The transmembrane domain of syntaxin 1A negatively regulates voltage-sensitive Ca2+ channels

Neuroscience Vol. 104, No. 2, pp. 599±607, 2001 599 Ca 21 channel regulation by syntaxin transmembrane domain

Pergamon

PII: S0306-4522(01)00083-5

q 2001 IBRO. Published by Elsevier Science Ltd Printed in Great Britain. All rights reserved 0306-4522/01 $20.00+0.00

www.elsevier.com/locate/neuroscience

THE TRANSMEMBRANE DOMAIN OF SYNTAXIN 1A NEGATIVELY REGULATES VOLTAGE-SENSITIVE Ca 21 CHANNELS M. TRUS, a* O. WISER, a* M. C. GOODNOUGH b and D. ATLAS a² a

Department of Biological Chemistry, The Hebrew University of Jerusalem, Jerusalem 91904, Israel

b

Department of Food Microbiology and Toxicology, University of Wisconsin, Madison, WI 53706, USA

AbstractÐSyntaxin 1A has a pronounced inhibitory effect on the activation kinetics and current amplitude of voltage-gated Ca 21 channels. This study explores the molecular basis of syntaxin interaction with N- and Lc-type Ca 21 channels by way of functional assays of channel gating in a Xenopus oocytes expression system. A chimera of syntaxin 1A and syntaxin 2 in which the transmembrane domain of syntaxin 2 replaced the transmembrane of syntaxin 1A (Sx1-2), signi®cantly reduced the rate of activation of N- and Lc-channels. This shows a similar effect to that demonstrated by syntaxin 1A, though the current was not inhibited. The major sequence differences at the transmembrane of the syntaxin isoforms are that the two highly conserved cysteines Cys 271 and Cys 272 in syntaxin 1A correspond to the valines Val 272 and Val 273 in syntaxin 2 transmembrane. Mutating either cysteines in Sx1-1 (syntaxin 1A) to valines, did not affect modulation of the channel while a double mutant C271/272V was unable to regulate inward current. Transfer of these two cysteines to the transmembrane of syntaxin 2 by mutating Val 272 and Val 273 to Cys 272 and Cys 273 led to channel inhibition. When cleaved by botulinum toxin, the syntaxin 1A fragments, amino acids 1-253 and 254-288, which includes the transmembrane domain, were both unable to inhibit current amplitude but retained the ability to modify the activation kinetics of the channel. A full-length syntaxin 1A and the integrity of the two cysteines within the transmembrane are crucial for coordinating Ca 21 entry through the N- and Lc-channels. These results suggest that upon membrane depolarization, the voltage-gated N- and Lc-type Ca 21-channels signal the exocytotic machinery by interacting with syntaxin 1A at the transmembrane and the cytosolic domains. Cleavage with botulinum toxin disrupts the coupling of the N- and Lc-type channels with syntaxin 1A and abolishes exocytosis, supporting the hypothesis that these channels actively participate in Ca 21 regulated secretion. q 2001 IBRO. Published by Elsevier Science Ltd. All rights reserved. Key words: secretion, Ca 21 channels, syntaxin, exocytosis, synaptotagmin, transmitter release.

Neurotransmitter release is mediated by a Ca 21 entry that initiates fusion of synaptic vesicles with the presynaptic membrane. The three major proteins involved in the fusion process are syntaxin 1A, synaptosome associated protein (SNAP-25) and vesicle associated membrane protein (VAMP) II (synaptobrevin) referred to as SNARE (SNAP-receptor) proteins. 41 According to present theories, assembly of SNAREs into a stable ternary-complex 1,14,17,19,24,44 is suf®cient to cause membrane fusion. 47,28 Other studies showed that SNARE complex association/dissociation did not affect the rate of fusion and were not speci®c. 10,11 The N-, P/Q-, and Lc-type voltage-sensitive Ca 21

channels are physically 3,9,39,40,45,49,50 and functionally linked to the SNARE proteins. 3,45,49±51 The binding of recombinant synaptic proteins was mapped to the II±III domain of the a1 subunit of N-, L-, and P/Q-type Ca 21 channels (synprint). 38±40,45,49±51 Furthermore, this cytosolic loop of N- and Lc-type channels a1B and a1C subunits inhibits neurotransmitter release when injected into secreting cells. 27,33,51 Syntaxin 1A signi®cantly reduces current amplitude and modi®es the rates of activation and inactivation of these channels when coexpressed in Xenopus oocytes. The reduction in current amplitude is however, not mimicked by truncated syntaxin lacking a transmembrane (TM) domain or by syntaxin 2. 50 Synaptotagmin reversed the inhibitory effect of syntaxin in Xenopus oocytes, and the SNAP25 altered P/Q channel activity in HEK cells. 45,49,54 Despite overwhelming biochemical 2,5,18,20,25,29,35 and genetic 7,34,37,52 evidence linking syntaxin 1A to exocytosis, data on the syntaxin 1A domains that interact with the voltage-sensitive Ca 21 channels are limited. 38 To locate syntaxin 1A domain interaction we monitored alterations in the kinetic properties of N- and Lctype Ca 21 channels by (i) a syntaxin 1A/2 chimera (Sx1-2); (ii) single and double amino acid syntaxinmutants; and (iii) botulinum toxin C-1 (Bot-C1). Two

*These authors contributed equally to the work. ²Corresponding author. Tel.: 11-972-2-658-5406; fax: 11-972-2658-5413. E-mail address: [email protected] (D. Atlas). Abbreviations: Bot-C1, botulinum toxin C-1; BSA, bovine serum albumin; GST, glutathione S-transferase; H, helical domain; HEPES, N-(2-hyroxyethyl) piperazine-N 0 -(2-ethanesulphonic acid); LC, light chain; OD, optical density; PCR, polymerase chain reaction; SNAP, soluble NSF sensitive attachment protein; SNARE, SNAP receptor; SNAP-25, synaptosome associated protein; Sx, syntaxin chimera; tact, time constant of activation; tinact, time constant of inactivation; TM, transmembrane; VAMP, vesicle associated membrane protein. 599

600

M. Trus et al.

adjacent cysteines, within the TM domain of syntaxin 1A (but not in syntaxin 2), are crucial for regulating current amplitude. The implications of these modi®cations for synaptic transmission are discussed. EXPERIMENTAL PROCEDURES

