- Email: [email protected]
Transcription of dbp from the coding region of the Bm17 gene is required for the efficient propagation of Bombyx mori nucleopolyhedrovirus
Virus Research 223 (2016) 57–63
Contents lists available at ScienceDirect
Virus Research journal homepage: www.elsevier.com/locate/virusres
Transcription of dbp from the coding region of the Bm17 gene is required for the efficient propagation of Bombyx mori nucleopolyhedrovirus Susumu Katsuma Department of Agricultural and Environmental Biology, Graduate School of Agricultural and Life Sciences, The University of Tokyo, Yayoi 1-1-1, Bunkyo-ku, Tokyo 113-8657, Japan
a r t i c l e
i n f o
Article history: Received 10 May 2016 Received in revised form 21 June 2016 Accepted 24 June 2016 Available online 29 June 2016 Keywords: Baculovirus Bm17 DBP BmNPV NPV
a b s t r a c t A Bombyx mori nucleopolyhedrovirus (BmNPV) mutant was generated, in which Bm17 was disrupted by the insertion of a lacZ reporter cassette. This mutant (Bm17D) exhibited defective phenotypes, i.e., budded viruses (BVs) and occlusion bodies (OBs) were less produced in both B. mori cultured cells and larvae. However, a repair virus (Bm17DR), lacking endogenous Bm17 but expressing Bm17 with its endogenous promoter at a different genomic locus, did not rescue most of the defective phenotypes of Bm17D. Transcriptional units in the Bm17 region were surveyed in detail using a transcriptome map of BmNPV-infected cells. It was found that one of the transcriptional start sites (TSSs) of dbp (Bm16) is located within the Bm17 coding region and that it does not likely function in the genome of Bm17D- or Bm17DR by inserting a lacZ cassette. From the obtained results, it was shown that both dbp transcription and DBP protein expression were markedly reduced in Bm17D- or Bm17DR-infected cells. This indicates that reduced dbp transcription alone results in decreased BV and OB production during BmNPV infection. © 2016 Elsevier B.V. All rights reserved.
1. Introduction Baculoviridae is a large family of pathogens that mainly infect lepidopteran insects. Baculoviruses are phylogenetically divided into four genera: Alphabaculovirus, Betabaculovirus, Gammabaculovirus, and Deltabaculovirus (Herniou et al., 2012). Alphabaculoviruses are composed of lepidopteran nucleopolyhedroviruses (NPVs). NPVs produce two types of virions during their infection cycle: occlusion-derived viruses (ODVs) and budded viruses (BVs); the former are occluded in occlusion bodies (OBs) and the virus can be transmitted from insect to insect via oral infection, whereas the latter spread infection to neighboring cells. Homologs of Autographa californica multiple nucleopolyhedrovirus (AcMNPV) orf26 (Ac26) have been found in many
Abbreviations: BmNPV, Bombyx mori nucleopolyhedrovirus; AcMNPV, Autographa californica multiple nucleopolyhedrovirus; TSS, transcriptional start site; BV, budded virus; OB, occlusion body; MOI, multiplicity of infection; PCR, polymerase chain reaction; SDS-PAGE, sodium dodecyl sulfate polyacrylamide gel electrophoresis; RT-qPCR, reverse transcription-quantitative PCR; LT50 , median lethal time; hpi, hours post infection; dsRNA, double-stranded RNA. E-mail address: [email protected] http://dx.doi.org/10.1016/j.virusres.2016.06.018 0168-1702/© 2016 Elsevier B.V. All rights reserved.
alphabaculoviruses. Bombyx mori nucleopolyhedrovirus (BmNPV) orf17 (Bm17), a BmNPV homolog of Ac26, encodes a 129 amino acid-long protein with the DUF734 domain. Recently, two research groups independently performed the bacmid-mediated gene knockout approach to understand the functions of Bm17 during BmNPV infection. Shen et al. reported that the disruption of Bm17 did not affect virus propagation in cultured cells (Shen et al., 2012). On the other hand, Ono et al. demonstrated that the Bm17disrupted virus propagated more slowly than the wild-type virus (Ono et al., 2012). To clarify the reason behind this phenotypic discrepancy, here a Bm17-disrupted BmNPV was generated by conventional homologous recombination in B. mori cultured cells. The results showed that transcription of dbp, one of the baculovirus DNA-binding protein genes (Mikhailov et al., 1998), from the Bm17 coding region, but not the Bm17 protein itself, plays an important role in efficient virus propagation in B. mori cultured cells and larvae.
58
S. Katsuma / Virus Research 223 (2016) 57–63
Fig. 1. Generation of Bm17D and Bm17DR. (A) Schematic representation of the polh and Bm17 loci in T3 (wild-type) and mutant BmNPVs. In Bm17D, the Bm17 gene is disrupted by an hsp70-lacZ gene cassette. Bm17DR is a repair mutant in which the FLAG-tagged wild-type Bm17 gene with the authentic Bm17 gene promoter is inserted into upstream of the polh locus of Bm17D. (B) PCR analysis of the genome of T3, Bm17D, and Bm17DR. Each genotype was confirmed by PCR using the primers EPS F/EPS R, Bm17F1/Bm17R1, and Bm17F2/Bm17R2. (C) Bm17 transcription. BmN-4 cells were infected with T3 and Bm17DR, and total RNA was subjected to RT-qPCR analysis. Data are shown as mean ± SD (n = 3). (D) Localization of the Bm17 protein in Bm17DR-infected BmN-4 cells. BmN-4 cells were infected with Bm17DR, nuclear (N) and cytosolic (C) fractions of infected cells were prepared at 48 hpi, and Western blot analysis was performed with anti-FLAG antibody. WC indicates the whole cell fraction prepared from Bm17DR-infected cells at 24 hpi. Table 1 Oligonucleotides used in this study. Primer name
Primer sequence (5 -3 )
Purpose
Bm17F1 Bm17R1 Bm17F2 Bm17R2 EPS F EPS R dbpF dbpR Bm17 F Eco Bm17 R Sac Flag
TGTTGTTAGCATGTGCGTAG CCACAGACTTGTCGATAAAC AACATCTTTGTCAACTCGCG ACATGTCGAATACGTGTTCG TGTCCGTTTGCTGGCAACTG TACTTATTTATTTGCGAGATGG CAAATGAATGCACACGTTTG ACGTGCCAAAAGCAACTTTG AAGAATTCGTCGCTGCTCGAATCGCCAATC AAGAGCTCTTGATAAAATAAAACGGAGGAGTGTCCTCGTTCATTTTACTT ATCGTCGTCATCCTTGTAATCACTCGTTAAAGTTACGG
Genotyping, qPCR Genotyping Genotyping qPCR Plasmid construction
S. Katsuma / Virus Research 223 (2016) 57–63
59
Fig. 2. Characterization of Bm17D and Bm17DR in BmN-4 cells. (A) BV production. BmN-4 cells were infected with T3, Bm17D, and Bm17DR at MOI of 5. BV titers were determined by the plaque assay. Data are shown as mean ± standard deviation (SD; n = 3). One-way analyses of variance (ANOVA) with post hoc Dunnett’s tests comparing each of the treatment group (Bm17D and Bm17DR) means with the mean for the control group (T3). a P <0.05, T3 versus Bm17D, T3 versus Bm17DR. b P <0.05, T3 versus Bm17DR. (B) Light microscopic observations of BmNPV-infected BmN-4 cells at 72 hpi. (C) OB production. BmNPV-infected BmN-4 cells at 72 hpi were gently scraped with a rubber policeman, and the total OB production was measured. Data are shown as mean ± SD (n = 4). *P <0.05 by one-way ANOVA and Dunnett’s posttests using T3 as a control. (D) Polyhedrin expression. SDS-PAGE analysis of BmNPV-infected BmN-4 cells at 48 and 72 hpi was performed. The gel stained with Coomassie brilliant blue (CBB) is shown. The results of Western blot using anti-actin antibody are also indicated as loading controls.
