Transcriptional analysis of two endoinulinase genes inuA and inuB in Aspergillus niger and nucleotide sequences of their promoter regions

JOURNAL OFBIOSCIENCE AND BIOENGWEERING Vol. 88, No. 6, 599-604. 1999

Transcriptional Analysis of Two Endoinulinase Genes inuA and inuB in Aspergillus niger and Nucleotide Sequences of Their Promoter Regions HIDETOSHI AKIMOTO, TAKAYUKI KUSHIMA, TOYOHIKO NAKAMURA, AND KAZUYOSHI OHTA* Department of Biological Resource Sciences,Faculty of Agriculture, Miyazaki University, 1-I Gakuen Kibanadai Nishi, Miyazaki 889-2192, Japan Received19 July 1999/Accepted14 September1999 Aspergillus niger 12 contained two copies of endoinulinase genes (imA and inuB) in the genome (K. Ohta et al., Biosci. Biotechnol. Biochem., 62, 1731-1738, 1998). The inwl- and inuB-specific DNA probes were constructed according to the respective 3’-noncoding sequencesthat diverged from each other. Poly(A)+ RNA was prepared from mycelia grown on inulin, fructose, or glucose in submerged culture. Three endoinulinase cDNA sequencesthat corresponded to the coding regions and their 5’. and 3’-flanking regions were obtained by reverse transcription and subsequent polymerase chain reaction. Southern blot analysis revealed that the amplified cDNA S’uoncoding sequenceshybridized to the inuB probe hut not to the inuA probe, regardless of the carbon source. The data suggest that only the inuB gene was transcribed constitutively. Four distinct 5’ ends of the transcripts were observed at positions - 80 (A), - 72 (G), - 69 (A), and - 65 (A) from the start codon. The inuB mRNAs were polyadenylated at various sites between 94 and 297 bp downstream of the stop codon. We have determined the nucleotide sequences of the 1201- and 1017-bp 5’-noncoding regions of the inuA and inuB genes, respectively. The inuB promoter region included a putative TATA box at - 116 (TATATA). [Key words: Aspergiflus niger, cDNA, endoinulinase, inulin, fungal promoter] Inulin is a linear polymer of 30 to 40 o-fructose residues linked by j-2,1 bonds and terminated by a Dglucose residue at the reducing end (1). Most microbial inulinases are exo-acting enzymes and are only produced in response to the presence of inulin (1). However, a filamentous fungus Aspergillus niger 12 produced extracellular inulinase in submerged culture irrespective of the carbon source; inulin and some other carbon sources, including fructose, glucose, xylose, sucrose and raffinose, supported the high level of inulinase production (2). Endoinulinase (2, I-p-D-fructan fructanohydrolase, EC 3.2.1.7) hydrolyzes the internal P-2,1-fructofuranosidic linkages in inulin to release inulotriose, -tetraose, and -pentaose as the main products. Ingestion of the resulting inulo-oligosaccharides is expected to increase the population of resident bifidobacteria in human intestinal flora and in turn contribute to human health (3). The enzyme was first isolated from A. niger 12 and characterized as a monomeric glycoprotein with the apparent M, of 54 kDa (4). The A. niger endoinulinase has industrial potentials for the production of inulo-oligosaccharides, since enzyme preparations from A. niger are generally recognized as safe (GRAS) by the U.S. Food and Drug Administration (FDA) (5). While A. niger 12 apparently secreted a single endoinulinase (4), our previous study showed the existence of two copies of the endoinulinase gene, inuA and inuB, in the genome of the A. niger strain (6). This article describes the expression analysis of the two endoinulinase genes at the transcriptional level. The previously cloned 1.8- and 2.5kbp genomic DNA fragments containing the inuA and inuB genes, respectively, lacked their promoter regions (6). We also report the cloning and sequencing of the inuA and inuB 5’-noncoding * Correspondingauthor.

regions and discuss the potential within these regions. MATERIALS

cis-acting sequences

AND METHODS

Fungal strain and culture conditions A. niger 12 used in this study was a wild-type strain from our culture collection and originally isolated from soil samples collected in Oita, Japan (2). Liquid cultures of the fungal strain were incubated at 30°C on a rotary shaker (140rpm), using the basal medium B containing 3.0% (w/v) inulin, fructose, or glucose as the carbon source (2). Analytical procedures The contents of duplicate flasks in the submerged culture were analyzed for enzyme activities and biomass. Inulinase activities were manifested by the action of both exo- and endoinulinases present in the culture filtrate of A. niger 12 (4, 7). In contrast to the endoinulinase that is specific for inulin, exoinulinases exhibit the activity toward sucrose besides inulin. For this reason, inulinase and invertase activities in the culture filtrates were assayed by measuring reducing sugars released from inulin and sucrose, respectively, after incubation at 40°C and pH 5.0 for 30min (8). One unit of inulinase activity was defined as the amount of enzyme that liberated 1 .O,nmol of fructose equivalent from inulin per min. One unit of invertase activity was defined as the amount of enzyme that hydrolyzed 1.0 pmol of sucrose per min. Mycelial growth was monitored by the dry weight (9) that was expressed as grams per liter of the fungal culture. DNA manipulations A. niger genomic DNA was extracted and purified from mycelia grown on fructose for 72 h as described previously (6). A plasmid vector pUC18 was used for the construction of an A. niger genomic library and subcloning in E. coli JM109 (10). 599

