- Email: [email protected]
Tracking a protein following dissociation from a protein–protein complex using a split SNAP-tag system
Analytical Biochemistry 477 (2015) 53–55
Contents lists available at ScienceDirect
Analytical Biochemistry journal homepage: www.elsevier.com/locate/yabio
Notes & Tips
Tracking a protein following dissociation from a protein–protein complex using a split SNAP-tag system Masayasu Mie ⇑, Tatsuhiko Naoki, Eiry Kobatake Department of Environmental Chemistry and Engineering, Interdisciplinary Graduate School of Science and Engineering, Tokyo Institute of Technology, Midori-ku, Yokohama 226-8502, Japan
a r t i c l e
i n f o
Article history: Received 26 December 2014 Received in revised form 13 February 2015 Accepted 17 February 2015 Available online 25 February 2015 Keywords: Protein–protein interaction Visualization SNAP-tag Complementation
a b s t r a c t Protein–protein interactions (PPIs) are important for various biological processes in living cells. Several methods have been developed for the visualization of PPIs in vivo; however, these methods are unsuitable for visualization of post-PPI events such as dissociation and translocation. In this study, we applied a split SNAP-tag system for the visualization of post-PPI events. This method enabled tracking of the protein following dissociation from the protein–protein complex. Thus, the split SNAP-tag system should prove to be a useful tool for visualization of post-PPI events. Ó 2015 Elsevier Inc. All rights reserved.
Protein–protein interactions (PPIs)1 are important in biological processes such as signal transduction and gene expression in living cells. Various methods have been developed for visualizing PPIs in vivo and reviewed in many articles [1–6]. Fluorescence resonance energy transfer (FRET) is the conventional method for visualization of PPIs in living cells because FRET signals change on association/ dissociation of protein–protein complexes. Therefore, this method is suitable for monitoring PPIs instantaneously. Bimolecular fluorescence complementation (BiFC) is an alternative method for visualization of PPIs in living cells [5–8]. This method is based on fluorescent protein complementation; split nonfluorescent fragments of a fluorescent protein regain fluorescence on association. Using variants of green fluorescent protein (GFP), BiFC enables visualization of multiple PPIs within the same cell [8]. However, these methods are not suitable for the visualization of proteins following dissociation from a protein–protein complex. Because FRET signals disappear on dissociation, FRET cannot be used to track proteins following dissociation from a protein–protein complex. In the BiFC assay, the dissociation of protein–protein complex does not occur because of the irreversibility of the reconstituted fluorescent protein [6,7]. To date, no method allows for the visualization of proteins following dissociation from a protein–protein complex. ⇑ Corresponding author. Fax: +81 45 924 5779. E-mail address: [email protected] (M. Mie). Abbreviations used: PPI, protein–protein interaction; FRET, fluorescence resonance energy transfer; BiFC, bimolecular fluorescence complementation; GFP, green fluorescent protein; hAGT, O6-alkylguanine-DNA-alkyltransferase; PKCa, protein kinase C alpha; PMA, phorbol-12-myristate-13-acetate; FKBP, FK506-binding protein. 1
http://dx.doi.org/10.1016/j.ab.2015.02.019 0003-2697/Ó 2015 Elsevier Inc. All rights reserved.
