- Email: [email protected]
The TP53 gene promoter is not methylated in families suggestive of Li-Fraumeni syndrome with no germline TP53 mutations
Cancer Genetics and Cytogenetics 193 (2009) 63e66
Short communication
The TP53 gene promoter is not methylated in families suggestive of Li-Fraumeni syndrome with no germline TP53 mutations Alena Finkova, Alzbeta Vazna, Ondrej Hrachovina, Sarka Bendova, Kamila Prochazkova, Zdenek Sedlacek* Department of Biology and Medical Genetics, Charles University 2nd Medical School and University Hospital Motol, Vuvalu 84, 15006 Prague 5, Czech Republic Received 5 November 2008; accepted 13 April 2009
Abstract
Germline TP53 mutations are found in only 70% of families with the Li-Fraumeni syndrome (LFS), and with an even lower frequency in families suggestive of LFS but not meeting clinical criteria of the syndrome. Despite intense efforts, to date, no other genes have been associated with the disorder in a significant number of TP53 mutation-negative families. A search for defects in TP53 other than heterozygous missense mutations showed that neither intron variants nor sequence variants in the TP53 promoter are frequent in LFS, and multiexon deletions have been found to be responsible for LFS only in several cases. Another cancer predisposition syndrome, hereditary non-polyposis colon cancer, has been associated with epigenetic silencing of one allele of the MLH1 or MSH2 genes. This prompted us to test the methylation of the TP53 gene promoter in a set of 14 families suggestive of LFS using bisulphite sequencing of three DNA fragments from the 50 region of the gene. We found no detectable methylation at any of the CG dinucleotides tested. Thus, epigenetic silencing of the TP53 promoter is not a frequent cause of the disorder in families suggestive of LFS but with no germline mutations in the coding part of the gene. Ó 2009 Elsevier Inc. All rights reserved.
1. Introduction Li-Fraumeni syndrome (LFS) is a rare autosomal dominant cancer predisposition syndrome with highly penetrant familial clustering of sarcomas, brain and adrenocortical tumors, and premenopausal breast cancers [1]. Most affected families carry germline mutations in the tumor suppressor gene TP53 coding the p53 protein [2,3]. Interestingly, TP53 mutation carriers have shorter telomeres and elevated frequency of copy number variants in their genomes, possibly further contributing to their cancer risks [4e6]. However, even in families meeting the strictest clinical criteria for LFS [7], germline TP53 mutations were found in only about 70% [8], and the diagnostic yield was even lower (around 20%) in families suggestive of LFS but meeting only relaxed criteria [9,10]. This prompted multiple attempts to identify other genes possibly involved in the syndrome. Germline mutations in the
* Corresponding author. Tel.: þ420 2 24435995; fax: þ420 2 24435994. E-mail address: [email protected] (Z. Sedlacek). 0165-4608/09/$ e see front matter Ó 2009 Elsevier Inc. All rights reserved. doi:10.1016/j.cancergencyto.2009.04.014
CHEK2 gene coding a checkpoint kinase acting in the same pathway upstream of the p53 protein were found in several families, but subsequent analyses questioned the broad involvement of this gene in LFS [11,12]. Similarly, no causal role in the syndrome was shown for PTEN [13], CDKN2 [13,14], BCL10 [15], TP63 [16], and BAX [17]. The analysis of families with no linkage to TP53 pointed to a region of chromosome 1 as a possible predisposing locus [18], but no gene from this region has been associated with LFS yet. The failure to assign other loci the causal role in LFS led to a search for defects in TP53 other than the classic heterozygous point mutations in the coding region of the gene, but neither intron variants [19] nor variants of the promoter [20] were shown to contribute to the phenotype. Another type of genetic defect that could escape detection using sequencing, large deletions of the TP53 gene, was also found to be only a very rare cause of LFS [21]. Interestingly, in several families, another cancer predisposition syndrome, hereditary non-polyposis colon cancer, was associated with epigenetic silencing of one allele of one of the predisposing genes, MLH1 or MSH2,
A. Finkova et al. / Cancer Genetics and Cytogenetics 193 (2009) 63e66
64
accompanied by methylation of the respective gene promoters [22e24]. As the TP53 gene in mutation-negative LFS families could potentially be inactivated by the same mechanism, we decided to test this possibility on a set of 14 families suggestive of LFS.
CAAACTTCCATCCCACT). Sequencing was performed using the polymerasae chain reaction (PCR) primers on an ABI PRISM 3100-Avant genetic analyzer (Applied Biosystems, Foster City, CA). A total of 10 CG dinucleotides could be reliably scored and were included in the analysis (Fig. 1). In parallel, a sample of universally methylated DNA (Chemicon) was subjected to the same procedure.
