Transcriptional regulation of the gilthead seabream (Sparus aurata) interleukin-6 gene promoter

Fish & Shellfish Immunology 35 (2013) 71e78

Contents lists available at SciVerse ScienceDirect

Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi

Transcriptional regulation of the gilthead seabream (Sparus aurata) interleukin-6 gene promoter Bàrbara Castellana 1, Rubén Marín-Juez 2, Josep V. Planas* Departament de Fisiologia i Immunologia, Facultat de Biologia, Universitat de Barcelona and Institut de Biomedicina de la Universitat de Barcelona (IBUB), 08028 Barcelona, Spain

a r t i c l e i n f o

a b s t r a c t

Article history: Received 27 January 2013 Received in revised form 13 March 2013 Accepted 4 April 2013 Available online 18 April 2013

Interleukin-6 (IL-6) has been identified and characterized from several fish species and its mRNA expression is induced by pathogen-associated molecular patterns (PAMPs) and cytokines in immune cells and tissues. However, the transcriptional regulation of the IL-6 gene in fish is not well understood. In the present study, we have cloned and sequenced a 1028 bp 50 -flanking DNA region from the IL-6 gene in seabream (Sparus aurata). Sequence analysis of the seabream IL-6 promoter (sbIL-6P) evidenced the presence of a conserved TATA motif and conserved response elements for NF-kB, C/EBPb (NF-IL6), AP-1 and GRE, similar to other vertebrate IL-6 promoters. Functional characterization of sbIL-6P was performed by cloning sbIL-6P into a luciferase expression vector and by transfecting it into L6 muscle cells, a mammalian cell line shown previously to express IL-6 in response to pro-inflammatory stimuli. We show here that the activity of sbIL-6P was significantly induced by pro-inflammatory cytokines such as tumor necrosis factor alpha (TNFa), IL-6 and IL-2, as well as by lipopolysaccharide (LPS), but significantly repressed by dexamethasone. In addition, the stimulatory effects of TNFa on sbIL-6P activity appeared to be mediated by the NF-kB, p38 MAPK and JNK signaling pathways. Deletion analyses of sbIL-6P suggested that activation of sbIL-6P by TNFa and IL-6 required the presence of binding motifs present in the proximal promoter (171 to 84) whereas activation by IL-2 required binding motifs present in the distal promoter (1024 to 864). The results from this study indicate, for the first time in fish, that proinflammatory cytokines, LPS and glucocorticoids can regulate the activity of the IL-6 gene at a transcriptional level and identify important regions in its response to cytokines. Ó 2013 Elsevier Ltd. All rights reserved.

Keywords: Interleukin-6 gene Promoter activity TNFa Seabream

1. Introduction Interleukin-6 (IL-6) is a pleiotropic cytokine that plays an important role in immune homeostatic processes such as inflammation, antibody production by B cells, T cell cytotoxicity and stem cell differentiation in mammals [1e5]. In addition, IL-6 plays an active role in bone and muscle metabolism, reproduction, neoplasia and in the modulation of acute-phase protein synthesis [6e8]. IL-6 is produced by many different cell types including T and B cells [9], polymorphonuclear cells, eosinophils, monocytes, macrophages,

* Corresponding author. Departament de Fisiologia i Immunologia, Facultat de Biologia, Universitat de Barcelona, Av. Diagonal 643, 08028 Barcelona, Spain. Tel.: þ34 934039384; fax: þ34 934110358. E-mail address: [email protected] (J.V. Planas). 1 Present address: Vall d’Hebron Research Institute (VHIR), Pg. de la Vall d’Hebron 119-129, 08035 Barcelona, Spain. 2 Present address: ZF-Screens B.V., Niels Bohrweg 11, 2333 CA Leiden, The Netherlands. 1050-4648/$ e see front matter Ó 2013 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.fsi.2013.04.012

dendritic cells, thyroid cells, chondrocytes and osteoblasts, fibroblasts, endothelial cells, keratinocytes, smooth and skeletal muscle cells [10]. Furthermore, IL-6 is produced in response to a wide variety of noxious stimuli, including viral and bacterial infections [11]. In addition, glucocorticoids [12] and tumor suppressor products p53 and protein retinoblastoma (pRB) repress the transcription of the IL-6 gene [13,14]. In humans, a deficient regulation of the IL-6 gene is involved in the pathogenesis of autoimmune diseases and affects normal and leukemic hematopoiesis [15,16], stressing the immunological relevance of this cytokine. In mammals, the regulation of IL-6 gene expression occurs mainly at a transcriptional level [17], although post-transcriptional mechanisms have also been described [18,19]. The characterization of the IL-6 promoter in mammals has revealed a complex control region that can be activated by multiple signaling pathways, including STAT (STAT1, STAT3 and STAT5), p38 MAPKs/ERK and cJNK pathways [20,21]. The human IL-6 promoter contains wellconserved binding sites for NF-kB, NF-IL6 (C/EBPb) [22,23], activating protein-1 (AP-1) and also contains cAMP and glucocorticoid