Previously, we developed a split SNAP-tag protein complementation assay as a novel method for visualization of PPIs in living cells [9]. SNAP-tag, a monomeric protein, is a mutant of the human DNA repair protein O6-alkylguanine-DNA-alkyltransferase (hAGT) and binds covalently to substrates containing O6-benzylguanine [10]. Split SNAP-tags, namely fragments of SNAP-tag divided between amino acid residues 91 and 92, were fused to proteins that can interact with each other. On interaction of fused proteins, SNAP-tag fragments are brought into proximity and the SNAP-tag activity is restored. In this method, only the interacting proteins were labeled with SNAP-tag substrates covalently modified with fluorophores. Therefore, we focused on a split SNAP-tag system for the visualization of a protein following dissociation of a protein–protein complex because the fluorescence signal should be maintained even after dissociation of protein–protein complexes. Here, we sought to determine whether split SNAP-tag can be employed for the visualization of a protein dissociated from a protein–protein complex. As a proof of concept, protein kinase C alpha (PKCa) was used for the translocation of split SNAP-tag fusion proteins. The overexpressed fusion protein consisting of PKCa and GFP translocates from the cytoplasm to the plasma membrane in response to phorbol esters such as phorbol-12-myristate-13-acetate (PMA) [11]. FM protein, a point mutant of the FK506-binding protein (FKBP), was used for the protein–protein interactions. FM can form homodimers with micromolar affinity that can be dissociated on the addition of FKBP ligands such as FK506 [12]. A schematic representation of the experimental design is shown in Scheme 1. The fusion proteins
54
Notes & Tips / Anal. Biochem. 477 (2015) 53–55
Scheme 1. Schematic representation of the experimental design. PKCa–FM–nSNAP and FM–cSNAP are expressed in HeLa cells. Split SNAP-tag activity is regained on the interaction of the FM fragments. The protein is then labeled by the addition of the fluorescent substrate of SNAP-tag. To maintain or dissociate FM interactions, chemical ligand, specifically dimerizer or FK506, respectively, is added to the cells. Following the addition of PMA, translocations of the fluorescence signals are observed.
PKCa–FM–nSNAP and FM–cSNAP are expressed in mammalian cells. Here, nSNAP indicates the SNAP fragment composed of residues 1 to 91, whereas cSNAP indicates the fragment composed of residues 92 to 182, including a labeling site at Cys145. These fusion proteins interact with each other via the FM fragments. On heterodimer formation between PKCa–FM–nSNAP and FM–cSNAP, the split SNAP-tag regains its activity and the cSNAP fragments are labeled on incubation with the fluorescent substrate of SNAP-tag. FK506 or chemical dimerizer is added to the cells to dissociate or maintain FM interactions, respectively, and the system is then allowed to incubate. After the addition of PMA, translocations are observed via fluorescence signals. The plasmids pPKCa–FM–nSNAP and pcDNA–FM–cSNAP were employed for the expression of PKCa–FM–nSNAP and FM–cSNAP, respectively. The plasmid pcDNA–FM–cSNAP was constructed in our previous study [9]. The pPKCa–FM–nSNAP plasmid was constructed as follows. First, DNA encoding the FM–cSNAP fragment was amplified by polymerase chain reaction (PCR) from pcDNA– FM–cSNAP using the primer sets CCGCGGATGGGAGTGCAGGT GGAAAC and GCGGCCGCGAATTCCTAGCCTATACCTGCAGGACCCA GCCCAGGCTTGCCA. The amplified fragment was digested with SacII and NotI. This fragment was inserted into pPKCa–EGFP (Clontech) and digested with the same restriction enzymes. The constructed plasmid pPKCa–FM–cSNAP was digested with KpnI and EcoRI for removal of the cSNAP fragment, followed by insertion of the nSNAP fragment from pcDNA–FM–nSNAP digested with KpnI and EcoRI (pPKCa–FM–nSNAP). These plasmids were cotransfected into HeLa cells, and the fusion proteins were expressed. To maintain heterodimer formation between PKCa–FM–nSNAP and FM–cSNAP, cells were first treated with the homodimeric ligand B/B Homodimerizer (Clontech) after labeling. B/B Homodimerizer is a synthetic ligand containing a bivalent FKBP12 binding site and, therefore, is used as the chemical dimerizer [13]. For protein labeling, cells were incubated with a SNAP-tag substrate, SNAP-Cell Oregon Green (New England Biolabs), for 60 min. After washing, cells were incubated with the cell medium in the presence of B/B Homodimerizer (1 lM) for 2 h to maintain interaction of the FM fragments and to remove unreacted SNAP-tag substrate. Cells were observed by confocal laser scanning microscopy (Olympus FV-300) prior to the addition of PMA. Several cells exhibited fluorescence in both the cytoplasm and nucleus. In most of the cells, however, fluorescence was observed only in the cytoplasm (Fig. 1A). The fluorescence was similar to that of cells expressing non-split SNAP-tag fused to PKCa (data not shown). Localization of the labeled proteins only in the cytoplasm was attributed to PKCa. In our previous
Fig.1. Confocal images of cells expressing PKCa–FM–nSNAP and FM–cSNAP after labeling with SNAP–Cell Oregon Green. (A) To maintain FM interactions, cells were treated with dimerizer (1 lM) for 2 h. (B) To dissociate FM interactions, cells were treated with FK506 (1 lM) for 2 h. After incubation with ligand, cells were observed before and after the addition of PMA. The scale bar represents 25 lM.