2. Materials and methods 2.1. Patients and families
3. Results and Discussion
Only families suggestive of LFS in whom TP53 mutation testing yielded negative results were enrolled into the study. These included 13 families meeting the criteria for LFS [7], Li-Fraumeni-like syndrome [10], or the Chompret criteria [9], and 1 family not meeting the criteria but including a child with rhabdomyosarcoma and several other affected relatives (Table 1). DNA was isolated from blood lymphocytes of the index patients from each family using the Gentra Puregene Blood Kit (Qiagen, Hilden, Germany). No germline TP53 mutations were found upon amplification and sequencing of all exons of the TP53 gene in any of the patients using the protocols described previously [25]. 2.2. Methylation analysis of the TP53 gene promoter DNA was chemically converted by bisulphite treatment using the CpGenome DNA Modification Kit (Chemicon, Temecula, CA). Three fragments of the promoter region of the TP53 gene and its putative CpG island [26,27] of 143, 120, and 158 base pairs (bp) containing 3, 7, and 6 CG dinucleotides, respectively (Fig. 1), were amplified using primers F (GGATTATTTGTTTTTATTTGTTATGG), R (ATAACTCT AAACTTTTAAAAAACTC), B (GGGAGTAGGTAGTT GTTGGGTTT), D (AAAAACTCATCAAATTCAATCAA AA), C (TTTTTGGATTGGGTAAGTTTTTG), and U (AAC
Methylation was not detectable at any of the 10 CG dinucleotides studied (Fig. 1) in any of the 14 patient samples. The cytosines within these CG dinucleotides were fully converted into thymines. In several experiments, where favorable signal-to-noise ratios allowed scoring of all 16 CG dinucleotides, no methylation was observed at any of the additional sites. In contrast to the DNA of the patients, sequencing of the PCR products obtained from the universally methylated DNA showed no conversion of cytosines at any of the CG dinucleotides tested. The methylation status of our patients thus resembled that of normal tissues from normal control individuals in which only unmethylated CG sites were detected in the TP53 promoter [28e31]. Methylation of the TP53 gene promoter was shown experimentally to reduce the transcriptional activity of the gene [27]. Several studies have subsequently revealed that TP53 promoter methylation could represent an alternative pathway to the inactivation of TP53 by a mutation in several types of sporadic tumors (e.g., breast cancer, hepatocellular carcinoma, leukemia, and glioma) [28,32e34], but not in adrenocortical or gastric cancer [29,30]. As far as hereditary cancer predisposition syndromes are concerned, aberrant constitutional promoter methylation of
Table 1 Cancer families enrolled into the study Family
Classification
Tumors
1 2 3 4 5 6 7 8 9 10 11 12 13
LFS, LFL, CH CH CH CH CH LFL CH CH CH LFL, CH CH CH LFL
P: P: P: P: P: P: P: P: P: P: P: P: P:
14
FH
uterine cancer þ osteosarcoma (34), D: osteosarcoma (10), M: ovarian cancer (44) uterine cancer (sarcoma) (33), S: breast cancer (28), PGM: bone cancer (?) adrenocortical carcinoma (16) breast cancer (38), B: astrocytoma (14), F: prostate cancer (66) breast cancer (29), B: colon cancer (sarcoma) (28), PC: testicular cancer (28) breast cancer (31), D: neuroblastoma (7), F: lung cancer (46) Ewing sarcoma (11) þ rhabdomyosarcoma (17), M: melanoma (20) breast cancer (45), M: breast cancer (29), MC: ovarian cancer (fibrosarcoma) (23) adrenocortical carcinoma (?) osteosarcoma (14), PA: breast cancer (56), PGF: gastrointestinal tract tumor (53) adrenocortical carcinoma (18) adrenocortical carcinoma (?) pleural sarcoma (35), F: adrenocortical carcinoma (60), MA: breast cancer (70), MGM: sarcoma (79), MGA: brain tumor (90) P: rhabdomyosarcoma (9), MGF: lung cancer (60), MGU: lung cancer (50), MGU: unknown cancer (30)
LFS, Li-Fraumeni syndrome [7]; LFL, Li-Fraumeni-like syndrome [10]; CH, Chompret criteria [9] [all sets of fulfilled criteria are indicated, although formally, the diagnosis of LFS excludes the diagnosis of LFL (family 1)]; FH, family history of cancer; age at tumor onset is in parentheses; ?, unknown age at onset; þ, multiple tumors in one individual; P, patient; D, daughter; M, mother; S, sister; PGM, paternal grandmother; B, brother; F, father; PC, paternal cousin; MC, maternal cousin; PA, paternal aunt; PGF, paternal grandfather; MA, maternal aunt; MGM, maternal grandmother; MGA, maternal grandaunt; MGF, maternal grandfather; MGU, maternal granduncle.
A. Finkova et al. / Cancer Genetics and Cytogenetics 193 (2009) 63e66
65
CG dinucleotides -100
-50
+1
basal promoter region
+50
+100
+150
+200
+250 bp
TP53 exon 1 putative TP53 CpG island
PCR primers and products
F
R
B
C
D
U
Fig. 1. Schematics of the 5’ end of the TP53 gene with positions of CG dinucleotides and PCR primers and products used in the analysis. Arrows point to CG dinucleotides that could be scored reliably in all patients. Minor and major transcription start sites (open and closed triangles, respectively) are indicated, as well as the 85-bp basal promoter region and the putative TP53 CpG island. Bases are numbered relative to the proximal major start site (þ1).
the causative genes, in some cases heritable, was observed in hereditary non-polyposis colon cancer [22e24]. This mechanism, however, does not seem to be frequent in other hereditary cancer syndromes. No epigenetic silencing of the APC gene was found among 60 families with adenomatous polyposis coli [35], and no abnormal methylation of BRCA1 promoter was found among 41 BRCA1/2 mutation-negative breast cancer families [36]. A low level of methylation possibly attributable to somatic mosaicism was identified in 3 out of 7 patients from another study [37], but subsequently in normal controls also [31]. Our study, although limited in size and scope, implies that this gene is not frequently epigenetically inactivated by methylation of its promoter in families suggestive of LFS but with no germline TP53 mutations.
