Transcriptome analysis of tube foot and large scale marker discovery in sea cucumber, Apostichopus japonicus

Comparative Biochemistry and Physiology, Part D 20 (2016) 41–49

Contents lists available at ScienceDirect

Comparative Biochemistry and Physiology, Part D journal homepage: www.elsevier.com/locate/cbpd

Transcriptome analysis of tube foot and large scale marker discovery in sea cucumber, Apostichopus japonicus Xiaoxu Zhou a,b,1, Hongdi Wang b,1, Jun Cui b,1, Xuemei Qiu a,b, Yaqing Chang a,b, Xiuli Wang a,b,⁎ a b

Key Laboratory of Mariculture & Stock Enhancement in North China's Sea, Ministry of Agriculture, Dalian Ocean University, Dalian 116023, China College of Fisheries and Life Science, Dalian Ocean University, 52 Heishijiao Street, Shahekou District, Dalian 116023, China

a r t i c l e

i n f o

Article history: Received 27 April 2016 Received in revised form 14 July 2016 Accepted 22 July 2016 Available online 04 August 2016 Keywords: Sea cucumber (Apostichopus japonicus) Tube foot Transcriptome analysis qRT-PCR Large scale molecular markers

a b s t r a c t Tube foot as one of the ambulacral appendages types in Aspidochirote holothurioids, is known for their functions in locomotion, feeding, chemoreception, light sensitivity and respiration. In this study, we explored the characteristic of transcriptome in the tube foot of sea cucumber (Apostichopus japonicus). Our results showed that among 390 unigenes which specifically expressed in the tube foot, 190 of them were annotated. Based on the assembly transcriptome, we found 219,860 SNPs from 34,749 unigenes, 97,683, 53,624, 27,767 and 40,786 were located in CDSs, 5′-UTRs, 3′-UTRs and non-CDS separately. Furthermore, 12,114 SSRs were detected from 7394 unigenes. Target genes of four specifically expressed miRNAs (miR-29a, miR-29b, miR-278-3p and miR-2005) in tube foot were also predicted based on the transcriptome, which contain immune-related factors (MBL, VLRA, AjC3, MyD88, CFB), skin pigmentation (MITF), candidate regeneration factor (TRP) and holothurians autolysis-related factor (CL). These results develop a relatively large number of molecular markers and transcriptome resources, and will provide a foundation for further analyses on the function and molecular mechanisms underlying A. japonicas tube foot. © 2016 Elsevier Inc. All rights reserved.

1. Introduction Sea cucumber, Apostichopus japonicus (Echinodermata, Holothuroidea), with rich nutritional value and high medicinal properties, naturally distributes along the coasts of China, Japan, Korea and far Russia of Northeast Asia (Chang et al., 2009; Sloan, 1984). Tube foot with the morphology of tubular projections is the unique hydraulic structures and varies greatly among the diverse classes of echinoderms (Diaz-Balzac et al., 2010a). It covers with the abdominal of sea cucumber with functions in locomotion, feeding, chemoreception, light sensitivity and respiration (Lesser et al., 2011). Though five meridional ambulacra bearing podia is presented as the pentamerous symmetry in sea cucumber (Steven et al., 2012), the tube foot are rarely arranged in five regular rows. In A. japonicus, ventral tube feet are aligned in three irregular longitudinal rows. The tube foot consisted of tiny water-filled tubes and a flat disc. The flat disc that terminated on hollow tubular projections is allows the podium to adhere to the substratum during locomotion. Recent researches about tube foot in echinoderms is mainly focus on the histological and neuroanatomical of the sea urchin and sea star (Santos et al., 2005; Lesser et al., 2011; Bronstein and Loya, 2013). In holothurians, the tube foot are differential ⁎ Corresponding author at: 52, Heishijiao Street, Shahekou District, Dalian, Liaoning 116023, China. E-mail address: [email protected] (X. Wang). 1 These authors contributed equally to this work.

http://dx.doi.org/10.1016/j.cbd.2016.07.005 1744-117X/© 2016 Elsevier Inc. All rights reserved.

from other types of podia named papillate podia, as the main type of podia and are referred to as locomotor podia (Hyman, 1955). Díaz-Balzac et al. (Diaz-Balzac et al., 2010a, 2010b) confirmed that the function of tube foot is also associated with neural signaling in Holothuria glaberrima. The immunization effort of tube foot was also investigated in sea cucumber A. japonicus (Sun et al., 2013a). In our previous study on tube foot, Wang et al. reported the identification and characterization of miRNAs in the tube foot, and four specially expressed miRNAs has been indicated (Wang et al., 2014). De novo assembled transcriptome is also a suitable data to identify miRNA targets, especially samples without reference genomes. Many researches has identification and validation various miRNA targets associated with the physiological characteristics of A. japonicus (Li et al., 2012; Zhang et al., 2013). However, as far as we know although the tube foot of A. japonicus has been well recognized on the level of histological and morphological characteristics, the study of the identification and expression analysis on the molecular biology is still lacking. Meanwhile, the molecular mechanisms underlying functions of tube foot remain largely unknown. The next-generation sequencing, based on RNA-Seq has remarkably changed the way to investigate the data of transcriptome in many organisms (Anisimov, 2008; Wang et al., 2009). RNA-Seq is powerful tool for unraveling transcriptome complexity, identification of genes, gene associated markers, regulatory non-coding RNAs and for alternative splicing analysis and transcriptome profiling. In the past several years, RNA-Seq has been widely used for differential expressed gene