600

AKIMOTO

J. BIOSCI.BIOENG.,

ET AL.

Digestion with restriction endonucleases was conducted as recommended by the supplier (Boehringer Mannheim GmbH, Mannheim, Germany). Standard molecular cloning techniques were performed as described by Sambrook et al. (11). Primer designs and polymerase chain reaction (PCR) The oligonucleotide primers designed in this study are based on the inuA and inuB genomic sequences of A. niger determined previously (6). Their positions and orientations are shown in Fig. 1 along with those of universal primers. The PCRs were carried out in a thermal cycler (GeneAmp PCR system 2400; Perkin-Elmer Co., Norwalk, CT, USA) as described previously (6). Construction of imA- and inuB-specific DNA probes Sequence comparison of the inuA and inuB genes revealed striking differences in their 3’-noncoding regions (6). These results enabled us to construct specific probes for each gene. We designed two different sets of the 20mer oligonucleotide primers to amplify the desired regions of the nonhomologous 3’-flanking sequences of the two genes by PCR (see Fig. 1A). Primer 1 (forward) (5’-AAG GGG ATT AAG ACG GTG AT-3’ corresponding to nucleotides [nt] +30 to 49 relative to the stop codon) and primer 2 (reverse) (5’-CGT TCC ACT TGA AAC ATG GA-3’ complementary to nt + 125 to 144) were derived from the inuA 3’-noncoding region. Primer 3 (forward) (5’-ATG ACG AGA GGC CCA GAG TC-3’ corresponding to nt f3 to 22) and primer 4 (reverse) (5’TGG ATA AAA CGC TAC CGG CA-3’ complementary to nt +130 to 149) were derived from the inuB 3’-noncoding region. The l.&kbp EcoRI-KpnI and 2.5kbp EcoRI-HincII fragments containing the inuA and inuB genes, respectively (6), served as templates for the cor(A) inuA

pINUll

inuB pINUll

I

1.6 kbp

I

(B) cDNA

: Adapter

sequence

(Cloatecb)

FIG. 1. Strategy for cloning the desired sequences of the A. niger endoinulinase genes. Arrows and arrowheads indicate the positions and orientations of ORFs and PCR primers, respectively. Adapter sequences and primers are not drawn to scale. E, EcoRI; P, P&I; B, BamHI; K, KgnI; H, HincII. (A) Restriction maps of genomic sequences were constructed from the inserts in plasmids pINU104 (6) and pINUll (this paper) for inuA and pINUlO7 (6) and pINUll (this paper) for inuB. Bars below each map indicate the same DNA probes used for cloning their 5’-noncoding regions. (B) Both ends of the full-length cDNA were flanked by the same adapter sequence as inverted repeats. PCRs were performed to obtain the ORF with primers 5 and 6, the 5’-noncoding regions with primers 7, 8, 9, and 10, and the 3’noncoding regions with primers 11, 7, 12, and 9.