Acknowledgments This work was supported by grants MSM0021620813 and MZO00064203. References [1] Li FP, Fraumeni JF Jr. Soft-tissue sarcomas, breast cancer, and other neoplasms. A familial syndrome? Ann Intern Med 1969;71:747e52. [2] Malkin D, Li FP, Strong LC, Fraumeni JF Jr, Nelson CE, Kim DH, Kassel J, Gryka MA, Bischoff FZ, Tainsky MA, et al. Germ line p53 mutations in a familial syndrome of breast cancer, sarcomas, and other neoplasms. Science 1990;250:1233e8. [3] Srivastava S, Zou ZQ, Pirollo K, Blattner W, Chang EH. Germ-line transmission of a mutated p53 gene in a cancer-prone family with Li-Fraumeni syndrome. Nature 1990;348:747e9. [4] Tabori U, Nanda S, Druker H, Lees J, Malkin D. Younger age of cancer initiation is associated with shorter telomere length in LiFraumeni syndrome. Cancer Res 2007;67:1415e8. [5] Trkova M, Prochazkova K, Krutilkova V, Sumerauer D, Sedlacek Z. Telomere length in peripheral blood cells of germline TP53 mutation carriers is shorter than that of normal individuals of corresponding age. Cancer 2007;110:694e702. [6] Shlien A, Tabori U, Marshall CR, Pienkowska M, Feuk L, Novokmet A, Nanda S, Druker H, Scherer SW, Malkin D. Excessive genomic DNA copy number variation in the Li-Fraumeni cancer predisposition syndrome. Proc Natl Acad Sci USA 2008;105: 11264e9.
[7] Li FP, Fraumeni JF Jr, Mulvihill JJ, Blattner WA, Dreyfus MG, Tucker MA, Miller RW. A cancer family syndrome in twenty-four kindreds. Cancer Res 1988;48:5358e62. [8] Varley JM, McGown G, Thorncroft M, Santibanez-Koref MF, Kelsey AM, Tricker KJ, Evans DG, Birch JM. Germ-line mutations of TP53 in Li-Fraumeni families: an extended study of 39 families. Cancer Res 1997;57:3245e52. [9] Chompret A, Abel A, Stoppa-Lyonnet D, Brugieres L, Pages S, Feunteun J, Bonaiti-Pellie C. Sensitivity and predictive value of criteria for p53 germline mutation screening. J Med Genet 2001;38:43e7. [10] Birch JM, Hartley AL, Tricker KJ, Prosser J, Condie A, Kelsey AM, Harris M, Jones PH, Binchy A, Crowther D, Craft AW, Eden OB, Evans DGR, Thompson E, Mann JR, Martin J, Mitchell ELD, Santibanez-Koref MF. Prevalence and diversity of constitutional mutations in the p53 gene among 21 Li-Fraumeni families. Cancer Res 1994;54:1298e304. [11] Bell DW, Varley JM, Szydlo TE, Kang DH, Wahrer DC, Shannon KE, Lubratovich M, Verselis SJ, Isselbacher KJ, Fraumeni JF, Birch JM, Li FP, Garber JE, Haber DA. Heterozygous germ line hCHK2 mutations in Li-Fraumeni syndrome. Science 1999;286:2528e31. [12] Sodha N, Houlston RS, Bullock S, Yuille MA, Chu C, Turner G, Eeles RA. Increasing evidence that germline mutations in CHEK2 do not cause Li-Fraumeni syndrome. Hum Mutat 2002;20:460e2. [13] Burt EC, McGown G, Thorncroft M, James LA, Birch JM, Varley JM. Exclusion of the genes CDKN2 and PTEN as causative gene defects in Li-Fraumeni syndrome. Br J Cancer 1999;80:9e10. [14] Portwine C, Lees J, Verselis S, Li FP, Malkin D. Absence of germline p16(INK4a) alterations in p53 wild type Li-Fraumeni syndrome families. J Med Genet 2000;37:E13. [15] Stone JG, Eeles RA, Sodha N, Murday V, Sheriden E, Houlston RS. Analysis of Li-Fraumeni syndrome and Li-Fraumeni-like families for germline mutations in Bcl10. Cancer Lett 1999;147:181e5. [16] Bougeard G, Limacher JM, Martin C, Charbonnier F, Killian A, Delattre O, Longy M, Jonveaux P, Fricker JP, Stoppa-Lyonnet D, Flaman JM, Frebourg T. Detection of 11 germline inactivating TP53 mutations and absence of TP63 and HCHK2 mutations in 17 French families with Li-Fraumeni or Li-Fraumeni-like syndrome. J Med Genet 2001;38:253e7. [17] Barlow JW, Mous M, Wiley JC, Varley JM, Lozano G, Strong LC, Malkin D. Germ line BAX alterations are infrequent in Li-Fraumeni syndrome. Cancer Epidemiol Biomarkers Prev 2004;13:1403e6. [18] Bachinski LL, Olufemi SE, Zhou X, Wu CC, Yip L, Shete S, Lozano G, Amos CI, Strong LC, Krahe R. Genetic mapping of a third Li-Fraumeni syndrome predisposition locus to human chromosome 1q23. Cancer Res 2005;65:427e31. [19] Varley JM, McGown G, Thorncroft M, Kelsey AM, Birch JM. Significance of intron 6 sequence variations in the TP53 gene in LiFraumeni syndrome. Cancer Genet Cytogenet 2001;129:85e7.