Anti-syntaxin antibodies were the kind gift of M. Takahashi (Tokyo, Japan), anti-a1C from Alomone Laboratories (Jerusalem, Israel), a*1C (dN60-del1773; X15539) rat b2A (m80545) from L. Birnbaumer (LA, USA); a2/d rabbit skeletal (M86621) from A. Schwarz (OH, USA); and rbB-I rat brain (a1B; M92905) from T.P.Snutch (B.C., Canada). All polymerase chain reactions (PCR) were carried out with Taq plus DNA polymerase (Startagene, CA, USA). Constructs Mutants in the TM domain of syntaxin 1A and syntaxin 2 were prepared by PCR extension of the appropriate mutated primers using either syntaxin 1A or syntaxin 2 as a template. To facilitate these constructs a BssHII site at the 3 0 end of the cytosolic syntaxin 1A fragment was introduced. This cytosolic fragment was cloned into the EcoRI site of pGEM-He-juel. 45 The BssH II site was used to introduce the appropriate TM domain derived from either syntaxin 1A or syntaxin 2. Sx1-2 was constructed by ligating a PCR fragment corresponding to the cytosolic domain of syntaxin 1A (M1-K265) with the TM domain of syntaxin 2 (amino acid W267-K290). Sx1-1 was constructed by ligating the PCR fragment (M1-K265) to the original TM domain of syntaxin 1A (amino acids: I266-288). This was then used as a syntaxin 1A control that included the silent mutation. Sx2-1 was constructed by ligating a PCR fragment corresponding to the cytosolic domain of syntaxin 2 (amino acids: M1-K266) with the TM domain of syntaxin 1A (amino acids: I266-288). cDNA of Bot-C1 light chain (LC) was prepared from LC cloned in pMAL-C2 with the primers 5 0 TTGGATCCATGCCAATAACAATTAACAAC and 3 0 TAGGATCCTAA CAAAATTTTGTAAATAAATAAAG. The PCR fragment was cut with BamH1 ®lled in and was then ligated into the pGEM-He-juel at the Sma I site. cRNA injection and protein expression in Xenopus oocytes Oocytes were removed and defolliculated by collagenase treatment as described. 51 Cells were maintained at 198C in ND96 solution (mM): 96 NaCl, 2 KCl, 1 MgCl2, 1.8 CaCl2, 2.5 Na 1 pyruvate/5 HEPES (pH 7.4) with antibiotics. Plasmid DNA for the channel subunits, a*1C (dN60-del1773), a1B, a2d,b2A syntaxin 1A, syntaxin 2 51 and Sx1-1, Sx1-2, Sx2-1were linearized, transcribed in vitro using T7 polymerase (Stratagene kit) in the presence of the cap analog G (5 0 ) ppp (5 0 ) G (Pharmacia, NJ, USA). cRNA was extracted with phenol:chloroform:isoamylalcohol (25:24:1, pH 5.5) and precipitated with 0.8 M LiCl over-night at 2208C. After 30 min centrifugation at 12,000 £ g cRNA pellets were washed three times with 95% denatured ethanol (5% methanol), dried and dissolved in 20 ml sterile ddH2O pre-®ltered through a 0.2 mm syringe ®lter. cRNA concentration was by OD260 (optical density) and its purity by OD260/OD280. The in vitro-transcribed capped cRNAs were injected into oocytes in a ®nal volume of 40 nl. In each experiment oocytes were injected with cRNA encoding either a1C/b2A/a2d (Lc-type channel) or a1Ba2d/b2A (N-type channel). Twenty-four hours later, oocytes were injected with syntaxin 1A as a control and with syntaxin chimeras or syntaxin mutants. Every experiment included oocytes injected with the same amount of channel. The effects of the chimeras or mutants were compared to syntaxin 1A injected with the same batch of oocytes. Electrophysiological assays Whole cell currents were recorded by applying a standard twomicroelectrode voltage clamp using a Dagan 8500 ampli®er.

Voltage and current agar cushioned electrodes (0.3±0.6 MV) were ®lled with 3 M KCl. 36 Current±voltage relationships were determined by voltage steps as indicated in the ®gure legends, in Ba 21 solution (mM): 5 Ba(OH)2, 50 N-methyl-d-glucamine (NMDG), 1 KOH, 40 tetraethylammonium (TEA), 5 HEPES (pH 7.5), titrated to pH 7.5 with (CH3)2SO4. Activation and inactivation kinetics were determined from leak subtracted current traces by a mono-exponential ®t of the pClamp7 software (Axon Instrument, USA). Conductance (G) was determined using equation G ˆ I/(V-Erev), where I ˆ peak-current, V ˆ voltage test pulse and Erev ˆ reversal potential of 5 mM Ba 21 obtained from linear regression at the X intercept of G±V curves plotted as G/Gmax versus voltage pulse and ®tted according to Boltzmann. Data presentation was done using Origin5 software (Microcal, USA). The data points correspond to the mean ^ S.E.M. (n ˆ 10±15) or as indicated. Statistical signi®cance was determined by Student's t-test, (P , 0.001) or as indicated. Membrane protein separation and identi®cation Oocytes were homogenized (Kontes homogenizer) in buffer containing (mM): Tris±HCl 10 (pH 7.4), EDTA 1, sucrose 250. This buffer also contains a cocktail of protease inhibitors: aprotinin, phenymethyl sulfonyl ¯uoride (PMSF), iodoaectamide, pepstatin A and luepeptin. Homogenates were then centrifuged (12,000 £ g, 10 min) to remove the yolk. The milky supernatant (membranous) was separated from the clear fraction (cytosol) and used for determining syntaxin expression. In the case of Bot-C1 expression, both fractions were used. For determining protein expression in oocyte plasma membranes, oocytes were incubated in cold hypotonic buffer containing 5 mM NaCl, 5 mM HEPES (pH 7.5) supplemented with protease-inhibitors. Plasma membranes were separated using ®ne forceps. Protein samples were quanti®ed (Bradford reagent, BioRad, USA), using bovine serum albumin as a standard, then separated by 10% sodium dodecylsulphate±polymerase gel electrophoresis and detected electrochemiluminescent system using anti syntaxin 1A and anti-a1C antibodies. RESULTS

