic capacity of C1inh against sepsis, vascular leak syndrome, acute myocardial infarction, endotoxin shock, and hereditary angioedema (HAE) has been reported [7,16]. Characterization has been conducted in a few mammals, including mice and human [17,18] and in some fish species, such as Nile tilapia, rock bream, and large yellow croakers [19–21]. In this study, for the first time we have proved the functional inhibitory potential of the teleostean C1-inhibitor on its direct substrates C1r and C1s in black rockfish. Black rockfish (Sebastes schlegelii) is one of the important aquaculture fish species in the Republic of Korea. In recent years, it has been reported that the aquaculture industry faces severe production loss due to pathogenic bacterial infections [22–24]. Therefore, understanding the molecular mechanisms in immunity could be an appropriate way to find a remedy for pathogenic attack. The present study discusses the identification, in silico and functional characterization of C1inh from black rockfish (SsC1inh) at the genomic, transcriptomic, and proteomic levels. Protease inhibition by recombinant SsC1inh (rSsC1inh) was exhibited by a protease assay using black rockfish recombinant proteins C1r (rSsC1r) and C1s (rSsC1s) as substrates, to delineate that the C1inh in black rockfish is functionally active and involved in the immunity mechanism of black rock fish.

2.2. Identification of SsC1inh cDNA from transcriptome database The cDNA sequence of rockfish C1inh (MG551291) was identified from our previously constructed rockfish transcriptome database [25] using the BLAST algorithm (https://blast.ncbi.nlm.nih.gov/Blast.cgi), and was termed SsC1inh. 2.3. In silico characterization of SsC1inh DNAssist (version 2.2) was used to predict the open reading frame (ORF) and the encoded amino acid sequence. Homologous protein sequences for SsC1inh were identified using BLAST. Pairwise sequence alignment and multiple sequence alignment with other organisms were conducted using EMBOSS Needle (https://www.ebi.ac.uk/Tools/psa/ emboss_needle/) and the ClustalW multiple alignment application of BioEdit sequence alignment editor software, respectively. The SignalP program (http://www.cbs.dtu.dk/services/SignalP/) was applied to check for the presence of signal peptides. Using the ExPASy ProtParam tool (http://web.expasy.org/protparam), the physical and chemical parameters of SsC1inh were predicted. The DISULFIND server (http:// disulfind.disi.unitn.it/) was used to assess the occurrence of possible cysteine disulfide bonds. The tertiary structure of the SsC1inh serpin domain was generated with the SWISS-MODEL online tool (https:// swissmodel.expasy.org/), using the crystal structure of the latent human C1-inhibitor serpin domain (PDB ID: 2oay.1) as a template. The most suitable model was chosen based on the confidence score (Cscore), which estimates the quality of predicted models, and the structure was further developed using PyMOL molecular graphic software version 1.7.4. Pairwise structural comparison was carried out with the DALI protein structure comparison server (http://ekhidna2. biocenter.helsinki.fi/dali/index.html#tabs-2). A phylogenetic tree was constructed using the MEGA 6.0 package (http://www. 141megasoftware.net/). To deduce the confidence value for the phylogenetic analysis, bootstrap trials were replicated 5000 times. The exon-intron structure was constructed using the gene mapper tool version 2.5 by analyzing the genomic DNA and complementary DNA sequences.

2. Materials and methods

2.4. Cloning, recombinant expression, and purification of the putative SsC1inh protein

2.1. Identification of SsC1inh gDNA A pair of sequence-specific forward and reverse primers, containing adapter nucleotide sequences with EcoRI and HindIII restriction recognition sites, respectively, at their 5′ ends, were designed (Table 1) to amplify the sequence encoding the complete SsC1inh mature peptide for cloning into the pMAL-c5X expression vector (New England Biolabs, Ipswich, MA, USA). To amplify the coding sequence, PCR was carried out in a 50 μL reaction mixture with the designed primers and ExTaq polymerase (TaKaRa, Japan) using cDNA isolated from the liver as a template. PCR conditions were set with initial denaturation at 94 °C for 3 min, 35 cycles of amplification at 94 °C for 30 s, 60 °C for 30 s, and 72 °C for 1 min, with a final extension at 72 °C for 5 min. The PCR product was resolved on 1.5% agarose gel and an AccuPrep® gel

The rock fish genomic DNA library was constructed using the de novo genome assembly method. Briefly, sequencing libraries were made using the mate-pair and illumina paired-end library preparation protocols (Illumina, San Diego, CA, USA), and were subjected to size selection for illumina MiSeq and NextSeq sequencing. Using the PacBio manufacture protocols (Pacific Biosciences, CA, USA) the sequencing libraries were prepared to obtain long non-fragmented DNA sequences. Finally, the curated transcripts and genes from the consensus gene model were subjected to functional annotation. The genomic DNA sequence of SsC1inh (MG551291) was picked out from the rock fish genomic DNA library using the Basic Local Alignment Search Tool Table 1 Primers used in this study. Name

Sequence (5′–3′)

Description

SsC1inh-F SsC1inh-R SsEF1α-F SsEF1α-R SsC1inh-CF SsC1inh-CR

GGTGAGGGTGCCGATTCTCTATCA TGTAAAGACTGCTGTCACCCGAGAG AACCTGACCACTGAGGTGAAGTCTG TCCTTGACGGACACGTTCTTGATGTT GAGAGAgaattcGTAAATCTCCAGGTGGTACCTGGTTCCA GAGAGAaagcttTCATGGCTCGGTCACTCTGCC

qPCR screening forward primer qPCR screening reverse primer qPCR screening forward primer qPCR screening reverse primer Cloning forward primer Cloning reverse primer

264

Fish and Shellfish Immunology 75 (2018) 263–273

J. Nilojan et al.

respectively.