42

X. Zhou et al. / Comparative Biochemistry and Physiology, Part D 20 (2016) 41–49

analysis in aquatic animals. For example, the pigmentation-related differential expression genes were obtain between two different shin color carp using RNA-Seq (Jiang et al., 2014). In addition, the molecular mechanisms of tissue difference also was identified by RNA-Seq, such as between gill and swimbladder of Takifugu rubripes and the papilla and skin of A. japonicus, respectively (Zhou et al., 2016). Recently, RNA-Seq has been widely used for identification of gene-associated markers in a variety of aquatic animals, such as Japanese fugu, Takifugu rubripes (Cui et al., 2014a, 2014b), channel catfish (Liu et al., 2011), carp (Xu et al., 2014) and salmon (Nunez-Acuna et al., 2014). Recently, some study on the RNA-Seq analyses of A. japonicus were performed immunology, histology and development (Sun et al., 2013b, 2016; Zhou et al., 2014). Besides, a number of molecular markers were obtained from A. japonicus. For example, 101 gene-based SNP markers were identified by using the High Resolution Melting (HRM) genotyping approach, and Yang et al. found 4197 SNP from 330 contigs by assembling 5728 Expressed Sequence Tags (EST), which were achieved from cDNA libraries of A. japonicus. In addition, miRNA also was a research hotspot at present. For a few years, the miRNAs mining of A. japonicus arises gradually by using high throughput sequencing. In the study of immune response mechanisms in infected skin ulceration syndrome-infected A. japonicus, 247 conserved and 10 novel miRNAs were obtained from eight libraries (Sun et al., 2016). In our previous work, 314 conserved and 27 novel miRNAs were identified in longitudinal muscle; 221 conserved and 34 novel miRNAs in respiratory tree (Wang et al., 2015); 260 conserved and 6 novel in tube foot (Wang et al., 2014), respectively. In the present study, we reported the transcriptome analysis of the tube foot in sea cucumber by RNA-Seq. A large amount of SNPs and SSRs were identified, which can be used for resource assessment, population genetic study and genome-wide association studies. Furthermore, the interaction analysis between several specifically expressed miRNAs and mRNAs in tube foot of A. japonicus is also presented in our study. This work provides a relatively large number of molecular markers and transcriptome resources, and will assist to understand the molecular mechanism of gene regulation in the tube foot of A. japonicus. 2. Materials and methods 2.1. Ethics and methods This study was approved by the Animal Care and Use Committee of the Key Laboratory of Mariculture in North China (Dalian, Liaoning). All surgery was performed under sodium pentobarbital anesthesia, and all efforts were made to minimize suffering. 2.2. Sample of sea cucumber A total of 45 sea cucumber, A. japonicus (with average weight 25 g) provided by the Key Laboratory of Mariculture in North China (Dalian, Liaoning). The tube foot of the sea cucumber were collected and pooled as previous study (Zhou et al., 2016). Tissues were placed into 2 mL of RNA later® Solution (Ambion) for overnight at 4 °C followed by transferring to −80 °C until RNA extraction. 2.3. RNA extraction and sequencing Total RNA was isolated from the tube foot tissue using the TRIzol Reagent (Invitrogen, CA, USA) following the manufacturer's instructions. The quantity and concentration of total RNA samples were determined using Agilent 2100 Bioanalyzer and 1% agarose gel electrophoresis. Libraries were prepared from the total RNA pools by the Biomarker Biotechnology Corporation (Beijing, China) including mRNA enrichment, fragment interruption, addition of

adapters, PCR amplification. RNA-Seq sequencing was performed by Illumina HiSeq 2500 for 125 bp paired-end reads.

2.4. Identification of the specifically expressed genes in tube foot The raw reads were trimmed to remove the reads with low quality, unknown nucleotides and adaptors. We used Bowtie to map the reads into the assembled reference transcriptome. The obtained sequences have been submitted to NCBI. All the clean reads were mapped to the de-novo transcriptome in our previous work (Zhou et al., 2016). In addition, the transDecoder (http://transdecoder.github.io/) was used to identify unigenes with predicted protein coding regions. To identify the unigenes specifically expressed in the tube foot, the differential expression profiles of unigenes were achieved by comparison with the data of A. japonicus papilla and skin (Zhou et al., 2016). The expression levels (FPKM, Fragments Per Kilobase of transcript per Million mapped reads) for each gene were calculated. The fold change was calculated as following formula:

Foldchange¼Log2

FPKMTubefoot FPKMTissues

where “tissues” indicates the FPKM for each of the unigenes identified in the papilla or skin. Significant candidates were predicted that had fold change N 2 or b−2 (p-value b0.05). 2.5. Identification of tube foot miRNA-mRNA networks The extracted 5′-untranslated regions (5′-UTRs) and 3′-untranslated regions (3′-UTRs) were obtained by in-house Perl script according to the predicated coding sequences (CDSs). The target genes of four significantly up-regulated miRNAs (miR-29a, miR29b, miR278-3p and miR2005), which were obtained from our previous work (Wang et al., 2014) were predicted using the sequences of tube foot transcriptome containing the extracted 5′-UTR and 3′-UTR as candidate query databases and four software including miRanda-3.3 (Enright et al., 2003), PITA (Kertesz et al., 2007) and RNAhybrid (Rehmsmeier et al., 2004), respectively. The parameters of miRanda-3.3 were “-sc 140”, “-en -17” and PITA were “-l 7-8”, while the default parameters were used in the RNAhybrid. The final potential target genes form RNA hybrid were filtered by ΔG ≦ 20. Sequences predicted by all programs were considered as potential target genes.

2.6. SNPs and SSRs identification and validation The single nucleotide polymorphisms (SNPs) and simple sequence repeats (SSR) were mined and identified by using GATK (https:// www.broadinstitute.org/gatk) and MISA (http://pgrc.ipk-gatersleben. de/misa/misa.html), respectively. At present, in order to obtain abundant information of synonymous coding SNPs (sSNPs) and nonsynonymous coding SNPs (nsSNPs), the SNPs classification were obtained by Perl script according to the predicted CDSs which including multiple predicted types of CDSs for one unigene. The unigenes larger than 1kbp were screened to performed SSR analysis. The parameters are as follows: the minimum repeat number was five for penta-, tetreand tri-nucleotides, six for di-nucleotide and ten for mono-nucleotide respectively. To evaluate the validation rate of the SNPs and SSRs identified by bioinformatics analysis, we randomly validated 36 SNPs and 14 SSRs by PCR amplification and direct sequencing (Yang et al., 2012). PCR primers were designed according to the assembled transcript sequences, and DNA of 10 individuals was used as PCR template.

X. Zhou et al. / Comparative Biochemistry and Physiology, Part D 20 (2016) 41–49

2.7. qRT-PCR validation RNA-Seq results were validated by qRT-PCR analysis of 16 randomly selected genes, which 12 of these were for target genes of microRNAs and others are for specifically expressed genes in tube foot. Primers were designed following the manufacturer's recommendations of SYBR Premix Ex TaqTM II kit (Takara, Dalian, China). The β-actin was used as housekeeping. Briefly, the amplification was performed in a total volume of 16 mL, containing 8 mL 2 × TransStart®Top Green qPCR SuperMix, 1 mL of cDNA, and 0.3 mL of 10 mM of each genespecific primer. The qRT-PCR reactions were performed on ABI StepOnePlus platform and replicated in three pools. And three technical replications were performed for each qRT-PCR validation. PCR was conducted as follows: 94 °C for 30 s, 45 cycles of 94 °C for 5 s, annealing temperature for 15 s, and 72 °C for 15 s. 3. Results and discussion 3.1. Characteristic and function analysis of sequences RNA-Seq has been accepted as a powerful approach for large-scale transcriptome profiling (Liu et al., 2013; Cui et al., 2015). In the present study, the transcriptome sequencing of the tube foot yielded over 37 million paired-end reads with 125 bp read lengths. After removal of adapter, rRNA and inferior sequences, a total of 33,976,507 cleaned reads (91.39%) were harvested as shown in Fig. 1. And unigenes with predicted ORF were shown in Supplementary Table 1. The RNA-Seq data sets of the sea cucumber tube foot have been deposited to NCBI sequence read archive (SRA) with accession numbers are SRX1097858. To further functionally annotation the transcriptome of tube foot, we filtered the information of annotation in previous study. Of all the sequences in tube foot, 16,100 showed significant matches to nr, 14,030 to Swiss-Prot, 16,090 to Pfam, 13,479 to KOG, 6108 to COG, 6130 to GO and 7389 to KEGG respectively. Altogether, 23,569 or unigenes had significant matches, at least one hit to these databases (Table 1). As shown in Fig. 2, the best hits for the large fraction of unigenes (around 43.6%) were from sea urchin (Strongylocentrotus purpuratus), which may be explained by vast genomic resources of S. purpuratus and its close evolutionary relationship to A. japonicus. In previous studies, many genes were cloned and analyzed from A. japonicus and recorded in these database. Of these unigenes identified in this study, only 143 in tube foot gained gene names form A. japonicus against kinds of database. It suggested that the limited genetic resources of A. japonicus represent a major obstacle to further research the function of this species.