2. Materials and methods
2.3. Construction of Bm17DR, a repair virus for Bm17D
2.1. Insects, cells, and viruses
To generate a repair virus for Bm17D, a FLAG-tagged Bm17 fragment with its endogenous promoter region was amplified by PCR using the primers shown in Table 1, and it was inserted into the transfer vector pBmhEPS1 (Kang et al., 1998). This plasmid was cotransfected with Bsu36I-digested polh-negative BmNPV-abb genomic DNA into BmN-4 cells using Cellfectin II reagent (Invitrogen) (Kang et al., 1998). A BmNPV expressing FLAG-tagged Bm17 protein (Bm17 EPS) was isolated by identifying plaques that produced OBs. An endogenous Bm17 was disrupted from the Bm17 EPS genome by homologous recombination and was designated as Bm17DR. The disruption of an endogenous Bm17 was confirmed by PCR using primers shown in Table 1. The expression of FLAGtagged Bm17 protein was confirmed by Western blot analysis with the anti-FLAG antibody (Sigma).
B. mori larvae (F1 hybrid Kinshu × Showa) were reared as previously described (Katsuma et al., 2006). The BmN-4 cell line was maintained in TC-100 medium with 10% fetal bovine serum. The BmNPV T3 (Maeda, 1984) isolate was used as the wild-type virus. Virus titers were determined by plaque assay as previously described (Maeda, 1984). BmN-4 cells were infected with BmNPVs at a multiplicity of infection (MOI) of 5. 2.2. Construction of the Bm17 deletion mutant by inserting a ˇ-galactosidase gene cassette To construct a plasmid for the deletion of Bm17, a plasmid containing a 5.3-kb PstJ fragment (nucleotides 13,910–19,195; GenBank Acc. no. L33180) (Maeda and Majima, 1990) was digested with MluI, and ligated to an hsp70-lacZ cassette (Kamita et al., 1993). The resultant plasmid was cotransfected with BmNPV T3 DNA into BmN-4 cells using Cellfectin II reagent (Invitrogen). Bm17-deleted BmNPV (Bm17D) was isolated by identifying plaques expressing galactosidase. The deletion of Bm17 was confirmed by polymerase chain reaction (PCR) using the primers shown in Table 1.
2.4. Assays for BV production To determine virus growth curves, BmN-4 cells were infected with T3, Bm17D, or Bm17DR at MOI of 5. After 1 h of incubation, the virus-containing culture medium was removed and fresh medium was added [0 h postinfection (hpi)]. A small amount of cul-
60
S. Katsuma / Virus Research 223 (2016) 57–63
A
B
1.0E+09
4.0E+08
8.0E+08
OBs/ml
6.0E+08
4.0E+08
*
*
2.0E+08
1.0E+08
T3
17D
Percent survival
80 60 40 20 0 120
130
17D
17DR
140
150
160
exp#3 T3 17D 17DR
100
Percent survival
T3 17D 17DR
110
*
exp#2
100
100
T3
17DR
exp#1
0 10 90
*
0.0E+00
0.0E+00
C
2.0E+08
170
hours postinfection
80 60 40 20
T3 17D 17DR
100
Percent survival
PFU/ml
3.0E+08
80 60 40 20 0
0 0 10 90
100
110
120
130
140
150
160
170
0 10 110
hours postinfection
120
130
140
150
160
170
180
190
hours postinfection
Fig. 3. Characterization of Bm17D and Bm17DR in B. mori larvae. (A) BV titer in the hemolymph of BmNPV-infected B. mori larvae at 96 hpi (n = 4). Data are shown as mean ± SD. *P <0.05 by one-way ANOVA and Dunnett’s posttests using T3 as a control. (B) OB release in the hemolymph of BmNPV-infected B. mori larvae at 96 hpi (n = 4). *P <0.05 by one-way ANOVA and Dunnett’s posttests using T3 as a control. (C) Survival curves of B. mori larvae infected with T3, Bm17D, and Bm17DR. LT50 s of T3, Bm17D, and Bm17DR were 120 h, 160 h, and 148 h in experiment #1 (exp#1, n = 16); 120 h, 164 h, and 152 h in experiment #2 (exp#2, n = 15); and 136 h, 176 h, and 164 h in experiment #3 (exp#3, n = 20), respectively.
ture medium was harvested at specific time points. BV production was determined by the plaque assay.
injection of BVs into the fifth instar B. mori larvae within 12 h after molting.