purification kit (Bioneer Co., Korea) was used to purify the PCR product. The purified PCR product and pMAL-c5X vector were simultaneously double digested with EcoRI and HindIII endonucleases and were purified with the AccuPrep® gel purification kit (Bioneer Co., Korea). The double digested PCR products were ligated into the pMALc5X vector using a Mighty Mix DNA ligation kit (Takara, Japan), by incubating at 16 °C for 30 min. The recombinant vectors were then introduced into Escherichia coli DH5α-competent cells and correct inframe insertion was confirmed by sequencing at Macrogen, Korea. A single clone confirmed by sequencing was then transformed into E. coli BL21 (DE3) competent cells. The Maltose-Binding Protein (MBP)-tagged recombinant protein was overexpressed in E. coli BL21 (DE3) cells by isopropyl-β-D-1-thiogalactopyranoside (IPTG) induction. Briefly, the SsC1inh transformed E. coli BL21 (DE3) cells were grown at 37 °C in Luria–Bertani (LB) broth containing ampicillin (100 μg/mL) and glucose (2%). When OD600 reached 0.3, the cells were transferred to 25 °C and grown until OD600 reached 0.5. After OD600 reached 0.5, cells were induced with 0.5 mM IPTG and incubated for 8 h. After that, cells were collected by centrifugation at 4000 × g for 30 min. The recombinant protein from harvested cells was then purified using maltose affinity chromatography [26]. Briefly, cells were harvested by centrifugation (4000 × g for 30 min at 4 °C). The pellet was resuspended in column buffer (20 mM Tris–HCl, pH 7.4, 200 mM NaCl) and sonicated on ice in the presence of lysozyme (1 mg/mL). Cell lysate was subjected to centrifugation (9000 × g for 30 min at 4 °C) and the supernatant was loaded onto a column packed with amylose resin. After washing the contents with 12× volume of column buffer, the protein was eluted by applying elution buffer (column buffer + 10 mM maltose). The protein purification procedure was monitored by collecting the sample fractions at different steps of the purification and running them on a 12% SDS polyacrylamide gel electrophoresis along with the standard molecular-weight marker. The purified recombinant protein concentration was then measured using the Bradford method [27].

2.6. Inhibition of rSsC1r and rSsC1s by rSsC1inh To elucidate the protease inhibitory activity of rSsC1inh on rSsC1r and rSsC1s proteins, a Pierce® Protease Assay Kit (Thermo Scientific, U.S.A) was used. The recombinant SsC1r and SsC1s purified in our previous experiment were used in this assay [28]. Briefly, a set of 50 μL of rSsC1r and rSsC1s proteins (200 μg/mL) was mixed with 50 μL of rSsC1inh (200 μg/mL), and another set of these proteins was mixed with 50 μL of rMBP (200 μg/mL, negative control) in 1.5 mL Eppendorf tubes. For the blank reaction, 50 μL of reaction buffer was separately mixed with 50 μL of rSsC1r and rSsC1s. This mixture was incubated at 25 °C for 5 min. Subsequently, a 96-well plate was added, with 100 μL of succinylated casein solution as a substrate, and another set of wells were filled with 100 μL of assay buffer as blank tests. Then, 50 μL of the incubated mixtures were treated separately to the corresponding succinylated casein and blank wells in triplicates. The plate was incubated at 25 °C for 20 min. Then, 50 μL of trinitrobenzene sulfonic acid (TNBSA) working solution was mixed into each well and incubated at 25 °C for 20 min. The absorbance of each sample at 450 nm wavelength was measured by a plate reader (Multiskan GO, Thermo Scientific). The proteolytic activity was estimated by subtracting the absorbance values of the corresponding blank wells from the casein added wells. Percentage inhibition was calculated using the following equation: % I = [(Au − At)/Au] × 100, where At is the protease activity of the corresponding rSsC1inh or MPB treated samples, and Au is the protease activity of the untreated samples.

2.7. Experimental animals and tissue collection Healthy black rockfish were received from the Marine Science Institute of Jeju National University, Jeju Self-Governing Province, Republic of Korea, and were screened for an average body weight of 200 g. The fish were then acclimatized in 400 L flat-bottom tanks filled with aerated, sand-filtered seawater at 22 ± 1 °C for one week. During this acclimatization period, fish were fed with commercial feed, twice a day. Feeding was discontinued two days prior to tissue collection. For investigating the spatial expression pattern of SsC1inh mRNA, 1 mL of peripheral blood was withdrawn from the caudal veins of five healthy fish using sterile syringes coated with 0.2% heparin sodium salt (USB, USA), and peripheral blood cells (PBCs) were harvested by centrifugation at 3000 × g at 4 °C for 10 min. The fish were then euthanized and other tissues, such as the gills, liver, spleen, head kidney, kidney, skin, muscle, heart, brain, intestine, testes, and ovary were excised, immediately snap-frozen, and stored at −80 °C for RNA isolation.

2.5. Protease inhibitory activity of rSsC1inh The inhibitory potential of rSsC1inh and the potentiation effect of heparin (Heparin sodium salt, USB®, USA) on the protease inhibitory activity of C1inh were tested against two serine proteases, C1 esterase and thrombin. For this purpose, a commercial kit for HAE diagnosis (TECHNOCHROM®, Technoclone GmbH, Vienna, Austria) by determining the C1inh levels in plasma was used to examine the inhibition of human C1 esterase by rSsC1inh. The experimental procedure was slightly altered from the vendor's protocol. The chromogenic substrate for C1 esterase (C2H5CO–Lys(ε-Cbo)–Gly–Arg–pNA; 0.6 μmol/ mL) and the reaction buffer were mixed and pre-incubated at 37 °C. Differentially diluted rSsC1inh, C1 esterase, and heparin (10 U/mL) or sample buffer were mixed and incubated at 37 °C for 5 min. Then, by mixing the above two solutions, the reaction was started, and the residual activity of C1 esterase was determined by measuring the absorbance at OD405, which is proportional to the amount of released pNA, using a microplate reader (Multiskan GO, Thermo Scientific). The inhibition of protease activity in thrombin by rSsC1inh was tested in a mixture of 0.1 M Tris–HCl (pH 8), pre-incubated mixture of diluted rSsC1inh, thrombin (bovine plasma, Sigma-Aldrich, USA; 0.625 μM), and heparin (10 U/mL) or buffer. The leftover protease activity of thrombin was measured as described above using the chromogenic substrate. Blanks were prepared by adding corresponding buffers in place of rSsC1inh. The recombinant MBP (rMBP) alone and heparin alone were used in the series of assays to assess their potential to inhibit the examined proteases. The inhibition percentage (% I) was individually calculated in the presence and absence of heparin using the following formula: % I = [(Ao - Ai)/Ao] × 100, where Ai and Ao are the absorbance in the presence and absence of rSsC1inh in the assay,