experiment, cells expressing FM–nSNAP and FM–cSNAP showed fluorescence in both the cytoplasm and nucleus, suggesting that FM–cSNAP was tethered to PKCa–FM–nSNAP by the dimerizer in the current experiment. After the addition of PMA, the cells exhibited strong fluorescence at the plasma membrane. Because the PKCa fragment was fused to nSNAP, which does not contain a labeling site, these results suggest that labeled FM–cSNAP was cotranslocated to the plasma membrane via the tethered PKCa– FM–nSNAP, demonstrating that the split SNAP-tag system allows for visualization of the translocation of a protein–protein complex exhibiting stable interactions. Next, cells were treated with FK506 instead of the dimerizer to dissociate the heterodimer formed between PKCa–FM–nSNAP and FM–cSNAP. After labeling, cells expressing PKCa–FM–nSNAP and FM–cSNAP were incubated with the cell medium in the presence of FK506 and subsequently observed. In contrast to the cells incubated with the dimerizer, cells treated with FK506 exhibited
Notes & Tips / Anal. Biochem. 477 (2015) 53–55
fluorescence in both the cytoplasm and nucleus (Fig. 1B). This suggests that the heterodimers formed between PKCa–FM–nSNAP and FM–cSNAP were dissociated, allowing the labeled FM–cSNAP to be transported into the nucleus. PMA was then added to the cells to induce translocation of the PKCa-fused protein, and the cells were observed. As expected, translocation of the fluorescence signal was not observed because FM–cSNAP was not fused to PKCa and, thus, was dissociated from PKCa–FM–nSNAP by the addition of FK506. In contrast, when cells expressing FM–nSNAP and PKCa–FM–cSNAP were observed under the same conditions, they exhibited strong fluorescence at the plasma membrane, which was caused by translocation of labeled PKCa–FM–cSNAP (see Fig. S1 in the online supplementary material). These results demonstrate that the split SNAP-tag system can be applied for tracking proteins following dissociation from a protein–protein complex. In conclusion, we have demonstrated that the split SNAP-tag system can visualize post-PPI events even after dissociation of the protein–protein complex, which has been difficult using conventional methods. This split SNAP-tag system should prove to be a useful tool for imaging events following PPIs. Acknowledgment This work was supported in part by the Japan Society for the Promotion of Science (JSPS, KAKENHI grant 22680041). Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.ab.2015.02.019.