2.5. Western blotting BmN-4 cells were infected with BmNPVs at MOI of 5 and harvested at 6, 12, 24, 48, or 72 hpi. The biochemical fractionation of BmN-4 cells was performed as previously described (Jarvis et al., 1991). Sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and Western blotting using anti-FLAG (Sigma), antiDBP (Okano et al., 1999), and anti-actin (Santa Cruz Biotechnology) antibodies were performed as previously described (Katsuma et al., 2007). 2.6. Reverse transcription-quantitative PCR (RT-qPCR) Total RNA was reverse-transcribed, diluted, and used for PCR as previously described (Katsuma et al., 2006). Primers for qPCR are shown in Table 1. RT-qPCR experiments were performed as previously described (Katsuma and Shimada, 2009). 2.7. Larval bioassays Fifth instar B. mori larvae were starved for several hours, injected with 50 l of a viral suspension containing 1 × 105 plaque forming units, and returned to the artificial diet at 25 ◦ C. The hemolymph of the infected larvae was collected at 96 hpi, and the released OBs were counted using a hemocytometer. BV titers in the hemolymph of the infected larvae were determined by the plaque assay. The median lethal time (LT50 ) was determined by the intrahemocoelic
3. Results and discussion 3.1. Generation and characterization of a mutant BmNPV lacking functional Bm17 To determine the role of Bm17 during viral infection in BmN-4 cells and B. mori larvae, a mutant BmNPV (Bm17D) was generated, in which a lacZ gene cassette was inserted within the Bm17 coding region (Fig. 1A). The disruption of Bm17 in the Bm17D genome was confirmed by PCR (Fig. 1B). The successful isolation of Bm17D showed that Bm17 was not essential for virus replication in BmN-4 cells, which is consistent with previous bacmid-based studies (Shen et al., 2012; Ono et al., 2012). The effect of Bm17 deletion on BV production in BmN-4 cells was examined. Bm17D showed a slightly retarded rate of BV production in BmN-4 cells (Fig. 2A). Next, the effect of Bm17 deletion on OB production in BmN-4 cells was investigated, and OB production was observed to be reduced in Bm17D-infected BmN-4 cells compared with that in T3-infected cells (Fig. 2B and C). SDS-PAGE analysis showed that this decrease was caused by the down-regulation of POLH expression (Fig. 2D). The effects of Bm17 disruption on BV and OB production in B. mori larvae were also examined. As shown in Fig. 3A, infectious BVs were reduced in the hemolymph of B. mori larvae infected with Bm17D compared with those infected with T3. Interestingly, OB production was drastically reduced in Bm17Dinfected larvae (Fig. 3B). In addition, the survival time of Bm17D-
S. Katsuma / Virus Research 223 (2016) 57–63
61
Fig. 4. Expression of dbp in Bm17D- or Bm17DR-infected BmN-4 cells. (A) Mapping of transcriptional units located in the dbp–Bm17 region. Three dbp TSSs, one Bm17 TSS, and an hsp70-lacZ cassette insertion site are indicated. (B) RT-qPCR analysis of dbp mRNA. BmN-4 cells were infected with T3, Bm17D, and Bm17DR at MOI of 5. Total RNA was prepared at 6, 12, 24, and 48 hpi and subjected to RT-qPCR of dbp. Data are shown as mean ± SD (n = 3). (C) Western blot analysis of the DBP protein. BmN-4 cells were infected with T3, Bm17D, and Bm17DR at MOI of 5. Cell lysate was prepared at 6, 12, 24, and 48 hpi and subjected to Western blot using anti-DBP or anti-actin antibody.
62
S. Katsuma / Virus Research 223 (2016) 57–63
Fig. 5. Schematic representation of the dbp and Bm17 loci in two BmNPV Bm17-disrupted bacmids. The deleted regions of Bm17 in two previously reported BmNPV bacmids (Shen et al., 2012; Ono et al., 2012) are shown. Three dbp TSSs, one Bm17 TSS, and an hsp70-lacZ cassette insertion site are also indicated.
infected larvae was markedly extended compared with that of T3infected larvae (Fig. 3C). 3.2. Characterization of Bm17DR, a repair virus for Bm17D To verify whether all of the defective phenotypes observed in Bm17D were solely caused by the disruption of Bm17, a repair virus Bm17DR was generated, which lacked endogenous Bm17 but possessed a FLAG-tagged Bm17 cassette with its endogenous promoter at the polh locus (Fig. 1A). Genotyping of Bm17DR was performed by PCR with three sets of primers (Fig. 1B). The onset and transcriptional pattern of Bm17 were similar in T3- and Bm17DR-infected BmN-4 cells (Fig. 1C). BmN-4 cells were infected with Bm17DR, and nuclear and cytosolic fractions of infected cells were prepared at 48 hpi. Western blot analysis with anti-FLAG antibody showed that FLAG-tagged Bm17 was expressed in BmN-4 cells at a molecular mass of approximately 14.5 kDa (Fig. 1D). The expression of Bm17 in BmN-4 cells was detected in the cytosolic, but not in the nuclear fraction (Fig. 1D), suggesting that Bm17DR expressed FLAG-tagged Bm17 protein and that Bm17 is mainly localized in the cytoplasm. Next, BV and OB production was examined in Bm17DR-infected BmN-4 cells and B. mori larvae. Surprisingly, reduced production of BVs and OBs was not repaired in Bm17DR-infected BmN-4 cells (Fig. 2C–D) and B. mori larvae (Fig. 3A–B). LT50 of Bm17DR was slightly lesser than that of Bm17D (Fig. 3C). These results indicate that Bm17 slightly contributes to viral pathogenicity in B. mori larvae and that most defective phenotypes observed in Bm17D do not result from the loss-of-function of the Bm17 gene itself. 3.3. Reduced expression of dbp in Bm17D- and Bm17DR-infected BmN-4 cells It was hypothesized that a lacZ insertional disruption of Bm17 affects the expression of neighboring genes, which are involved in both BV and OB production. To investigate this issue, the transcriptome map of BmNPV using a full-length cDNA library generated from BmNPV-infected BmN-4 cells was used (Katsuma et al., 2011). Bm16, also known as dbp, is located at upstream of Bm17 and is transcribed from three early transcriptional start sites (TSSs; Fig. 4A). One dbp mRNA transcribed from TSS-3 was disrupted by a lacZ insertion within the coding region of Bm17, and the two other transcripts from TSS-1 and TSS-2 (both of which are expressed from the intergenic region and are not disrupted) likely produced dbp
mRNA in Bm17D- or Bm17DR-infected BmN-4 cells (Fig. 4A). DBP is a baculoviral DNA-binding protein that preferentially binds to single-stranded DNA and colocalizes with viral DNA replication sites (Mikhailov et al., 1998; Okano et al., 1999). The dbp knockout AcMNPV cannot produce BVs in cultured cells (Vanarsdall et al., 2007) and the double-stranded RNA (dsRNA)-mediated silencing of dbp in AcMNPV-infected cells suppresses the expression of the major capsid protein VP39 and POLH (Quadt et al., 2007). The phenotype observed in dbp-silenced cells is similar to that of Bm17D or Bm17DR, strongly suggesting that a lacZ insertional disruption of Bm17 in Bm17D and Bm17DR reduces the expression level of dbp. To verify whether an insertion of a lacZ cassette actually decreases dbp expression, the level of dbp mRNA was measured in T3-, Bm17D-, or Bm17DR-infected BmN-4 cells. The RT-qPCR experiments showed a marked reduction in the level of dbp mRNA in Bm17D- or Bm17DR-infected cells compared with that of T3infected cells at 6 and 12 hpi (Fig. 4B), whereas the mRNA levels at 24 and 48 hpi were comparable among the viruses (Fig. 4B). Furthermore, Western blot analysis was performed, and the amounts of DBP protein were found to be markedly decreased in Bm17Dor Bm17DR-infected cells at 6, 12, and 24 hpi, but the difference became smaller at 48 hpi (Fig. 3C). Considering these results, it can be concluded that Bm17D and Bm17DR are the dbp knocked-down mutants and that dbp TSS-3 is important for efficient BV and OB production.