66
A. Finkova et al. / Cancer Genetics and Cytogenetics 193 (2009) 63e66
[20] Attwooll CL, McGown G, Thorncroft M, Stewart FJ, Birch JM, Varley JM. Identification of a rare polymorphism in the human TP53 promoter. Cancer Genet Cytogenet 2002;135:165e72. [21] Bougeard G, Brugieres L, Chompret A, Gesta P, Charbonnier F, Valent A, Martin C, Raux G, Feunteun J. Bressac-de Paillerets B, Frebourg T. Screening for TP53 rearrangements in families with the Li-Fraumeni syndrome reveals a complete deletion of the TP53 gene. Oncogene 2003;22:840e6. [22] Chan TL, Yuen ST, Kong CK, Chan YW, Chan AS, Ng WF, Tsui WY, Lo MW, Tam WY, Li VS, Leung SY. Heritable germline epimutation of MSH2 in a family with hereditary nonpolyposis colorectal cancer. Nat Genet 2006;38:1178e83. [23] Suter CM, Martin DI, Ward RL. Germline epimutation of MLH1 in individuals with multiple cancers. Nat Genet 2004;36:497e501. [24] Morak M, Schackert HK, Rahner N, Betz B, Ebert M, Walldorf C, Royer-Pokora B, Schulmann K, von Knebel-Doeberitz M, Dietmaier W, Keller G, Kerker B, Leitner G, Holinski-Feder E. Further evidence for heritability of an epimutation in one of 12 cases with MLH1 promoter methylation in blood cells clinically displaying HNPCC. Eur J Hum Genet 2008;16:804e11. [25] Sedlacek Z, Kodet R, Seemanova E, Vodvarka P, Wilgenbus P, Mares J, Poustka A, Goetz P. Two Li-Fraumeni syndrome families with novel germline p53 mutations: loss of the wild-type p53 allele in only 50% of tumours. Br J Cancer 1998;77:1034e9. [26] Tuck SP, Crawford L. Characterization of the human p53 gene promoter. Mol Cell Biol 1989;9:2163e72. [27] Schroeder M, Mass MJ. CpG methylation inactivates the transcriptional activity of the promoter of the human p53 tumor suppressor gene. Biochem Biophys Res Commun 1997;235:403e6. [28] Amatya VJ, Naumann U, Weller M, Ohgaki H. TP53 promoter methylation in human gliomas. Acta Neuropathol 2005;110:178e84. [29] Sidhu S, Martin E, Gicquel C, Melki J, Clark SJ, Campbell P, Magarey CJ, Schulte KM, Roher HD, Delbridge L, Robinson BG. Mutation and methylation analysis of TP53 in adrenal carcinogenesis. Eur J Surg Oncol 2005;31:549e54.
[30] Lima EM, Leal MF, Burbano RR, Khayat AS, Assumpcao PP, Bello MJ, Rey JA, Smith MA, Casartelli C. Methylation status of ANAPC1, CDKN2A and TP53 promoter genes in individuals with gastric cancer. Braz J Med Biol Res 2008;41:539e43. [31] Kontorovich T, Cohen Y, Nir U, Friedman E. Promoter methylation patterns of ATM, ATR, BRCA1, BRCA2 and P53 as putative cancer risk modifiers in Jewish BRCA1/BRCA2 mutation carriers. Breast Cancer Res Treat 2008; (doi: 10.1007/S10549-008-0121-3). [32] Kang JH, Kim SJ, Noh DY, Park IA, Choe KJ, Yoo OJ, Kang HS. Methylation in the p53 promoter is a supplementary route to breast carcinogenesis: correlation between CpG methylation in the p53 promoter and the mutation of the p53 gene in the progression from ductal carcinoma in situ to invasive ductal carcinoma. Lab Invest 2001;81:573e9. [33] Pogribny IP, James SJ. Reduction of p53 gene expression in human primary hepatocellular carcinoma is associated with promoter region methylation without coding region mutation. Cancer Lett 2002;176: 169e74. [34] Agirre X, Vizmanos JL, Calasanz MJ, Garcia-Delgado M, Larrayoz MJ, Novo FJ. Methylation of CpG dinucleotides and/or CCWGG motifs at the promoter of TP53 correlates with decreased gene expression in a subset of acute lymphoblastic leukemia patients. Oncogene 2003;22:1070e2. [35] Romero-Gimenez J, Dopeso H, Blanco I, Guerra-Moreno A, Gonzalez S, Vogt S, Aretz S, Schwartz S Jr, Capella G, Arango D. Germline hypermethylation of the APC promoter is not a frequent cause of familial adenomatous polyposis in APC/MUTYH mutation negative families. Int J Cancer 2008;122:1422e5. [36] Chen Y, Toland AE, McLennan J, Fridlyand J, Crawford B, Costello JF, Ziegler JL. Lack of germ-line promoter methylation in BRCA1-negative families with familial breast cancer. Genet Test 2006;10:281e4. [37] Snell C, Krypuy M, Wong EM, Loughrey MB, Dobrovic A. BRCA1 promoter methylation in peripheral blood DNA of mutation negative familial breast cancer patients with a BRCA1 tumour phenotype. Breast Cancer Res 2008;10:R12.