2.8. Immune challenge and tissue collection In order to detect the immune response of SsC1inh under pathogenic stress with different immune stimulants, a Gram-positive bacterial strain Streptococcus iniae (1 × 105 CFU/μl), a Gram-negative bacterial endotoxin Lipopolysaccharide (LPS; 1.5 μg/μl), and a double-stranded RNA viral mimic polyinosinic:polycytidylic acid (poly I:C; 1.5 μg/μl), were administered to the respective fish groups. At first, acclimatized fish were divided into four groups, each containing 35 fish. Each stimulant was separately resuspended in 200 μL of phosphate-buffered saline (PBS) and intraperitoneally injected as a single dose to all of the individuals in the respective group. For the control group, 200 μL of PBS was administered in the same way. Blood and spleen samples were collected from five fish from each group at 3, 6, 12, 24, 48, and 72 h post-injection (h p.i.), snap-frozen in liquid nitrogen, and stored at −80 °C prior to analysis. 265

Fish and Shellfish Immunology 75 (2018) 263–273

J. Nilojan et al.

Fig. 1. Multiple sequence alignment of SsC1inh with other known orthologs. Gaps are indicated by points to improve the alignments. Completely, (100%) strongly, and weakly conserved residues among all analyzed species are indicated by asterisks (*), colons (:) and periods (.), respectively. Completely conserved residues among fish species are shaded in a gray color. The serpin domain and two immunoglobulin-like domains have been indicated by orange- and blue-colored arrow lines, respectively. The reactive center loop (RCL) is marked by a box, and the scissile peptide bond P1–P1′ and its residues have been indicated in red- and blue-colored triangles, respectively. (For interpretation of the references to color in this figure legend, the reader is referred to the Web version of this article.)

266

Fish and Shellfish Immunology 75 (2018) 263–273

J. Nilojan et al.

3.2. Analysis of sequence homology, tertiary structure, and evolutionary relationship

2.9. RNA extraction and cDNA synthesis Total RNA was isolated from tissues of five individual fish (40 mg/ fish) using QIAzol® (Qiagen, Valencia, CA, USA), per the vendor's protocol, and were further purified with the RNeasy Mini Kit (Qiagen, Valencia, CA, USA). The quality of the RNA was checked by 1.5% agarose gel electrophoresis, and the concentration was determined spectrophotometrically at 260 nm in a micro-drop plate (Thermo Scientific). The first-strand cDNA was synthesized using 2.5 μg of extracted total RNA using a PrimeScript™ First-Strand cDNA Synthesis Kit (TaKaRa, Ohtsu, Japan), and was then diluted 40-fold in nuclease-free water and stored at −20 °C until further use.

When the sequence homology was assessed at the amino acid level by pairwise alignment, the SsC1inh showed the highest similarity (87.8%) and identity (76.3%) with the Oplegnathus fasciatus C1inh ortholog, and exhibited high similarities with other teleostean orthologs, while a limited similarity to human (44.4%) and other mammalian orthologs was observed. Multiple sequence alignment (Fig. 1) revealed a highly conserved pattern among the teleostean species. The teleostean homologs were longer than those of non-teleosts, as they possess an extended N-terminal region. The Ig-like domains showed a diverse pattern, but the serpin domain exhibited a higher degree of homology. The N-terminal Ig-like domains have been manifested to have an unessential role in the inhibitory activity in mammals, as N-terminally truncated proteins have retained their ability to inhibit proteases [32]. The amino terminal of C1inh is the longest among all known serpins [32]. Even though the functional importance of the N-terminal is unknown, it has been suggested that it may stabilize inhibitor-protease complex formation, confer additional specificity, and inhibit the auto activation of C1 [32]. As observed in most serpins, the amino terminal region was also unique and species specific for C1inhs. Two intradomain disulfide bonds were predicted by the DISULFIND server at the 38C-C88 and 125C-C191 residues in the 1st and 2nd immunoglobulinlike domains of SsC1inh. A pair of invariant cysteine residues, which are completely conserved among all teleostean species, were noticed in each Ig-like domain. Unlike the amino terminal domain, the carboxy terminal serpin domain, which is responsible for the inhibitory role, showed an eminent preserved pattern. It contains a protease recognition region of 12 amino acids, termed the reactive center loop (RCL), through which specific target proteases bind to the serpin. The P1 residue of the RCL, responsible for the protease specificity to serpins, has been discovered as an Arg residue in human C1inh [33]. It was conserved in all analyzed species in the multiple sequence alignment (Fig. 1). The scissile peptide bond P1–P1′ was denoted with Arg-Ser in SsC1inh and all examined teleostean species, while the P1′ residue varied in other species. The fish C1inhs showed a strong conservation of residues in the RCL, suggesting that they might target a similar array of proteins. While comparing the tertiary structure, the C1inh exhibited a large β-sheet A, consisting of seven strands and a protruded RCL containing an additional strand, which makes the C1inh unique from other serpins. These features have been illustrated based on the crystal structure of the human C1inh [13]. Using that as the template, the model of SsC1inh was constructed (Fig. 2) and the overall constructed structure showed significant similarity with the human C1inh ortholog with a Z-score of 61.7 in the pairwise structural comparison with DALI server [34]. The evolutionary relationship was analyzed using a phylogenetic tree constructed with selected vertebrate C1inh orthologs using the neighbor-joining method (Fig. 3). A serpin from Thermococcus gammatolerans, used as an outgroup, rooted the tree. It was observed that fish C1inhs alone have been separated into a main branch, and all other vertebrates have been clustered within the second main branch, suggesting that teleostean C1inhs are unique from other vertebrate orthologs. The branching pattern indicates that SsC1inh has speciated from a common vertebrate ancestor and gathered into the fish group. SsC1inh exhibited the closest relationship with O. fasciatus. All of these results supported the conclusion that the gene chosen in this study is the rockfish C1inh equivalent.