Fig. 1. The distribution of clean reads.

43

Table 1 Unigenes annotation by various databases. Database

Hit number

nr Swiss-Prot Pfam KOG COG GO KEGG

16,101 14,031 16,091 13,480 6109 6131 7390

For further understanding the function of the unigenes in tube foot, GO classification was performed and the result was shown in Fig. 3. For cellular component, cell (GO: 0005623) and cell part (GO: 0044464) were the dominant terms, followed by the organelle (GO: 0044422). For molecular function, catalytic activity (GO: 0003824) was the most represented term, followed by and binding (GO: 0005488). Meanwhile, for biological process, cellular process (GO: 0009987) and metabolic process (GO: 0008152) were highly represented. We also found some function-related categories, such as locomotion, localization and establishment of localization, may be associated with the locomotion or feeding of A. japonicus. More interesting, pigmentation in biological process was found, suggesting a potential way to understand the pigmentation in the body wall of A. japonicus. Furthermore, biological adhesion term was also found in biological process. Adhesion plays an integral role holding population of cells together, and as a lubricant, allowing tissues to slide past one another (Khalili and Ahmad, 2015; Shawky and Davidson, 2015). Biological adhesion may be associated with the locomotion of tube foot. Further studies on these several function-related categories may warrant the dissection of the molecular mechanism in the tube foot of sea cucumber. 3.2. Identification of gene-associated markers Due to the stability and extensive distribution of microsatellite marker (SSR) along genomes and transcriptomes, SSRs are still widely used in genetics and biology researches. In the present study, a total of 12,114 SSRs were explored in 7394 unigenes, 3819 (51.65%) of which was annotated. The amount of SSRs can be increased by almost double than that of in the previous research of A. japonicus (Zhou et al., 2014) (6417 SSRs were detected in 5970 unigenes). Following the mononucleotide (9153), di-nucleotide (1641) is the second most abundant motif type (Table 2). Dreisigackera et al. (Dreisigackera et al., 2004) have concluded that the potentially polymorphisms are higher in low motif than advanced motif. As shown in Fig. 4, the low motif (mono-, di- and tri-nucleotide) were dominant in our study. It is suggested that most of SSRs of A. japonicus tube foot may possess hypervariability. Among various motifs types, the most dominant was AT/AT, followed by AC/GT, AG/CT, AAT/ATT. Similar distribution of motif types and annotation rates (53.87%) were obtained in previous research (Zhou et al., 2014). However, AC/GT was the most common type in some studies that focus on the probe of SSRs marker, involving in the group of vertebrate, such as catfish and croaker (Zhang et al., 2014; Xiao et al., 2015). It may provide the evidence that the different between echinoderms and vertebrates. Moreover, of the12,114 SSRs, 3216 were omitted perfect primers. As conclude, the explored SSRs in our study win the highly availability. A total of 219,860 SNPs, including 127,547 transitions and 92,313 tranversions were identified from 34,749 unigenes (Fig. 5A). Detail information was shown as Supplementary Table 2. Previous study showed that SNPs in 5′-UTRs and 3′-UTRs regions were important since some of them might lead to changes in mRNA binding sites (Miyamoto et al., 2007). In this study, further analysis of the functional SNPs showed that 97,683, 53,624, 27,767 and 40,786 were distributed in CDSs, 5′-UTRs, 3′-UTRs and sequences without predicted CDS (non-CDSs), respectively (Fig. 5B). SNPs located in CDSs are effective

44

X. Zhou et al. / Comparative Biochemistry and Physiology, Part D 20 (2016) 41–49

Fig. 2. Species distribution in nr database blast. Note that the best hits for unigenes are covered in the analysis.

for assessing the polymorphisms that directly affect the phenotype related to important economic traits. In some situations, mutations in CDSs may give rise to the loss of protein function that leading to species extinction. And then, beneficial mutations can be suggested by the retained traits during evolution (Lynch et al., 2006; Zhu et al., 2012). Thus, mutation in CDSs can be used for explaining the influences of natural selection at the gene and protein levels (Ellegren, 2008). And the 39,722 nsSNPs and 81,727 sSNPs were obtained in the present study. These SNPs are possibly to be used in the further genetic studies and selection breeding program of A. japonicus. Moreover, a large number of SNPs were found in known-function genes, such as methionine synthase, serine/threonine-protein kinase, trypsin-like serine protease, cysteine synthase-like, lysozyme and bone morphogenetic protein that are useful for illustrating gene impact on development and economically important trait (Mashanov et al., 2012; Yuan et al., 2012; Xue et al., 2015). 3.3. Analysis of the specifically expressed unigenes in the tube foot We obtained 390 unigenes that specifically expressed in the tube foot, 190 of which were annotated (Supplementary Table 3). Several shared unigenes involved in sea star footprint protein 1 (Sfp1), peropsin, neurona- and acetylcholine- related protein were of interest to us. Sfp1 as the first sea star footprint protein, was regarded as the second most abundant constituent of the adhesive footprints (Hennebert et al., 2015). The secretion of Sfp1 may be correlated to strong adhesion and could be switched by sensory cells via the nerve plexus (Hennebert et al., 2014). Peropsin which has been described in several vertebrates such as Amphioxus and in the jumping spider, Hasarius adansoni (Nagata et al., 2010), Cupiennius salei (Eriksson et al., 2013) is thought to function as a photoisomerase in chordates (Sun et al., 1997; Koyanagi et al., 2002). Several neuron- and acetylcholine-related protein were also found in our study, which may be suggest some function of transmitting of neuron signal. Further studies on the protein related to neuron and acetylcholine were needed