responding pair of PCR primers. The primers amplified the predicted 115- and 147-bp fragments of the inuA and inuB 3’-noncoding regions, respectively. The two PCR products were purified and labeled with digoxigenin (DIG) by the random primer method using a DIG DNA labeling and detection kit (Boehringer) for use as inuAand inuB-specific DNA probes. Southern blots of the EcoRI-digested genomic DNAs were probed separately with the inuA- and inuB-derived DNA fragments to rule out the possibility of cross hybridization. Each probe hybridized specifically to one of the 4.0- and 6.0-kbp fragments that were previously shown to contain inuA and inuB genes, respectively (6). Poly(A)+ RNA isolation and cloning of endoinulinase cDNAs Mycelia were harvested from the 24-h-old cultures by filtration and ground to a fine powder under liquid nitrogen. Total RNA was isolated from the powdered mycelium with an ISOGEN RNA isolation kit (Wako Pure Chemical Industries, Osaka) by the method of Chomczynski and Sacchi (12). Poly(A)+ RNA was isolated from total RNA with a QuickPrep Micro mRNA purification kit (Pharmacia Biotech Inc., Uppsala, Sweden) by following the manufacturer’s instructions. Reverse transcription (RT) and subsequent PCR amplifications were performed using a SMART RACE cDNA amplification kit (Clontech Laboratories Inc., Palo Alto, CA, USA). First strand cDNAs were synthesized with M-MLV reverse transcriptase (Life Technologies Inc., Gaithersburg, MD, USA) and 17-mer dT with an adapter sequence provided in the kit. The following is the same pair of primers we designed to amplify the open reading frames (ORFs) of the possible inuA and inuB cDNAs from the first-strand cDNA template (letters in bold type indicate the coding sequence): primer 5 (forward) (5’-GCT CTA GAG CCA AGA TGT TGA ATC CGA AGG TTG-3’) and primer 6 (reverse) (5’GG_GGTACCCCGTTCATTCAAGTGAAACACT CCG-3’) (see Fig. 1B). To generate XbaI and KpnI sites (underlined in the sequences above) at 5’ and 3’ ends of the amplified fragment, respectively, the additional sequences were attached to the 5’ ends of corresponding primers. The PCR product was digested with Xbal and KpnI, and cloned into the XbaI-KpnI sites of pUC18 and sequenced as described below. Mapping of 5’ and 3’ ends of endoinuhase mRNAs The 5’ and 3’ ends of the possible inuA and inuB transcripts were mapped by rapid amplification of cDNA ends (RACE) (13). The first-strand cDNAs obtained above using the RACE cDNA amplification kit contained the same adapter sequence at both ends as inverted repeats (see Fig. 1B). In RACE experiments, nested PCR was performed using the full-length cDNAs as the template. For 5’ RACE, primer 7 (forward) (UPM provided in the kit) and primer 8 (reverse) (5’-CTC GTT CAT CCA GTA CTG GTC CGG TGT-3’ complementary to nt 103 to 129 in the inuA and inuB ORFs) were used in the first PCR. The amplified fragment served as the template for the second PCR using primer 9 (forward) (NUP provided in the kit) and primer 10 (reverse) (5’-GAT GGA CGG TAA TCA TTA GAC TGC GCC3’ complementary to nt 66 to 92). For 3’ RACE, primer 11 (forward) (5’-CGG ACA AGG AGA GGC CGT CAT-3’ corresponding to nt 1422 to 1442) and primer 7 (reverse) (see above) were used in the first PCR. The amplified fragment served as the template for the second PCR using primer 12 (for-

VOL.

88,

1999

ward) (S-TGC AGT GCT GCA GTC GGT GGA-3’ corresponding to nt 1506 to 1526) and primer 9 (reverse) (see above). The 5’ and 3’ RACE products were cloned into a pCRI1 vector using the TA cloning kit (Invitrogen Co., San Diego, CA, USA) and sequenced. Nucleotide sequencing Both strands of the cloned DNA fragments were sequenced by the dideoxy chaintermination method (14) using an Applied Biosystems model 310 automated DNA sequencer. Nucleotide sequences were analyzed with the GENETYX-MAC (Software Development Co. Ltd., Tokyo) software package. Nucleotide sequence accession numbers The updated nucleotide sequences of the 2928-bp fragment containing the inuA gene and the 3429-bp fragment containing the inuB gene will appear in the DDBJ/EMBL/GenBank nucleotide sequence databases under the accession numbers AB012771 and AB012772, respectively. RESULTS Inulinase and invertase activities secreted by A. niger A. niger 12 was cultivated for 24 and 72 h on a medium containing inulin, its final hydrolysis product fructose, or the readily metabolizable substrate glucose as the carbon source. The inulinase and invertase activities secreted per gram dry weight of mycelia were compared among the culture filtrates (Table 1). Growth on inulin resulted in the highest inulinase activities of 87.6U/g in 24 h and 349 U/g in 72 h. Glucose-grown mycelia exhibited inulinase activity of 161 U/g in 72 h, higher than 54.1 U/g for fructose-grown mycelia. The low level of invertase activity was found in 72-h culture with glucose, probably due to the repression by the presence of glucose. The resulting ratio of inulinase activity to invertase activity was 67.1, suggesting that endoinulinase was predominant as compared to the exoinulinases. Thus, the A. niger inulinase activity appeared to be inducible by inulin, but insensitive to carbon catabolite repression. Expression analysis of inuA and inuB genes The expression of inuA and inuB genes was studied with transcrips from mycelia grown on a medium containing inulin, fructose, or glucose as the carbon source. Southern blot analysis of 3’ RACE products The possible inuA and inuB transcripts were expected to differ in their 3’noncoding sequences. Accordingly, a pair of the same primer was designed for 3’ RACE to amplify the inuA and inuB cDNA fragments between 3’ ends of ORFs and poly(A) tails (see Fig. 1B). The 3’ RACE products were separated by electrophoresis on a 2.0% (w/v) agarose gel, and fragments of about 300 bp were detected by ethidium bromide staining in all samples from three different cultures (Fig. 2, left panel). Southern blot analysis of the fragments with the genespecific DNA probes was performed to differentiate between inuA and inuB cDNAs (Fig. 2, middle and right TABLE