2.10. Transcriptional analysis by quantitative real-time PCR (qPCR) The tissue-specific expression and immune responsive temporal mRNA expression pattern of SsC1inh in healthy and immune-challenged rockfish were tested using a SYBR Green qPCR assay on a Real Time System TP800 Thermal Cycler Dice™ (TaKaRa, Ohtsu, Japan), using gene-specific primers (Table 1). The reaction mixture was 10 μL in final volume, with 3 μL of diluted cDNA, 5 μL of 2 × TaKaRa Ex Taq™ SYBR premix, 0.4 μL of each primer (10 pmol/μL), and 1.2 μL dH2O. The mixture was subjected to the following program: one cycle at 95 °C for 30 s; 45 cycles of 95 °C for 5 s, 58 °C for 10 s, and 72 °C for 20 s, and a single final cycle at 95 °C for 15 s, 60 °C for 30 s, and 95 °C for 15 s. Relative mRNA expression was determined by the Livak 2−ΔΔCT method [29], using rockfish elongation factor-1-alpha (SsEF1α, GenBank accession no. KF430623) as the internal reference gene [30]. The spatial expression levels of SsC1inh in each tissue were calculated using the tissue with the lowest expression as the normalizing constant. Fold differences in the expression of SsC1inh after being immune challenged were calculated relative to their expression at 0 h p.i, and then normalized to the corresponding PBS-injected group. All reactions were run in triplicates, and the results were presented as mean values ± standard deviation (SD) of triplicates. A two-tailed unpaired t-test was used to compare the relative SsC1inh mRNA expression. Significant differences between experimental groups and the 0 h p.i control group were defined as P < 0.05.

3. Results and discussion 3.1. In silico characterization of SsC1inh The identified cDNA sequence of the SsC1inh was 2161 bp long, consisting of an ORF of 1797 bp encoding a peptide consisting of 598 amino acids. Untranslated regions (UTR) at the 5′ and 3′ ends were 106 bp and 258 bp long, respectively. The predicted molecular weight of the SsC1inh was 67.0 kDa, and the isoelectric point was 5.39. The SignalP server identified a signal peptide of 20 amino acids in length at the Nterminal of the pre-peptide, with a cleavage site between 20Cys and 21 Val residues, affirming that SsC1inh would be secreted extracellularly. The amino acid sequence possessed a typical two-domain architecture of serpin family members, with a C-terminal serpin superfamily domain and two immunoglobulin (Ig)-like domains at the Nterminal, per the results obtained from the NCBI-CDD and InterProScan servers. The Glycosylation servers marked two N-glycosylation sites and an O-glycosylation site located at 312Asn, 330Asn, and 211Thr, respectively. In mammals, glycosylation is suggested to play a subtle role associated with the plasma half-life of C1inhs [31]. In contrast to mammalian C1inhs, teleostean C1inhs exhibit a lower degree of glycosylation, and the impact of glycosylation on the biological function of the teleost C1inh is not clear [19].

3.3. Genomic DNA analysis The identified full-length genomic DNA sequence of SsC1inh was 6837 bp long. By analyzing the genomic DNA and complementary DNA sequences, the exon-intron structure was constructed using the gene mapper tool. The constructed structure was then compared with other 267

Fish and Shellfish Immunology 75 (2018) 263–273

J. Nilojan et al.

(B)

(A) β Sheet C β Sheet B

Fig. 2. Predicted tertiary structures of the SsC1inh (A) and human C1inh (B) serpin domain. β-sheets A, B, and C are colored in green, purple, and pink, respectively. RCL is indicated in red. P1 and P1′ residues are shown in orange- and blue-colored spheres, respectively. (For interpretation of the references to color in this figure legend, the reader is referred to the Web version of this article.)

β Sheet A P1ʹ-Ser547 547

P1ʹ-Thr445

P1-Arg546 546

P1-Arg444

orthologous C1inh sequences from fish, mammals, and birds. The established structure of SsC1inh was made up of 11 exons interrupted by 10 introns where the first exon and part of the 11th exon were coding 5′ and 3′ UTRs, respectively (Fig. 4). The exon/intron boundary sequences obeyed the GT/AG rule, indicating the presence of splice sites. The other 10 exons were encoding the ORF. The same pattern was observed in other fish, such as rock bream, fugu, and stickleback; however, the ORF of zebrafish was only encoded by nine exons. In other orthologs from mammals and birds other than turkey, the coding sequences were distributed in seven exons, as depicted in mice [17] and humans [35], whereas the coding sequence of turkey was composed of six exons. Within each group (fish, mammal, and bird) the exon sizes seemed to be conserved, but while comparing all the groups together, the anterior part of the structures shows diversity and the posterior part shows conservation in exon lengths. This observation supports the results obtained in the MSA, that the front sequences encoding the immunoglobulin-like domains differed among species, and the latter sequences encoding the serpin domain were highly conserved in all taxa.

This further explains the importance of high conservation of the active serpin domain among different species because it is responsible for protease inhibition. The difference in the genomic organization of teleost C1inhs from other species, and the presence of extended N-terminal domains in teleost C1inh and its lack of presence in other orthologs also support the evolutionary distinctiveness observed in the constructed phylogenetic tree.

3.4. Functional characterization of SsC1inh 3.4.1. Cloning and overexpression of rSsC1inh The purity of rSsC1inh was checked by SDS-PAGE (Fig. 5). The purified elution showed a band which had a molecular weight around 109.5 kDa, consistent with the predicted molecular weight of SsC1inh (67.0 kDa + 42.5 kDa (Molecular weight of MBP)) (Fig. 5). The purified rSsC1inh and rMBP proteins were used in functional assays.

Fig. 3. Phylogenetic analysis of SsC1inh with other identified C1inh orthologs. The bootstrap confidence values (%), based on 5000 bootstrap replications obtained using the neighborjoining method, are indicated at the nodes of the tree. Accession numbers are shown next to each sequence.