Syntaxin tranmembrane domain modulates current amplitude of Lc- and N-type Ca 21 channels The dramatic modulation of Ca 21 channel kinetics and amplitude by syntaxin 1A 3,51could result from a reduction in the number of Ca 21 channels on the cell surface. To test this possibility, Ca 21 channel activity at the plasma membrane was monitored. cRNAs encoding the Lc-type channel, a*1C, a2d, and b2A were injected into Xenopus oocytes. Two days later, syntaxin 1A cRNA was injected and at day 4±6, currents were evoked from a holding potential of 280 mV to 120 mV test pulse (80 ms). Current amplitude reached its maximal value in oocytes expressing either the channel alone or combined with syntaxin 1A. Current inhibition was detected in oocytes expressing syntaxin 1A, starting only at day 5 and 6 (Fig. 1A; left). Since the maximal number of functional channels in the plasma membrane has been achieved, the decrease in current amplitude indicates a direct syntaxin interaction with the channel rather than an effect on number of channels. Furthermore, western blot analysis of oocyte-plasma membrane showed an increase of a1C if expressed with syntaxin 1A (Fig. 1A; right). To map the syntaxin 1A domains responsible for modifying the kinetic properties of Ca 21 channels, we prepared Sx1-2, a chimera in which syntaxin 1A TM

Ca 21 channel regulation by syntaxin transmembrane domain

601

Fig. 1. Functional and western blot analysis of Lc-type Ca 21 channels and syntaxin in Xenopus oocytes (A, left) Xenopus oocytes were injected with cRNA of a*1C(2 ng), b2A(5 ng), and a2d (1.5 ng). At day 2, syntaxin cRNA (5 ng) was injected and at days 4±6 currents were recorded in response to 400 ms test pulse from a holding potential of 280 mV to 120 mV. Peak current amplitudes of oocytes injected with (closed circle) and without syntaxin (open circle) are presented. The data points correspond to the mean ^ S.E.M.; at day 6, P , 0.001 (n ˆ 12). Syntaxin expression in Xenopus oocyte membrane was analyzed by anti-a1C antibodies (right). (B) Western blot analysis of membrane fraction of oocyte expressing the Lc-channel alone or with 3.3 ng/oocyte of syntaxin 1-1 or syntaxin 1-2, using anti-syntaxin antibodies.

domain was replaced by the TM domain of syntaxin 2. The amino acid sequence of the two syntaxin-isoforms differs mainly in the TM domain, ,30% homology, as compared to 79% for the entire sequence. 2 First, protein levels of syntaxin 1-1 and syntaxin 1-2 in oocyte membranes were determined using monoclonal anti-syntaxin antibodies. The 35 kDa syntaxin 1A protein was detected in oocytes expressing Sx1-1 and Sx1-2, demonstrating similar expression and insertion in Xenopus oocyte membranes (Fig. 1B). Next, we tested the functional effect of Sx1-2. Representative traces (Fig. 2A) and leak-subtracted peak current±voltage relationships (I±V curves; Fig. 2B, C) showed that Sx1-1 caused a signi®cant reduction in maximal current in voltages ranging from 220 to 140 mV, an effect equal to that of syntaxin 1A (Fig. 2A±C). In contrast, Sx1-2 showed a moderate inhibition only at lower activation voltages. Similar to syntaxin 2 it failed to reduce current amplitude at higher voltages indicating a right shift of the voltage dependence of activation (Fig. 2A±C). The shift toward positive potentials was clearly demonstrated in the G±V curves (Fig. 2D, E). The midpoint of activation of the channel V1/ 2 ˆ 214.08 ^ 1.0 was shifted by syntaxin 1A to 24.8 ^ 0.8 mV, by Sx1-1 to 24.6 ^ 0.69 mV, by Sx12 to 25.9 ^ 0.5 mV, and by syntaxin 2 to 210 ^ 0.7 mV; Erev ˆ 50, 50.6, 57, 56 and 47 mV, respectively (Fig. 2D,E). The slopes of the Boltzmann ®t were similar. Both Sx1-1 and Sx1-2 lowered the rate of activation (Fig. 2F; quantitation of the activation kinetics is shown below). Together, these results demonstrate that syntaxin 1A TM domain confers the mediated inhibitory action of Lc-type currents and the cytosolic domain of syntaxin 1A is responsible for reducing the rate and voltage dependence of activation. The consequences of substituting syntaxin 2 TM domain for syntaxin 1A TM domain were also tested with N-type Ca 21 channels. The slow activation rate of rbB-I 43 made tact measurements reliable. cRNA of a1B,

a2d, b2A, the N-type channel subunits, 51 were coexpressed in Xenopus oocytes with Sx1-2 and Sx1-1. Representative traces of N-type currents (Fig. 3A) and leak-subtracted peak current±voltage relationships (Fig. 3B) showed that Sx1-1 current inhibition was lost in Sx12. It would appear that similar to inhibiting Lc-currents, the TM domain of syntaxin 1A is responsible for conferring inhibition of ion ¯ow through the N-type Ca 21 channel. The G±V relationship was not shifted. The mid-point of activation V1/2 of N-type channel alone was 0.6 ^ 0.4 mV, with Sx1-1 20.48 ^ 0.5 mV and Sx1-2 21.7 ^ 0.7 mV; Erev ˆ 53, 46 and 49 mV respectively (Fig. 3C). However, Sx1-1 modi®ed the slope of the channel from e-fold/3.3 ^ 0.4 to 7.4 ^ 0.5 mV and Sx1-2 to 6.1 ^ 0.6 mV (Fig. 3C). Sx1-1 and Sx1-2 induced a decrease in the rates of activation from tact ˆ 193 ^ 16 (n ˆ 10) to 261 ^ 32 ms (n ˆ 5; P , 0.002) and to 359 ^ 32 ms (n ˆ 6; P , 0.0001) respectively (Fig. 3D). Similarly a decrease in the rates of inactivation (Fig. 3E) from tinact ˆ 5.6 ^ 1.2 s (n ˆ 5) to 10.9 ^ 0.4 s (n ˆ 3) and 15.9 ^ 1.2 s (n ˆ 4) by Sx1-1 and Sx1-2 respectively, practically unaffected by TM substitution. N- and Lc-channel activation kinetics is modi®ed by syntaxin 1A Previously we have shown that syntaxin 1A in addition to inhibiting ion ¯ow, slows-down the activation rate of Lc-channel channel. 50 To determine whether modulation of activation kinetics can be mapped to the TM or the cytosolic domain of syntaxin, we measured the Sx1-2 effect on the activation rate of Lc- and N-type channels. Oocytes were injected with the channel subunits and one day later with two cRNA concentrations of Sx1-1 and Sx1-2, 1.6 and 3.3 ng/oocyte. Five days later, inward currents were evoked in response to various test potentials (Fig. 4A±D). The Sx1-1 and Sx1-2 concentrationdependent effect on the time constant of activation (tact)