55
References [1] E.A. Jares-Erijman, T.M. Jovin, Imaging molecular interactions in living cells by FRET microscopy, Curr. Opin. Chem. Biol. 10 (2006) 409–416. [2] K. Truong, M. Ikura, The use of FRET imaging microscopy to detect protein– protein interactions and protein conformational changes in vivo, Curr. Opin. Struct. Biol. 11 (2001) 573–578. [3] S.W. Michnick, P.H. Ear, E.N. Manderson, I. Remy, E. Stefan, Universal strategies in research and drug discovery based on protein-fragment complementation assays, Nat. Rev. Drug Discovery 6 (2007) 569–582. [4] S.S. Shekhawat, I. Ghosh, Split-protein systems: beyond binary protein–protein interactions, Curr. Opin. Chem. Biol. 15 (2011) 789–797. [5] T.K. Kerppola, Visualization of molecular interactions using bimolecular fluorescence complementation analysis: Characteristics of protein fragment complementation, Chem. Soc. Rev. 38 (2009) 2876–2886. [6] Y. Kodama, C.D. Hu, Bimolecular fluorescence complementation (BiFC): a 5year update and future perspectives, BioTechniques 53 (2012) 285–298. [7] C.D. Hu, Y. Chinenov, T.K. Kerppola, Visualization of interactions among bZIP and Rel family proteins in living cells using bimolecular fluorescence complementation, Mol. Cell 9 (2002) 789–798. [8] C.D. Hu, T.K. Kerppola, Simultaneous visualization of multiple protein interactions in living cells using multicolor fluorescence complementation analysis, Nat. Biotechnol. 21 (2003) 539–545. [9] M. Mie, T. Naoki, K. Uchida, E. Kobatake, Development of a split SNAP-tag protein complementation assay for visualization of protein–protein interactions in living cells, Analyst 137 (2012) 4760–4765. [10] A. Keppler, S. Gendreizig, T. Gronemeyer, H. Pick, H. Vogel, K. Johnsson, A general method for the covalent labeling of fusion proteins with small molecules in vivo, Nat. Biotechnol. 21 (2003) 86–89. [11] S. Wagner, C. Harteneck, F. Hucho, K. Buchner, Analysis of the subcellular distribution of protein kinase C alpha using PKC–GFP fusion proteins, Exp. Cell Res. 258 (2000) 204–214. [12] C.T. Rollins, V.M. Rivera, D.N. Woolfson, T. Keenan, M. Hatada, S.E. Adams, L.J. Andrade, D. Yaeger, M.R. van Schravendijk, D.A. Holt, M. Gilman, T. Clackson, A ligand-reversible dimerization system for controlling protein–protein interactions, Proc. Natl. Acad. Sci. U.S.A. 97 (2000) 7096–7101. [13] T. Clackson, Dissecting the functions of proteins and pathways using chemically induced dimerization, Chem. Biol. Drug Des. 67 (2006) 440–442.
Contents lists available at ScienceDirect
Analytical Biochemistry journal homepage: www.elsevier.com/locate/yabio
Notes & Tips
Tracking a protein following dissociation from a protein–protein complex using a split SNAP-tag system Masayasu Mie ⇑, Tatsuhiko Naoki, Eiry Kobatake Department of Environmental Chemistry and Engineering, Interdisciplinary Graduate School of Science and Engineering, Tokyo Institute of Technology, Midori-ku, Yokohama 226-8502, Japan
a r t i c l e
i n f o
Article history: Received 26 December 2014 Received in revised form 13 February 2015 Accepted 17 February 2015 Available online 25 February 2015 Keywords: Protein–protein interaction Visualization SNAP-tag Complementation
a b s t r a c t Protein–protein interactions (PPIs) are important for various biological processes in living cells. Several methods have been developed for the visualization of PPIs in vivo; however, these methods are unsuitable for visualization of post-PPI events such as dissociation and translocation. In this study, we applied a split SNAP-tag system for the visualization of post-PPI events. This method enabled tracking of the protein following dissociation from the protein–protein complex. Thus, the split SNAP-tag system should prove to be a useful tool for visualization of post-PPI events. Ó 2015 Elsevier Inc. All rights reserved.