268

Fish and Shellfish Immunology 75 (2018) 263–273

J. Nilojan et al.

Fig. 4. Schematic representation of the genomic exon-intron architecture of the C1inh gene in different vertebrates. Accession numbers and total lengths of the genomic DNA sequences are shown next to each sequence. Coding regions, 5′ and 3′ untranslated regions, and introns are denoted by dark-colored boxes, empty boxes, and lines, respectively. The sizes of the exons and introns are shown above or below each structure, respectively.

both in their zymogenic or activated forms [16]. In addition to this, C1inh regulates an array of proteases, including MASP2 of the lectin pathway, and plasma kallikrein, factor XIIa, and factor XIa of the plasma kallikrein–kinin system. The protease inhibitory potential of the purified rSsC1inh was assessed, using its ability to inhibit C1 esterase and thrombin, which are involved in the complement pathway and coagulation systems, respectively. The ability of C1inh to inhibit the protease that catalyzes a chromogenic reaction, in which the reduction occurs at OD450, was considered as the inhibitory potential of rSsC1inh. This assay was conducted based on this principle. Approximately 34% of human C1 esterase activity was inhibited by 60 μg of rSsC1inh under the given conditions (Fig. 6A). In a similar fashion, rSsC1inh inhibited nearly 48% of bovine thrombin activity (Fig. 6B). There was no activity recorded for MPB. Therefore, we suggest that the inhibition of protease activity in both assays was due to the presence of rSsC1inh. C1inh regulates activation of the classical complement pathway via inhibiting C1r and C1s proteases by binding to both their zymogenic and activated forms. This regulation is very crucial in assuring homeostasis. Thus, to check this functional inhibitory activity in rockfish SsC1inh, the rockfish C1r (SsC1r) and C1s (SsC1s) molecules were used as substrates. Recombinant C1r and C1s proteases from rockfish have been isolated, and their proteolytic potential was demonstrated in our previous study [28]. Using the protease assay kit, the inhibitory activity of rSsC1inh on rSsC1r and rSsC1s was assessed (Fig. 7). The results indicated that proteolytic activities of both proteases were significantly inhibited by rSsC1inh. A negligible amount of inhibition was noticed with rMBP, as expected. These results indicated that the complement regulatory function in black rockfish is functionally active with the presence of active SsC1inh.

Fig. 5. SDS–PAGE analysis of recombinant SsC1inh Lanes: U, total cellular extract prior to IPTG induction; L, total lysate after induction; P, pellet after induction; S, supernatant after induction; E, purified recombinant protein after amylose resin affinity chromatography elution; M, protein marker (enzynomics).

3.4.2. Inhibition assays C1-inhibitor is a member of the serpin superfamily, whose structure and functions resemble other serpin family members. This suicide inhibitor inactivates proteins by a trapping mechanism that is activated following the identification of protease through the reactive center loop, which protrudes from the surface of the molecule. Cleavage of the scissile peptide bond P1-P1′ distorts the molecule, resulting in the formation of a covalent bond between the P1 residue of the inhibitor and the active site serine of the target protease [16]. C1inh is the sole inhibitor of the classical complement pathway proteases C1r and C1s,

3.4.3. Heparin potentiation assay The presence of a shorter RCL in C1inh, which diminishes exposure 269

Fish and Shellfish Immunology 75 (2018) 263–273

J. Nilojan et al.

expression of SsC1inh was normalized with SsEF1α, and the relative expressions were calculated by comparing to the expression levels in the heart. The SsC1inh expression was extremely high in the liver (588699.3-fold), followed by the gills (438.5-fold) compared to in the heart. Lower expression levels were observed in the skin, kidney, intestine, head kidney, and spleen, but these expression levels were negligible compared to the liver and gills. The expression profile has been checked in humans [39], mice [17], trout [40], and rock bream [20]. All of the analyzed basal mRNA expression profiles showed the highest expression in the liver. These findings were compatible with our results, and strongly suggested that hepatocytes are the main site of C1inh synthesis. However, western blot analysis performed on large yellow croaker reported higher C1inh protein levels in the spleen, kidney, brain, and heart, and lower expression in the liver and gills [21]. Although, the highest expression of C1inh has been reported in the liver, considerable levels have been reported in an array of tissues, in previous studies on both mammals and fishes [17,20,40]. Even though the biological significance of extra-hepatic synthesis of C1inh in multiple sites is not clear, it has been hypothesized that localized synthesis may be required to augment the level of C1inh in plasma, as this acts as a suicide inhibitor, regulating a variety of proteases, and is important in the regulation of protease targets in sites to which access is limited for C1inh in the plasma, such as the central nervous system [39]. In contrast, our study shows a very low expression of C1inh in tissues compared to in the liver, except in the gills. This observation is compatible with the findings in a study on Nile tilapia [41]. 3.6. Immune responsive temporal expression pattern of SsC1inh mRNA The complement system plays a crucial role in the clearing of various pathogens through complement activation. But improper activation may lead to severe self-damage to the host, as this system is nonspecific. Therefore, to protect the host from this danger, the system has developed regulatory molecules, which are either soluble or membranebound proteins. C1inh, a fluid phase inhibitor, inhibits the complement activation through the classical and lectin pathways [10]. Hence, quantifying the SsC1inh mRNA level in response to the pathological conditions would help to elucidate its role in rockfish. For this purpose, the temporal transcriptional pattern of SsC1inh mRNA in the liver, the main site of C1inh synthesis (Fig. 9A), and the spleen, an important immunological organ (Fig. 9B), were kinetically detected by qPCR in a time-course manner after an in vivo immune challenge with LPS, PolyI:C, and S. iniae. Poly I:C mimics viral infection, and S. iniae and LPS imitate Gram-positive and Gram-negative bacterial infections, respectively. S. iniae is a common major pathogen of marine fish [42]. In liver tissue, SsC1inh was initially downregulated, and then raised to the basal value under the influence of all three stimulants. It is important to note that a huge amount of SsC1inh transcripts in the liver are represented by even a small change in the expression. The expression of SsC1inh was downregulated in 6–24 h p.i against poly I:C and S. iniae, whereas downregulation took 6–72 h p.i against LPS induction. The expression of SsC1inh was extremely high in the liver under normal physiological conditions, and the expression under pathological conditions was significantly downregulated. Once the pathogenic attack was encountered, the complement system is activated to eradicate the antigens. So, it is obvious that the level of complement activation inhibitors should be minimized for an efficient counter attack on pathogens. However, once the immune system gains control over the invading microbes, it is essential to repress the active complement components in order to prevent self-damage, as this system is nonspecific. Hence, the level of the C1inh is increased once again. This observation is fully compatible with our previously reported expression profiles of black rockfish SsC1r and SsC1s, which are the direct targets of SsC1inh [28]. Both genes SsC1r and SsC1s showed an upregulated pattern of expression against LPS and S. iniae from 6 to 24 h p.i, and

Fig. 6. Inhibition assays for rSsC1inh protein against (A) C1 esterase and (B) thrombin in the presence or absence of heparin. The percentage of inhibition was calculated by the function of the rSsC1inh dose by elucidating the amount of reduction in protease activity, as determined by the chromogenic assay. Error bars represent the SD (n = 3). Asterisks (*) represent significant differences (P < 0.05) in % inhibition by rSsC1inh in the presence and absence of heparin.