ENDOINULINASE

GENE EXPRESSION

I

I

b

FG

EtdBr

FG

inuA probe

IN A. NIGER

I

601

FG

inuB probe

FIG. 2. Southern blot analysis of the 3’-noncoding regions of the endoinulinase cDNAs with imA- and in&?-specific probes. Poly(A)’ RNA was prepared from A. niger 12 grown for 24 h in medium B containing inulin (lane I), fructose (lane F), or glucose (lane G). cDNA 3’-noncoding regions were amplified by 3’ RACE using the primers shown in Fig. 1B. Left panel, ethidium bromide (EtdBr) staining of the agarose gel; Middle and right panels, hybridization with DIG-labeled DNA probes specific for the respective 3’-noncoding regions of the inuA and inuB genes.

panels). All the three cDNA bands hybridized to the inuB probe. In contrast, hybridization signals were not detected for any of the bands with the inuA probe. While detection of transcripts by RT-PCR and hybridization was qualitative, this sensitive detection method clearly showed that only the inuB gene was transcribed regardless of the carbon source present in the culture medium. IdentiJication of cDNA sequences Sequence analysis of the inuA and inuB genes revealed the ORFs of 1548 bp encoding a protein of 516 amino acids (6). In this study, nine cDNA clones covering the entire ORFs were obtained from the fructose-grown mycelia, and all the cDNA coding sequences were identical to the inuB gene (data not shown). Comparison of the coding sequences between the cDNAs and the inuB gene confirmed the absence of introns in the ORF. In addition, 16 and 28 cDNA clones containing the 5’- and 3’-noncoding sequences, respectively, were obtained from mycelia cultivated using the three different carbon sources. Comparison of the cDNA 5’- and 3’-noncoding sequences with the genomic DNAs also showed that all the cDNA clones represented the inuB transcripts irrespective of the carbon source. The results confirmed the above observations in the Southern blot analysis of the 3’-noncoding regions of cDNAs. Transcriptional start points and polyadenylation sites of the inuB gene To localize the promoter region in the inuB 5’-noncoding sequence (see below), transcriptional start points of the inuB gene were deduced from the sequence analysis of a total of 16 independent cDNA

1. Comparison of enzyme activities in culture filtrates of A. niger 12 grown on medium with the different carbon sources=

lnulinase activity (U/g) Invertase activity (U/g) I/S ratios Mycelium dry wt. (g/l) 24h 72h 24h 72h 24h 72h 24 h 12h Inulin 87.6 349.0 30.0 24.1 2.9 14.5 3.2 25.5 Fructose 19.8 54.1 13.1 8.3 1.5 6.5 2.8 12.6 Glucose 24.6 161.0 15.3 2.4 1.6 67.1 2.8 19.6 a Results were from duplicate experiments. Enzyme production was standardized to the dry weight of mycelia for variation of growth from flask to flask. b Inulinase activity/invertase activity. Carbon source

602

AKIMOTO

TABLE

2.

Sequenceb (5’.-+3) TTTACTT TCTGCCA GCCACTC CTCACAG

ET AL.

J. BIOSCI. BIOENC~.,

Transcriptional start points of the inuB gene deduced from the cDNA clones” bp upstream from ATG 80 12 69 65

bp downstream No. of cDNA clones” from TATA box 36 44 47 51

~~TGACGAGAGGCCCAGAGTCGGTTGTTCGTTCTTCC

+57

GACAGCAATTATCCTGGCTAAAAACGGGACTCCGG~CTCCGTC~ATGTTTGTCTA~GTATTGAGT

,117 Y 0:

1 0 4 1 0

F

G

0 2 2 1

3 0 2 1

a cDNAs were prepared from RNA extracted from inulin (I)-, fructose (F)-, or glucose (G)-grown mycelia. b The first nucleotide of each transcript is underlined. c The number of clones with the indicated 5’ ends.