3.4. Conclusions In this study, a Bm17-disrupted mutant Bm17D and its repair virus Bm17DR were characterized. Bm17D showed defective phenotypes in BV and OB production, particularly in B. mori larvae, but Bm17DR did not rescue most phenotypes of Bm17D. Larval assays revealed that the Bm17 protein has a little contribution to BmNPV pathogenicity in B. mori larvae. Further experiments revealed that Bm17D and Bm17DR lacked one of the dbp mRNAs transcribed from TSS-3 by inserting a lacZ cassette within the Bm17 gene and that dbp expression was markedly decreased in Bm17D- or Bm17DRinfected cells. This is consistent with a previous report where a transient knockdown of dbp with dsRNA transfection caused downregulation of structural proteins, resulting in aberrant formation of nucleocapsids and OBs in AcMNPV-infected cells (Quadt et al., 2007).
S. Katsuma / Virus Research 223 (2016) 57–63
There are two reports on Bm17-disrupted bacmids that described markedly different results. The disruption of Bm17 leads to no apparent phenotypic defects (Shen et al., 2012), whereas slow propagation of a Bm17-disrupted bacmid has been seen (Ono et al., 2012). To elucidate the reason for this inconsistency, disrupted loci of Bm17 were examined in each BmNPV bacmid. As shown in Fig. 5, all dbp transcripts were likely to be intact in a bacmid as reported by Shen et al. (Shen et al., 2012). In contrast, TSS-3 is disrupted in a bacmid as reported by Ono et al. (Ono et al., 2012), which is quite similar to Bm17D of the present study. Combined with the results of the present experiments, it can be concluded that the disruption of Bm17 does not affect virus propagation and that the downregulation of dbp by the removal of one of the dbp TSSs causes reduced BV and OB production. In addition, the results from the present study revealed that the expression level of dbp greatly contributes to BmNPV propagation in B. mori larvae, particularly in OB production (Fig. 3A–B). Finally, the present results suggested that more attention should be paid in future to all transcriptional units produced from the target gene when a gene knockout baculovirus is constructed. Acknowledgments I thank WonKyung Kang for providing DBP antibody, and Munetaka Kawamoto for clerical assistance. This work was supported by grants from MEXT (24658047, 25292196, and 16H05051), Japan. References Herniou, E.A., Arif, B.M., Becnel, J.J., Blissard, G.W., Bonning, B., Harrison, R., Jehle, J.A., Theilmann, D.A., Vlak, J.M., et al., 2012. Family Baculoviridae. In: King, A.M.Q. (Ed.), Virus Taxonomy: Ninth Report of the International Committee on Taxonomy of Viruses. Elsevier Academic Press, pp. 163–173.
63
Jarvis, D.L., Bohlmeyer, D.A., Garcia Jr., A., 1991. Requirements for nuclear localization and supramolecular assembly of a baculovirus polyhedrin protein. Virology 185, 795–810. Kamita, S.G., Majima, K., Maeda, S., 1993. Identification and characterization of the p35 gene of Bombyx mori nuclear polyhedrosis virus that prevents virus-induced apoptosis. J. Virol. 67, 455–463. Kang, W., Tristem, M., Maeda, S., Crook, N.E., O’Reilly, D.R., 1998. Identification and characterization of the Cydia pomonella granulovirus cathepsin and chitinase genes. J. Gen. Virol. 79, 2283–2292. Katsuma, S., Shimada, T., 2009. Bombyx mori nucleopolyhedrovirus ORF34 is required for efficient transcription of late and very late genes. Virology 392, 230–237. Katsuma, S., Horie, S., Daimon, T., Iwanaga, M., Shimada, T., 2006. In vivo and in vitro analyses of a Bombyx mori nucleopolyhedrovirus mutant lacking functional vfgf. Virology 355, 62–70. Katsuma, S., Mita, K., Shimada, T., 2007. ERK- and JNK-dependent signaling pathways contribute to Bombyx mori nucleopolyhedrovirus infection. J. Virol. 81, 13700–13709. Katsuma, S., Kang, W., Shin-I, T., Ohishi, K., Kadota, K., Kohara, Y., Shimada, T., 2011. Mass identification of transcriptional units expressed from the Bombyx mori nucleopolyhedrovirus genome. J. Gen. Virol. 92, 200–203. Maeda, S., 1984. A plaque assay and cloning of Bombyx mori nuclear polyhedrosis virus. J. Seric. Sci. Jpn. 53, 547–548. Maeda, S., Majima, K., 1990. Molecular cloning and physical mapping of the genome of Bombyx mori nuclear polyhedrosis virus. J. Gen. Virol. 71, 1851–1855. Mikhailov, V.S., Mikhailova, A.L., Iwanaga, M., Gomi, S., Maeda, S., 1998. Bombyx mori nucleopolyhedrovirus encodes a DNA-binding protein capable of destabilizing duplex DNA. J. Virol. 72, 3107–3116. Okano, K., Mikhailov, V.S., Maeda, S., 1999. Colocalization of baculovirus IE-1 and two DNA-binding proteins, DBP and LEF-3, to viral replication factories. J. Virol. 73, 110–119. Ono, C., Kamagata, T., Taka, H., Sahara, K., Asano, S., Bando, H., 2012. Phenotypic grouping of 141 BmNPVs lacking viral gene sequences. Virus Res. 165, 197–206. Quadt, I., van Lent, J.W., Knebel-Mörsdorf, D., 2007. Studies of the silencing of baculovirus DNA binding protein. J. Virol. 81, 6122–6127. Shen, H., Zhou, Y., Zhang, W., Nin, B., Wang, H., Wang, X., Shao, S., Chen, H., Guo, Z., Liu, X., Yao, Q., Chen, K., 2012. Characterization of Bombyx mori nucleopolyhedrovirus with a knockout of Bm17. Cytotechnology 64, 711–718. Vanarsdall, A.L., Mikhailov, V.S., Rohrmann, G.F., 2007. Characterization of a baculovirus lacking the DBP (DNA-binding protein) gene. Virology 364, 475–485.