72

B. Castellana et al. / Fish & Shellfish Immunology 35 (2013) 71e78

response elements (CRE and GRE, respectively), c-fos retinoblastoma control and c-fos serum-response element homology regions, and a multiple response element (MRE) that are important for the regulation of the IL-6 gene by immune-related stimuli in immune cells [24]. It has been widely demonstrated that TNFa, a proinflammatory cytokine that induces the IL-6 gene, activates NF-kB and the JNK pathway through the MAPK signaling cascade [15,16]. From an evolutionary perspective, IL-6 is a phylogenetically ancient molecule that has been conserved from fish to mammals. In fish, IL-6 has been identified and characterized from several species and its protein and gene structure is similar to its mammalian counterpart [25e29]. The recent generation of recombinant fish IL6 from two different species has provided initial support for the notion that fish IL-6, like mammalian IL-6, is a pleiotropic cytokine [30,31]. IL-6 stimulates macrophage proliferation and the expression of antimicrobial peptides in rainbow trout (Oncorhynchus mykiss) [30] as well as the expression of transcription factors that regulate T-cell differentiation and antibody production in the orange spotted grouper (Epinephelus coioides) [31]. Importantly, studies on several fish species have also shown that the expression of IL-6 in immune cells and tissues is highly induced by immune stimuli such as LPS, peptidoglycan, DNA, poly I:C and IL-1b [26e28,30]. However, very little is known regarding the transcriptional regulation of the IL-6 gene in fish and only the olive flounder (Paralichthys olivaceus) IL-6 promoter has been characterized and shown to be regulated by LPS and by the p65 subunit of NF-kB [32]. In order to better understand the transcriptional regulation of the IL-6 gene in fish by immune stimuli, we set out to identify and characterize the regulation of the promoter of the IL-6 gene in the gilthead seabream (Sparus aurata). Our results indicate that the seabream IL-6 promoter contains similar response elements to its mammalian counterpart that allows it to specifically respond to cytokines such as TNFa, IL-2 and IL-6 itself as well as glucocorticoids and LPS. 2. Material and methods 2.1. Cell culture L6 myoblasts (kindly donated by Dr. Amira Klip, the Hospital for Sick Children, Toronto, Canada) were maintained in a-MEM (Invitrogen, El Prat del Llobregat, Spain) supplemented with 10% FBS (Invitrogen) and 1% antibiotic-antimycotic solution (10,000 U/ml penicillin G, 10 mg/ml streptomycin, 25 mg/ml amphotericin B). Cells were incubated at 37  C with 5% of CO2. 2.2. Isolation and sequence analysis of the sbIL-6 promoter To identify the 50 flanking region of the sbIL-6 gene we applied a PCR-based genomic walking strategy using seabream liver genomic DNA, purified using DNAzol (Invitrogen), as template. For this purpose we used the Genome Walker kit (Clontech Labs, Inc., Palo Alto, CA) according to the manufacturer’s protocol. The genespecific primers within the 50 -UTR region of sbIL-6 gene were 50 -CCTCTCCGTCTCCCACTCCTCACCTG-30 (primer sbIL-6rev GW1, Table 1) for the initial PCR and 50 -CTGCTGCTGCTGGCAAGCACTTGTTGC-30 (primer sbIL-6rev GW2) for the nested PCR. PCR products (w1 kb), amplified using Advantage-Pol II kit (Clontech), were cloned into the pGEM-T Easy vector (Promega, Corp., Madison, WI) and sequenced in both strands with the BigDye 3.1 terminator sequencing kit (Applied Biosystems, Foster City, CA). The sbIL-6 promoter sequence was searched for putative transcription factor (TF) binding sites using the default settings of the web-based programs Transcription Elements Search System (TESS) (http://www.cbil.upenn.edu/tess) [33], Patch (http://www.gene-

Table 1 Sequences of primers used in this study. Primer name

Primer sequence (50 e30 )

sbIL-6-rev GW1 sbIL-6-rev GW2 T7 HindIIIa Sp6 MluIa PGL-revHindIIIa PGL863a PGL486a PGL171a PGL84a

CCTCTCCGTCTCCCACTCCTCA CTGCTGCTGCTGGCAAGCACTTGTT CCCAAGCTTTAATACGACTCACTATAGG GCAACGCGTATTTAGGTGACACTATAGA CCCAAGCTTCTGATGCTGAGGGCCGTC GCAACGCGTGAGACAGCAGAGATGGAAG GCAACGCGTCGTTACATTGTAAACAATAG GCAACGCGTGTACAAGTACCTCAAAGTA GCAACGCGTCTTCTACTTCATGCCTG

a

The sequences of the MluI and HindIII sites are indicated in bold.

regulation.com/cgi-bin/pub/programs/patch), Transfact (http:// transfact.gbf.de/programs.htlm) and MatInspector software [34]. In order to find the predicted transcription start site (TSS) and the TATA box in sbIL-6P we used the web-based programs http://www. fruitfly.org/seq_tools/promoter.html [35] and (http://zeus2.itb.cnr. it/wwebgene/wwwHC_tata.html), respectively. 2.3. Generation of luciferase reporter gene constructs An approximately 1 kb-long MluI-HindIII DNA fragment (1028 to þ68) of the sbIL-6 promoter (sbIL-6P) was ligated to the pGL3Basic vector, previously digested with MluI and HindIII, to allow transcription of the firefly (Photinus pyralis) luciferase gene under the control of sbIL-6P. The resulting plasmid corresponding to the parental sbIL-6P (pGL3-sbIL-6P) was subjected to unidirectional deletions by PCR using primers that incorporate the MluI and HindIII sites (Table 1) to make a series of deletion constructs. The deletion constructs were sequenced and confirmed to have correct sequences and were used to study the transcriptional functionality of sbIL-6P. Four serial deletion constructs, ranging from 864 to 84 bp relative to the TSS, were generated (Fig. 7A): (1) sbIL-6P864 (864 to þ64), that comprises the first 864 bp from the predicted TSS of the promoter sequence and excluding two GR, two AP-1 and one GATA responsive element from the most distal 164 bp; (2) sbIL-6P-483 (483 to þ64), that comprises the first 483 bp, including the entire predicted MRE and the C/EBPb binding site; (3) sbIL-6P-171 (171 to þ64), that comprises part of the MRE and the predicted AP-1 and NF-kB binding sites and (4) sbIL-6P-84, that comprises only the TATA box. A promoterless luciferase reporter vector, pGL3-Basic (Promega), was used in the course of these studies as a negative control. The pRL-TK expression plasmid, containing the sea pansy (Renilla reniformis) gene under control of an SV40 promoter, was also used as an internal control for transfection efficiency (Promega). A reporter pGL3-Control vector (firefly luciferase gene under the control of the SV40 promoter) was used as a positive control of luciferase luminescence (Promega). The human IL-6 promoter parental plasmid (pIL6-Luc651), containing 651 bp of the human IL-6 promoter (kindly provided by Dr. Oliver Eickelberg, Department of Medicine II, University of Giessen, Giessen, Germany) was used as a positive control and for comparison of activity levels with sbIL-6P. 2.4. Transient transfections and luciferase assays For the luciferase assays, approximately 6  104 L6 myoblasts, previously shown by our laboratory to express IL-6 in response to hTNFa [36], were seeded onto 24-well plates, cultured overnight under 5% CO2 at 37  C and transfected with the plasmids described above (1 mg/well) using the Lipofectamine2000Ô reagent (Invitrogen), according to the manufacturer’s protocol. Briefly, cells were plated at 90% confluence and cultured overnight with a-MEM

B. Castellana et al. / Fish & Shellfish Immunology 35 (2013) 71e78

73

Fig. 1. Seabream (Sparus aurata) IL-6 promoter sequence. A) The seabream IL-6 promoter sequence is shown with corresponding numbers relative to the TSS, which is indicated by an arrow. Sequences underlined contain consensus binding sites to known transcription factors. B) A schematic comparison of the IL-6 promoters of seabream (Sparus aurata), human (Homo sapiens) and chicken (Gallus gallus) is shown, showing the different transcription factor binding sites present in each. GRE, glucocorticoid response element, PRE, progesterone response element; AP-1, activating protein-1, SRE, serum response element, RCE, retinoblastoma control element.