to explain the detail signal transmission in tube foot. A. japonicus is affiliated with the echinodermata and their phylum hemichordates are the closest known relatives of the chordates (Du et al., 2012). The following researches that about echinodermata or chordates may provide molecule base to further explore the function-related genes of A. japonicus. 3.4. Prediction and analysis of miRNA target genes To predict and analyze target genes, 40,375 5′-UTR reads and 19,940 3′-UTR reads were extracted from the tube foot transcriptome. Based on these reads, the potential target genes of identified miRNAs were predicted using the program miRanda-3.3a, PITA and hybrid, respectively. The sequences of predicted target genes and the predicted binding sites for the four miRNAs were listed in Supplementary Table 4. The numbers of predicted target genes for miR-29a, miR-29b, miR-278-3p and miR-2005, were 648, 645, 589 and 1191, (Fig. 6, Supplementary Figs. 1, 2 and 3), respectively. Compared with our previous work, we found more predicted target genes suggesting that the transcriptome data we used may be more specific than that of Wang et al. (Wang et al., 2014), and the sequences of 5′-UTR are more than twice as likely as previous study (15,758) to predict target genes. This study highlights with several target genes, which are annotated as coding protein of A. japonicus (Table 3). The known genes identified in this study may have an important role in biochemical process, including some immune-related factors, such as mannan-binding C-type lectin (MBL), laccase-type phenoloxidase (PO), variable lymphocyte receptor A diversity region (VLRA), profilin, complement component 3-2 (AjC3), myeloid differentiation primary response protein 88 (MyD88) and complement factor B (CFB); skin pigmentationrelated gene, such as microphthalmia-associated transcription factor (MITF) (Zhao et al., 2012); candidate regeneration factor, such as tropomyosin (TRP) and holothurians autolysis-related factor, such as cathepsin L (CL). In our study, CL regulated by miR-29a and miR-29b was observed. Enzyme activity assay showed that CL can hydrolyze Z-Arg-Arg-NMec

X. Zhou et al. / Comparative Biochemistry and Physiology, Part D 20 (2016) 41–49

45

Fig. 3. Distribution of the most common GO term categories.

(specific substrate of cathepsin L) (Yan et al., 2009). According to previous reports CL plays important role in hydrolyze fibrin (Yamashita and Konagaya, 1990; Visessanguan et al., 2003), and also participate in the autolytic process of the myofibrillar proteins in back muscle of Hypophthalmichthys molitrix (Li et al., 2004). Autolysis easily happens to sea cucumber, and causes a mass of deterioration of the overall quality. In the previous study, the enhancement of cathepsin L activity Table 2 The distribution of the identified SSRs in sequences using the MISA software. Repeat numbers

Motif Mono-

Di-

Tri-

Tetra-

Penta-

5 6 7 8 9 10 11 ≥12 Total Motif (%)

0 0 0 0 0 3965 1846 3342 9153 75.56

0 815 412 214 94 72 30 4 1641 13.55

826 266 108 15 2 0 1 0 1218 10.05

88 9 1 0 0 0 0 0 98 0.81

2 1 0 1 0 0 0 0 4 0.03

Total

Repeat numbers (%)

916 1091 521 230 96 4037 1877 3346 12,114

7.56 9.01 4.30 1.90 0.79 33.33 15.49 27.62 100

and degradation of the structural proteins were found by the UVA irradiation in sea cucumber (Qi et al., 2016). This study speculated that miR-29a and miR-29b may affect the autolysis in tube foot of A. japonicus. The TRP regulated by miR-278-3p also interest us. TRP as a major protein of smooth muscle, skeletal muscle and myocardium, compose subunits of alpha and beta, can forming the troponin complex associate with actin to affecting muscle contraction. And TRP was considered as a candidate for regeneration-related factors of A. japonicus (Xia et al., 2013). According to our study, it's suggested that tube foot specifically expressed miR-278-3p may take part in the regulation of locomotion and regeneration process in tube foot. The MITF potentially regulated by miR-2005 was also observed in this study. The formation of melanin in the melanocytes is depended on MITF. Zhao et al. found the reason why albino A. japonicus has fewer melanocytes and a reduced ability to synthesize melanin is likely because of lower expression of MITF (Zhao et al., 2012). And further investigation is required to explore the molecular mechanism for the process of autolysis, regulation and albino by tube foot specifically expressed miRNAs. A. japonicus is endowed with innate immune system for preventing pathogen infection. Many miRNAs are detected to take part in the several pathogen processes in A. japonicus by regulating their target genes, such as Ajp105, AjTollip and IRAK-1 (Lv et al., 2015; Lu et al., 2015a,

46

X. Zhou et al. / Comparative Biochemistry and Physiology, Part D 20 (2016) 41–49

Fig. 4. Repeat number variants distribution for detected polymorphic SSRs.

2015b). In the present study, some immune-related genes are also predicted to regulated by specifically expressed miR-29a, miR-2005 and miR-278-3p in tube foot, such as MBL, VLRA, AjC3-2, Myd88 (Zhong et al., 2011; Lu et al., 2013; Yang et al., 2015). C3 is the point of convergence for all three complement-activating pathways, as the isoform of C3 in A. japonicus, AjC3-2 is similar with AjC3, both are play a major role in complement-activating pathways (Zhou et al., 2011). And MBL is the starter switch of complement-activating lectins, which is one of the complement-activating pathways (Taylor et al., 1989). Myd88 can recruits IRAK-4 and IRAK-1 in succession, phosphorylated IRAK-1 then mediates the recruitment of TRAF6, and activate the TLR signaling pathway. In the previous study, miR-133 has validated to promoting pathogen phagocytosis in A. japonicus through IRAK-1 targeting (Lu et al., 2015b). In our study, Myd88 is the putative target gene of

Fig. 5. Distribution of putative single nucleotide polymorphisms (SNPs) in the transcriptome of the tube foot (A) and deep analysis of the functional SNPs of the tube foot (B).

miR-2005, that suggesting that the miR-133 and miR-2005 may play the important in TLR signaling pathway through IRAK-1 and Myd88 targeting. Tube foot as the part of body wall in A. japonicus, also plays an important role in resisting the external environment. Combined with our study, many immune-related genes were regulated by miR-29b, miR-2005 and miR-278-3p, respectively. Thought there are no evidence to show tube foot acts as immune effector, this work may provide a new insight to understand the physiological mechanism of these immune-related factors that regulated by specifically expressed miRNAs in tube foot for further investigation. 3.5. The validation of the analysis data To evaluate the validation rate of the SNPs identified by bioinformatics analysis, we selected 36 SNPs and validated by PCR amplification and direct sequencing. The reliability and accuracy of the predicted SNPs is showed in Table 4, which suggest predicted SNPs can be used in the future studies. Similarly 14 SSRs are also validated. Except for l-gulono-gamma-lactone oxidase (GULO) (Supplementary Fig. 4.), the sequencing results of several other genes are consistent with the data of transcriptome (Table 5). To validate the results obtained, we randomly selected 4 genes for validation the specifically expressed genes and 12 genes for validation the target genes by using qRT-PCR (Fig. 7). Information on all the

Fig. 6. The predicted target mRNA of mir-29a.