Contents lists available at ScienceDirect
Virus Research journal homepage: www.elsevier.com/locate/virusres
Transcription of dbp from the coding region of the Bm17 gene is required for the efficient propagation of Bombyx mori nucleopolyhedrovirus Susumu Katsuma Department of Agricultural and Environmental Biology, Graduate School of Agricultural and Life Sciences, The University of Tokyo, Yayoi 1-1-1, Bunkyo-ku, Tokyo 113-8657, Japan
a r t i c l e
i n f o
Article history: Received 10 May 2016 Received in revised form 21 June 2016 Accepted 24 June 2016 Available online 29 June 2016 Keywords: Baculovirus Bm17 DBP BmNPV NPV
a b s t r a c t A Bombyx mori nucleopolyhedrovirus (BmNPV) mutant was generated, in which Bm17 was disrupted by the insertion of a lacZ reporter cassette. This mutant (Bm17D) exhibited defective phenotypes, i.e., budded viruses (BVs) and occlusion bodies (OBs) were less produced in both B. mori cultured cells and larvae. However, a repair virus (Bm17DR), lacking endogenous Bm17 but expressing Bm17 with its endogenous promoter at a different genomic locus, did not rescue most of the defective phenotypes of Bm17D. Transcriptional units in the Bm17 region were surveyed in detail using a transcriptome map of BmNPV-infected cells. It was found that one of the transcriptional start sites (TSSs) of dbp (Bm16) is located within the Bm17 coding region and that it does not likely function in the genome of Bm17D- or Bm17DR by inserting a lacZ cassette. From the obtained results, it was shown that both dbp transcription and DBP protein expression were markedly reduced in Bm17D- or Bm17DR-infected cells. This indicates that reduced dbp transcription alone results in decreased BV and OB production during BmNPV infection. © 2016 Elsevier B.V. All rights reserved.
1. Introduction Baculoviridae is a large family of pathogens that mainly infect lepidopteran insects. Baculoviruses are phylogenetically divided into four genera: Alphabaculovirus, Betabaculovirus, Gammabaculovirus, and Deltabaculovirus (Herniou et al., 2012). Alphabaculoviruses are composed of lepidopteran nucleopolyhedroviruses (NPVs). NPVs produce two types of virions during their infection cycle: occlusion-derived viruses (ODVs) and budded viruses (BVs); the former are occluded in occlusion bodies (OBs) and the virus can be transmitted from insect to insect via oral infection, whereas the latter spread infection to neighboring cells. Homologs of Autographa californica multiple nucleopolyhedrovirus (AcMNPV) orf26 (Ac26) have been found in many
Abbreviations: BmNPV, Bombyx mori nucleopolyhedrovirus; AcMNPV, Autographa californica multiple nucleopolyhedrovirus; TSS, transcriptional start site; BV, budded virus; OB, occlusion body; MOI, multiplicity of infection; PCR, polymerase chain reaction; SDS-PAGE, sodium dodecyl sulfate polyacrylamide gel electrophoresis; RT-qPCR, reverse transcription-quantitative PCR; LT50 , median lethal time; hpi, hours post infection; dsRNA, double-stranded RNA. E-mail address: [email protected] http://dx.doi.org/10.1016/j.virusres.2016.06.018 0168-1702/© 2016 Elsevier B.V. All rights reserved.
alphabaculoviruses. Bombyx mori nucleopolyhedrovirus (BmNPV) orf17 (Bm17), a BmNPV homolog of Ac26, encodes a 129 amino acid-long protein with the DUF734 domain. Recently, two research groups independently performed the bacmid-mediated gene knockout approach to understand the functions of Bm17 during BmNPV infection. Shen et al. reported that the disruption of Bm17 did not affect virus propagation in cultured cells (Shen et al., 2012). On the other hand, Ono et al. demonstrated that the Bm17disrupted virus propagated more slowly than the wild-type virus (Ono et al., 2012). To clarify the reason behind this phenotypic discrepancy, here a Bm17-disrupted BmNPV was generated by conventional homologous recombination in B. mori cultured cells. The results showed that transcription of dbp, one of the baculovirus DNA-binding protein genes (Mikhailov et al., 1998), from the Bm17 coding region, but not the Bm17 protein itself, plays an important role in efficient virus propagation in B. mori cultured cells and larvae.
58
S. Katsuma / Virus Research 223 (2016) 57–63
Fig. 1. Generation of Bm17D and Bm17DR. (A) Schematic representation of the polh and Bm17 loci in T3 (wild-type) and mutant BmNPVs. In Bm17D, the Bm17 gene is disrupted by an hsp70-lacZ gene cassette. Bm17DR is a repair mutant in which the FLAG-tagged wild-type Bm17 gene with the authentic Bm17 gene promoter is inserted into upstream of the polh locus of Bm17D. (B) PCR analysis of the genome of T3, Bm17D, and Bm17DR. Each genotype was confirmed by PCR using the primers EPS F/EPS R, Bm17F1/Bm17R1, and Bm17F2/Bm17R2. (C) Bm17 transcription. BmN-4 cells were infected with T3 and Bm17DR, and total RNA was subjected to RT-qPCR analysis. Data are shown as mean ± SD (n = 3). (D) Localization of the Bm17 protein in Bm17DR-infected BmN-4 cells. BmN-4 cells were infected with Bm17DR, nuclear (N) and cytosolic (C) fractions of infected cells were prepared at 48 hpi, and Western blot analysis was performed with anti-FLAG antibody. WC indicates the whole cell fraction prepared from Bm17DR-infected cells at 24 hpi. Table 1 Oligonucleotides used in this study. Primer name
Primer sequence (5 -3 )
Purpose
Bm17F1 Bm17R1 Bm17F2 Bm17R2 EPS F EPS R dbpF dbpR Bm17 F Eco Bm17 R Sac Flag
TGTTGTTAGCATGTGCGTAG CCACAGACTTGTCGATAAAC AACATCTTTGTCAACTCGCG ACATGTCGAATACGTGTTCG TGTCCGTTTGCTGGCAACTG TACTTATTTATTTGCGAGATGG CAAATGAATGCACACGTTTG ACGTGCCAAAAGCAACTTTG AAGAATTCGTCGCTGCTCGAATCGCCAATC AAGAGCTCTTGATAAAATAAAACGGAGGAGTGTCCTCGTTCATTTTACTT ATCGTCGTCATCCTTGTAATCACTCGTTAAAGTTACGG
Genotyping, qPCR Genotyping Genotyping qPCR Plasmid construction
S. Katsuma / Virus Research 223 (2016) 57–63
59
Fig. 2. Characterization of Bm17D and Bm17DR in BmN-4 cells. (A) BV production. BmN-4 cells were infected with T3, Bm17D, and Bm17DR at MOI of 5. BV titers were determined by the plaque assay. Data are shown as mean ± standard deviation (SD; n = 3). One-way analyses of variance (ANOVA) with post hoc Dunnett’s tests comparing each of the treatment group (Bm17D and Bm17DR) means with the mean for the control group (T3). a P <0.05, T3 versus Bm17D, T3 versus Bm17DR. b P <0.05, T3 versus Bm17DR. (B) Light microscopic observations of BmNPV-infected BmN-4 cells at 72 hpi. (C) OB production. BmNPV-infected BmN-4 cells at 72 hpi were gently scraped with a rubber policeman, and the total OB production was measured. Data are shown as mean ± SD (n = 4). *P <0.05 by one-way ANOVA and Dunnett’s posttests using T3 as a control. (D) Polyhedrin expression. SDS-PAGE analysis of BmNPV-infected BmN-4 cells at 48 and 72 hpi was performed. The gel stained with Coomassie brilliant blue (CBB) is shown. The results of Western blot using anti-actin antibody are also indicated as loading controls.