containing 10% FBS without antibiotics at 37  C. Lipofectamine2000 reagent were mixed with a-MEM without FBS/antibiotics (4.5 ml/150 ml medium), incubated for 5 min at room temperature, combined with construct DNA (1.5 mg/150 ml for pGL3 and 0.5 mg/ 150 ml for pRL-TK) and further incubated for 20e30 min at room temperature. Cells were washed once with PBS and a total of 100 ml

of DNA-Lipofectamine2000 reagent mixture was added to each well (in triplicate) and incubated for 2e4 h under 5% CO2 at 37  C. After this period, 250 ml of a-MEM-20% FBS without antibiotics were added to each well. Cells were incubated for 24 h and observed for evidence of cytotoxicity under the microscope. After transfection, cells were cultured in the absence or presence of

74

B. Castellana et al. / Fish & Shellfish Immunology 35 (2013) 71e78

sbIL-6P activity (fold change over control)

2 *

*

*

1,5

*

*

10

1

*

*

1

0,5

0 Control

10

50

100

1

TNFα IL-6 Cytokine (ng/ml)

10

IL-2

Fig. 2. Effects of cytokines on the activity of the seabream (Sparus aurata) IL-6 promoter (sbIL-6P) in L6 cells. Activity of a luciferase reporter gene driven by the sbIL-6P (1 kb to þ68 bp) in L6 cells. Following transfection of L6 cells with the promoter construct, cells were cultured in a-MEM-10% FBS in the absence (control) or presence of recombinant human TNFa (10, 50 and 100 ng/ml), recombinant rat IL-6 (1 and 10 ng/ ml) and recombinant human IL-2 (1 and 10 ng/ml). Luciferase activity in cell lysates was measured and expressed relative to the activity of untreated cells and shown as fold increase over control, which was set to 1. Data are the mean  SE of five independent experiments performed in triplicate. * Statistically significant differences from control by one-way ANOVA followed by Tukey’s post-hoc test (P < 0.05).

A

Fig. 4. Effects of lipopolysaccharide (LPS) and the phorbol ester phorbol-12-myristate13-acetate (PMA) on the activity of the seabream (Sparus aurata) IL-6 promoter (sbIL6P) in L6 cells. Activity of sbIL-6P under basal conditions or stimulated by LPS alone (10 ng/ml) or LPS plus PMA (10 ng/ml). Results are shown as fold induction over control (i.e. sbIL-6P activity under basal conditions). Each bar represents the mean  SE of three independent experiments, each performed in triplicate. Different letters denote statistically significant differences (P < 0.05 between control and LPS and P < 0.01 between LPS alone and LPS þ PMA) among groups by one-way ANOVA followed by Tukey’s post-hoc test.

IL-6 promoter activity (RLU)

15

recombinant human TNFa (hTNFa; 10, 50 and 100 ng/ml), recombinant rat IL-6 (rIL-6; 1 and 10 ng/ml) (R&D systems, USA), recombinant human IL-2 (hIL-2; 1 and 10 ng/ml), LPS (10 ng/ml) and the phorbol ester phorbol-12-myristate-13-acetate (PMA; 10 ng/ ml) (Sigma) for 20 h. For the time-course experiments, we transfected L6 myoblasts with the pGL3-sbIL-6P construct and exposed cells to hTNFa (50 ng/ml), rIL-6 (10 ng/ml) and hIL-2 (10 ng/ml) for 6, 12 and 20 h. Subsequently, cells were analyzed for firefly and R. reniformis luciferase activity using the Dual-Luciferase Reporter Assay System (Promega). Cells were lysed and 20 ml of the resulting lysate were transferred to a white 96-well plate (Cultek) and luciferase activity was measured in an Infinite M200 luminometer

10

5

0 Seabream

Human

B

IL-6 promoter activity (fold change over control)

2,5

2

Seabream Human

B

B

b

b

B ab

1,5 a

A

1

0,5

0

0

10

50

100

TNFα (ng/ml) Fig. 3. Comparison of the activity of the seabream (Sparus aurata) and human (Homo sapiens) IL-6 promoters in L6 cells. A) Comparison of the basal activity of seabream and human IL-6 promoters in L6 cells. Results are expressed in relative luciferase units (RLU). B) Comparison of the response to recombinant human TNFa stimulation of the seabream and human IL-6 promoters in L6 cells. Results are shown as fold change over control (i.e. non-stimulated L6 cells). RLU, relative luciferase units. Each bar represents the mean  S.E. of three independent experiments, each performed in triplicate. Different letters (lower case for seabream and upper case for human) denote statistically significant (P < 0.01) differences among groups by one-way ANOVA followed by Tukey’s post-hoc test.

Fig. 5. Effects of dexamethasone (DEX) on the activity of the seabream (Sparus aurata) IL-6 promoter (sbIL-6P) in L6 cells. Activity of sbIL-6P (A) and sbIL-6P-483 (B) in L6 cells transiently transfected with either construct and stimulated with recombinant human TNFa (50 ng/ml), DEX (100 ng/ml) or TNFa þ DEX for 20 h. Results are shown as fold change over control. Each bar represents the mean  SE of three independent experiments, each performed in triplicate. Different letters denote statistically significant (P < 0.05) differences among groups by one-way ANOVA followed by Tukey’s post-hoc test.

B. Castellana et al. / Fish & Shellfish Immunology 35 (2013) 71e78

75

sbIL-6P activity (fold change over control)

3,0 b

2,5

2,0 a 1,5

a a

a

1,0 0,5 0 -

+ -

+ + -

+ + -

+ +

TNF BAY 11-7082 SB 220025 SP 600125

Fig. 6. Effects of specific inhibitors of the NF-kB (Bay 11-7082), p38 MAPK (SB 220025) and JNK (SP 600125) pathways on the TNFa-stimulated activity of the seabream (Sparus aurata) IL-6 promoter (sbIL-6P) in L6 cells. Activity of sbIL-6P in L6 cells transiently transfected with the parental construct and stimulated with recombinant human TNFa (50 ng/ml) in the absence or presence of the inhibitors. Cells were treated with vehicle (DMSO), Bay 11-7082 (1 mM), SB 220025 (1 mM) and SP 600125 (1 mM) for 1 h before stimulation with rhTNFa for 20 h. Control cells were treated with the same amount of DMSO. Results are shown as fold change over control. Each bar represents the mean  SE of four independent experiments, each performed in triplicate. Different letters denote statistically significant (P < 0.01) differences among groups by one-way ANOVA followed by Tukey’s post-hoc test.