602

M. Trus et al.

Fig. 2. Functional modulation of Lc-type Ca 21 channels by syntaxin 1-1 and syntaxin 1-2. (A) Superposition of macroscopic currents evoked from a holding potential of 280 mV to various test potentials of 5 mV increments in response to 80 ms test pulse (inset) in oocytes expressing a1*C, b2A and a2/d alone or with syntaxin 1A, syntaxin 2 (cRNA 5 ng/oocyte), syntaxin 1-1 and syntaxin 1-2. cRNA was injected as described in Fig. 1. (B) Current±voltage relationship: collected data from oocytes co-expressing a1*C, b2A, and a2/d (open circle) or with syntaxin 1A (closed circle) syntaxin 2 (closed square) and (C) with syntaxin 1-1 (closed triangle) syntaxin 1-2 (open triangle). (D, E) Normalized conductance±voltage (G±V) relationship obtained from (B, C), displayed with a Boltzmann ®t. (F) Normalized representative current traces of Lc-channel with syntaxin 1-1- or syntaxin 1-2 evoked to 110 mV. The onset of response was plotted and ®tted by a mono exponential ®t. The data points correspond to the mean ^ S.E.M. of currents (n ˆ 10±15). Current traces have been corrected for leakage and capacitative transients by on-line subtraction.

was observed for both types of channels. Both Sx1-1 and Sx1-2 modi®ed tact practically to the same extent (Figs 4A±D and 6). The small but signi®cant increase in tact with 1.6 ng of Sx1-1 and Sx1-2 became more pronounced in oocytes injected with 3.3 ng of either Sx1-1 or Sx1-2, indicating a sensitivity to syntaxin levels. The activation rate of Lc-type channels was slowed down to a similar extent by syntaxin 1A, Sx 12, and syntaxin 2 (Fig. 6). We veri®ed no in¯uence of current amplitude on tact under our assay conditions. Bot-C1 LC speci®cally cleaves syntaxin 1A to cytosolic (amino acids 1±253) and a TM containing fragment (amino acids 254±288 35). It was used as a tool to determine if the cytosolic and TM domains could independently modify the properties of the channel. cRNA of Bot-C1 LC was injected into Xenopus oocytes

Fig. 3. Syntaxin TM domain inhibits inward N-type Ca 21 current. (A) Superposition of macroscopic currents generated by a1B, b2A, and a2/d subunits of the N-type Ca 21 channels, evoked from a holding potential of 280 mV to various test potentials (7 s duration) alone, or with either syntaxin 1-1 or syntaxin 1-2. (B) Current±voltage relationship: collected data from oocytes (n ˆ 5±10) co-expressing the Ntype channel with syntaxin 1-1 (close triangle) syntaxin 1-2 (open triangle) or alone (open circle). Currents were evoked in response to a 1.4-s pulse to various test potentials. (C) The normalized conductance±voltage (G±V) relationship obtained from (B) is displayed with a Boltzmann ®t. (D) Normalized representative current traces of Ntype channel with or without Sx1-1- or Sx1-2 evoked to 120 mV in response to 1.4-s test pulse. Time constant of activation (tact) was obtained from the onset of response by a mono exponential ®t (see Results). (E) Normalized N-type currents were evoked in response to a 7-s pulse to 120 mV test pulse. The time constant of inactivation of the channel was tinact ˆ 5.6 ^ 1.2 s (n ˆ 5); with Sx1-1, tinact ˆ 10.9 ^ 0.4 s; (n ˆ 3; P , 0.001); with Sx1-2, tinact ˆ 15.9 ^ 1.2 s (n ˆ 4; P , 0.001). cRNA injected/oocyte: a1B (16 ng); a2/d (5 ng); b2A (7 ng); other cRNA amounts were mentioned in Fig. 2. The data points correspond to the mean ^ S.E.M. (n ˆ 10±15). Statistical significance was determined by Student's t-test. The traces shown have been corrected for leakage and capacitative transients by on-line subtraction.

two days prior to recording. Bot-C1 effectively cleaved syntaxin 1A as shown by the appearance of a 32 kDa cytosolic cleavage product in a western analysis (Fig. 5A). The inhibitory effect of syntaxin 1A on current amplitude (.70%) was abolished in oocytes co-expressing Bot-C1 LC (Fig. 5B). Cleavage of syntaxin 1A by Bot-C1 however, did not change the effect of syntaxin 1A on the activation rate. Syntaxin 1A increased tact from 2.5 ^ 0.23 (n ˆ 9) to 3.9 ^ 0.3 (n ˆ 6), measured at 120 mV test potential while in the presence Bot-C1, tact remained higher then channel alone, similar to intact syntaxin 1A (tact ˆ 4.6 ^ 0.5 ms; n ˆ 6; Fig. 5C). These results were further supported by Sx2-1, a chimera of syntaxin 2 in which the TM was replaced with TM of syntaxin 1A. Sx2-1 did not reduce inward current, showing that the TM domain of syntaxin 1A is not suf®cient for inhibiting current amplitude (Fig. 6).

Ca 21 channel regulation by syntaxin transmembrane domain

21

Fig. 4. Modi®cation of the activation kinetics of Lc- and N-type Ca channels by syntaxin 1-1 and syntaxin 1-2. (A) Time constant of activation (tact, mean ^ S.E.M., n ˆ 10±15) of a1*C, a2/d, and b2A (Lc-type channel) currents generated in Xenopus oocytes alone, or together with Sx1-1 (1.6 ng/oocyte) and Sx1-2 (1.6 ng/ oocyte) or (B) with Sx1-1 (3.3 ng/oocyte) and Sx1-2 (3.3 ng/oocyte) plotted against 80 pulse to various test potentials. Statistical signi®cance was determined by Student's t-test; P , 0.00001 for syntaxin 11 (n ˆ 10) and syntaxin 1-2 (n ˆ 15). (C) tact of a1B, a2/d, and b2A (N-type channel) currents generated in Xenopus oocytes (n ˆ 5±10) alone, or together with Sx1-1 (1.6 ng/oocyte) and syntaxin 1-2 (1.6 ng/oocyte) or (D) with Sx1-1 (3.3 ng/oocyte) and Sx1-2 (3.3 / oocyte), plotted against 1.4-s pulse to various test potentials. Statistical signi®cance was determined by Student's t-test; P , 0.0019 (n ˆ 5) for syntaxin 1-1 and P , 0.00001 (n ˆ 6) for Syntaxin 1-2. tact was determined by a single exponent ®t.