2. Materials and methods
2.3. Construction of Bm17DR, a repair virus for Bm17D
2.1. Insects, cells, and viruses
To generate a repair virus for Bm17D, a FLAG-tagged Bm17 fragment with its endogenous promoter region was amplified by PCR using the primers shown in Table 1, and it was inserted into the transfer vector pBmhEPS1 (Kang et al., 1998). This plasmid was cotransfected with Bsu36I-digested polh-negative BmNPV-abb genomic DNA into BmN-4 cells using Cellfectin II reagent (Invitrogen) (Kang et al., 1998). A BmNPV expressing FLAG-tagged Bm17 protein (Bm17 EPS) was isolated by identifying plaques that produced OBs. An endogenous Bm17 was disrupted from the Bm17 EPS genome by homologous recombination and was designated as Bm17DR. The disruption of an endogenous Bm17 was confirmed by PCR using primers shown in Table 1. The expression of FLAGtagged Bm17 protein was confirmed by Western blot analysis with the anti-FLAG antibody (Sigma).
B. mori larvae (F1 hybrid Kinshu × Showa) were reared as previously described (Katsuma et al., 2006). The BmN-4 cell line was maintained in TC-100 medium with 10% fetal bovine serum. The BmNPV T3 (Maeda, 1984) isolate was used as the wild-type virus. Virus titers were determined by plaque assay as previously described (Maeda, 1984). BmN-4 cells were infected with BmNPVs at a multiplicity of infection (MOI) of 5. 2.2. Construction of the Bm17 deletion mutant by inserting a ˇ-galactosidase gene cassette To construct a plasmid for the deletion of Bm17, a plasmid containing a 5.3-kb PstJ fragment (nucleotides 13,910–19,195; GenBank Acc. no. L33180) (Maeda and Majima, 1990) was digested with MluI, and ligated to an hsp70-lacZ cassette (Kamita et al., 1993). The resultant plasmid was cotransfected with BmNPV T3 DNA into BmN-4 cells using Cellfectin II reagent (Invitrogen). Bm17-deleted BmNPV (Bm17D) was isolated by identifying plaques expressing galactosidase. The deletion of Bm17 was confirmed by polymerase chain reaction (PCR) using the primers shown in Table 1.
2.4. Assays for BV production To determine virus growth curves, BmN-4 cells were infected with T3, Bm17D, or Bm17DR at MOI of 5. After 1 h of incubation, the virus-containing culture medium was removed and fresh medium was added [0 h postinfection (hpi)]. A small amount of cul-
60
S. Katsuma / Virus Research 223 (2016) 57–63
A
B
1.0E+09
4.0E+08
8.0E+08
OBs/ml
6.0E+08
4.0E+08
*
*
2.0E+08
1.0E+08
T3
17D
Percent survival
80 60 40 20 0 120
130
17D
17DR
140
150
160
exp#3 T3 17D 17DR
100
Percent survival
T3 17D 17DR
110
*
exp#2
100
100
T3
17DR
exp#1
0 10 90
*
0.0E+00
0.0E+00
C
2.0E+08
170
hours postinfection
80 60 40 20
T3 17D 17DR
100
Percent survival
PFU/ml
3.0E+08
80 60 40 20 0
0 0 10 90
100
110
120
130
140
150
160
170
0 10 110
hours postinfection
120
130
140
150
160
170
180
190
hours postinfection
Fig. 3. Characterization of Bm17D and Bm17DR in B. mori larvae. (A) BV titer in the hemolymph of BmNPV-infected B. mori larvae at 96 hpi (n = 4). Data are shown as mean ± SD. *P <0.05 by one-way ANOVA and Dunnett’s posttests using T3 as a control. (B) OB release in the hemolymph of BmNPV-infected B. mori larvae at 96 hpi (n = 4). *P <0.05 by one-way ANOVA and Dunnett’s posttests using T3 as a control. (C) Survival curves of B. mori larvae infected with T3, Bm17D, and Bm17DR. LT50 s of T3, Bm17D, and Bm17DR were 120 h, 160 h, and 148 h in experiment #1 (exp#1, n = 16); 120 h, 164 h, and 152 h in experiment #2 (exp#2, n = 15); and 136 h, 176 h, and 164 h in experiment #3 (exp#3, n = 20), respectively.
ture medium was harvested at specific time points. BV production was determined by the plaque assay.
injection of BVs into the fifth instar B. mori larvae within 12 h after molting.