(Tecan). The level of firefly luciferase activity was normalized to that of R reniformis luciferase activity for each transfection. The inhibitors BAY 11-7082, that inhibit the phosphorylation of IkBa and consequently block the degradation of the NF-kB inhibitor IkB protein; SB 220025, an inhibitor of p38 MAPK, and SP 600125, an inhibitor of JNK (Calbiochem) were initially dissolved in DMSO and used at a final concentration of 1 mM. Cells were incubated with the inhibitors alone at the concentration of 1 mM to determine that no effect was produced in any of the parameters measured. Cells were preincubated with the inhibitors for 1 h at 37  C and then incubated in the absence or presence of hTNFa (50 ng/ml for sbIL6P and 10 ng/ml for the human IL-6 promoter) for 20 h, conditions shown previously by our laboratory to be effective in blocking the NF-kB, p38 MAPK and JNK pathways activated by hTNFa in L6 cells [36]. Control cells were treated with the same amount of DMSO. 2.5. Statistical analyses Differences in continuous variables between groups were analyzed for statistical significance with one-way analysis of variance (ANOVA) followed by Tukey’s post-hoc test, using PASW 18 software (Chicago, IL, USA). When the variance was not homogenous we used the non-parametric ManneWhitney U test. Results are expressed as means  SE of at least three independent experiments and differences were considered to be significant when P < 0.05. 3. Results 3.1. Sequence analysis of the 50 flanking region of the seabream IL-6 gene A genomic DNA fragment of approximately 1 kb corresponding to the 50 flanking region of the sbIL-6 gene was obtained. Fig. 1A shows the sbIL-6P sequence with the essential features annotated. A putative TSS in sbIL-6P could be mapped to an adenine 26 bp downstream to the TATA box (Fig. 1A). Sequence analysis revealed the presence of

Fig. 7. Effects of serial deletions of the 50 -flanking region of the seabream IL-6 gene on basal and cytokine-induced activity of the seabream (Sparus aurata) IL-6 promoter (sbIL-6P) in L6 cells. Different deletions of the 50 -flaking region from 1 kb to 84 bp relative to the transcription start site (TSS) were transiently transfected into L6 cells. (A) Schematic diagram of the deletion mutants with the main cis-acting elements marked and with the basal activity levels of the different deletion mutants. Results are shown as fold change over sbIL-6P-84 activity. Each bar represents the mean  SE of three independent experiments, each performed in triplicate. Different letters denote statistically significant (P < 0.01) differences among groups using Mann Whitney test. (B) Activity of the different deletion mutants of sbIL-6P in transfected L6 cells incubated in the absence or presence of recombinant human TNFa (50 ng/ml), recombinant human IL-2 (10 ng/ml) and recombinant rat IL-6 (10 ng/ml) for 20 h. Results are shown as fold induction over control. Each bar represents the mean  SE of three independent experiments, each performed in triplicate. * Statistically significant differences from control by one-way ANOVA followed by Tukey’s post-hoc test (P < 0.05).

a canonical TATA box (TATAAAA) at position 33 to 26 relative to the TSS that appears to be well conserved among vertebrate IL-6 promoters (Fig. 1B) [37e39]. Although the 50 flanking region of the human IL-6 gene is known to be GC-rich, the sbIL-6P sequence was rich in AT content (57%); however, we found two important GC-rich regions named Sp1 in the proximal sbIL-6P sequence. Screening of the sbIL-6P sequence for TF consensus binding sites using TRANSFACT/MatInspector 2.2 [40] and TFSearch 1.3 [41] revealed the presence of many common consensus binding sites for TFs typical in vertebrate IL-6 promoters, including NF-IL6 or C/EBPb (180 to 171; consensus sequence T(T/G)NNGNAA(T/G)), NFAT (189 to 181; TGAAAATA), CREBd (93 to 85; consensus sequence GTGACGT(A/ C)(G/A)), NF-kB (58 to 48; consensus sequence GGGRNNYYCCGGAAATCCC), AP-1 (93 to 86; consensus sequence T(G/N)A(G/N) TC(A/N)), HSE-1 (195 to 189), GATA-1/3 (606 to 593; 312 to 299; consensus sequence CTGAAGAATA) and glucocorticoid and progesterone response elements (GRE/PRE, respectively) (761 to 749; 528 to 514; consensus sequence TGTTCANNNTGTTCT, GGATACANNNTGTTCT) in the distal cluster. However, only consensus

76

B. Castellana et al. / Fish & Shellfish Immunology 35 (2013) 71e78

binding sites for NF-kB and MRE were found in similar locations in the human and seabream IL-6 promoters (Fig. 1B). 3.2. Transcriptional regulation of the sbIL-6 promoter by cytokines in L6 cells In order to study the regulation of the sbIL-6 gene, we initially examined the time-dependent activation of the sbIL-6 promoter by cytokines using this heterologous system. Maximal induction of sbIL-6P activity by the tested cytokines was significant (P < 0.01) after 20 h of incubation (data not shown) and this incubation time was chosen for subsequent experiments. We next evaluated the dose-dependent activation of sbIL-6P by transfecting L6 myoblasts and incubating cells with various concentrations of hTNFa (10, 50 and 100 ng/ml), rIL-6 (1 and 10 ng/ml) and hIL-2 (1 and 10 ng/ml) for 20 h. Our results show that all the concentrations tested of hTNFa, rIL-6 and hIL-2 had a significant stimulatory effect on sbIL6P activity (Fig. 2). These data show that the necessary regulatory elements for the activation of sbIL-6P by cytokines are present in the 1 kb promoter fragment analyzed. As a control, we compared the basal and the hTNFa-induced activity of sbIL-6P with that of the human IL-6 promoter construct (PIL-6-LUC651, [42]) in L6 cells. Although the basal activity of the human IL-6 promoter was higher (approximately 5-fold) than that of the seabream promoter (Fig. 3A), the response of the two promoters to a range of concentrations of hTNFa was similar (Fig. 3B). In addition to cytokines, we also investigated the activation of sbIL-6P by LPS in L6 cells. We stimulated L6 cells with LPS (10 ng/ml) in the absence or presence of the phorbol ester PMA (10 ng/ml) and measured sbIL-6P activity. As we show in Fig. 4, LPS strongly induced sbIL-6P activity (1.6-fold over non-stimulated cells, P < 0.01) and, when in combination with PMA, caused a 2.3-fold induction (P < 0.01) relative to non-stimulated transfected cells (Fig. 4). In view of the known anti-inflammatory effects of glucocorticoids, we also investigated the effects of dexamethasone (100 ng/ml), a synthetic glucocorticoid, on the activity of sbIL-6P in the absence or presence of hTNFa (50 ng/ml). In contrast to the stimulatory effects of cytokines, LPS and PMA, dexamethasone significantly (P < 0.01) inhibited the basal and hTNFa-induced sbIL-6P activity in L6 cells (Fig. 5A). Taken together, our results show that sbIL-6P activity in L6 cells is induced by cytokines such as TNFa, IL-2 and IL-6, as well as by LPS and PMA, and is inhibited by dexamethasone. 3.3. Intracellular signaling pathways involved in the activation of sbIL-6P by TNFa Next, we investigated the signaling pathways used by hTNFa to activate sbIL-6P. Treatment of L6 cells with the NF-kB, p38 MAPK and JNK inhibitors resulted in a significant loss of sbIL-6P activation by hTNFa (P < 0.001) (Fig. 6). Similarly, hTNFa significantly blocked the activity of the human IL-6 promoter (P < 0.001) (Supplementary Fig. 1). None of the inhibitors tested affected the basal activity of sbIL-6P (Supplementary Fig. 2). 3.4. Identification of cis-regions important for basal and cytokineinduced activation of the sbIL-6 promoter To define the function of the 50 -upstream region of the seabream IL-6 gene, we investigated the effects of sequential 50 deletions on the activity of sbIL-6P in L6 cells. First, we examined the basal activity of the various sbIL-6P deletion constructs. The basal activity in all the deletion constructs, with the exception of the sbIL-6P-84 construct, was higher than the parental pGL3b-sbIL-6P construct (Fig. 7A). The highest promoter activity was observed with the sbIL6P-171 construct, which contains only the predicted proximal