Short communication
The TP53 gene promoter is not methylated in families suggestive of Li-Fraumeni syndrome with no germline TP53 mutations Alena Finkova, Alzbeta Vazna, Ondrej Hrachovina, Sarka Bendova, Kamila Prochazkova, Zdenek Sedlacek* Department of Biology and Medical Genetics, Charles University 2nd Medical School and University Hospital Motol, Vuvalu 84, 15006 Prague 5, Czech Republic Received 5 November 2008; accepted 13 April 2009
Abstract
Germline TP53 mutations are found in only 70% of families with the Li-Fraumeni syndrome (LFS), and with an even lower frequency in families suggestive of LFS but not meeting clinical criteria of the syndrome. Despite intense efforts, to date, no other genes have been associated with the disorder in a significant number of TP53 mutation-negative families. A search for defects in TP53 other than heterozygous missense mutations showed that neither intron variants nor sequence variants in the TP53 promoter are frequent in LFS, and multiexon deletions have been found to be responsible for LFS only in several cases. Another cancer predisposition syndrome, hereditary non-polyposis colon cancer, has been associated with epigenetic silencing of one allele of the MLH1 or MSH2 genes. This prompted us to test the methylation of the TP53 gene promoter in a set of 14 families suggestive of LFS using bisulphite sequencing of three DNA fragments from the 50 region of the gene. We found no detectable methylation at any of the CG dinucleotides tested. Thus, epigenetic silencing of the TP53 promoter is not a frequent cause of the disorder in families suggestive of LFS but with no germline mutations in the coding part of the gene. Ó 2009 Elsevier Inc. All rights reserved.
1. Introduction Li-Fraumeni syndrome (LFS) is a rare autosomal dominant cancer predisposition syndrome with highly penetrant familial clustering of sarcomas, brain and adrenocortical tumors, and premenopausal breast cancers [1]. Most affected families carry germline mutations in the tumor suppressor gene TP53 coding the p53 protein [2,3]. Interestingly, TP53 mutation carriers have shorter telomeres and elevated frequency of copy number variants in their genomes, possibly further contributing to their cancer risks [4e6]. However, even in families meeting the strictest clinical criteria for LFS [7], germline TP53 mutations were found in only about 70% [8], and the diagnostic yield was even lower (around 20%) in families suggestive of LFS but meeting only relaxed criteria [9,10]. This prompted multiple attempts to identify other genes possibly involved in the syndrome. Germline mutations in the
* Corresponding author. Tel.: þ420 2 24435995; fax: þ420 2 24435994. E-mail address: [email protected] (Z. Sedlacek). 0165-4608/09/$ e see front matter Ó 2009 Elsevier Inc. All rights reserved. doi:10.1016/j.cancergencyto.2009.04.014
CHEK2 gene coding a checkpoint kinase acting in the same pathway upstream of the p53 protein were found in several families, but subsequent analyses questioned the broad involvement of this gene in LFS [11,12]. Similarly, no causal role in the syndrome was shown for PTEN [13], CDKN2 [13,14], BCL10 [15], TP63 [16], and BAX [17]. The analysis of families with no linkage to TP53 pointed to a region of chromosome 1 as a possible predisposing locus [18], but no gene from this region has been associated with LFS yet. The failure to assign other loci the causal role in LFS led to a search for defects in TP53 other than the classic heterozygous point mutations in the coding region of the gene, but neither intron variants [19] nor variants of the promoter [20] were shown to contribute to the phenotype. Another type of genetic defect that could escape detection using sequencing, large deletions of the TP53 gene, was also found to be only a very rare cause of LFS [21]. Interestingly, in several families, another cancer predisposition syndrome, hereditary non-polyposis colon cancer, was associated with epigenetic silencing of one allele of one of the predisposing genes, MLH1 or MSH2,
A. Finkova et al. / Cancer Genetics and Cytogenetics 193 (2009) 63e66
64
accompanied by methylation of the respective gene promoters [22e24]. As the TP53 gene in mutation-negative LFS families could potentially be inactivated by the same mechanism, we decided to test this possibility on a set of 14 families suggestive of LFS.
CAAACTTCCATCCCACT). Sequencing was performed using the polymerasae chain reaction (PCR) primers on an ABI PRISM 3100-Avant genetic analyzer (Applied Biosystems, Foster City, CA). A total of 10 CG dinucleotides could be reliably scored and were included in the analysis (Fig. 1). In parallel, a sample of universally methylated DNA (Chemicon) was subjected to the same procedure.