to target proteases, results in a relatively lower inhibition potential than that of other serpins, as evidenced by the lower association constants for different C1inh-target protease pairs [10,31]. Like other serpins, the inhibitory properties of C1inh could be modulated by glycosaminoglycans (GAGs) [36]. It has been proved that the inhibition capacity of human C1inh could be significantly intensified in the presence of GAGs, such as dextran sulfate [37] and heparin [38]. To examine the effect of GAGs on the activity of rSsC1inh against C1 esterase (Fig. 6A) and thrombin (Fig. 6B), inhibitory assays were performed in the presence or absence of heparin. Our results suggest that heparin significantly potentiates the inhibitory activity of rSsC1inh against human C1 esterase. Further, a control assay was carried out with only heparin, to assess if heparin alone could show any inhibitory functions against the examined proteases. The results indicated that it did not show any inhibition against both C1 esterase and thrombin. Hence, these findings delineate that rSsC1inh is active against human C1 esterase and thrombin, and its inhibition potential could be raised by heparin. 3.5. Tissue specific mRNA expression pattern of SsC1inh A qPCR was carried out to delineate the spatial expression pattern of SsC1inh in 14 different tissues from healthy rockfish (Fig. 8) with the gene-specific primers designed for SsC1inh cDNA (Table 1). The 270

Fish and Shellfish Immunology 75 (2018) 263–273

J. Nilojan et al.

Fig. 7. Inhibition assay for rSsC1inh against rSsC1r and rSsC1s. The percentage inhibition was calculated by determining the amount of reduction in protease activity, as elucidated by the chromogenic assay. MBP was used as the negative control. Error bars represent SD (n = 3).

SsC1inh mRNA from 24 h p.i. Comparatively, the level of induction was low when induced with poly I:C. Although the expression of SsC1inh was low under normal physiological conditions in the spleen, it was significantly upregulated after immune stress. Rock bream C1inh was slightly downregulated in the early phase, and was significantly upregulated at later phases in the liver [20]. In Nile tilapia, significant induction was observed in the spleen and liver after 48 h p.I, with a higher level in the spleen rather than in the liver [19]. The C1inh protein profile, analyzed at the translational level by western blotting in large yellow croaker upon bacterial challenge, reported an unchanged level up to 12 h, and a gradual increase from the

then returned to the basal level. In accordance with this observation, SsC1inh expression was downregulated from 6 to 24 h p.i. to allow the complement system to effectively eradicate invading pathogens, and once the situation was under control, the expression of SsC1inh returned to the basal level to control complement activation and maintain homeostasis. In the spleen, the SsC1inh mRNA levels were kept constant during the early and middle phases and were highly upregulated during the late phase. Bacterial stimulants LPS and S. iniae dramatically increased the level from 48 h p.i (11.8- and 11.0-fold, respectively); meanwhile, the viral-mimicking poly I:C upregulated the expression (4.7-fold) of

Fig. 8. Tissue-specific mRNA expression pattern of SsC1inh. Expression fold-changes of mRNA were detected by qPCR and evaluated by the 2−ΔΔCT method using the rockfish elongation factor-1α gene as the internal reference. Data are presented relative to those in the heart. Error bars represent the SD (n = 3).