Loss and gain of current inhibition through single amino acid mutations To determine the exact site of interaction of the TM domain with the channel we mutated the highly conserved cysteine residues (271 and 272) of syntaxin 1A to valines (present in the TM of syntaxin 2, Figs 6 and 7). Syntaxin 1A CC/VV (C271V/C272V) mutant was expressed in Xenopus oocytes and tested for activity when co-expressed with a*1C/a2/d/b2A and a1B/a2/d/ b2A. Protein expression of all syntaxin mutants was determined and found similar to syntaxin 1A and syntaxin 1-2 (data not shown; Fig. 1B). While this mutant lost its modifying action on current amplitude, it retained its ability and slowed the rate of activation (Figs 4 and 6). Similarly, syntaxin 1A CC/VV mutant lost its ability to modulate inward current through N-type channel (data not shown). While the exchange of the two cysteines rendered syntaxin 1A inactive, mutating either Cys 271 (syntaxin 1A C271V) or Cys 272 (syntaxin 1A C272V) resulted in fully functional syntaxin (Figs 6 and 7). Furthermore, although the sequence of syntaxin 2 TM is different to that of syntaxin 1A (,30%), replacement of only two valines with two cysteine residues at positions 272 and 273 (syntaxin 1-2 VV/CC mutant; V272C/V273C) made this mutant fully active (Figs 6 and 7).

603

Fig. 5. Bot-C1 cancels syntaxin 1A effect on Lc-type Ca 21 channel current amplitude but not on channel-activation. (A) Expression of syntaxin 1A with Lc-type channel and Bot-C1 light chain. Xenopus oocytes were injected with cRNA of a1*C/b2A/a2/d subunits, at day 2 with syntaxin 1A (cRNA, Fig. 1) and at day 4 with Bot-C1 light chain (cRNA 20 ng/oocyte). At day 6, the oocytes were tested for protein expression using anti syntaxin 1A antibodies. Full-length syntaxin 1A and Bot-C1 cleaved-syntaxin are detected. Inward currents were evoked from a holding potential of 280 mV in response to 80 ms test pulse to various test potentials presented in (B) I±V curves and (C) time constant of activation (tact, mean ^ S.E.M.; Statistical signi®cance was determined by Student's t-test, P , 0.01 (n ˆ 6±9) at voltages greater than 110 mV. Xenopus oocytes expressing a1*C/b2A/a2/d alone (open circle), with syntaxin 1A (closed circle) with syntaxin 1A and Bot-C1 (square). DISCUSSION

Interaction of syntaxin transmembrane domain with voltage-sensitive Ca 21 channels The participation of Ca 21 channels in various fusion processes 27,46,50 is of particular interest since disruption of syntaxin interactions with Ca 21 channels could affect membrane-fusion. The highly conserved C-terminal region of syntaxin includes both a TM domain and a helical domain (H3) that participate in the exocytotic core complex formation. The physiological importance of syntaxin 1A TM domain was inferred from three observations: First, the similar splicing patterns observed for the rat syntaxin 2, 2 mouse syntaxin 21 and syntaxin genes in C. elegans 34 and second, in vitro assay showed TM domains of both syntaxin and VAMP II contribute to the stability of the syntaxin 1A/SNAP±25/VAMP protease-resistant complex, suggesting that the cytosolic regions may function as an independent domain. 30 Finally, for obtaining a stable interaction of VAMPII and syntaxin 1A, the TM domains of both proteins, is required. 26 We used a Sx1-2 chimera, constructed with the cytosolic domain of syntaxin 1A and the TM domain of syntaxin 2, to explore the functional role of the syntaxin TM domain in regulating the kinetics of Ca 21 channels. The sole difference between syntaxin 1A (Sx1-1) and Sx1-2 is the TM domain at the C-terminal. As expected, the effect of the cytosolic domain on the tact was the

604

M. Trus et al.

Fig. 6. Cysteine residues within the TM domain of syntaxin 1A play a crucial role in regulating current ¯ow through N- and L-type Ca 21 channels. Upper: Current±voltage relationship of oocytes expressing Lc-type Ca 21 channel with Sx2-1, or syntaxin mutants as indicated. Lower: tact of above. Currents were evoked from a holding potential of 280 mV to various test potentials in response to 80 ms test pulse. Each mutant (closed circle) and its control (open circle) were tested in a separate experiment. cRNA amounts of Lctype channel subunits injected as in Fig. 1; Sx2-1 and mutants (5 ng/oocyte). Statistical signi®cance was determined by Student's ttest with P , 0.0001 (upper panel) and P , 0.01 lower panel (n ˆ 10±15) for pulses above 15 mV

same as Sx1-1, but Sx1-2 did not inhibit current amplitude. The failure of Sx1-2 to inhibit maximal current implies that the TM domain not only functions as a hydrophobic membrane anchor, but also interacts speci®cally with the a1 subunits of Lc- and N-type Ca 21 channels. Since the TM spanning sequence of syntaxin mediates current inhibition, it explains the failure of a TM-truncated syntaxin 1A (amino acids 1-267) to inhibit Ca 21 current 51. The signi®cance of the syntaxin 1A TM domain in regulating exocytosis was recently inferred by characterizing a syntaxin mutant js116, in C. elegans. 34 The pertinence of TM domains for signaling pathways across the cell membrane was previously reported for various receptors, including the epidermal growth factor (EGF), c-erbB-2/neu and b-adrenergic receptor. 6,16 Two highly conserved cysteine residues display a H1(HA)

H2(HB)

HC

H3

Interaction of the syntaxin cytosolic domain with voltage sensitive Ca 21 channels

TM 267 288

Current Inhibition TM-Syntaxin 1A (rat)

IMI I I C CVI LG I I IAST I GG I FG

TM-Syntaxin 1A (C271V/C272V)

IM I I I V VVI LG I I IAST I GG I FG

TM-Syntaxin 1A (C271V)

IM I I I V CVI LG I I IAST I GG I FG

TM-Syntaxin 1A (C272V)

IM I I I C VV I LG I I IAST I GG I FG

+ + +

271 272

TM-syntaxin 2 (rat)