Protein–protein interactions (PPIs)1 are important in biological processes such as signal transduction and gene expression in living cells. Various methods have been developed for visualizing PPIs in vivo and reviewed in many articles [1–6]. Fluorescence resonance energy transfer (FRET) is the conventional method for visualization of PPIs in living cells because FRET signals change on association/ dissociation of protein–protein complexes. Therefore, this method is suitable for monitoring PPIs instantaneously. Bimolecular fluorescence complementation (BiFC) is an alternative method for visualization of PPIs in living cells [5–8]. This method is based on fluorescent protein complementation; split nonfluorescent fragments of a fluorescent protein regain fluorescence on association. Using variants of green fluorescent protein (GFP), BiFC enables visualization of multiple PPIs within the same cell [8]. However, these methods are not suitable for the visualization of proteins following dissociation from a protein–protein complex. Because FRET signals disappear on dissociation, FRET cannot be used to track proteins following dissociation from a protein–protein complex. In the BiFC assay, the dissociation of protein–protein complex does not occur because of the irreversibility of the reconstituted fluorescent protein [6,7]. To date, no method allows for the visualization of proteins following dissociation from a protein–protein complex. ⇑ Corresponding author. Fax: +81 45 924 5779. E-mail address: [email protected] (M. Mie). Abbreviations used: PPI, protein–protein interaction; FRET, fluorescence resonance energy transfer; BiFC, bimolecular fluorescence complementation; GFP, green fluorescent protein; hAGT, O6-alkylguanine-DNA-alkyltransferase; PKCa, protein kinase C alpha; PMA, phorbol-12-myristate-13-acetate; FKBP, FK506-binding protein. 1
http://dx.doi.org/10.1016/j.ab.2015.02.019 0003-2697/Ó 2015 Elsevier Inc. All rights reserved.
Previously, we developed a split SNAP-tag protein complementation assay as a novel method for visualization of PPIs in living cells [9]. SNAP-tag, a monomeric protein, is a mutant of the human DNA repair protein O6-alkylguanine-DNA-alkyltransferase (hAGT) and binds covalently to substrates containing O6-benzylguanine [10]. Split SNAP-tags, namely fragments of SNAP-tag divided between amino acid residues 91 and 92, were fused to proteins that can interact with each other. On interaction of fused proteins, SNAP-tag fragments are brought into proximity and the SNAP-tag activity is restored. In this method, only the interacting proteins were labeled with SNAP-tag substrates covalently modified with fluorophores. Therefore, we focused on a split SNAP-tag system for the visualization of a protein following dissociation of a protein–protein complex because the fluorescence signal should be maintained even after dissociation of protein–protein complexes. Here, we sought to determine whether split SNAP-tag can be employed for the visualization of a protein dissociated from a protein–protein complex. As a proof of concept, protein kinase C alpha (PKCa) was used for the translocation of split SNAP-tag fusion proteins. The overexpressed fusion protein consisting of PKCa and GFP translocates from the cytoplasm to the plasma membrane in response to phorbol esters such as phorbol-12-myristate-13-acetate (PMA) [11]. FM protein, a point mutant of the FK506-binding protein (FKBP), was used for the protein–protein interactions. FM can form homodimers with micromolar affinity that can be dissociated on the addition of FKBP ligands such as FK506 [12]. A schematic representation of the experimental design is shown in Scheme 1. The fusion proteins
54
Notes & Tips / Anal. Biochem. 477 (2015) 53–55
Scheme 1. Schematic representation of the experimental design. PKCa–FM–nSNAP and FM–cSNAP are expressed in HeLa cells. Split SNAP-tag activity is regained on the interaction of the FM fragments. The protein is then labeled by the addition of the fluorescent substrate of SNAP-tag. To maintain or dissociate FM interactions, chemical ligand, specifically dimerizer or FK506, respectively, is added to the cells. Following the addition of PMA, translocations of the fluorescence signals are observed.