271

Fish and Shellfish Immunology 75 (2018) 263–273

J. Nilojan et al.

the black rockfish complement system. Acknowledgments This research was a part of the project titled ‘Fish Vaccine Research Center’, funded by the Ministry of Oceans and Fisheries, Korea and supported by a grant from Marine Biotechnology Program (PJT200620, Genome Analysis of Marine Organisms and Development of Functional Applications) Funded by Ministry of Oceans and Fisheries, Korea. References [1] D. Mastellos, D. Morikis, S.N. Isaacs, M.C. Holland, C.W. Strey, J.D. Lambris, Complement: structure, functions, evolution, and viral molecular mimicry, Immunol. Res. 27 (2003) 367–386, http://dx.doi.org/10.1385/IR:27:2-3:367. [2] B.P. Morgan, K.J. Marchbank, M.P. Longhi, C.L. Harris, A.M. Gallimore, Complement: central to innate immunity and bridging to adaptive responses, Immunol. Lett. 97 (2005) 171–179, http://dx.doi.org/10.1016/j.imlet.2004.11. 010. [3] N.S. Sheerin, T. Springall, M.C. Carroll, B. Hartley, S.H. Sacks, Protection against anti-glomerular basement membrane (GBM)-mediated nephritis in C3- and C4-deficient mice, Clin. Exp. Immunol. 110 (1997) 403–409, http://dx.doi.org/10.1046/ j.1365-2249.1997.4261438.x. [4] J.P. Williams, T.T. Pechet, M.R. Weiser, R. Reid, L. Kobzik, F.D. Moore, M.C. Carroll, H.B. Hechtman, Intestinal reperfusion injury is mediated by IgM and complement, J. Appl. Physiol. 86 (1999) 938–942, http://dx.doi.org/10.1186/ccf1999-81. [5] J.J. Alexander, A. Lim, C. He, R.L. MacDonald, V.M. Holers, R.J. Quigg, Renal, central nervous system and pancreatic overexpression of recombinant soluble Crry in transgenic mice. A novel means of protection from complement-mediated injury, Immunopharmacology 42 (1999) 245–254, http://dx.doi.org/10.1016/S01623109(99)00010-7. [6] N. Davoust, S. Nataf, R. Reiman, M. V Holers, I.L. Campbell, S.R. Barnum, Central nervous system-targeted expression of the complement inhibitor sCrry prevents experimental allergic encephalomyelitis, J. Immunol. 163 (1999) 6551–6556 http://www.ncbi.nlm.nih.gov/pubmed/10586048. [7] A. Sahu, J.D. Lambris, Complement inhibitors: a resurgent concept in anti-inflammatory therapeutics, Immunopharmacology 49 (2000) 133–148, http://dx.doi. org/10.1016/S0162-3109(00)80299-4. [8] H.J. Muller-Eberhard, Molecular organization and function of the complement system, Annu. Rev. Biochem. 57 (1988) 321–347, http://dx.doi.org/10.1146/ annurev.bi.57.070188.001541. [9] M.K. Pangburn, H.J. Müller-Eberhard, The alternative pathway of complement, Springer Semin. Immunopathol. 7 (1984) 163–192, http://dx.doi.org/10.1007/ BF01893019. [10] S. Zeerleder, C1-inhibitor: more than a serine protease inhibitor, Semin. Thromb. Hemost. 37 (2011) 362–374. [11] S.E. Degn, S. Thiel, J.C. Jensenius, New perspectives on mannan-binding lectinmediated complement activation, Immunobiology 212 (2007) 301–311, http://dx. doi.org/10.1016/j.imbio.2006.12.004. [12] P.F. Zipfel, C. Skerka, Complement regulators and inhibitory proteins, Nat. Rev. Immunol. 9 (2009) 729–740, http://dx.doi.org/10.1038/nri2620. [13] L. Beinrohr, V. Harmat, J. Dobó, Z. Lörincz, P. Gál, P. Závodszky, C1 inhibitor serpin domain structure reveals the likely mechanism of heparin potentiation and conformational disease, J. Biol. Chem. 282 (2007) 21100–21109, http://dx.doi.org/10. 1074/jbc.M700841200. [14] R.B. Sim, A. Reboul, G.J. Arlaud, C.L. Villiers, M.G. Colomb, Interaction of 125Ilabelled complement subcomponents C1r and C1s with protease inhibitors in plasma, FEBS Lett. 97 (1979) 111–115, http://dx.doi.org/10.1016/0014-5793(79) 80063-0. [15] G. Ambrus, P. Gál, M. Kojima, K. Szilágyi, J. Balczer, J. Antal, L. Gráf, A. Laich, B.E. Moffatt, W. Schwaeble, R.B. Sim, P. Závodszky, Natural substrates and inhibitors of mannan-binding lectin-associated serine protease-1 and -2: a study on recombinant catalytic fragments, J. Immunol. 170 (2003) 1374–1382, http://dx. doi.org/10.4049/jimmunol.170.3.1374. [16] A.E. Davis, P. Mejia, F. Lu, Biological activities of C1 inhibitor, Mol. Immunol. 45 (2008) 4057–4063, http://dx.doi.org/10.1016/j.molimm.2008.06.028. [17] M. Lener, G. Vinci, C. Duponchel, T. Meo, M. Tosi, Molecular cloning, gene structure and expression profile of mouse C1 inhibitor, Eur. J. Biochem. 254 (1998) 117–122. [18] S.C. Bock, K. Skriver, E. Nielsen, H.C. Thøgersen, B. Wiman, V.H. Donaldson, R.L. Eddy, J. Marrinan, E. Radziejewska, R. Huber, Human C1 inhibitor: primary structure, cDNA cloning, and chromosomal localization, Biochemistry 25 (1986) 4292–4301. [19] M. Ding, M. Chen, X. Zhong, Y. Wang, S. Fu, X. Yin, Z. Guo, J. Ye, Identification and characterization of C1 inhibitor in Nile tilapia (Oreochromis niloticus) in response to pathogenic bacteria, Fish Shellfish Immunol. 61 (2017) 152–162, http://dx.doi. org/10.1016/j.fsi.2016.12.014. [20] N. Umasuthan, S.D.N.K. Bathige, K.S. Revathy, W.D.N. Wickramaarachchi, Q. Wan, I. Whang, E. Kim, M.-A. Park, H.-C. Park, J. Lee, A C1 inhibitor ortholog from rock bream (Oplegnathus fasciatus): molecular perspectives of a central regulator in terms of its genomic arrangement, transcriptional profiles and anti-protease

Fig. 9. Temporal gene expression of C1inh in the liver (A) and spleen (B), after an in vivo challenge with lipopolysaccharides (LPS), S. iniae, and poly I:C. Relative mRNA levels were determined by SYBR green qPCR. The rockfish elongation factor-1α was used as the internal reference gene. Relative expression was calculated by applying the Livak method. Error bars represent SD (n = 3). The asterisk symbol (*) represents significant difference (P < 0.05) in expression fold when compared with 0 h p.i.

5th day to 20th day after the challenge [21]. Further, the C1inh mRNA level in rainbow trout continued to be stable till 8 h after the LPS challenge [40]. All of these studies suggest a late-phase upregulation pattern of C1inh. Instead, a significant downregulated pattern was detected in the middle phase (6–24 h p.i) in the liver in our study. Meanwhile, a significant upregulated pattern was observed at the later phase in the spleen. Collectively, the results from the present study and our previous findings on SsC1r and SsC1s elucidate that the complement system is functionally active against invading pathogens at the early phase, and thereafter, the SsC1inh level increases at a later phase to assure homeostasis and to prevent the damage to the host [28]. 3.7. Conclusion In summary, the C1inh gene from black rockfish has been identified and molecularly characterized. The serpin domain was highly conserved among analyzed orthologs. The constructed phylogenetic tree and the genomic architecture of C1inh from different vertebrate lineages revealed the unique evolutionary properties of teleostean C1inh from non-teleostean homologs. Tissue-specific mRNA expression patterns revealed the highest expression in the liver. Regulation in the mRNA expression pattern after immune challenges revealed its importance in controlling the complement system to maintain homeostasis. Functional studies explain that SsC1inh is functionally active, with a high potential to inhibit SsC1r and SsC1s. Taken together, our results suggest that SsC1inh, SsC1r, and SsC1s are active members of 272

Fish and Shellfish Immunology 75 (2018) 263–273

J. Nilojan et al.

[21]

[22]

[23]

[24]

[25]

[26]

[27]

[28]

[29]

[30]