2.5. Western blotting BmN-4 cells were infected with BmNPVs at MOI of 5 and harvested at 6, 12, 24, 48, or 72 hpi. The biochemical fractionation of BmN-4 cells was performed as previously described (Jarvis et al., 1991). Sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and Western blotting using anti-FLAG (Sigma), antiDBP (Okano et al., 1999), and anti-actin (Santa Cruz Biotechnology) antibodies were performed as previously described (Katsuma et al., 2007). 2.6. Reverse transcription-quantitative PCR (RT-qPCR) Total RNA was reverse-transcribed, diluted, and used for PCR as previously described (Katsuma et al., 2006). Primers for qPCR are shown in Table 1. RT-qPCR experiments were performed as previously described (Katsuma and Shimada, 2009). 2.7. Larval bioassays Fifth instar B. mori larvae were starved for several hours, injected with 50 l of a viral suspension containing 1 × 105 plaque forming units, and returned to the artificial diet at 25 ◦ C. The hemolymph of the infected larvae was collected at 96 hpi, and the released OBs were counted using a hemocytometer. BV titers in the hemolymph of the infected larvae were determined by the plaque assay. The median lethal time (LT50 ) was determined by the intrahemocoelic
3. Results and discussion 3.1. Generation and characterization of a mutant BmNPV lacking functional Bm17 To determine the role of Bm17 during viral infection in BmN-4 cells and B. mori larvae, a mutant BmNPV (Bm17D) was generated, in which a lacZ gene cassette was inserted within the Bm17 coding region (Fig. 1A). The disruption of Bm17 in the Bm17D genome was confirmed by PCR (Fig. 1B). The successful isolation of Bm17D showed that Bm17 was not essential for virus replication in BmN-4 cells, which is consistent with previous bacmid-based studies (Shen et al., 2012; Ono et al., 2012). The effect of Bm17 deletion on BV production in BmN-4 cells was examined. Bm17D showed a slightly retarded rate of BV production in BmN-4 cells (Fig. 2A). Next, the effect of Bm17 deletion on OB production in BmN-4 cells was investigated, and OB production was observed to be reduced in Bm17D-infected BmN-4 cells compared with that in T3-infected cells (Fig. 2B and C). SDS-PAGE analysis showed that this decrease was caused by the down-regulation of POLH expression (Fig. 2D). The effects of Bm17 disruption on BV and OB production in B. mori larvae were also examined. As shown in Fig. 3A, infectious BVs were reduced in the hemolymph of B. mori larvae infected with Bm17D compared with those infected with T3. Interestingly, OB production was drastically reduced in Bm17Dinfected larvae (Fig. 3B). In addition, the survival time of Bm17D-
S. Katsuma / Virus Research 223 (2016) 57–63
61
Fig. 4. Expression of dbp in Bm17D- or Bm17DR-infected BmN-4 cells. (A) Mapping of transcriptional units located in the dbp–Bm17 region. Three dbp TSSs, one Bm17 TSS, and an hsp70-lacZ cassette insertion site are indicated. (B) RT-qPCR analysis of dbp mRNA. BmN-4 cells were infected with T3, Bm17D, and Bm17DR at MOI of 5. Total RNA was prepared at 6, 12, 24, and 48 hpi and subjected to RT-qPCR of dbp. Data are shown as mean ± SD (n = 3). (C) Western blot analysis of the DBP protein. BmN-4 cells were infected with T3, Bm17D, and Bm17DR at MOI of 5. Cell lysate was prepared at 6, 12, 24, and 48 hpi and subjected to Western blot using anti-DBP or anti-actin antibody.
62
S. Katsuma / Virus Research 223 (2016) 57–63
Fig. 5. Schematic representation of the dbp and Bm17 loci in two BmNPV Bm17-disrupted bacmids. The deleted regions of Bm17 in two previously reported BmNPV bacmids (Shen et al., 2012; Ono et al., 2012) are shown. Three dbp TSSs, one Bm17 TSS, and an hsp70-lacZ cassette insertion site are also indicated.
infected larvae was markedly extended compared with that of T3infected larvae (Fig. 3C). 3.2. Characterization of Bm17DR, a repair virus for Bm17D To verify whether all of the defective phenotypes observed in Bm17D were solely caused by the disruption of Bm17, a repair virus Bm17DR was generated, which lacked endogenous Bm17 but possessed a FLAG-tagged Bm17 cassette with its endogenous promoter at the polh locus (Fig. 1A). Genotyping of Bm17DR was performed by PCR with three sets of primers (Fig. 1B). The onset and transcriptional pattern of Bm17 were similar in T3- and Bm17DR-infected BmN-4 cells (Fig. 1C). BmN-4 cells were infected with Bm17DR, and nuclear and cytosolic fractions of infected cells were prepared at 48 hpi. Western blot analysis with anti-FLAG antibody showed that FLAG-tagged Bm17 was expressed in BmN-4 cells at a molecular mass of approximately 14.5 kDa (Fig. 1D). The expression of Bm17 in BmN-4 cells was detected in the cytosolic, but not in the nuclear fraction (Fig. 1D), suggesting that Bm17DR expressed FLAG-tagged Bm17 protein and that Bm17 is mainly localized in the cytoplasm. Next, BV and OB production was examined in Bm17DR-infected BmN-4 cells and B. mori larvae. Surprisingly, reduced production of BVs and OBs was not repaired in Bm17DR-infected BmN-4 cells (Fig. 2C–D) and B. mori larvae (Fig. 3A–B). LT50 of Bm17DR was slightly lesser than that of Bm17D (Fig. 3C). These results indicate that Bm17 slightly contributes to viral pathogenicity in B. mori larvae and that most defective phenotypes observed in Bm17D do not result from the loss-of-function of the Bm17 gene itself. 3.3. Reduced expression of dbp in Bm17D- and Bm17DR-infected BmN-4 cells It was hypothesized that a lacZ insertional disruption of Bm17 affects the expression of neighboring genes, which are involved in both BV and OB production. To investigate this issue, the transcriptome map of BmNPV using a full-length cDNA library generated from BmNPV-infected BmN-4 cells was used (Katsuma et al., 2011). Bm16, also known as dbp, is located at upstream of Bm17 and is transcribed from three early transcriptional start sites (TSSs; Fig. 4A). One dbp mRNA transcribed from TSS-3 was disrupted by a lacZ insertion within the coding region of Bm17, and the two other transcripts from TSS-1 and TSS-2 (both of which are expressed from the intergenic region and are not disrupted) likely produced dbp
mRNA in Bm17D- or Bm17DR-infected BmN-4 cells (Fig. 4A). DBP is a baculoviral DNA-binding protein that preferentially binds to single-stranded DNA and colocalizes with viral DNA replication sites (Mikhailov et al., 1998; Okano et al., 1999). The dbp knockout AcMNPV cannot produce BVs in cultured cells (Vanarsdall et al., 2007) and the double-stranded RNA (dsRNA)-mediated silencing of dbp in AcMNPV-infected cells suppresses the expression of the major capsid protein VP39 and POLH (Quadt et al., 2007). The phenotype observed in dbp-silenced cells is similar to that of Bm17D or Bm17DR, strongly suggesting that a lacZ insertional disruption of Bm17 in Bm17D and Bm17DR reduces the expression level of dbp. To verify whether an insertion of a lacZ cassette actually decreases dbp expression, the level of dbp mRNA was measured in T3-, Bm17D-, or Bm17DR-infected BmN-4 cells. The RT-qPCR experiments showed a marked reduction in the level of dbp mRNA in Bm17D- or Bm17DR-infected cells compared with that of T3infected cells at 6 and 12 hpi (Fig. 4B), whereas the mRNA levels at 24 and 48 hpi were comparable among the viruses (Fig. 4B). Furthermore, Western blot analysis was performed, and the amounts of DBP protein were found to be markedly decreased in Bm17Dor Bm17DR-infected cells at 6, 12, and 24 hpi, but the difference became smaller at 48 hpi (Fig. 3C). Considering these results, it can be concluded that Bm17D and Bm17DR are the dbp knocked-down mutants and that dbp TSS-3 is important for efficient BV and OB production.