2. Materials and methods 2.1. Patients and families
3. Results and Discussion
Only families suggestive of LFS in whom TP53 mutation testing yielded negative results were enrolled into the study. These included 13 families meeting the criteria for LFS [7], Li-Fraumeni-like syndrome [10], or the Chompret criteria [9], and 1 family not meeting the criteria but including a child with rhabdomyosarcoma and several other affected relatives (Table 1). DNA was isolated from blood lymphocytes of the index patients from each family using the Gentra Puregene Blood Kit (Qiagen, Hilden, Germany). No germline TP53 mutations were found upon amplification and sequencing of all exons of the TP53 gene in any of the patients using the protocols described previously [25]. 2.2. Methylation analysis of the TP53 gene promoter DNA was chemically converted by bisulphite treatment using the CpGenome DNA Modification Kit (Chemicon, Temecula, CA). Three fragments of the promoter region of the TP53 gene and its putative CpG island [26,27] of 143, 120, and 158 base pairs (bp) containing 3, 7, and 6 CG dinucleotides, respectively (Fig. 1), were amplified using primers F (GGATTATTTGTTTTTATTTGTTATGG), R (ATAACTCT AAACTTTTAAAAAACTC), B (GGGAGTAGGTAGTT GTTGGGTTT), D (AAAAACTCATCAAATTCAATCAA AA), C (TTTTTGGATTGGGTAAGTTTTTG), and U (AAC
Methylation was not detectable at any of the 10 CG dinucleotides studied (Fig. 1) in any of the 14 patient samples. The cytosines within these CG dinucleotides were fully converted into thymines. In several experiments, where favorable signal-to-noise ratios allowed scoring of all 16 CG dinucleotides, no methylation was observed at any of the additional sites. In contrast to the DNA of the patients, sequencing of the PCR products obtained from the universally methylated DNA showed no conversion of cytosines at any of the CG dinucleotides tested. The methylation status of our patients thus resembled that of normal tissues from normal control individuals in which only unmethylated CG sites were detected in the TP53 promoter [28e31]. Methylation of the TP53 gene promoter was shown experimentally to reduce the transcriptional activity of the gene [27]. Several studies have subsequently revealed that TP53 promoter methylation could represent an alternative pathway to the inactivation of TP53 by a mutation in several types of sporadic tumors (e.g., breast cancer, hepatocellular carcinoma, leukemia, and glioma) [28,32e34], but not in adrenocortical or gastric cancer [29,30]. As far as hereditary cancer predisposition syndromes are concerned, aberrant constitutional promoter methylation of
Table 1 Cancer families enrolled into the study Family
Classification
Tumors
1 2 3 4 5 6 7 8 9 10 11 12 13
LFS, LFL, CH CH CH CH CH LFL CH CH CH LFL, CH CH CH LFL
P: P: P: P: P: P: P: P: P: P: P: P: P:
14
FH
uterine cancer þ osteosarcoma (34), D: osteosarcoma (10), M: ovarian cancer (44) uterine cancer (sarcoma) (33), S: breast cancer (28), PGM: bone cancer (?) adrenocortical carcinoma (16) breast cancer (38), B: astrocytoma (14), F: prostate cancer (66) breast cancer (29), B: colon cancer (sarcoma) (28), PC: testicular cancer (28) breast cancer (31), D: neuroblastoma (7), F: lung cancer (46) Ewing sarcoma (11) þ rhabdomyosarcoma (17), M: melanoma (20) breast cancer (45), M: breast cancer (29), MC: ovarian cancer (fibrosarcoma) (23) adrenocortical carcinoma (?) osteosarcoma (14), PA: breast cancer (56), PGF: gastrointestinal tract tumor (53) adrenocortical carcinoma (18) adrenocortical carcinoma (?) pleural sarcoma (35), F: adrenocortical carcinoma (60), MA: breast cancer (70), MGM: sarcoma (79), MGA: brain tumor (90) P: rhabdomyosarcoma (9), MGF: lung cancer (60), MGU: lung cancer (50), MGU: unknown cancer (30)
LFS, Li-Fraumeni syndrome [7]; LFL, Li-Fraumeni-like syndrome [10]; CH, Chompret criteria [9] [all sets of fulfilled criteria are indicated, although formally, the diagnosis of LFS excludes the diagnosis of LFL (family 1)]; FH, family history of cancer; age at tumor onset is in parentheses; ?, unknown age at onset; þ, multiple tumors in one individual; P, patient; D, daughter; M, mother; S, sister; PGM, paternal grandmother; B, brother; F, father; PC, paternal cousin; MC, maternal cousin; PA, paternal aunt; PGF, paternal grandfather; MA, maternal aunt; MGM, maternal grandmother; MGA, maternal grandaunt; MGF, maternal grandfather; MGU, maternal granduncle.
A. Finkova et al. / Cancer Genetics and Cytogenetics 193 (2009) 63e66
65
CG dinucleotides -100
-50
+1
basal promoter region
+50
+100
+150
+200
+250 bp
TP53 exon 1 putative TP53 CpG island
PCR primers and products
F
R
B
C
D
U
Fig. 1. Schematics of the 5’ end of the TP53 gene with positions of CG dinucleotides and PCR primers and products used in the analysis. Arrows point to CG dinucleotides that could be scored reliably in all patients. Minor and major transcription start sites (open and closed triangles, respectively) are indicated, as well as the 85-bp basal promoter region and the putative TP53 CpG island. Bases are numbered relative to the proximal major start site (þ1).
the causative genes, in some cases heritable, was observed in hereditary non-polyposis colon cancer [22e24]. This mechanism, however, does not seem to be frequent in other hereditary cancer syndromes. No epigenetic silencing of the APC gene was found among 60 families with adenomatous polyposis coli [35], and no abnormal methylation of BRCA1 promoter was found among 41 BRCA1/2 mutation-negative breast cancer families [36]. A low level of methylation possibly attributable to somatic mosaicism was identified in 3 out of 7 patients from another study [37], but subsequently in normal controls also [31]. Our study, although limited in size and scope, implies that this gene is not frequently epigenetically inactivated by methylation of its promoter in families suggestive of LFS but with no germline TP53 mutations.