(2013) 67–73, http://dx.doi.org/10.1016/j.margen.2013.08.002. [31] I.G.A. Wagenaar-Bos, C.E. Hack, Structure and function of C1-inhibitor, Immunol. Allergy Clin. North Am. 26 (2006) 615–632, http://dx.doi.org/10.1016/j.iac.2006. 08.004. [32] M. Coutinho, K.S. Aulak, A.E. Davis 3rd, Functional analysis of the serpin domain of C1 inhibitor, J. Immunol. 153 (1994) 3648–3654. [33] G.S. Salvesen, J.J. Catanese, L.F. Kress, J. Travis, Primary structure of the reactive site of human Cl-inhibitor, J. Biol. Chem. 260 (1985) 2432–2436. [34] L. Holm, P. Rosenstrom, Dali server: conservation mapping in 3D, Nucleic Acids Res. 38 (2010) W545–W549, http://dx.doi.org/10.1093/nar/gkq366. [35] P.E. Carter, B. Dunbar, J.E. Fothergill, Genomic and cDNA cloning of the human C1 inhibitor. Intron-exon junctions and comparison with other serpins, Eur. J. Biochem. 173 (1988) 163–169, http://dx.doi.org/10.1111/j.1432-1033.1988. tb13980.x. [36] J. Potempa, E. Korzus, J. Travis, The serpin superfamily of proteinase inhibitors: structure, function, and regulation, J. Biol. Chem. 269 (1994) 15957–15960. [37] W.a. Wuillemin, H. te Velthuis, Y.T. Lubbers, C.P. de Ruig, E. Eldering, C.E. Hack, Potentiation of C1 inhibitor by glycosaminoglycans: dextran sulfate species are effective inhibitors of in vitro complement activation in plasma, J. Immunol. 159 (1997) 1953–1960 http://www.ncbi.nlm.nih.gov/pubmed/9257861. [38] R. Rent, R. Myhrman, B.A. Fiedel, H.G. Departments, Potentiation of Cl-esterase inhibitor activity by heparin, Clin. Exp. Immunol. 23 (1976) 264–271 http://www. ncbi.nlm.nih.gov/pubmed/1538461. [39] A.E. Prada, K. Zahedi, A.E. Davis, Regulation of C1 inhibitor synthesis, Immunobiology 199 (1998) 377–388, http://dx.doi.org/10.1016/S0171-2985(98) 80042-9. [40] T. Wang, C.J. Secombes, Complete sequencing and expression of three complement components, C1r, C4 and C1 inhibitor, of the classical activation pathway of the complement system in rainbow trout Oncorhynchus mykiss, Immunogenetics 55 (2003) 615–628, http://dx.doi.org/10.1007/s00251-003-0622-5. [41] A. He, J. Yang, S. Tang, C. Wang, Cloning and molecular characterization of complement component 1 inhibitor (C1INH) and complement component 8β (C8β) in Nile tilapia (Oreochromis niloticus), Fish Shellfish Immunol. 35 (2013) 1055–1058, http://dx.doi.org/10.1016/j.fsi.2013.07.019. [42] M.R. Weinstein, M. Litt, D.A. Kertesz, P. Wyper, D. Rose, M. Coulter, A. McGeer, R. Facklam, C. Ostach, B.M. Willey, A. Borczyk, D.E. Low, Invasive infections due to a fish pathogen, Streptococcus iniae, N. Engl. J. Med. 337 (1997) 589–594, http:// dx.doi.org/10.1056/NEJM199708283370902.

activities of recombinant peptide, Dev. Comp. Immunol. 42 (2014) 197–210, http://dx.doi.org/10.1016/j.dci.2013.09.006. W. Wei, H. Wu, H. Xu, X. Zhang, T. Chu, C. Wu, K. Chang, Y. Zhang, Cloning and molecular characterization of lycC1INH genes in large yellow croaker (Pseudosciaena crocea), Fish Shellfish Immunol. 28 (2010) 221–227, http://dx.doi. org/10.1016/j.fsi.2009.09.001. H.K. Lim, Korean aquaculture: Status and Future Directions Brief History of Aquaculture, Aquac. Res. Team, Rep. Natl. Fish. Res. Dev. Institute, Repub. Korea, 2006. H.J. Han, D.Y. Kim, W.S. Kim, C.S. Kim, S.J. Jung, M.J. Oh, D.H. Kim, Atypical Aeromonas salmonicida infection in the black rockfish, Sebastes schlegeli Hilgendorf, in Korea, J. Fish. Dis. 34 (2011) 47–55, http://dx.doi.org/10.1111/j. 1365-2761.2010.01217.x. S.H. Kang, G.W. Shin, Y.S. Shin, K.J. P, Y. rim Kim, H. hee Yang, E. young Lee, E. goo Lee, N. eung Huh, O.M. Ju, T. sung Jung, Experimental evaluation of pathogenicity of Lactococcus garvieae in black rockfish (Sebastes schlegeli), J. Vet. Sci. (Suwon-Si, Korea) 5 (2004) 387–390 doi:200412387 [pii]. W.S. Thulasitha, N. Umasuthan, R.G.P.T. Jayasooriya, J.K. Noh, H.-C. Park, J. Lee, A thioredoxin domain-containing protein 12 from black rockfish Sebastes schlegelii: responses to immune challenges and protection from apoptosis against oxidative stress, Comp. Biochem. Physiol. Part C Toxicol. Pharmacol. 185–186 (2016) 29–37, http://dx.doi.org/10.1016/j.cbpc.2016.02.005. C.V. Maina, P.D. Riggs, A.G. Grandea, B.E. Slatko, L.S. Moran, J.A. Tagliamonte, L.A. McReynolds, di G. Chu, An Escherichia coli vector to express and purify foreign proteins by fusion to and separation from maltose-binding protein, Gene 74 (1988) 365–373, http://dx.doi.org/10.1016/0378-1119(88)90170-9. M.M. Bradford, A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding, Anal. Biochem. 72 (1976) 248–254, http://dx.doi.org/10.1016/0003-2697(76)90527-3. J. Nilojan, S.D.N.K. Bathige, R. Kugapreethan, H. Yang, M.-J. Kim, B.-H. Nam, J. Lee, Molecular features and the transcriptional and functional delineation of complement system activators C1r and C1s from Sebastes schlegelii, Dev. Comp. Immunol. 81 (2018) 279–290, http://dx.doi.org/10.1016/j.dci.2017.12.011. K.J. Livak, T.D. Schmittgen, Analysis of relative gene expression data using realtime quantitative PCR and the 2−ΔΔCT method, Methods 25 (2001) 402–408, http://dx.doi.org/10.1006/meth.2001.1262. M. Liman, W. Wenji, L. Conghui, Y. Haiyang, W. Zhigang, W. Xubo, Q. Jie, Z. Quanqi, Selection of reference genes for reverse transcription quantitative realtime PCR normalization in black rockfish (Sebastes schlegeli), Mar. Genomics 11

273