clones of 5’ RACE products from inulin-, fructose-, or glucose-grown mycelia. Four distinct 5’ ends of the transcripts were observed at nt -80 (A), -72 (G), -69 (A), and -65 (A) from the start codon (Table 2). There appeared to be different transcriptional start points for the carbon sources: -72 and -69 for inulin; -72, -69, and -65 for fructose; and -80, -69, and ~ 65 for glucose. Multiple transcriptional start points were also observed for several other Aspergillus genes (15, 16). The 3’ ends of the inuB transcripts were deduced from the sequence analysis of a total of 28 different cDNA clones of 3’ RACE products: 8 clones for inulin, 10 clones for fructose, and 10 clones for glucose. The inuB transcripts were polyadenylated at a total of 16 different sites from 94 to 297 bp downstream of the stop codon (Fig. 3): 8 sites from 165 to 297 bp for inulin; 7 sites from 157 to 297 bp for fructose; and 7 sites from 94 to 251 bp for glucose. The presence of at least two polyadenylation sites in Aspergillus oryzae a-amylase genes has been described for Taa-G2 at 144 and 147 bp downstream of the stop codon (17), Amyl at 118 and 133 bp, and Amy11 at 168 and 232 bp (18). In this study, analysis of the large number of cDNA clones revealed that location of the poly(A) tail was highly variable in the inuB transcripts. The consensus signal AATAAA for polyadenylation of the 3’ end of mature mRNA was usually located 10 to 30 bp upstream of the polyadenylation sites in higher eukaryotic genes (19). The polyadenylation signal was not present within the 3’-noncoding sequences of the inuB cDNAs, and its absence may permit the heterogeneity in polyadenylation sites. Cloning and nucleotide sequences of the inuA and inuB promoter regions To determine the underlying causes for the lack of inuA transcript and for the constitutive expression of inuB gene, we isolated and analyzed the 5’-noncoding regions of the inuA and inuB genes. The genomic DNA was digested with PstI and Southern blots were probed with the 648-bp DNA internal fragment of the inuB ORF (amino acid residues 41 to 256) (see Fig. 1A) prepared previously (6). The hybridization signals were observed for three distinct fragments of 0.9, 1.6, and 1.8 kbp (data not shown). The 0.9-kbp fragments were internal to the inuA and inuB ORFs. The remaining 1.8- and 1.6-kbp fragments were expected to contain their 5’-noncoding regions and were cloned into the PstI site of pUC18 to yield the plasmids pINUll and pINUll1, respectively. The nucleotide sequence analysis revealed that the plasmids pINUll and pINUll 1 contained the 1201- and 1017-bp 5’-noncoding regions of the inuA and inuB genes, respectively. Figure 4 shows a comparison of the two 5’-noncoding sequences. A high degree of homology

GTGTACCTAGTAT~CGGTAGCGTTTTATCCAGAACTAG&GGTGAC&,AGAGT~G

GTTTTCCGGC&&TGGCAGATTCACGTC~TGTC~GTGG~AATTTTTTTGGTAA t: . . 5 CAACGTTACGATA$ACTTGGATGATACAGTAAACCGCCUTATAAGCAATTAATTCAGAC

AACCCCTTAGATTGCTTATGGTGGAGGATACCCTATACTA?%AATGTATGGGAAATAUAA

+177

+237 i +297

+‘151

FIG. 3. Polyadenylation sites of the 3’-noncoding sequence of the A. niger inuB gene. Numbering on the right is relative to the A of the TGA stop codon (boxed). The polyadenylation sites of the inuB gene were deduced from the poly(A) tail of 28 different cDNA clones obtained by 3’ RACE: 8 clones for inulin (0 above the sequence), 10 clones for fructose (0 above the sequence), and 10 clones for glucose (A below the sequence). Symbols indicate the last nucleotide before putative poly(A) addition to the respective mRNA.

(92% identity) extended to nt -749 relative to the inuB start codon, and the two gaps at -701 and -405 were generated by alignment. Two pairs of direct repeats are found in the inuA 5’-noncoding sequence: a sequence 5’AGT GAG AGA CTA GTG A-3’ is partially overlapped (-428 to -413 and -417 to -402) and another sequence 5’-TAG TGA TCT CTC CGA-3’ is separated only by 4 nt (-407 to ~-393 and - 388 to - 374). In most fungal promoters sequenced so far, the selected TATA boxes were found around 30 bp upstream of the first transcriptional start point (20). Consequently, a putative TATA box in the inuB promoter region was the TATATA sequence at -- 116 relative to the start codon and 36 to 51 bp upstream of the transcriptional start points described above. A putative CCAAT sequence and its complement ATTGG, which have been observed in the regulatory regions of several fungal genes (20), were only found in inuA gene at -466 and - 150 relative to the start codon, respectively. DISCUSSION As reported previously (6), two highly homologous endoinulinase genes, inuA and inuB, in the A. niger genome must have evolved by gene duplication of a common ancestor. Several lines of evidence indicated that the inuB gene was expressed alone in the submerged culture. First, Southern blot analysis of 3’ RACE products detected the inuB transcripts from inulin-, fructose-, or glucose-grown mycelia, but not even a low level of inuA transcript. Second, the sequence data of a total of 51 cDNA clones obtained by RT-PCR showed that all the cDNA sequences were identical to the inuB gene. Third, our previous work (6) demonstrated that partial amino acid sequences of the secreted enzyme corresponded to the inuB gene product. However, both inuA and inuB genes were previously expressed in E. coli, indicating that the two cloned genes encoded the functional enzymes (6). A possible explanation for the lack of inuA transcript is that inuA represents a pseudogene defective in transcription or a copy only transcribed under specific environmental conditions that remain to be investigated. Duplicated genes have been also noted in Aspergillus awamori (21) and A. oryzae (16-18) where two or three copies of the cw-amylase gene are present. Gines et al. (18) reported that two a-amylase genes in A. oryzae were both transcribed as revealed by sequence analysis of the