PKCa–FM–nSNAP and FM–cSNAP are expressed in mammalian cells. Here, nSNAP indicates the SNAP fragment composed of residues 1 to 91, whereas cSNAP indicates the fragment composed of residues 92 to 182, including a labeling site at Cys145. These fusion proteins interact with each other via the FM fragments. On heterodimer formation between PKCa–FM–nSNAP and FM–cSNAP, the split SNAP-tag regains its activity and the cSNAP fragments are labeled on incubation with the fluorescent substrate of SNAP-tag. FK506 or chemical dimerizer is added to the cells to dissociate or maintain FM interactions, respectively, and the system is then allowed to incubate. After the addition of PMA, translocations are observed via fluorescence signals. The plasmids pPKCa–FM–nSNAP and pcDNA–FM–cSNAP were employed for the expression of PKCa–FM–nSNAP and FM–cSNAP, respectively. The plasmid pcDNA–FM–cSNAP was constructed in our previous study [9]. The pPKCa–FM–nSNAP plasmid was constructed as follows. First, DNA encoding the FM–cSNAP fragment was amplified by polymerase chain reaction (PCR) from pcDNA– FM–cSNAP using the primer sets CCGCGGATGGGAGTGCAGGT GGAAAC and GCGGCCGCGAATTCCTAGCCTATACCTGCAGGACCCA GCCCAGGCTTGCCA. The amplified fragment was digested with SacII and NotI. This fragment was inserted into pPKCa–EGFP (Clontech) and digested with the same restriction enzymes. The constructed plasmid pPKCa–FM–cSNAP was digested with KpnI and EcoRI for removal of the cSNAP fragment, followed by insertion of the nSNAP fragment from pcDNA–FM–nSNAP digested with KpnI and EcoRI (pPKCa–FM–nSNAP). These plasmids were cotransfected into HeLa cells, and the fusion proteins were expressed. To maintain heterodimer formation between PKCa–FM–nSNAP and FM–cSNAP, cells were first treated with the homodimeric ligand B/B Homodimerizer (Clontech) after labeling. B/B Homodimerizer is a synthetic ligand containing a bivalent FKBP12 binding site and, therefore, is used as the chemical dimerizer [13]. For protein labeling, cells were incubated with a SNAP-tag substrate, SNAP-Cell Oregon Green (New England Biolabs), for 60 min. After washing, cells were incubated with the cell medium in the presence of B/B Homodimerizer (1 lM) for 2 h to maintain interaction of the FM fragments and to remove unreacted SNAP-tag substrate. Cells were observed by confocal laser scanning microscopy (Olympus FV-300) prior to the addition of PMA. Several cells exhibited fluorescence in both the cytoplasm and nucleus. In most of the cells, however, fluorescence was observed only in the cytoplasm (Fig. 1A). The fluorescence was similar to that of cells expressing non-split SNAP-tag fused to PKCa (data not shown). Localization of the labeled proteins only in the cytoplasm was attributed to PKCa. In our previous
Fig.1. Confocal images of cells expressing PKCa–FM–nSNAP and FM–cSNAP after labeling with SNAP–Cell Oregon Green. (A) To maintain FM interactions, cells were treated with dimerizer (1 lM) for 2 h. (B) To dissociate FM interactions, cells were treated with FK506 (1 lM) for 2 h. After incubation with ligand, cells were observed before and after the addition of PMA. The scale bar represents 25 lM.
experiment, cells expressing FM–nSNAP and FM–cSNAP showed fluorescence in both the cytoplasm and nucleus, suggesting that FM–cSNAP was tethered to PKCa–FM–nSNAP by the dimerizer in the current experiment. After the addition of PMA, the cells exhibited strong fluorescence at the plasma membrane. Because the PKCa fragment was fused to nSNAP, which does not contain a labeling site, these results suggest that labeled FM–cSNAP was cotranslocated to the plasma membrane via the tethered PKCa– FM–nSNAP, demonstrating that the split SNAP-tag system allows for visualization of the translocation of a protein–protein complex exhibiting stable interactions. Next, cells were treated with FK506 instead of the dimerizer to dissociate the heterodimer formed between PKCa–FM–nSNAP and FM–cSNAP. After labeling, cells expressing PKCa–FM–nSNAP and FM–cSNAP were incubated with the cell medium in the presence of FK506 and subsequently observed. In contrast to the cells incubated with the dimerizer, cells treated with FK506 exhibited
Notes & Tips / Anal. Biochem. 477 (2015) 53–55
fluorescence in both the cytoplasm and nucleus (Fig. 1B). This suggests that the heterodimers formed between PKCa–FM–nSNAP and FM–cSNAP were dissociated, allowing the labeled FM–cSNAP to be transported into the nucleus. PMA was then added to the cells to induce translocation of the PKCa-fused protein, and the cells were observed. As expected, translocation of the fluorescence signal was not observed because FM–cSNAP was not fused to PKCa and, thus, was dissociated from PKCa–FM–nSNAP by the addition of FK506. In contrast, when cells expressing FM–nSNAP and PKCa–FM–cSNAP were observed under the same conditions, they exhibited strong fluorescence at the plasma membrane, which was caused by translocation of labeled PKCa–FM–cSNAP (see Fig. S1 in the online supplementary material). These results demonstrate that the split SNAP-tag system can be applied for tracking proteins following dissociation from a protein–protein complex. In conclusion, we have demonstrated that the split SNAP-tag system can visualize post-PPI events even after dissociation of the protein–protein complex, which has been difficult using conventional methods. This split SNAP-tag system should prove to be a useful tool for imaging events following PPIs. Acknowledgment This work was supported in part by the Japan Society for the Promotion of Science (JSPS, KAKENHI grant 22680041). Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.ab.2015.02.019.