NF-kB, AP-1 and CRE binding sites. Deleting nucleotides from 171 to 84 caused a significant decrease (nearly a 30-fold reduction) in luciferase activity. In order to identify the regions important in sbIL-6P for its response to cytokines, we investigated the activity of the various deletion constructs under hTNFa (50 ng/ml), hIL-2 (10 ng/ml) or rIL-6 (10 ng/ml) stimulation (Fig. 7B). In all the deletion constructs, with the exception of sbIL-6P-84, hTNFa induced luciferase activity at a similar extent (approximately 1.5 fold-increase over the nonstimulated control, P < 0.01). Similarly, rIL-6 significantly stimulated (P < 0.01) the activity of all the sbIL-6P deletion constructs, with the exception of sbIL-6P-84. However, hIL-2 only induced the activity of the parental sbIL-6P construct, suggesting that IL-2 cis responsive elements in the sbIL-6P may be distally located in the region comprised between 1027 and 864 bp. In view of the strong inhibition of the activity of sbIL-6P by dexamethasone (Fig. 5A), we examined the effects of dexamethasone on the activity of sbIL-6P-483, a deletion construct lacking the predicted GREs in sbIL-6P. Surprisingly, dexamethasone inhibited sbIL-6P-483 activity to similar levels than the parental sbIL-6P (Fig. 5B). Therefore, deletion of nucleotides from 1028 to 483 in sbIL-6P did not result in the loss of the inhibitory effects of dexamethasone on sbIL-6P activity. 4. Discussion Characterization of the sbIL-6P sequence evidenced a complex control region with transcription binding motifs for NF-kB, AP-1, CREB, NF-IL6 (C/EBPb) and the DNA binding sites GRE and MRE, that are known to be induced by multiple signaling pathways in mammalian IL-6 promoters [20,37]. Sequence comparison of the seabream, chicken and human IL-6 promoters evidenced the presence of a conserved TATA motif and conserved response elements for NF-kB, C/EBPb (NF-IL6), AP-1 and GRE (Fig. 1B). The core promoter region of the seabream IL-6 gene showed higher homology to the human IL-6 promoter than to the chicken IL-6 promoter. Not surprisingly, however, sbIL-6P showed the highest structural similarity with the recently reported flounder IL-6 promoter [32]. Among the various TFs predicted to bind to the sbIL-6P sequence is C/EBPb/NF-IL6 [43,44]. In fact, binding sites for C/EBPb/ NF-IL6 are present in the promoter regions of numerous cytokines and other pro-inflammatory genes such as IL-12, TNFa, IL-1b, IL-8, MCP-1 and G-CSF [45e47]. The expression of C/EBP family members can be influenced by various inflammatory stimuli, some of which were used in the present study, including TNFa [48], IL-6 [44] and LPS [49], suggesting a relevant role for this transcription factor in the regulation of sbIL-6P promoter activity. In support of this idea, expression of C/EBPb was recently shown to induce the activity of the flounder IL-6 promoter [32]. Importantly, a common feature of the proximal region of all the IL-6 promoters characterized to date, including sbIL-6P, is the presence of a binding site for NF-kB. It is well established that the action of NF-kB on the IL-6 promoter mediates, in large part, the regulation of IL-6 expression by a variety of stimuli (e.g. TNFa, IL-6, LPS, PMA). In addition, sbIL-6P contains consensus binding sites for other known transcription factors, such as GATA [50], NFAT [51,52] and c-ETS-1 [53,54] that have been implicated in leukocyte-specific gene expression. In the present study, we report for the first time the transcriptional activation of a fish IL-6 gene by pro-inflammatory stimuli. Importantly, we demonstrate that pro-inflammatory cytokines such as TNFa, IL-6 and IL-2 induce the activity of sbIL-6P, as it was previously described for the human and mouse IL-6 promoters [20,55,56]. TNFa is one of the most important inducers of the IL-6 gene in mammals and, as shown in the present study, TNFa can