ENDOINULINASE

VOL. 88, 1999

GENE EXPRESSION

-1,039

CTGGACCACGTACMCGCCGCTMCCTGGTCATCTACAACCCTA

-1,017

CTGCAGTGTGACTGCGCCACAAGATGTCAGCGCTGCGGTGAT~TCGAGCTACAGCA~AGCTGGG~TMCAGAGTC~GTTGA

****

*

IN A. NZGER

* **

*

-949

AGGACTGGCCT-GGCCGGCGCGMGATCGCGGAGACGGCCG~CTAC~C~C~~GTG---AC~CCCCMGATGAGTGGT-GM * ** ** *** * * * * **** ** * * **** ** ** * *** **

-927

AGAGGTGCCCTCTGTTGAGTCTCTMGA---CGMTGCAGCCGCCACACCTCGTGCT~ATGC~CTATACGCGACG~~ATGATCGCA

-864

ATGTGT-TGGMCAAAAACCGAGAGATACCAGTAGCCACTAGAGAGA~CTCT~GGTCTACTTG-GTAAATGTCTCMCAAAATGCC ** *** * * *** * * **** * * * * *** ***** ******

-840

ATGGCTATMGTCMGGTGTCCTMCTCGAAATACCACCG~ACTCACTCCTC-~GG--TAC~GMGCCCTGCA~GTCACCCT--A

-776

ACTACGAGCATTGTTGGTTGGAGCTATTCAGCGCCTGATTGATTCCTCTGTACTCGTATACTCGTATTCGCACCGGACTAGACTCG~ ** ***********t****************************** ***** ***************************

-755

TAAACMGCATTGTTGGrrGGAGCTATTCAGCGCCTGATTG

-686

CACGGCATCATMCCCGCCATAGCTCGGATTATGCAGAGGTACTCTCGCATAGACMCCTACATATGGTCTCTG~GCTGATACC~GAT ********************************************************** ************ **************

-673

TACGGCATCATMCCCGCCATAGCTCGGATTATGCAGAGGTACTCTCGCATAGACMCCCACATATGGTCTCCG~GCTGATACCTTMT

-596

TGATTCCAGACCGACGGACTCGTCACGGGCGMGGGCCGC~CGCGGAGCTGCTTGACMCTCCCGATCCCGTGMTATAGCGMCCACT ********** ************************** *******************al*************** ******

-583

TGATTCCAGATCGACGGACTCGTCACGGGCGMGGGCTGC~CGCGGAGCTGC~GACMCTCCCGATCCCGT~TATA--GMCCACT

-506

CTCGGTACCCGGAATCTCACCTTGCATCTCCACCTmTACC **** *********** ***** *******************

-495

CTCGTTACCCGGMTCACACCTCGCATCTCCACCTmTACCA

-416

. . ... .k. . .......... .......1,I,. ,.................................,,,, * -b GTGAGAGACTAGTGATCTCTCCGATGATTAGTGATCTCTCCGMTGMTCGGAC~GT~GTCCACCACTACCC~CGATAGMGTCTCG

-405

-----------GTG-TCTCTCCGACATTAGTGATCTCTCCGGATGMTCGGACTTAT~GTCCACCACTACCC~CGATAGMGTCTCG

-326

GCCTCACGCTCTCCCTGACACCGAGCGCGTTGTCCTTCCC~TAT~GATCTGCACGGGCGAGC~CATCGCTTCCGTATAGGCATAC *********************************************** ** ********************* *****************

-327

GCCTCACGCTCTCCCTGACACCGAGCGCGTTGTCCTTCCC~ATMCGACCTGCACGGGCGAGC~CATCAC~CCGTATAGGCATAC

-236

CTCTA~MCTGTGMTGGCTATATGACGGACMGGATCCGGGAG~~CGGG~~CMCGCTGAGCATGCGACTATCAG~ ** ************* ***************************************************

-237

CmArrMCTGTGMCGGCATATGACGGACMGGATCCGGGAG~~CGGGG~TTCMCGCCGAGCATGCMCTATCAGTm

-146

GGGAAATGlAAGGCGTCTTGGCCATGATAmATATATAGCTCGCT~CCGTGCGAGTAGATGGCTATAC~~CTGCCACTCACAGGTCT ************t**************************************************** *******************t**