WI IAAV VVAVIAVLALIIGLSVCK

TM-syntaxin 2 (V272C/V273C)

WI IAAC CVAVIAVLALIIGLSVCK

remarkable sequence±difference between TMs' of syntaxin 1A (amino acids 271 and 272) and 2 (amino acids 272 and 273; Fig. 7). Do only these two residues account for the inhibitory effect of the syntaxin 1A TM domain on Ca 21 current? Mutating the two cysteine to valine residues resulted in a total loss-of-function. When only one cysteine residue, Cys271 or 272, were mutated to valine, full activity of syntaxin 1A was observed. Moreover, the insertion of two cysteine residues in place of valine in the TM of Sx1-2 confers the ability to inhibit Ca 21 current on Sx1-2 (Fig. 6). According to these results, regulation of Ca 21 current would appear to be dependent on two cysteine residues within the TM domain of syntaxin 1A. An inhibitory action of syntaxin on synaptic transmission in neuronal or endocrine cells could result from inhibition of Ca 21 entry. 48,50,52

+

272 273

Fig. 7. Domain-structure of syntaxin. Schematic diagram of the syntaxin 1A four helical domains (HA), (HB), (HC), H3 and the TM at the C-terminal domain. A single letter presents mutations in syntaxin 1A and syntaxin 2 TM domains. Numbers above the letters represent mutated residues. The ability of the mutants to inhibit Ca 21 currents is presented by (1) and (-).

The cytosolic domain of syntaxin 1A includes the coiled-coil domains H1 (HA), H2 (HB), HC, 22 and H3. 22,30 The large coiled-coil motif of syntaxin (H3) binds to synaptotagmin, 7 SNAP-25, 8,22,23,31 synaptobrevin, 22,31 a-SNAP, and NSF. 17 The binding of the H3 domain to synprint 39makes H3 a potential Ca 21 channel regulatory site. 12,35 Results of the syntaxin mutants, showed that channel activation kinetics was modi®ed in much the same way as intact syntaxin regardless of the TM domain sequence. Could the cytosolic domain of syntaxin 1A be solely responsible for modifying the activation kinetics of the voltage sensitive Ca 21 channel? To address this question we used Bot-C1 that speci®cally cleaves syntaxin 1A.

Ca 21 channel regulation by syntaxin transmembrane domain

Through cleavage with Bot-C1, we observed a reduction in the activation kinetics of the channel to the same extent as by full-length syntaxin. In contrast, the cleaved syntaxin 1A lost its modulation capacity to reduce Ca 21 current. We assume that following Bot-C1 cleavage, the cytosolic fragment (amino acids 1±253) and the TM containing fragment (amino acids 254±288) remained bound to the channel, consequently, resisting degradation (western blot analysis) and retaining the modulatory action of channel activation kinetics. This experiment does not reveal whether one of the fragments is exclusively responsible for lowering the activation rate of the channel or the simultaneous presence of the two fragments is required. However, loss of current modulation by Bot-C1, indicates that both TM and cytosolic domains are necessary for regulating current amplitude. This result was supported further, by using the Sx2-1, a chimera of syntaxin 2 in which its TM domain was replaced by syntaxin 1 TM. Sx2-1 was unable to inhibit inward currents although the TM (of syntaxin 1A) insured membrane insertion 32 suggesting that the Nterminal of syntaxin 1A might contain unique sequence speci®city important for regulating Ca 21 channels. Furthermore, we used a recombinant fusion protein composed of the TM domain of syntaxin 1A fused to glutathione-S-transferase (GST). The cRNA encoding for the GST±TM fusion protein was expressed in Xenopus oocytes along with the Lc-type channel and affected neither current amplitude nor the rate of activation (data not shown). Thus, TM of syntaxin 1A cannot modify current amplitude independently of its cytosolic region. The ability of syntaxin 1A to promote slow inactivation of the N-type channel 13 was not affected by the TM domain sequences. 4 Similarly, we have shown in the present study, the activation and inactivation kinetics of the N- and Lc-type channels demonstrated no TM domain speci®city (Figs 2, 3 and 6). These ®ndings are also consistent with our Bot-C1 treatment results, which

605

eliminated syntaxin TM inhibitory effect but did not change modulation of activation rate. The fact that the cleaved fragment that contains the TM domain cannot inhibit the channel indicates the existence of another crucial residue(s) on the cytosolic portion of syntaxin 1A. The complete recovery of the channel from syntaxin effect, clearly demonstrates that both cytosolic and TM domains contribute the overall inhibitory effects of syntaxin 1A. We have previously suggested that the excitosome complex consisting of Ca 21 channel, syntaxin 1A, SNAP-25, and synaptotagmin could mimic protein± protein interaction of a docked, release-ready vesicle at the site of Ca 21 entry. 45,50 When assembled in the excitosome syntaxin 1A looses its inhibitory action and therefore, cleavage with Bot-C1 is not expected to affect the Ca 21 current. Indeed, Bot-C1 injected into calyx of chick ganglion, 42 giant squid terminal, 25,29 and chromaf®n cell 53 or transfected into PC-12 cells, 15 blocked transmitter release without affecting whole cell inward current. 25,42 In regions outside the active zone however, Ca 21 channels could associate with syntaxin 1A. It remains therefore to be shown, whether cleavage with Bot-C1 increases Ca 21 in¯ux in selective regions that contain few or no vesicles. The coupling of the Ca 21 channel to syntaxin 1A, shown here through modi®ed activation kinetics of the Lc- and N-type channels, suggests that juxtaposition of these proteins may facilitate a feedback mechanism of channel activity. We expect future studies to verify the importance of the syntaxin 1A interaction with the channel at both the TM and cytosolic domains in determining the precise timing of Ca 21 entry and the onset of transmitter release.

AcknowledgementsÐWe thank Roy Cohen for excellent technical assistance. The study was partly supported by the H.L. Lauterbach and J.J. Berreby funds for D.A.