B. Castellana et al. / Fish & Shellfish Immunology 35 (2013) 71e78

also induce the activity of sbIL-6P when expressed in L6 cells, for lack of a suitable seabream cell line for these types of studies, and to a similar extent as the human IL-6 promoter. Using this same cell system, we previously showed that TNFa stimulates endogenous IL-6 mRNA and protein expression [36], supporting the notion that TNFa can fully regulate the expression of IL-6 at a transcriptional level in L6 cells. Therefore, L6 cells represent a useful tool to study the regulation of the expression of the sbIL-6 gene in vitro. In support of the notion that the seabream IL-6 gene is induced transcriptionally by TNFa, our laboratory has generated data showing that recombinant seabream TNFa is able to increase IL-6 mRNA levels in the seabream preosteoblastic Vsa16 cell line (Castellana and Planas, in preparation). In agreement with studies in mammals showing that TNFa can stimulate IL-6 promoter activity and IL-6 expression via the p38 MAPK, JNK and NF-kB pathways [21], our data resulting from the use of selective inhibitors of these pathways suggest that these signaling pathways may also be involved in the TNFa-induced, but not the basal, activity of sbIL-6P. Previous studies from our laboratory demonstrated that TNFa activated NF-kB and p38 MAPK in L6 cells, as was shown by the stimulation of the degradation of IkB and phosphorylation of p38 MAPK by TNFa [36]. Interestingly, mutation of the NF-kB binding site in the flounder IL-6 promoter did not affect the basal activity of the promoter but prevented its activation by LPS [32]. Therefore, these data combined support the hypothesis that, like in mammals [57], the induction of NF-kB binding activity by TNFa may contribute to the activation of the piscine IL-6 promoters and induction of IL-6 gene expression. Furthermore, our results also suggest for the first time that the p38 MAPK and JNK pathways may also be involved in the regulation of the activity of piscine IL-6 promoters by TNFa. Recent reports have shown that the expression of IL-6 in immune cells and organs in rainbow trout and orange spotted grouper is induced by homologous recombinant IL-6 [30,31]. In the present study, the induction of sbIL-6P activity by IL-6 suggests that IL-6 can also regulate the transcriptional activity of its own gene in fish. In addition, we demonstrate for the first time that IL-2 can induce the transcriptional activity of a teleost IL-6 gene. IL-2 is a cytokine with anti- and pro-inflammatory activity that is induced by IL-6 in monocytes [58]. Further studies are needed to understand the physiological relevance of the regulation of the IL-6 promoter by IL-6 and IL-2 in fish. Here, we also report on the regulation of the activity of sbIL-6P by factors other than cytokines. A strong inducer of the activity of sbIL-6P was LPS. Particularly when combined with PMA, LPS strongly increased the activity of sbIL-6P in L6 cells. These results are in agreement with previous reports on the induction of the IL-6 gene in human monocytic leukemia cells (U937) after exposure to LPS plus PMA, that was attributed to an increase in transcription factors such as NF-IL6 and other C/EBP family members [59]. Interestingly, dexamethasone repressed the basal and TNFa-induced activity of sbIL-6P in L6 cells, supporting the antiinflammatory activity of glucocorticoids in fish species [60]. The deletion analysis performed with sbIL-6P revealed a region of w200 bp (from 171 to þ64) that we define as the core promoter because it represents the minimal promoter sequence with sustained levels of luciferase activity as evidenced by the fact that removal of additional 50 sequence significantly decreased its activity. This region includes the entire NF-kB and AP-1 binding sites as well as part of the MRE (sbIL-6P-171; Fig. 7A). TNFa and IL-6 were able to induce sbIL-6P activity in all the deletion constructs except in that containing only the TATA box (i.e. sbIL-6P-84), suggesting that the essential binding motifs for the activation of sbIL6P by TNFa and IL-6 are present in the sbIL-6P-171 construct (i. e. NF-kB, AP-1, partial MRE and CRE). Interestingly, the lack of the C/EBPb (NF-IL6) site in sbIL-6P-171 had no effect on the ability of

77

TNFa and IL-6 to induce sbIL-6P activity. Further studies are clearly needed to establish the importance of the C/EBPb (NF-IL6) binding site in the regulation of sbIL-6P activity by cytokines. Nevertheless, it is tempting to speculate that the NF-kB and AP-1 binding sites, as well as the MRE within the proximal region of sbIL-6P located near the TATA box, may function as anchor sites for the basal transcriptional machinery and that they may also be involved in the regulation of sbIL-6P activity by TNFa and IL-6. In support of this hypothesis, we showed here that the presence of this particular set of binding sites in the proximal region of sbIL-6P was absolutely necessary for TNFa-induced sbIL-6P activity, as it had been reported for the human IL-6 promoter [20]. In the case of IL-2, we only observed a significant induction of sbIL-6P activity in the parental construct, suggesting the requirement of binding motifs, other than NF-kB, AP-1, CREB and C/EBPb (NF-IL6) that would be present in the distal region 1028 to 864 of sbIL-6P for the activation of sbIL-6P by IL-2. Further studies are needed to characterize the elements in sbIL-6P that confer responsiveness to IL-2. Surprisingly, the strong repression of sbIL-6 activity elicited by dexamethasone was not affected by deletion of predicted binding sites for glucocorticoids. These results suggest that regions in the proximal sbIL-6P sequence, not identified in the present study as GREs, may participate in the repression of sbIL-6P by dexamethasone. In summary, we have identified and characterized the regulation of the promoter of the IL-6 gene in seabream. Our results indicate, for the first time in teleosts, that the seabream IL-6 gene is activated transcriptionally by cytokines (e.g. TNFa, IL-2 and IL-6) and LPS and repressed by glucocorticoids. These results contribute to our understanding on the mechanisms regulating IL-6 expression in teleosts. Acknowledgments We thank Dr. Amira Klip for the rat L6 cell line and Dr. Oliver Eickelberg for the pIL-6-Luc651 construct. This study was supported by grants from the Ministerio de Educación y Ciencia, Spain (CSD2007-0002 and AGL2009-07006 to JVP). BC was supported by the Pleurogene project funded by Genoma España. RMJ was supported by a predoctoral fellowship from the Ministerio de Educación y Ciencia, Spain (FPI program). Appendix A. Supplementary data Supplementary data related to this article can be found at http:// dx.doi.org/10.1016/j.fsi.2013.04.012. References [1] Van Snick J. Interleukin-6: an overview. Annu Rev Immunol 1990;8:253e78. [2] Akira S, Hirano T, Taga T, Kishimoto T. Biology of multifunctional cytokines: IL 6 and related molecules (IL 1 and TNF). FASEB J 1990;4:2860e7. [3] Kishimoto T, Hirano T. A new interleukin with pleiotropic activities. Bioessays 1988;9:11e5. [4] Naka T, Nishimoto N, Kishimoto T. The paradigm of IL-6: from basic science to medicine. Arthritis Res 2002;4(Suppl. 3):S233e42. [5] Simpson RJ, Hammacher A, Smith DK, Matthews JM, Ward LD. Interleukin-6: structureefunction relationships. Protein Sci 1997;6:929e55. [6] Ganter U, Arcone R, Toniatti C, Morrone G, Ciliberto G. Dual control of Creactive protein gene expression by interleukin-1 and interleukin-6. EMBO J 1989;8:3773e9. [7] Heinrich PC, Horn F, Graeve L, Dittrich E, Kerr I, Muller-Newen G, et al. Interleukin-6 and related cytokines: effect on the acute phase reaction. Z Ernahrungswiss 1998;37(Suppl. 1):43e9. [8] Morrone G, Ciliberto G, Oliviero S, Arcone R, Dente L, Content J, et al. Recombinant interleukin 6 regulates the transcriptional activation of a set of human acute phase genes. J Biol Chem 1988;263:12554e8. [9] Horii Y, Muraguchi A, Suematsu S, Matsuda T, Yoshizaki K, Hirano T, et al. Regulation of BSF-2/IL-6 production by human mononuclear cells. Macrophage-dependent synthesis of BSF-2/IL-6 by T cells. J Immunol 1988;141:1529e35.