-147

GGGAAATGAAAGGCGTCTTGGCCATGATAmATATATAGCTCGC~CCGTGCGAGTAGATGGC~AC~CTGCCACTCACAGG~

*** *********

****************

* **

**

***********t*********

*************

**

CTCAGAGMGTGGMTTCMGMTACCAAATTGTTCG-TTTGCTTTGTTACTCCM~ ************************* ********** ****** ***************

-57

TTCAGAGMGTGGMTTCMGMTACTAAATTGTTCGTTlTGCTCTGTTACTCCM@

**

**

* * *

*

**

********

**************

**

*********************************

********

t -56

* * * *

*

603

********

tt

**

*

t

FIG. 4. Nucleotide sequencesof the 5’-noncodingregionsof the A. niger inuA and inuB genes.Numbering on the left is relativeto the A of the ATG start codon (boxed). The 5’-noncodingsequencesof inuA (upper line) and of inuB (lower line) geneswere aligned by using the GENETYX-MAC

software package. Asterisks indicate identical nucleotides and dashed lines indicate gaps required to align nucleotide sequences.

As for the inuA 5Lnoncodingsequence,only the first 1039bp from the start codon are shown. Starch-responsive elements(TCACGGGC and GGAAATT), the CCAAT box or its complement ATTGG, and the putative TATA box, are underlined. Transcriptional by vertical arrows. Horizontal arrows above the inuA DNA sequence denote the two pairs of direct repeats. clones. Wirsel et al. (16) showed that two of the three a-amylase genes (amyl and amy3) in their A. oryzae strain were transcribed. No transcript was detectable from the third copy (amy2) by Northern blot analysis, although the ORFs and about 630 bp upstream regions of amyl and amy were identical. Likewise, the A. niger inuA transcript was not detectable under the culture conditions investigated despite the high degree of homology of the promoter sequence with that of the inuB gene. The divergence of the further upstream sequence of inuA from that of inuB may be responsible for the lack of a detectable mRNA.

cDNA

start points are denoted

Many microbial enzymes exhibiting hydrolytic activity are under dual control of induction and carbon catabolite repression by growth substrates. Interestingly, we found the octanucleotide 5’-TCACGGGC-3’ at -561 to -554 relative to the inuB start codon and the heptanucleotide 5’-GGAAATT-3’ at -182 to -176, both of which were reported to be responsible for starch induction of cw-amylase and glucoamylase genes in A. oryzue (22-24). The two starch-responsive elements are also expected to participate in inulin induction in the inuB gene. The inuB promoter region did not include a consensus binding site for the CreA repressor (5’-SYGGRG-

604

AKIMOTO

ET AL.

J. BIOSCI. BIOENG.,

3’), which was suggested to repress transcription in response to glucose (25). The absence of the CreA-binding site may be responsible for glucose-derepressed expression of the inuB gene. The use of a constitutive promoter is generally more convenient because it does not require the addition of an inducer (26). We are interested in using the inuB promoter for the development of heterologous gene expression systems in Aspergillus species. ACKNOWLEDGMENTS This study was supported in part by the project entitled “High and Ecological Utilization of Regional Carbohydrates”, through Special Coordination Funds for Promoting Science and Technology (Leading Research Utilizing Potential of Regional Science and Technology) of the Science and Technology Agency of the Japanese Government, 1998. REFERENCES 1. Vandamme, E. J. and Derycke, D. G.: Microbial inulinases: fermentation process, properties, and applications. Adv. Appl. Microbial., 29, 139-176 (1983). 2. Nakamura, T., Hoashi, S., and Nakatsu, S.: Culture conditions for inulase production by Aspergillus. Nippon Nogeikagaku Kaishi, 52, 105-l 10 (1978). (in Japanese) 3. Tomomatsu, H.: Health effects of oligosaccharides. Food Technol., 48, 61-65 (1994). 4. Nakamura, T., Kurokawa, T., Nakatsu, S., and Ueda, S.: Crystallization and general properties of an extracellular inulase from Aspergillus sp. Nippon Nogeikagaku Kaishi, 52, 159-166 (1978). (in Japanese) 5. Taylor, M. 3. and Richardson, T.: Applications of microbial enzymes in food systems and in biotechnology. Adv. Appl. Microbial., 25, 7-35 (1979). 6. Ohta, K., Akimoto, H., Matsuda, S., Toshimitsu, D., and Nakamura, T.: Molecular cloning and sequence analysis of two endoinulinase genes from Aspergillus niger. Biosci. Biotechnol. Biochem., 62,1731-1738 (1998). I. Nakamura. T.. Maruki. S.. Nakatsu. S.. and Ueda. S.: General properties ‘of an extracellular inulase (P-II) from Aspergillus sp. Nippon Nogeikagaku Kaishi, 52, 581-587 (1978). (in Japanese) 8. Nakamura, T., Nagatomo, Y., Hamada, S., Nishioo, Y., and Ohta, K.: Occurrence of two forms of extracellular endoinulinase from Aspergillus niger mutant 817. J. Ferment. Bioeng., 78, 134-139 (1994). 9. Ohta, K., Hamada, S., and Nakamura, T.: Production of high concentrations of ethanol from inulin by simultaneous saccharification and fermentation using Aspergillus niger and Saccharomyces cerevisiae. Appl. Environ. Microbial., 59, 729-733 (1993). C., Vieira, J., and Messing, J.: Improved 10. Yanisch-Perron, Ml3 phage cloning vectors and host strains: nucleotide sequences of the Ml3mp18 and pUCl9 vectors. Gene, 33, 103119 (1985). 11. Sambrook, J., Fritsch, E. F., and Maniatis, T.: Molecular clon-