X. Zhou et al. / Comparative Biochemistry and Physiology, Part D 20 (2016) 41–49

47

Table 3 Detailed information of miRNA target genes identified in the tube foot. miRNA

Target mRNA ID

Abbr.

Annotate

NCBI ID

miR-278-3p

c58611.graph_c0 c62762.graph_c0 c65915.graph_c0 c66891.graph_c0 c67015.graph_c0 c50905.graph_c0 c55537.graph_c1 c63457.graph_c0 c66450.graph_c0 c67418.graph_c0 c70437.graph_c1 c72574.graph_c0 c51248.graph_c0 c66162.graph_c0 c70437.graph_c1 c66162.graph_c0 c73083.graph_c0

MBL TRP PO Bhsm1 VLRA LiTNFF profilin HSP26 SAPA MITF AjC3-2 MyD88 Bhsm1 CL AjC3-2 CL CFB

Mannan-binding C-type lectin [Apostichopus japonicus] Tropomyosin [Apostichopus japonicus] Laccase-type phenoloxidase [Apostichopus japonicus] Betainehomocysteine S-methyltransferase 1 [Apostichopus japonicus] Variable lymphocyte receptor A diversity region [Apostichopus japonicus] LPS-induced TNF-alpha factor [Apostichopus japonicus] Profilin [Apostichopus japonicus] Heat shock protein 26 [Apostichopus japonicus] Serum amyloid protein A [Apostichopus japonicus] Microphthalmia-associated transcription factor [Apostichopus japonicus] Complement component 3-2 [Apostichopus japonicus] Myeloid differentiation primary response protein 88 [Apostichopus japonicus] Betainehomocysteine S-methyltransferase 1 [Apostichopus japonicus] Cathepsin L [Apostichopus japonicus] Complement component 3-2 [Apostichopus japonicus] Cathepsin L [Apostichopus japonicus] Complement factor B [Apostichopus japonicus]

gi|86277302 |gb|ABC87994.1 gi|302340969|gb|ADL27535.1| gi|526264965|gb|AGR83982.1| gi|646223324|gb|AIB51691.1| gi|685874311|gb|AIP87048.1| gi|646223326|gb|AIB51692.1| gi|407894519|gb|AFU36096.1| gi|325301261|gb|ADZ05534.1| gi|184202039|gb|ABX55830.2| gi|322836048|gb|ADX20705.1| gi|320091306|gb|ADW08937.1| gi|544599831|gb|AGW25455.1| gi|646223324|gb|AIB51691.1| gi|159792912|gb|ABW98676.1| gi|320091306|gb|ADW08937.1| gi|159792912|gb|ABW98676.1| gi|323320820|gb|ADX36428.1|

miRNA-2005

miR-29b

miR-29a

Table 4 SNPs validation by experiment. Gene ID

Gene name

Primer sequences (5′–3)′

Number of SNPs validated

Number of SNPs

c73782.graph_c0 c58095.graph_c0 c67591.graph_c0 c65065.graph_c0 c68560.graph_c0 c72527.graph_c0 c63457.graph_c0 c68203.graph_c1 c64061.graph_c0 c71359.graph_c0 c40187.graph_c0 c56725.graph_c0

Notch wnt5 protein Transcription factor SOX-10-like Collagen-related protein 2 - hydra magnipapillata NF-kappaB transcription factor Rel Solute carrier family 35 member E3-like Heat shock protein 26 Uncharacterized protein LOC100891783 Uncharacterized protein LOC752530 Macoilin-like Bifunctional heparan sulfate N-deacetylase/N-sulfotransferase

F: CTAGTAGAAGCGACTGTGAG R:ATCCGACCTCTATCGACATG F: ATCTTTCTGGAAGTGCGTCC R: GGACCTCTATAGGTACGGAT F: TGACGATGAACAACAACCGC R: CTGAAGGCTGCTGGTATTCT F: TCAGACATTGTGGGGCTAAG R: ATACACCGGGTCAATACGAG F: GGTACGAGCCGATAGTTGTCAT R: AACTTTGTCGACCTGCCTGT F: GGTACGAGCCGATAGTTGTCAT R: GCACTTCACAAGCAACTTTTCC F: TCCATCATTTGGCCTTCAGCGTA R: CATCAAACTCGTCATCGGCAAGC F: TCCATCATTTGGCCTTCAGCGTA R: CATCAAACTCGTCATCGGCAAGC F: CCTTCTTCGCAACCTTCACA R: CCACCTCTCTCCTCTTTACT F: TGAGGACTTCCACACTTTTGC R: GGTCTCCGGGAAGAAATGAT F: ATCGCCATTGACAACAACTG R: CCAGACCACCTCAGGGATAA F: CGCTGACATGTTTTTCTTTGG R: CCTTTTCGAAAGCTACAGAACG

2 3 1 7 2 3 1 1 1 2 1 3

2 4 1 8 5 4 3 2 1 2 1 3

primers is shown in Supplementary Table 5. Ten target genes were significantly repressed in the tube foot comparing to papilla, skin, respiratory tree, coelomic fluid and body wall. However, six target genes, such as MBL, Hypothetical protein LOTGIDRAFT_181176, glutamine synthetase (GS) and Betainehomocysteine S-methyltransferase1 were down-regulation in tube foot, while the down-regulation was also achieved in other tissues, such as skin and papilla. In the previous study, Zhang et al. confirmed that miR-137 and miR-2008 in regulating the Betainehomocysteine S-methyltransferase to promote ROS production and the clearance of pathogenic microorganisms through Hcy accumulation (Zhang et al., 2015). Based on the these findings, target genes may be dominated by more than one miRNA or other kinds of pasttranscriptional regulation. These results illustrate that the identified

miRNAs in the previous study may associate with the target genes which is predicted in the present study. 4. Conclusion In conclusion, we perform a high-through sequencing of A. japonicus transcriptome using Illumina 2500 sequencing platform. A large number of genetic markers were identified. The SSRs and SNPs identified here can provide abundant genetics and molecular ecology resources in A. japonicus. Moreover, gene information of sea cucumbers' tube foot were got compared with previous research. And this present study may provide theoretical basis for further physiological and pathological researches of A. japonicus.