REFERENCES 21

1. Bennett M. K. (1997) Ca and the regulation of neurotransmitter secretion. Curr. Opin. Neurobiol. 7, 316±322. 2. Bennett M. K., Garcia-Arraras J. E., Elferink L. A., Peterson K., Fleming A. M., Hazuka C. D. and Scheller R. H. (1993) The syntaxin family of vesicular transport receptors. Cell 74, 863±873. 3. Bezprozvanny I., Scheller R. H. and Tsien R. W. (1995) Functional impact of syntaxin on gating of N-type and Q-type calcium channels. Nature 378, 623±626. 4. Bezprozvanny I., Zhong P., Scheller R. H. and Tsien R. W. (2000) Molecular determinants of the functional interaction between syntaxin and Ntype Ca 21 channel gating. Proc. natn. Acad. Sci. USA 97, 13,943±13,948. 5. Blasi J., Chapman E. R., Yamasaki S., Binz T., Niemann H. and Jahn R. (1993) Botulinum neurotoxin C1 blocks neurotransmitter release by means of cleaving HPC-1/syntaxin. Eur. molec. Biol. Org. J. 12, 4821±4828. 6. Brabdt-Rauf P. W., Pincus M. R. and Monaco R. (1995) Conformation of the transmembrane domain of the c-erbB-2 oncogene-encoded protein in its monomeric and dimeric states. J. Prot. Chem. 14, 33±40. 7. Broadie K., Prokop A., Bellen H. J., O'Kane C. J., Schulze K. L. and Sweeney S. T. (1995) Syntaxin and synaptobrevin function downstream of vesicle docking in Drosophila. Neuron 15, 663±673. 8. Chapman E. R., Hanson P. I., An S. and Jahn R. (1995) Ca 21 regulates the interaction between synaptotagmin and syntaxin 1. J. biol. Chem 270, 23,667±23,671. 9. Charvin N., L'eveque C., Walker D., Berton F., Raymond C., Kataoka M., Shoji-Kasai Y., Takahashi M., De Waard M. and Seagar M. J. (1997) Direct interaction of the calcium sensor protein synaptotagmin I with a cytoplasmic domain of the alpha1A subunit of the P/Q-type calcium channel. Eur. molec. Biol. Org. J. 16, 4591±4596. 10. Chen Y. A., Scales S. J., Patel S. M., Doung Y. C. and Scheller R. H. (1999) SNARE complex formation is triggered by Ca 21 and drives membrane fusion. Cell 97, 165±174. 11. Coorssen J. R., Blank P. S., Tahara M. and Zimmerberg J. (1998) Biochemical and functional studies of cortical vesicle fusion: the SNARE complex and Ca 21 sensitivity. J. Cell Biol. 143, 1845±1857. 12. Davis A. F., Bai J., Fasshauer D., Wolowick M. J., Lewis J. L. and Chapman E. R. (1999) Kinetics of synaptotagmin responses to Ca 21 and assembly with the core SNARE complex onto membranes. Neuron 24, 363±376.