Acknowledgments This work was supported by grants MSM0021620813 and MZO00064203. References [1] Li FP, Fraumeni JF Jr. Soft-tissue sarcomas, breast cancer, and other neoplasms. A familial syndrome? Ann Intern Med 1969;71:747e52. [2] Malkin D, Li FP, Strong LC, Fraumeni JF Jr, Nelson CE, Kim DH, Kassel J, Gryka MA, Bischoff FZ, Tainsky MA, et al. Germ line p53 mutations in a familial syndrome of breast cancer, sarcomas, and other neoplasms. Science 1990;250:1233e8. [3] Srivastava S, Zou ZQ, Pirollo K, Blattner W, Chang EH. Germ-line transmission of a mutated p53 gene in a cancer-prone family with Li-Fraumeni syndrome. Nature 1990;348:747e9. [4] Tabori U, Nanda S, Druker H, Lees J, Malkin D. Younger age of cancer initiation is associated with shorter telomere length in LiFraumeni syndrome. Cancer Res 2007;67:1415e8. [5] Trkova M, Prochazkova K, Krutilkova V, Sumerauer D, Sedlacek Z. Telomere length in peripheral blood cells of germline TP53 mutation carriers is shorter than that of normal individuals of corresponding age. Cancer 2007;110:694e702. [6] Shlien A, Tabori U, Marshall CR, Pienkowska M, Feuk L, Novokmet A, Nanda S, Druker H, Scherer SW, Malkin D. Excessive genomic DNA copy number variation in the Li-Fraumeni cancer predisposition syndrome. Proc Natl Acad Sci USA 2008;105: 11264e9.
[7] Li FP, Fraumeni JF Jr, Mulvihill JJ, Blattner WA, Dreyfus MG, Tucker MA, Miller RW. A cancer family syndrome in twenty-four kindreds. Cancer Res 1988;48:5358e62. [8] Varley JM, McGown G, Thorncroft M, Santibanez-Koref MF, Kelsey AM, Tricker KJ, Evans DG, Birch JM. Germ-line mutations of TP53 in Li-Fraumeni families: an extended study of 39 families. Cancer Res 1997;57:3245e52. [9] Chompret A, Abel A, Stoppa-Lyonnet D, Brugieres L, Pages S, Feunteun J, Bonaiti-Pellie C. Sensitivity and predictive value of criteria for p53 germline mutation screening. J Med Genet 2001;38:43e7. [10] Birch JM, Hartley AL, Tricker KJ, Prosser J, Condie A, Kelsey AM, Harris M, Jones PH, Binchy A, Crowther D, Craft AW, Eden OB, Evans DGR, Thompson E, Mann JR, Martin J, Mitchell ELD, Santibanez-Koref MF. Prevalence and diversity of constitutional mutations in the p53 gene among 21 Li-Fraumeni families. Cancer Res 1994;54:1298e304. [11] Bell DW, Varley JM, Szydlo TE, Kang DH, Wahrer DC, Shannon KE, Lubratovich M, Verselis SJ, Isselbacher KJ, Fraumeni JF, Birch JM, Li FP, Garber JE, Haber DA. Heterozygous germ line hCHK2 mutations in Li-Fraumeni syndrome. Science 1999;286:2528e31. [12] Sodha N, Houlston RS, Bullock S, Yuille MA, Chu C, Turner G, Eeles RA. Increasing evidence that germline mutations in CHEK2 do not cause Li-Fraumeni syndrome. Hum Mutat 2002;20:460e2. [13] Burt EC, McGown G, Thorncroft M, James LA, Birch JM, Varley JM. Exclusion of the genes CDKN2 and PTEN as causative gene defects in Li-Fraumeni syndrome. Br J Cancer 1999;80:9e10. [14] Portwine C, Lees J, Verselis S, Li FP, Malkin D. Absence of germline p16(INK4a) alterations in p53 wild type Li-Fraumeni syndrome families. J Med Genet 2000;37:E13. [15] Stone JG, Eeles RA, Sodha N, Murday V, Sheriden E, Houlston RS. Analysis of Li-Fraumeni syndrome and Li-Fraumeni-like families for germline mutations in Bcl10. Cancer Lett 1999;147:181e5. [16] Bougeard G, Limacher JM, Martin C, Charbonnier F, Killian A, Delattre O, Longy M, Jonveaux P, Fricker JP, Stoppa-Lyonnet D, Flaman JM, Frebourg T. Detection of 11 germline inactivating TP53 mutations and absence of TP63 and HCHK2 mutations in 17 French families with Li-Fraumeni or Li-Fraumeni-like syndrome. J Med Genet 2001;38:253e7. [17] Barlow JW, Mous M, Wiley JC, Varley JM, Lozano G, Strong LC, Malkin D. Germ line BAX alterations are infrequent in Li-Fraumeni syndrome. Cancer Epidemiol Biomarkers Prev 2004;13:1403e6. [18] Bachinski LL, Olufemi SE, Zhou X, Wu CC, Yip L, Shete S, Lozano G, Amos CI, Strong LC, Krahe R. Genetic mapping of a third Li-Fraumeni syndrome predisposition locus to human chromosome 1q23. Cancer Res 2005;65:427e31. [19] Varley JM, McGown G, Thorncroft M, Kelsey AM, Birch JM. Significance of intron 6 sequence variations in the TP53 gene in LiFraumeni syndrome. Cancer Genet Cytogenet 2001;129:85e7.