12. 13.

14. 15.

16. 17.

18. 19. 20.

21.

22.

23.

24. 25.

26.

ing: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York (1989). Chomczynski, P. and Sacchi, N.: Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem., 162, 156-159 (1987). Frohman, M.A.: RACE: rapid amplification of cDNA ends, p. 28-38. In Innis, M. A., Gelfand, D. H., Sninsky, J. .I., and White, T. J. (ed.), PCR protocols: a guide to methods and applications. Academic Press, New York (1990). Sanger, F., Nicklen, S., and Coulson, A. R.: DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA, 74, 5463-5467 (1977). Nunberg, J. H., Meade, J. H., Cole G., Lawyer, F. C., McCabe, P., Schweickart, V., Tal, R., Wittman, V. P., Flatgaard, J. E., and Innis, M. A.: Molecular cloning and characterization of the glucoamylase gene of Aspergillus awamori. Mol. Cell. Biol., 4, 2306-2315 (1984). Wirsel, S., Lachmund, A., Wildbardt, G., and Ruttkowski, E.: Three n-amylase genes of Aspergillus oryzae exhibit identical intron-exon organization. Mol. Microbial., 3, 3-14 (1989). Tsukagosbi, N., Furukawa, M., Nagaba, H., Kirita, N., Tsuboi, A., and Udaka, S.: Isolation of a cDNA encoding Aspergillus oryzae Taka-amylase A: evidence for multiple related genes. Gene, 84, 319-327 (1989). Gines, M. J., Dove, M. J., and Seligy, V. L.: Aspergillus oryzae has two nearly identical Taka-amylase genes, each containing eight introns. Gene, 79, 107-117 (1989). Proudfoot, N. J. and Brownlee, G. G.: 3’ Non-coding region sequences in eukaryotic messenger RNA. Nature, 263, 211-214 (1976). Gurr, S. J., Unkles, S. E., and Kinghorn, J. R.: The structure and organization of nuclear genes of filamentous fungi, p. 93139. In Kinghorn, J. R. (ed.), Gene structure in eukaryotic microbes. IRL Press, Oxford, United Kingdom (1987). Korman, D. R., Bayliis, F. T., Barnett, C. C., Carmona, C. L., Kodama, K. H., Royer, T. J., Thompson, S. A., Ward, M., Wilson, L. J., and Berka, R. M.: Cloning, characterization, and expression of two n-amylase genes from Aspergillus niger var. awamori. Curr. Genet., 17, 203-212 (1990). Tsuchiya, K., Tada, S., Gomi, K., Kitamoto, K., Kumagai, C., and Tamura, G.: Deletion analysis of the Taka-amylase A gene promoter using a homologous transformation system in Aspergillus oryzae. Biosci. Biotechnol. Biochem., 56, 1849-1853 (1992). Hata, Y., Kitamoto, K., Gomi, K., Kumagai, C., and Tamura, G.: Functional elements of the promoter region of the Aspergillus oryzae glaA gene encoding glucoamylase. Curr. Genet., 22, 85-91 (1992). Tsukagoshi, N.: Regulation of microbial genes: basic and applied studies. Nippon Nogeikagaku Kaishi, 73, 713-721 (1999). (in Japanese) Cubero, B. and Scazzocchio, C.: Two different, adjacent and divergent zinc finger binding sites are necessary for CREAmediated carbon catabolite repression in the proline gene cluster of Asoernillus nidulans. EMBO J., 13, 407415 (1994). Davies, R. W.: Heterologous gene expression’and protein secretion in Aspergillus, p. 527-560. In Martinelli, S. D. and Kinghorn, J. R. (ed.), Aspergillus: 50 years on. Elsevier, Amsterdam (1994).