606

M. Trus et al.

13. Degtiar V. E., Scheller R. H. and Tsien R. W. (2000) Syntaxin modulation of slow inactivation of N-type calcium channels. J. Neurosci. 20, 4355±4367. 14. Fasshauer D., Eliason W. K., Brunger A. T. and Jahn R. (1998) Identi®cation of a minimal core of the synaptic SNARE complex suf®cient for reversible assembly and disassembly. Biochemistry 37, 10,354±10,362. 15. Fisher R. J. and Burgoyne R. D. (1999) The effect of transfection with Botulinum neurotoxin C1light chain on exocytosis measured in cell populations and by single-cell amperometry in PC12 cells. P¯uÈgers Arch. 437, 754±762. 16. Gether U., Lin S., Ghanouni P., Ballesteros J. A., Weinstein H. and Kobilka B. K. (1997) Agonists induce conformational changes in transmembrane domains III and VI of the beta2 adrenoceptor. Eur. molec. Biol. Org. J. 16, 6737±6747. 17. Goda Y. (1997) SNAREs and regulated vesicle exocytosis. Proc. natn. Acad. Sci. USA 94, 769±772. 18. Hanson P. I., Otto H., Barton N. and Jahn R. (1995) Assembly and disassembly of a ternary complex of synaptobrevin, syntaxin, and SNAP-25 in the membrane of synaptic vesicles. J. biol. Chem. 270, 16,955±16,961. 19. Hanson P. I., Heuser J. E. and Jahn R. (1997) Neurotransmitter release-four years of SNARE complexes. Curr. Opin. Neurobiol. 7, 310±315. 20. Hayashi T., McMahon H., Yamasaki S., Binz T., Hata Y., SuÈdhof T. S. and Niemann H (1994) Synaptic vesicle membrane fusion complex: action of clostridial neurotoxins on assembly. Eur. molec. Biol. Org. J. 13, 5051±5061. 21. Ibaraki K., Horikawa H. P., Morita T., Mori H., Sakimura K., Mishina M., Saisu H. and Abe T. (1995) Identi®cation of four different forms of syntaxin 3. Biochem. biophys. Res. Commun. 211, 997±1005. 22. Kee Y., Lin R. C., Hsu S. C. and Scheller R. H. (1995) Distinct domains of syntaxin are required for synaptic vesicle fusion complex formation and dissociation. Neuron 14, 991±998. 23. Li C., Ullrich B., Zhang J. Z., Anderson R. G., Brose N. and SuÈdhof T. C. (1995) Ca(21)-dependent and -independent activities of neural and non-neural synaptotagmins. Nature 375, 594±599. 24. Lin R. C. and Scheller R. H. (1997) Structural organization of the synaptic exocytosis core complex. Neuron 19, 1087±1094. 25. Marsal J., Ruiz-Montasell B., Blasi J., Moreira J. E., Contreras D., Sugimori M. and Llinas R. (1997) Block of transmitter release by botulinum C1 action on syntaxin at the squid giant synapse. Proc. natn. Acad. Sci. USA 94, 14,871±14,876. 26. Margittai M., Otto H. and Jahn R. (1999) A stable interaction between syntaxin 1A and synaptobrevin 2 mediated by their transmembrane domains. Fedn Eur. biochem. Socs Lett. 446, 40±44. 27. Mochida S., Sheng Z. H., Baker C., Kobayashi H. and Catterall W. A. (1996) Inhibition of neurotransmission by peptides containing the synaptic protein interaction site of N-type Ca 21 channels. Neuron. 17, 781±788. 28. Nickel W., Weber T., McNew J. A., Parlati F., Sollner T. H. and Rothman J. E. (1999) Content mixing and membrane integrity during membrane fusion driven by pairing of isolated v-SNAREs and t-SNAREs. Proc. natn. Acad. Sci. USA 96, 12,571±12,576. 29. O'Connor V., Heuss C., De Bello W. M., Dresbach T., Charlton M. P., Hunt J. H., Pellegrini L. L., Hodel A., Burger M. M., Betz H., Augustine G. J. and Schafer T. (1997) Disruption of syntaxin-mediated protein interactions blocks neurotransmitter secretion. Proc. natn. Acad. Sci. USA 94, 12,186±12,191. 30. Poirier M. A., Hao J. C., Malkus P. N., Chan C., Moore M. F., King D. S. and Bennett M. K. (1998) Protease resistance of syntaxin SNAP-25 VAMP complexes. Implication for assembly and structure. J. biol. Chem. 273, 11,370±11,377. 31. Pevsner J., Hsu S., Braun J. E. A, Calakos N., Ting E., Bennett M. K. and Scheller R. H. (1994) Speci®city and regulation of a synaptic vesicle docking complex. Neuron 13, 353±361. 32. Rapoport T. A., Jungnickel B. and Kutay U. (1996) Protein transport across the eukaryotic endoplasmic reticulum and bacterial inner membranes. A. Rev. Biochem. 65, 271±303. 33. Rettig J., Heinemann C., Asheri U., Sheng Zu.-H., Yokoyama C. T., Catterall W. A. and Neher E. (1997) Alteration of Ca 21 dependence of n, urotransmitter release by disruption of Ca 21 channel/syntaxin interaction. J. Neurosci. 17, 6647±6656. 34. Saifee O., Wei L. and Nonet M. (1998) The Caenorhabditis elegans unc-64 locus encodes a syntaxin that interacts genetically with synaptobrevin. Molec. Biol. Cell. 9, 1235±1252. 35. Schiavo G., Shone C. C., Bennett M. K., Scheller R. H. and Montecucco C. (1995) Botulinum neurotoxin type C cleaves a single Lys±Ala bond within the carboxyl-terminal region of syntaxins. J. biol. Chem. 270, 10,566±10,570. 36. Schreibmayer W., Lester H. A. and Dascal N. (1994) Voltage clamping of Xenopus laevis oocytes utilizing agarose-cushion electrodes. P¯uÈgers Arch. 426, 453±458. 37. Schulze K. L., Broadie K., Perin M. S. and Bellen H. J. (1995) Genetic and electrophysiologic studies of Drosophila syntaxin 1A demonstrates its role in nonneuronal secretion and neurotransmission. Cell 80, 311±320. 38. Sheng Zu. -H., Rettig J., Takahashi M. and Catterall W. A. (1994) Identi®cation of a syntaxin-binding site on N-type calcium channels. Neuron 13, 1303±1313. 39. Sheng Zu. -H., Rettig J., Cook T. and Catterall W. A. (1996) Calcium-dependent interaction of N-type calcium channels with the synaptic core complex. Nature 379, 451±454. 40. Sheng Z. -H., Yokoyama C. T. and Catterall W. A. (1997) Interaction of the synprint site of N-type Ca 21 channels with the C2B domain of synaptotagmin I. Proc. natn. Acad. Sci. USA 94, 5405±5410. 41. SoÈllner T., Bennett M. K., Whiteheart S. W., Scheller R. H. and Rothman J. E. (1993) A protein assembly±disassembly pathway in vitro that may correspond to sequential steps of synaptic vesicles docking, activation and fusion. Cell 75, 409±418. 42. Stanley E. F. and Mirotznik R. R. (1997) Cleavage of syntaxin prevents G-protein regulation of presynaptic calcium channels. Nature 20, 404±409. 43. Stea A., Dubel S. J., Pragnell M., Leonard J. P., Campbell K. P. and Snutch T. P. (1993) A beta-subunit normalizes the electrophysiological properties of a cloned N-type Ca 21 channel alpha 1-subunit. Neuropharmacology 32, 1103±1116. 44. Sutton R. B., Fasshauer D., Jahn R. and Brunger A. T. (1998) Crystal structure of a SNARE complex involved in synaptic exocytosis at 2.4 A resolution. Nature 395, 347±353. 45. Tobi D., Wiser O., Trus M. and Atlas D. (1998) N-type voltage-sensitive calcium channel interacts with syntaxin, synaptotagmin and SNAP-25 in a multiprotein complex. Recept. Channels 6, 89±98. 46. Ungermann C., Sato K. and Wickner W. (1998) De®ning the functions of trans-SNARE pairs. Nature 396, 543±548. 47. Weber T., Zemelman B. V., McNew J. A., Westermann B., Gmachl M., Parlati F., SoÈllner T. H. and Rothman J. E. (1999) SNAREins minimal machinery for membrane fusion. Cell 92, 759±772. 48. Watanabe T., Fujiwara T., Komazaki S., Yamaguchi K., Tajima O. and Akagawa K. (1999) HPC-1/syntaxin 1A suppresses exocytosis of PC12 cells. J. Biochem. 125, 685±689. 49. Wiser O., Tobi D., Trus M. and Atlas D. (1997) Synaptotagmin restores kinetic properties of a syntaxin-associated N-type voltage sensitive calcium channel. Fedn Eur. biochem. Socs Lett. 404, 203±207. 50. Wiser O., Trus M., Hernandez A., RenstroÈm E., Barg S., Rorsman P. and Atlas D. (1999) The voltage sensitive L-type Ca 21 channel is functionally coupled to the exocytotic machinery. Proc. natn. Acad. Sci. USA 96, 248±253.

Ca 21 channel regulation by syntaxin transmembrane domain

607

51. Wiser O., Bennett M. K. and Atlas D. (1996) Functional interaction of syntaxin and SNAP-25 with voltage sensitive L- and N-type Ca 21 channels. Eur. molec. Biol. Org. J. 15, 4100±4110. 52. Wu M. N., Fergestad T., Lloyd T. E., He Y., Broadie K. and Bellen H. J. (1999) Syntaxin 1A interacts with multiple exocytic proteins to regulate neurotransmitter release in vivo. Neuron 23, 593±605. 53. Xu T., Binz T., Neimann H. and Neher E. (1998) Multiple kinetic components of exocytosis distinguished by neurotoxin sensitivity. Nat. Neurosci. 1, 192±200. 54. Zhong H., Yokoyama C. T., Scheuer T. and Catterall W. A. (1999) Reciprocal regulation of P/Q-type Ca 21 channels by SNAP-25, syntaxin and synaptotagmin. Nat. Neurosci. 2, 939±941. (Accepted 20 February 2001)