3.4. Conclusions In this study, a Bm17-disrupted mutant Bm17D and its repair virus Bm17DR were characterized. Bm17D showed defective phenotypes in BV and OB production, particularly in B. mori larvae, but Bm17DR did not rescue most phenotypes of Bm17D. Larval assays revealed that the Bm17 protein has a little contribution to BmNPV pathogenicity in B. mori larvae. Further experiments revealed that Bm17D and Bm17DR lacked one of the dbp mRNAs transcribed from TSS-3 by inserting a lacZ cassette within the Bm17 gene and that dbp expression was markedly decreased in Bm17D- or Bm17DRinfected cells. This is consistent with a previous report where a transient knockdown of dbp with dsRNA transfection caused downregulation of structural proteins, resulting in aberrant formation of nucleocapsids and OBs in AcMNPV-infected cells (Quadt et al., 2007).
S. Katsuma / Virus Research 223 (2016) 57–63
There are two reports on Bm17-disrupted bacmids that described markedly different results. The disruption of Bm17 leads to no apparent phenotypic defects (Shen et al., 2012), whereas slow propagation of a Bm17-disrupted bacmid has been seen (Ono et al., 2012). To elucidate the reason for this inconsistency, disrupted loci of Bm17 were examined in each BmNPV bacmid. As shown in Fig. 5, all dbp transcripts were likely to be intact in a bacmid as reported by Shen et al. (Shen et al., 2012). In contrast, TSS-3 is disrupted in a bacmid as reported by Ono et al. (Ono et al., 2012), which is quite similar to Bm17D of the present study. Combined with the results of the present experiments, it can be concluded that the disruption of Bm17 does not affect virus propagation and that the downregulation of dbp by the removal of one of the dbp TSSs causes reduced BV and OB production. In addition, the results from the present study revealed that the expression level of dbp greatly contributes to BmNPV propagation in B. mori larvae, particularly in OB production (Fig. 3A–B). Finally, the present results suggested that more attention should be paid in future to all transcriptional units produced from the target gene when a gene knockout baculovirus is constructed. Acknowledgments I thank WonKyung Kang for providing DBP antibody, and Munetaka Kawamoto for clerical assistance. This work was supported by grants from MEXT (24658047, 25292196, and 16H05051), Japan. References Herniou, E.A., Arif, B.M., Becnel, J.J., Blissard, G.W., Bonning, B., Harrison, R., Jehle, J.A., Theilmann, D.A., Vlak, J.M., et al., 2012. Family Baculoviridae. In: King, A.M.Q. (Ed.), Virus Taxonomy: Ninth Report of the International Committee on Taxonomy of Viruses. Elsevier Academic Press, pp. 163–173.
63
Jarvis, D.L., Bohlmeyer, D.A., Garcia Jr., A., 1991. Requirements for nuclear localization and supramolecular assembly of a baculovirus polyhedrin protein. Virology 185, 795–810. Kamita, S.G., Majima, K., Maeda, S., 1993. Identification and characterization of the p35 gene of Bombyx mori nuclear polyhedrosis virus that prevents virus-induced apoptosis. J. Virol. 67, 455–463. Kang, W., Tristem, M., Maeda, S., Crook, N.E., O’Reilly, D.R., 1998. Identification and characterization of the Cydia pomonella granulovirus cathepsin and chitinase genes. J. Gen. Virol. 79, 2283–2292. Katsuma, S., Shimada, T., 2009. Bombyx mori nucleopolyhedrovirus ORF34 is required for efficient transcription of late and very late genes. Virology 392, 230–237. Katsuma, S., Horie, S., Daimon, T., Iwanaga, M., Shimada, T., 2006. In vivo and in vitro analyses of a Bombyx mori nucleopolyhedrovirus mutant lacking functional vfgf. Virology 355, 62–70. Katsuma, S., Mita, K., Shimada, T., 2007. ERK- and JNK-dependent signaling pathways contribute to Bombyx mori nucleopolyhedrovirus infection. J. Virol. 81, 13700–13709. Katsuma, S., Kang, W., Shin-I, T., Ohishi, K., Kadota, K., Kohara, Y., Shimada, T., 2011. Mass identification of transcriptional units expressed from the Bombyx mori nucleopolyhedrovirus genome. J. Gen. Virol. 92, 200–203. Maeda, S., 1984. A plaque assay and cloning of Bombyx mori nuclear polyhedrosis virus. J. Seric. Sci. Jpn. 53, 547–548. Maeda, S., Majima, K., 1990. Molecular cloning and physical mapping of the genome of Bombyx mori nuclear polyhedrosis virus. J. Gen. Virol. 71, 1851–1855. Mikhailov, V.S., Mikhailova, A.L., Iwanaga, M., Gomi, S., Maeda, S., 1998. Bombyx mori nucleopolyhedrovirus encodes a DNA-binding protein capable of destabilizing duplex DNA. J. Virol. 72, 3107–3116. Okano, K., Mikhailov, V.S., Maeda, S., 1999. Colocalization of baculovirus IE-1 and two DNA-binding proteins, DBP and LEF-3, to viral replication factories. J. Virol. 73, 110–119. Ono, C., Kamagata, T., Taka, H., Sahara, K., Asano, S., Bando, H., 2012. Phenotypic grouping of 141 BmNPVs lacking viral gene sequences. Virus Res. 165, 197–206. Quadt, I., van Lent, J.W., Knebel-Mörsdorf, D., 2007. Studies of the silencing of baculovirus DNA binding protein. J. Virol. 81, 6122–6127. Shen, H., Zhou, Y., Zhang, W., Nin, B., Wang, H., Wang, X., Shao, S., Chen, H., Guo, Z., Liu, X., Yao, Q., Chen, K., 2012. Characterization of Bombyx mori nucleopolyhedrovirus with a knockout of Bm17. Cytotechnology 64, 711–718. Vanarsdall, A.L., Mikhailov, V.S., Rohrmann, G.F., 2007. Characterization of a baculovirus lacking the DBP (DNA-binding protein) gene. Virology 364, 475–485.