78

B. Castellana et al. / Fish & Shellfish Immunology 35 (2013) 71e78

[10] Helle M, Boeije L, Pascual-Salcedo D, Aarden L. Differential induction of interleukin-6 production by monocytes, endothelial cells and smooth muscle cells. Prog Clin Biol Res 1991;367:61e71. [11] Sehgal PB. Interleukin 6 in infection and cancer. Proc Soc Exp Biol Med (New York, NY) 1990;195:183e91. [12] Ray A, LaForge KS, Sehgal PB. On the mechanism for efficient repression of the interleukin-6 promoter by glucocorticoids: enhancer, TATA box, and RNA start site (Inr motif) occlusion. Mol Cell Biol 1990;10:5736e46. [13] Asschert JG, De Vries EG, De Jong S, Withoff S, Vellenga E. Differential regulation of IL-6 promoter activity in a human ovarian-tumor cell line transfected with various p53 mutants: involvement of AP-1. Int J Cancer 1999;81:236e42. [14] Buchmann AM, Swaminathan S, Thimmapaya B. Regulation of cellular genes in a chromosomal context by the retinoblastoma tumor suppressor protein. Mol Cell Biol 1998;18:4565e76. [15] Kamimura D, Ishihara K, Hirano T. IL-6 signal transduction and its physiological roles: the signal orchestration model. Rev Physiol Biochem Pharmacol 2003;149:1e38. [16] Ishihara K, Hirano T. IL-6 in autoimmune disease and chronic inflammatory proliferative disease. Cytokine Growth Factor Rev 2002;13:357e68. [17] Grassl C, Luckow B, Schlondorff D, Dendorfer U. Transcriptional regulation of the interleukin-6 gene in mesangial cells. J Am Soc Nephrol 1999;10: 1466e77. [18] Zhao W, Liu M, Kirkwood KL. p38alpha stabilizes interleukin-6 mRNA via multiple AU-rich elements. J Biol Chem 2008;283:1778e85. [19] Clark A. Post-transcriptional regulation of pro-inflammatory gene expression. Arthritis Res 2000;2:172e4. [20] Dendorfer U, Oettgen P, Libermann TA. Multiple regulatory elements in the interleukin-6 gene mediate induction by prostaglandins, cyclic AMP, and lipopolysaccharide. Mol Cell Biol 1994;14:4443e54. [21] Vanden Berghe W, Plaisance S, Boone E, De Bosscher K, Schmitz ML, Fiers W, et al. p38 and extracellular signal-regulated kinase mitogen-activated protein kinase pathways are required for nuclear factor-kappaB p65 transactivation mediated by tumor necrosis factor. J Biol Chem 1998;273:3285e90. [22] Akira S, Isshiki H, Nakajima T, Kinoshita S, Nishio Y, Hashimoto S, et al. A nuclear factor for the IL-6 gene (NF-IL6). Chem Immunol 1992;51:299e322. [23] Akira S, Isshiki H, Nakajima T, Kinoshita S, Nishio Y, Natsuka S, et al. Regulation of expression of the interleukin 6 gene: structure and function of the transcription factor NF-IL6. Ciba Found Symp 1992;167:47e62. [24] Vanden Berghe W, Vermeulen L, De Wilde G, De Bosscher K, Boone E, Haegeman G. Signal transduction by tumor necrosis factor and gene regulation of the inflammatory cytokine interleukin-6. Biochem Pharmacol 2000;60: 1185e95. [25] Iliev DB, Castellana B, Mackenzie S, Planas JV, Goetz FW. Cloning and expression analysis of an IL-6 homolog in rainbow trout (Oncorhynchus mykiss). Mol Immunol 2007;44:1803e7. [26] Bird S, Zou J, Savan R, Kono T, Sakai M, Woo J, et al. Characterisation and expression analysis of an interleukin 6 homologue in the Japanese pufferfish, Fugu rubripes. Dev Comp Immunol 2005;29:775e89. [27] Nam BH, Byon JY, Kim YO, Park EM, Cho YC, Cheong J. Molecular cloning and characterisation of the flounder (Paralichthys olivaceus) interleukin-6 gene. Fish Shellfish Immunol 2007;23:231e6. [28] Castellana B, Iliev DB, Sepulcre MP, MacKenzie S, Goetz FW, Mulero V, et al. Molecular characterization of interleukin-6 in the gilthead seabream (Sparus aurata). Mol Immunol 2008;45:3363e70. [29] Varela M, Dios S, Novoa B, Figueras A. Characterisation, expression and ontogeny of interleukin-6 and its receptors in zebrafish (Danio rerio). Dev Comp Immunol 2012;37:97e106. [30] Costa MM, Wang T, Monte MM, Secombes CJ. Molecular characterization and expression analysis of the putative interleukin 6 receptor (IL-6Ralpha and glycoprotein-130) in rainbow trout (Oncorhynchus mykiss): salmonid IL6Ralpha possesses a polymorphic N-terminal Ig domain with variable numbers of two repeats. Immunogenetics 2012;64:229e44. [31] Chen HH, Lin HT, Foung YF, Han-You Lin J. The bioactivity of teleost IL-6: IL-6 protein in orange-spotted grouper (Epinephelus coioides) induces Th2 cell differentiation pathway and antibody production. Dev Comp Immunol 2012;38:285e94. [32] Kong HJ, Nam BH, Kim YO, Kim WJ, Cho HK, Lee CH, et al. Characterization of the flounder IL-6 promoter and its regulation by the p65 NF-kappaB subunit. Fish Shellfish Immunol 2012;28:961e4. [33] Schug J. Using TESS to predict transcription factor binding sites in DNA sequence. Curr Protoc Bioinform 2008;21. 2.6.1e2.6.15. [34] Cartharius K, Frech K, Grote K, Klocke B, Haltmeier M, Klingenhoff A, et al. MatInspector and beyond: promoter analysis based on transcription factor binding sites. Bioinformatics (Oxford, England) 2005;21:2933e42. [35] Reese MG. Application of a time-delay neural network to promoter annotation in the Drosophila melanogaster genome. Comp Chem 2001;26:51e6.