Table 5 Details of the SSR markers developed. Gene ID

SSR

Gene name

Primer sequences (5′–3)′

Tm (°C)

c75243.graph_c0 c62044.graph_c0 c66579.graph_c0 c64249.graph_c0 c69865.graph_c0 c58767.graph_c0 c54554.graph_c0 c71265.graph_c0 c70746.graph_c0 c71359.graph_c0 c40187.graph_c0 c70193.graph_c0 c56725.graph_c0 c74531.graph_c0

(GACG)5 (ATAC)5 (TGTC)7 (GAA)5(TAA)7 (ATC)5 (TAT)5 (GTG)5 (TA)6 (CT)7 (AAC)5 (GCTT)5 (TGT)5 (T)10 (T)16

GMP synthase Translation initiation factor 1A Hypothetical protein BRAFLDRAFT_115457 L-gulono-gamma-lactone oxidase Uncharacterized protein LOC100889674 Hypothetical protein BRAFLDRAFT_86061 Zinc transporter ZIP12-like Novel gene UDP-glucuronosyltransferase 2B33-like Macoilin-like Bifunctional heparan sulfate N-deacetylase/N-sulfotransferase Insulin-like growth factor-binding protein-like 1-like SoxB1 Epithelial chloride channel protein-like

F: GGACGACGTGAATCCAAGAT R: TAGCAAACTCTTGCGGTCAA F: ATGGCTTCTTTCGCGAGTT R: GCGTCGCATGGTAAATTTCT F: AAAGTCAATTCTGGTTGCGG R: CCAACAGGATTTTCTTCCGA F: CGTAGCTTACCTTAACGGCAC R: CAGCCTGAGAACTGTTCATGG F: TGCCGTTCTTGACACTGAAG R: GATATGAAAGAGGCGGTGGA F: ACGTTTGTCGGAAAGATTGG R: TGCTCTCATTGTCGGCATAC F: TCAACTGCGTTGGTCACTTC R: ATGCCTCGGACACTCAAGAC F: TGTGGGTAGTTGCTAGTTTTC R: GAGAGAGGCGACCATACTGT F: GTGAGACAGCAGACAGCCAG R: AAAGCATTCCTCGTGAGCAT F: TGAGGACTTCCACACTTTTGC R: GGTCTCCGGGAAGAAATGAT F: ATCGCCATTGACAACAACTG R: CCAGACCACCTCAGGGATAA F: ACCGATGGAAAGAGCACACT R: GTCCGCTGTTTGAATGATGG F: CGCTGACATGTTTTTCTTTGG R: CCTTTTCGAAAGCTACAGAACG F: CCAGCATCGTACCGACTCTT R: TAATGAATTCCATGCCGTGA

52 52 55 55 55 59 59 57 59 59 55 55 55 59

48

X. Zhou et al. / Comparative Biochemistry and Physiology, Part D 20 (2016) 41–49

Fig. 7. The qRT-PCR validation results. The tissues are abbreviated as follows: P: papilla; R: respiratory tree; B: body wall; T: tube foot; S: skin; C: coelomocytes.

Supplementary data to this article can be found online at http://dx. doi.org/10.1016/j.cbd.2016.07.005. Acknowledgements This project was supported by the National Natural Science Foundation of China (No. 31572608) and the Program for Liaoning Excellent Talents in University, China (No. LR2014022). We would like to acknowledge Derong Kong, He Sun, Zhicheng Wang and Haoze Wang for their help on this experiment. References Anisimov, S.V., 2008. Serial Analysis of Gene Expression (SAGE): 13 years of application in research. Current pharmaceutical biotechnology 9, 338–350. Bronstein, O., Loya, Y., 2013. The taxonomy and phylogeny of Echinometra (Camarodonta: Echinometridae) from the red sea and western Indian Ocean. PLoS One 8, e77374. Chang, Y., Feng, Z., Yu, J., Ding, J., 2009. Genetic variability analysis in five populations of the sea cucumber Stichopus (Apostichopus) japonicus from China, Russia, South Korea and Japan as revealed by microsatellite markers. Mar. Ecol. 30, 455–461. Cui, J., Wang, H., Liu, S., Qiu, X., Jiang, Z., Wang, X., 2014a. Transcriptome analysis of the gill of Takifugu rubripes using Illumina sequencing for discovery of SNPs. Comp. Biochem. Physiol. Part D Genomics Proteomics 10, 44–51. Cui, J., Wang, H., Liu, S., Zhu, L., Qiu, X., Jiang, Z., Wang, X., Liu, Z., 2014b. SNP discovery from transcriptome of the swimbladder of Takifugu rubripes. PLoS One 9, e92502. Cui, J., Xu, J., Zhang, S., Wang, K., Jiang, Y., Mahboob, S., Al-Ghanim, K.A., Xu, P., 2015. Transcriptional profiling reveals differential gene expression of Amur ide (Leuciscus waleckii) during spawning migration. Int. J. Mol. Sci. 16, 13959–13972. Diaz-Balzac, C.A., Abreu-Arbelo, J.E., Garcia-Arraras, J.E., 2010a. Neuroanatomy of the tube feet and tentacles in Holothuria glaberrima (Holothuroidea, Echinodermata). Zoomorphology 129, 33–43. Diaz-Balzac, C.A., Mejias, W., Jimenez, L.B., Garcia-Arraras, J.E., 2010b. THE CATECHOLAMINERGIC NERVE PLEXUS OF HOLOTHUROIDEA. Zoomorphology 129, 99–109.

Dreisigackera, S.P., Zhangc, M.L., Warburtonc, M., et al., 2004. SSR and pedigree analyses of genetic diversity among CIMMYT wheat lines targeted to different megaenvironments. Crop Sci. 44, 381–388. Du, H., Bao, Z., Hou, R., Wang, S., Su, H., Yan, J., Tian, M., Li, Y., Wei, W., Lu, W., Hu, X., Wang, S., Hu, J., 2012. Transcriptome sequencing and characterization for the sea cucumber Apostichopus japonicus (Selenka, 1867). PLoS One 7, e33311. Ellegren, H., 2008. Comparative genomics and the study of evolution by natural selection. Mol. Ecol. 17, 4586–4596. Enright, A.J., John, B., Gaul, U., Tuschl, T., Sander, C., Marks, D.S., 2003. MicroRNA targets in Drosophila. Genome Biol. 5, R1. Eriksson, B.J., Fredman, D., Steiner, G., Schmid, A., 2013. Characterisation and localisation of the opsin protein repertoire in the brain and retinas of a spider and an onychophoran. BMC Evol. Biol. 13, 186. Hennebert, E., Wattiez, R., Demeuldre, M., Ladurner, P., Hwang, D.S., Waite, J.H., Flammang, P., 2014. Sea star tenacity mediated by a protein that fragments, then aggregates. Proc. Natl. Acad. Sci. U. S. A. 111, 6317–6322. Hennebert, E., Leroy, B., Wattiez, R., Ladurner, P., 2015. An integrated transcriptomic and proteomic analysis of sea star epidermal secretions identifies proteins involved in defense and adhesion. J. Proteome 128, 83–91. Hyman, L.H., 1955. The invertebrates: echinodermata. Vol. 4. McGraw-Hill, New York. Jiang, Y., Zhang, S., Xu, J., Feng, J., Mahboob, S., Al-Ghanim, K.A., Sun, X., Xu, P., 2014. Comparative transcriptome analysis reveals the genetic basis of skin color variation in common carp. PLoS One 25, e108200. Kertesz, M., Iovino, N., Unnerstall, U., Gaul, U., Segal, E., 2007. The role of site accessibility in microRNA target recognition. Nat. Genet. 39, 1278–1284. Khalili, A.A., Ahmad, M.R., 2015. A review of cell adhesion studies for biomedical and biological applications. Int. J. Mol. Sci. 16, 18149–18184. Koyanagi, M., Terakita, A., Kubokawa, K., Shichida, Y., 2002. Amphioxus homologs of Go-coupled rhodopsin and peropsin having 11-cis- and all-trans-retinals as their chromophores. FEBS Lett. 531, 525–528. Lesser, M.P., Carleton, K.L., Bottger, S.A., Barry, T.M., Walker, C.W., 2011. Sea urchin tube feet are photosensory organs that express a rhabdomeric-like opsin and PAX6. Proceedings. Biol. Sci./R. Soc. 278, 3371–3379. Li, S.H., Zhang, N., Liu, H., Ma, C.W., 2004. 2004. Prelimin ary study of the relationship between autolysis of silver carp (Hypophthalmichthys molitrix). Myofibrillar Proteins and Endogenous Cathepsins B, L and H. College of Food Science and Nutritional Engineering 9. China Agricultural University, Beijing, pp. 71–75. Li, C., Feng, W., Qiu, L., Xia, C., Su, X., Jin, C., Zhou, T., Zeng, Y., Li, T., 2012. Characterization of skin ulceration syndrome associated microRNAs in sea cucumber Apostichopus japonicus by deep sequencing. Fish Shellfish Immunol. 33, 436–441.