55
References [1] E.A. Jares-Erijman, T.M. Jovin, Imaging molecular interactions in living cells by FRET microscopy, Curr. Opin. Chem. Biol. 10 (2006) 409–416. [2] K. Truong, M. Ikura, The use of FRET imaging microscopy to detect protein– protein interactions and protein conformational changes in vivo, Curr. Opin. Struct. Biol. 11 (2001) 573–578. [3] S.W. Michnick, P.H. Ear, E.N. Manderson, I. Remy, E. Stefan, Universal strategies in research and drug discovery based on protein-fragment complementation assays, Nat. Rev. Drug Discovery 6 (2007) 569–582. [4] S.S. Shekhawat, I. Ghosh, Split-protein systems: beyond binary protein–protein interactions, Curr. Opin. Chem. Biol. 15 (2011) 789–797. [5] T.K. Kerppola, Visualization of molecular interactions using bimolecular fluorescence complementation analysis: Characteristics of protein fragment complementation, Chem. Soc. Rev. 38 (2009) 2876–2886. [6] Y. Kodama, C.D. Hu, Bimolecular fluorescence complementation (BiFC): a 5year update and future perspectives, BioTechniques 53 (2012) 285–298. [7] C.D. Hu, Y. Chinenov, T.K. Kerppola, Visualization of interactions among bZIP and Rel family proteins in living cells using bimolecular fluorescence complementation, Mol. Cell 9 (2002) 789–798. [8] C.D. Hu, T.K. Kerppola, Simultaneous visualization of multiple protein interactions in living cells using multicolor fluorescence complementation analysis, Nat. Biotechnol. 21 (2003) 539–545. [9] M. Mie, T. Naoki, K. Uchida, E. Kobatake, Development of a split SNAP-tag protein complementation assay for visualization of protein–protein interactions in living cells, Analyst 137 (2012) 4760–4765. [10] A. Keppler, S. Gendreizig, T. Gronemeyer, H. Pick, H. Vogel, K. Johnsson, A general method for the covalent labeling of fusion proteins with small molecules in vivo, Nat. Biotechnol. 21 (2003) 86–89. [11] S. Wagner, C. Harteneck, F. Hucho, K. Buchner, Analysis of the subcellular distribution of protein kinase C alpha using PKC–GFP fusion proteins, Exp. Cell Res. 258 (2000) 204–214. [12] C.T. Rollins, V.M. Rivera, D.N. Woolfson, T. Keenan, M. Hatada, S.E. Adams, L.J. Andrade, D. Yaeger, M.R. van Schravendijk, D.A. Holt, M. Gilman, T. Clackson, A ligand-reversible dimerization system for controlling protein–protein interactions, Proc. Natl. Acad. Sci. U.S.A. 97 (2000) 7096–7101. [13] T. Clackson, Dissecting the functions of proteins and pathways using chemically induced dimerization, Chem. Biol. Drug Des. 67 (2006) 440–442.