66
A. Finkova et al. / Cancer Genetics and Cytogenetics 193 (2009) 63e66
[20] Attwooll CL, McGown G, Thorncroft M, Stewart FJ, Birch JM, Varley JM. Identification of a rare polymorphism in the human TP53 promoter. Cancer Genet Cytogenet 2002;135:165e72. [21] Bougeard G, Brugieres L, Chompret A, Gesta P, Charbonnier F, Valent A, Martin C, Raux G, Feunteun J. Bressac-de Paillerets B, Frebourg T. Screening for TP53 rearrangements in families with the Li-Fraumeni syndrome reveals a complete deletion of the TP53 gene. Oncogene 2003;22:840e6. [22] Chan TL, Yuen ST, Kong CK, Chan YW, Chan AS, Ng WF, Tsui WY, Lo MW, Tam WY, Li VS, Leung SY. Heritable germline epimutation of MSH2 in a family with hereditary nonpolyposis colorectal cancer. Nat Genet 2006;38:1178e83. [23] Suter CM, Martin DI, Ward RL. Germline epimutation of MLH1 in individuals with multiple cancers. Nat Genet 2004;36:497e501. [24] Morak M, Schackert HK, Rahner N, Betz B, Ebert M, Walldorf C, Royer-Pokora B, Schulmann K, von Knebel-Doeberitz M, Dietmaier W, Keller G, Kerker B, Leitner G, Holinski-Feder E. Further evidence for heritability of an epimutation in one of 12 cases with MLH1 promoter methylation in blood cells clinically displaying HNPCC. Eur J Hum Genet 2008;16:804e11. [25] Sedlacek Z, Kodet R, Seemanova E, Vodvarka P, Wilgenbus P, Mares J, Poustka A, Goetz P. Two Li-Fraumeni syndrome families with novel germline p53 mutations: loss of the wild-type p53 allele in only 50% of tumours. Br J Cancer 1998;77:1034e9. [26] Tuck SP, Crawford L. Characterization of the human p53 gene promoter. Mol Cell Biol 1989;9:2163e72. [27] Schroeder M, Mass MJ. CpG methylation inactivates the transcriptional activity of the promoter of the human p53 tumor suppressor gene. Biochem Biophys Res Commun 1997;235:403e6. [28] Amatya VJ, Naumann U, Weller M, Ohgaki H. TP53 promoter methylation in human gliomas. Acta Neuropathol 2005;110:178e84. [29] Sidhu S, Martin E, Gicquel C, Melki J, Clark SJ, Campbell P, Magarey CJ, Schulte KM, Roher HD, Delbridge L, Robinson BG. Mutation and methylation analysis of TP53 in adrenal carcinogenesis. Eur J Surg Oncol 2005;31:549e54.
[30] Lima EM, Leal MF, Burbano RR, Khayat AS, Assumpcao PP, Bello MJ, Rey JA, Smith MA, Casartelli C. Methylation status of ANAPC1, CDKN2A and TP53 promoter genes in individuals with gastric cancer. Braz J Med Biol Res 2008;41:539e43. [31] Kontorovich T, Cohen Y, Nir U, Friedman E. Promoter methylation patterns of ATM, ATR, BRCA1, BRCA2 and P53 as putative cancer risk modifiers in Jewish BRCA1/BRCA2 mutation carriers. Breast Cancer Res Treat 2008; (doi: 10.1007/S10549-008-0121-3). [32] Kang JH, Kim SJ, Noh DY, Park IA, Choe KJ, Yoo OJ, Kang HS. Methylation in the p53 promoter is a supplementary route to breast carcinogenesis: correlation between CpG methylation in the p53 promoter and the mutation of the p53 gene in the progression from ductal carcinoma in situ to invasive ductal carcinoma. Lab Invest 2001;81:573e9. [33] Pogribny IP, James SJ. Reduction of p53 gene expression in human primary hepatocellular carcinoma is associated with promoter region methylation without coding region mutation. Cancer Lett 2002;176: 169e74. [34] Agirre X, Vizmanos JL, Calasanz MJ, Garcia-Delgado M, Larrayoz MJ, Novo FJ. Methylation of CpG dinucleotides and/or CCWGG motifs at the promoter of TP53 correlates with decreased gene expression in a subset of acute lymphoblastic leukemia patients. Oncogene 2003;22:1070e2. [35] Romero-Gimenez J, Dopeso H, Blanco I, Guerra-Moreno A, Gonzalez S, Vogt S, Aretz S, Schwartz S Jr, Capella G, Arango D. Germline hypermethylation of the APC promoter is not a frequent cause of familial adenomatous polyposis in APC/MUTYH mutation negative families. Int J Cancer 2008;122:1422e5. [36] Chen Y, Toland AE, McLennan J, Fridlyand J, Crawford B, Costello JF, Ziegler JL. Lack of germ-line promoter methylation in BRCA1-negative families with familial breast cancer. Genet Test 2006;10:281e4. [37] Snell C, Krypuy M, Wong EM, Loughrey MB, Dobrovic A. BRCA1 promoter methylation in peripheral blood DNA of mutation negative familial breast cancer patients with a BRCA1 tumour phenotype. Breast Cancer Res 2008;10:R12.