X. Zhou et al. / Comparative Biochemistry and Physiology, Part D 20 (2016) 41–49 Liu, S., Zhou, Z., Lu, J., Sun, F., Wang, S., Liu, H., Jiang, Y., Kucuktas, H., Kaltenboeck, L., Peatman, E., Liu, Z., 2011. Generation of genome-scale gene-associated SNPs in catfish for the construction of a high-density SNP array. BMC Genomics 12, 53. Liu, S., Wang, X., Sun, F., Zhang, J., Feng, J., Liu, H., Rajendran, K.V., Sun, L., Zhang, Y., Jiang, Y., Peatman, E., Kaltenboeck, L., Kucuktas, H., Liu, Z., 2013. RNA-Seq reveals expression signatures of genes involved in oxygen transport, protein synthesis, folding, and degradation in response to heat stress in catfish. Physiol. Genomics 45, 462–476. Lu, Y., Li, C., Zhang, P., Shao, Y., Su, X., Li, Y., Li, T., 2013. Two adaptor molecules of MyD88 and TRAF6 in Apostichopus japonicus toll signaling cascade: molecular cloning and expression analysis. Dev. Comp. Immunol. 41, 498–504. Lu, M., Zhang, P., Li, C., Zhang, W., Jin, C., Han, Q., 2015a. MiR-31 modulates coelomocytes ROS production via targeting p105 in Vibrio splendidus challenged sea cucumber Apostichopus japonicus in vitro and in vivo. Fish Shellfish Immunol. 45, 293–299. Lu, M., Zhang, P.J., Li, C.H., Lv, Z.M., Zhang, W.W., Jin, C.H., 2015b. miRNA-133 augments coelomocyte phagocytosis in bacteria-challenged Apostichopus japonicus via targeting the TLR component of IRAK-1 in vitro and in vivo. Sci. Rep. 30, 12608. Lv, Z., Li, C., Zhang, P., Wang, Z., Zhang, W., Jin, C.H., 2015. MiR-200 modulates coelomocytes antibacterial activities and LPS priming via targeting Tollip in Apostichopus japonicus. Fish Shellfish Immunol. 45, 431–436. Lynch, M., Koskella, B., Schaack, S., 2006. Mutation pressure and the evolution of organelle genomic architecture. Science 311, 1727–1730. Mashanov, V.S., Zueva, O.R., Garcia-Arraras, J.E., 2012. Expression of Wnt9, TCTP, and Bmp1/Tll in sea cucumber visceral regeneration. Gene Expr. Patterns 12, 24–35. Miyamoto, Y., Mabuchi, A., Shi, D.Q., Kubo, T., Takatori, Y., Saito, S., Fujioka, M., Sudo, A., Uchida, A., Yamamoto, S., Ozaki, K., Takigawa, M., Tanaka, T., Nakamura, Y., Jiang, Q., Ikegawa, S., 2007. A functional polymorphism in the 5′ UTR of GDF5 is associated with susceptibility to osteoarthritis. Nat. Genet. 39, 529–533. Nagata, T., Koyanagi, M., Tsukamoto, H., Terakita, A., 2010. Identification and characterization of a protostome homologue of peropsin from a jumping spider. Journal of comparative physiology. A Neuroethol. Sens. Neural Behav. Physiol. 196, 51–59. Nunez-Acuna, G., Valenzuela-Munoz, V., Gallardo-Escarate, C., 2014. High-throughput SNP discovery and transcriptome expression profiles from the salmon louse Caligus rogercresseyi (Copepoda: Caligidae). Comp. Biochem. Physiol. Part D Genomics Proteomics 10, 9–21. Qi, H., Fu, H., Dong, X., Feng, D., Li, N., Wen, C., Nakamura, Y., Zhu, B., 2016. Apoptosis induction is involved in UVA-induced autolysis in sea cucumber Stichopus japonicus. J. Photochem. Photobiol. B Biol. 3, 130–135. Rehmsmeier, M., Steffen, P., Hochsmann, M., Giegerich, R., 2004. Fast and effective prediction of microRNA/target duplexes. RNA 10, 1507–1517. Santos, R., Haesaerts, D., Jangoux, M., Flammang, P., 2005. Comparative histological and immunohistochemical study of sea star tube feet (Echinodermata, Asteroidea). J. Morphol. 263, 259–269. Shawky, J.H., Davidson, L.A., 2015. Tissue mechanics and adhesion during embryo development. Dev. Biol. 401, 152–164. Sloan, N.A., 1984. Echinoderm fisheries of the world: a review. In: Keegan, BF, O’ Connor, BDS (Eds.), Echinodermata. Rotterdam: Balkema AA 109–124. Steven, W.P., Yves, S., Chantal, C., 2012. Commercially Important Sea Cucumber of The World Rome. Food and agriculture organization of the united nations 2. Sun, H., Gilbert, D.J., Copeland, N.G., Jenkins, N.A., Nathans, J., 1997. Peropsin, a novel visual pigment-like protein located in the apical microvilli of the retinal pigment epithelium. Proc. Natl. Acad. Sci. U. S. A. 94, 9893–9898. Sun, H., Zhou, Z., Dong, Y., Yang, A., Jiang, B., Gao, S., Chen, Z., Guan, X., Wang, B., Wang, X., 2013a. Identification and expression analysis of two toll-like receptor genes from sea cucumber (Apostichopus japonicus). Fish Shellfish Immunol. 34, 147–158. Sun, L., Yang., H., Chen, M., Ma, D., Lin, C., 2013b. RNA-Seq reveals dynamic changes of gene expression in key stages of intestine regeneration in the sea cucumber Apostichopus japonicas. PLoS One 8, e69441. Sun, H., Zhou, Z., Dong, Y., Yang, A., Jiang, J., Chen, Z., Guan, X., Wang, B., Gao, S., Jiang, B., 2016. Expression analysis of microRNAs related to the skin ulceration syndrome of sea cucumber Apostichopus japonicus. Fish Shellfish Immunol. 49, 205–212. Taylor, M.E., Brickell, P.M., Craig, R.K., Summerfield, J.A., 1989. Structure and evolutionary origin of the gene encoding a human serum mannose-binding protein. Biochem. J. 262, 763–771.