[36] Roher N, Samokhvalov V, Diaz M, MacKenzie S, Klip A, Planas JV. The proinflammatory cytokine tumor necrosis factor-alpha increases the amount of glucose transporter-4 at the surface of muscle cells independently of changes in interleukin-6. Endocrinology 2008;149:1880e9. [37] Tanabe O, Akira S, Kamiya T, Wong GG, Hirano T, Kishimoto T. Genomic structure of the murine IL-6 gene. High degree conservation of potential regulatory sequences between mouse and human. J Immunol 1988;141:3875e81. [38] Droogmans L, Cludts I, Cleuter Y, Kettmann R, Burny A. Nucleotide sequence of the bovine interleukin-6 gene promoter. DNA Seq 1992;3:115e7. [39] Premraj A, Sreekumar E, Nautiyal B, Rasool TJ. Molecular characterization and prokaryotic expression of buffalo (Bubalus bubalis) Interleukin-6. Mol Immunol 2006;43:202e9. [40] Wingender E, Chen X, Hehl R, Karas H, Liebich I, Matys V, et al. TRANSFAC: an integrated system for gene expression regulation. Nucleic Acids Res 2000;28: 316e9. [41] Heinemeyer T, Wingender E, Reuter I, Hermjakob H, Kel AE, Kel OV, et al. Databases on transcriptional regulation: TRANSFAC, TRRD and COMPEL. Nucleic Acids Res 1998;26:362e7. [42] Eickelberg O, Pansky A, Mussmann R, Bihl M, Tamm M, Hildebrand P, et al. Transforming growth factor-beta1 induces interleukin-6 expression via activating protein-1 consisting of JunD homodimers in primary human lung fibroblasts. J Biol Chem 1999;274:12933e8. [43] McNagny KM, Sieweke MH, Doderlein G, Graf T, Nerlov C. Regulation of eosinophil-specific gene expression by a C/EBP-Ets complex and GATA-1. EMBO J 1998;17:3669e80. [44] Akira S, Isshiki H, Sugita T, Tanabe O, Kinoshita S, Nishio Y, et al. A nuclear factor for IL-6 expression (NF-IL6) is a member of a C/EBP family. EMBO J 1990;9:1897e906. [45] Goethe R, Phi-van L. Evidence for an enhanced transcription-dependent de novo synthesis of C/EBPbeta in the LPS activation of the chicken lysozyme gene. J Leukoc Biol 1997;61:367e74. [46] Bretz JD, Williams SC, Baer M, Johnson PF, Schwartz RC. C/EBP-related protein 2 confers lipopolysaccharide-inducible expression of interleukin 6 and monocyte chemoattractant protein 1 to a lymphoblastic cell line. Proc Natl Acad Sci U S A 1994;91:7306e10. [47] Goethe R, Loc PV. The far upstream chicken lysozyme enhancer at -6.1 kilobase, by interacting with NF-M, mediates lipopolysaccharide-induced expression of the chicken lysozyme gene in chicken myelomonocytic cells. J Biol Chem 1994;269:31302e9. [48] Yin M, Yang SQ, Lin HZ, Lane MD, Chatterjee S, Diehl AM. Tumor necrosis factor alpha promotes nuclear localization of cytokine-inducible CCAAT/enhancer binding protein isoforms in hepatocytes. J Biol Chem 1996;271:17974e8. [49] Spooner CJ, Sebastian T, Shuman JD, Durairaj S, Guo X, Johnson PF, et al. C/ EBPbeta serine 64, a phosphoacceptor site, has a critical role in LPS-induced IL-6 and MCP-1 transcription. Cytokine 2007;37:119e27. [50] Yang D, Suzuki S, Hao LJ, Fujii Y, Yamauchi A, Yamamoto M, et al. Eosinophilspecific regulation of gp91(phox) gene expression by transcription factors GATA-1 and GATA-2. J Biol Chem 2000;275:9425e32. [51] Symes A, Gearan T, Fink JS. NFAT interactions with the vasoactive intestinal peptide cytokine response element. J Neurosci Res 1998;52:93e104. [52] Torgerson TR, Colosia AD, Donahue JP, Lin YZ, Hawiger J. Regulation of NF-kappa B, AP-1, NFAT, and STAT1 nuclear import in T lymphocytes by noninvasive delivery of peptide carrying the nuclear localization sequence of NF-kappa B p50. J Immunol 1998;161:6084e92. [53] Grenningloh R, Kang BY, Ho IC. Ets-1, a functional cofactor of T-bet, is essential for Th1 inflammatory responses. J Exp Med 2005;201:615e26. [54] Grenningloh R, Miaw SC, Moisan J, Graves BJ, Ho IC. Role of Ets-1 phosphorylation in the effector function of Th cells. Eur J Immunol 2008;38:1700e5. [55] Chen BC, Liao CC, Hsu MJ, Liao YT, Lin CC, Sheu JR, et al. Peptidoglycan-induced IL-6 production in RAW 264.7 macrophages is mediated by cyclooxygenase-2, PGE2/PGE4 receptors, protein kinase A, I kappa B kinase, and NF-kappa B. J Immunol 2006;177:681e93. [56] Robb BW, Hershko DD, Paxton JH, Luo GJ, Hasselgren PO. Interleukin-10 activates the transcription factor C/EBP and the interleukin-6 gene promoter in human intestinal epithelial cells. Surgery 2002;132:226e31. [57] Libermann TA, Baltimore D. Activation of interleukin-6 gene expression through the NF-kappa B transcription factor. Mol Cell Biol 1990;10:2327e34. [58] Musso T, Espinoza-Delgado I, Pulkki K, Gusella GL, Longo DL, Varesio L. IL-2 induces IL-6 production in human monocytes. J Immunol 1992;148:795e800. [59] Natsuka S, Akira S, Nishio Y, Hashimoto S, Sugita T, Isshiki H, et al. Macrophage differentiation-specific expression of NF-IL6, a transcription factor for interleukin-6. Blood 1992;79:460e6. [60] MacKenzie S, Iliev D, Liarte C, Koskinen H, Planas JV, Goetz FW, et al. Transcriptional analysis of LPS-stimulated activation of trout (Oncorhynchus mykiss) monocyte/macrophage cells in primary culture treated with cortisol. Mol Immunol 2006;43:1340e8.