49

Visessanguan, W., Benjakul, S., An, H., 2003. Purification and characterization of cathepsin L in arrowtooth flounder (Atheresthes stomias) muscle. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 134, 477–487. Wang, H., Liu, S., Cui, J., Li, C., Qiu, X., Chang, Y., Liu, Z., Wang, X., 2014. Characterization and expression analysis of microRNAs in the tube foot of sea cucumber Apostichopus japonicus. PLoS One 9, e111820. Wang, H., Liu, S., Cui, J., Li, C., Hu, Y., Zhou, W., Chang, Y., Qiu, X., Liu, Z., Wang, X., 2015. Identification and characterization of microRNAs from longitudinal muscle and respiratory tree in sea cucumber (Apostichopus japonicus) using high-throughput sequencing. PLoS One 10, e0134899. Wang, Z., Gerstein, M., Snyder, M., 2009. RNA-Seq: a revolutionary tool for transcriptomics. Nat. Rev. Genet. 10, 57–63. Xia, C.G., Cui, J.W., Zhong, H.L., Cheng, H., Zhou, J., Li, Y., Zhang, C.D., Li, T.W., Su, X.R., 2013. Prokaryotic expression of tropomysin gene from south cultured sea cucumber Apostichopus japonicus. Oceanologia Limnol. Sin. 44, 206–208. Xiao, S., Han, Z., Wang, P., Han, F., Liu, Y., Li, J., Wang, Z.Y., 2015. Functional marker detection and analysis on a comprehensive transcriptome of large yellow croaker by next generation sequencing. PLoS One 10, e0124432. Xu, J., Zhao, Z., Zhang, X., Zheng, X., Li, J., Jiang, Y., Kuang, Y., Zhang, Y., Feng, J., Li, C., Yu, J., Li, Q., Zhu, Y., Liu, Y., Xu, P., Sun, X., 2014. Development and evaluation of the first highthroughput SNP array for common carp (Cyprinus carpio). BMC Genomics 15, 307. Xue, Z., Li, H., Wang, X., Li, X., Liu, Y., Sun, J., Liu, C., 2015. A review of the immune molecules in the sea cucumber. Fish Shellfish Immunol. 44, 1–11. Yamashita, M., Konagaya, S., 1990. Purification and characterization of cathepsin L from the white muscle of chum salmon, Oncorhynchus keta. Comp. Biochem. Physiol. B Comp. Biochem. 96, 247–252. Yan, R.X., Xu, S.T., Cong, L.N., Yang, G.K., Zhu, B.W., 2009. Cloning, Expression and Assay of Cathepsin L from the Sea Cucumber Stichopus japonicus. 28. Dalian Polytechnic University, pp. 391–396. Yang, A., Sun, D., Liu, S., Dong, Y., Chen, Z., 2012. Characterization of fifteen SNP markers by mining EST in sea cucumber, Apostichopus japonicus. J. Genet. 91, e49–53. Yang, L., Yao, F., Ba, H., Qin, T., Luan, H., Li, Z., Hou, L., Zou, X., 2015. Identification, expression pattern and potential role of variable lymphocyte receptor Aj-VLRA from Apostichopus japonicus in response to bacterial challenge. Fish Shellfish Immunol. 45, 221–230. Yuan, Z., Dahms, H.U., Han, L.L., Li, Q.Y., Zhang, Q.Z., Wu, R.J., Tan, J., Zou, X.Y., Hou, L., 2012. Cloning and characterization of a trypsin-like serine protease gene, a novel regeneration-related gene from Apostichopus japonicus. Gene 502, 46–52. Zhang, P., Li, C., Zhu, L., Su, X., Li, Y., Jin, C., Li, T., 2013. De novo assembly of the sea cucumber Apostichopus japonicas hemocytes transcriptome to identify miRNA targets associated with skin ulceration syndrome. PLoS One 8 (9), 12, e73506. Zhang, J., Ma, W., Song, X., Lin, Q., Gui, J.F., Mei, J., 2014. Characterization and development of EST-SSR markers derived from transcriptome of yellow catfish. Molecules 19, 16402–16415. Zhang, P., Li, C., Zhang, R., Zhang, W., Jin, C., Wang, L., Song, L., 2015. The roles of two miRNAs in regulating the immune response of sea cucumber. Genetics 201, 1397–1410. Zhao, H., Yang, H., Zhao, H., Liu, S., Wang, T., 2012. Differences in MITF gene expression and histology between albino and normal sea cucumbers (Apostichopus japonicus Selenka). Chin. J. Oceanol. Limnol. 30, 80–91. Zhong, L., Z., F., Bi, Y., 2011. Preliminary research of hemolysis activity of complement factor B in Apostichopus japonicus. Fish. Sci. Technol. Guangxi 4, 11–17. Zhou, Z., Sun, D., Yang, A., Dong, Y., Chen, Z., Wang, X., Guan, X., Jiang, B., Wang, B., 2011. Molecular characterization and expression analysis of a complement component 3 in the sea cucumber (Apostichopus japonicus). Fish Shellfish Immunol. 31, 540–547. Zhou, Z.C., Dong, Y., Sun, H.J., Yang, A.F., Chen, Z., Gao, S., Jiang, J.W., Guan, X.Y., Jiang, B., Wang, B., 2014. Transcriptome sequencing of sea cucumber (Apostichopus japonicus) and the identification of gene-associated markers. Mol. Ecol. Resour. 14, 127–138. Zhou, X., Cui, J., Liu, S., Kong, D., Sun, H., Gu, C., Wang, H., Qiu, X., Chang, Y., Liu, Z., Wang, X., 2016. Comparative transcriptome analysis of papilla and skin in the sea cucumber, Apostichopus japonicus. PeerJ 4, e1779. Zhu, C., Cheng, L., Tong, J., Yu, X., 2012. Development and characterization of new single nucleotide polymorphism markers from expressed sequence tags in common carp (Cyprinus carpio). Int. J. Mol. Sci. 13, 7343–7353.