- Email: [email protected]
Transforming Growth Factor β Expression in Human Placenta and Placental Bed During Early Pregnancy
Placenta (2002), 23, 44–58 doi:10.1053/plac.2001.0746, available online at http://www.idealibrary.com on
Transforming Growth Factor Expression in Human Placenta and Placental Bed During Early Pregnancy H. Simpsona, S. C. Robsona, J. N. Bulmerb, A. Barberc and F. Lyallc,d a Department of Obstetrics and Gynaecology, and b Department of Pathology, University of Newcastle upon Tyne, Royal Victoria Infirmary, Newcastle-upon-Tyne, NE1 4LP, UK and c,dMaternal and Fetal Medicine Section, Institute of Medical Genetics, University of Glasgow, Yorkhill, Glasgow, G3 8SJ, UK Paper accepted 5 October 2001
Normal human pregnancy depends on physiological transformation of spiral arteries. Pre-eclampsia and fetal growth restriction are associated with impaired trophoblast invasion and spiral artery transformation. Recent data obtained from studies on placenta suggest that temporal changes in expression of TGF-3 play a key role in trophoblast invasion and that over-expression of TGF-3 in pre-eclampsia is responsible for inadequate trophoblast invasion. There are, however, no studies of specific TGF-s in the placental bed throughout pregnancy although this is where the invasive trophoblast and spiral arteries are located. In this study we have used immunohistochemistry, Western blot analysis, ELISA and RT-PCR to examine the expression of TGF-1, TGF-2 and TGF-3 in placental bed biopsies and placentas from 7–19 weeks’ gestation. The results show that TGF-1, 2 and 3 are expressed in the placenta throughout this time but the striking temporal changes in TGF-3 expression previously reported were not observed. Extravillous trophoblast within the placental bed expressed TGF-2 but not TGF-1 or TGF-3 while extracellular TGF-1 and cytoplasmic TGF-2 were detected in decidua. These data suggest that TGF-1 and TGF-2 but not TGF-3 may play a role in trophoblast invasion. 2002 Harcourt Publishers Ltd Placenta (2002), 23, 44–58
INTRODUCTION During early human pregnancy, extravillous cytotrophoblast (CTB) from anchoring villi invade the decidualized endometrium and myometrium (interstitial trophoblast) and also migrate in a retrograde direction along the spiral arteries (endovascular trophoblast) transforming them into large diameter vessels of low resistance (Pijnenborg et al., 1983). Endovascular trophoblast invasion has been reported to occur in two waves; the first into the decidual segments of spiral arteries at 8–10 weeks’ gestation and the second into myometrial segments at 16–18 weeks’ gestation (Pijnenborg et al., 1983). This physiological transformation is characterized by a gradual loss of the normal musculoelastic structure of the arterial wall and replacement by amorphous fibrinoid material in which trophoblast cells are embedded (Brosens et al., 1967; De Wolf et al., 1973; Khong et al., 1986; Pijnenborg et al., 1980; Sheppard et al., 1976). These physiological changes are required for a successful pregnancy. Failure of trophoblast invasion and spiral artery transformation has been documented in pre-eclampsia (PE), one of the d To whom correspondence should be addressed at: Maternal and Fetal Medicine Section, Institute of Medical Genetics, Yorkhill, Glasgow, G3 8SJ, UK. Tel: 0044 (0)141 201 0657; Fax: 0044 (0)141 357 4277; E-mail: [email protected]
0143–4004/02/010044+15 $35.00/0
leading causes of maternal death. In this syndrome reduced utero-placental perfusion is associated with widespread endothelial dysfunction and fetal growth restriction (FGR) leading to significant maternal and perinatal morbidity (Roberts and Redman, 1993). Similar spiral artery abnormalities have been reported in the placental bed of women with FGR in the absence of maternal hypertension as well as miscarriage (Hustin et al., 1990; Jauniaux et al., 1994; Khong et al., 1987, 1995; Michel et al., 1990; Pijnenborg et al., 1991; Sheppard et al., 1976, 1981). Thus failure of the spiral arteries to undergo physiological transformation may lead to a spectrum of pregnancy failure. Despite the importance of trophoblast invasion and vascular remodelling the processes controlling them are still not well understood. However they are thought to include changes in expression of cell adhesion molecules, matrix metalloproteinases and their tissue inhibitors and growth factors and their receptors (Lyall and Kaufmann, 2000; Lyall and Robson, 2000). Transforming growth factor-s (TGF-s) are members of a large superfamily of cytokines including activins, inhibins, bone morphogenic proteins and others (Pepper, 1997). The TGF family is composed of three related 25 kDa homodimeric proteins TGF-1, 2 and 3. TGF-s exert their biological effects by binding to cell surface receptors designated types I, II and III. A number of studies have suggested that TGF-, 2002 Harcourt Publishers Ltd
Simpson et al.: TGF- and Human Trophoblast Invasion
produced primarily by the decidua, may regulate trophoblast invasion (Lala and Hamilton, 1996). Recently it was reported that TGF-3 in trophoblast is a major regulator of trophoblast invasion in vivo and in vitro (Caniggia et al., 1999). Expression of TGF-3 in placental villous tissue was reported to be low at 5–6 weeks’ gestation, peaking at 7–8 weeks’ gestation and then was virtually undetectable by 9 weeks. It was reported that this coincided with the time of maximal trophoblast invasion. Furthermore this group also reported that TGF-3 was weakly expressed in third trimester placentas but was strongly expressed in placentas obtained from women with PE. It was suggested that over-expression of TGF-3 in PE may account for failure of trophoblast invasion. Despite the possible importance of TGF-s in trophoblast invasion no study has systematically investigated expression of TGF-s in the placental bed throughout the period of trophoblast invasion and spiral artery transformation. Thus in this paper we have used immunohistochemistry, ELISA, Western blotting and RT-PCR to examine the expression of TGF-1, 2 and 3 in placental bed biopsies and placentas from 7–19 weeks’ gestation.
MATERIALS AND METHODS Sample collection The procedure for collection of placentas and placental bed biopsies had been published previously (Lyall et al., 2000, 1999). Paired first and second trimester samples were obtained from women undergoing termination of apparently normal pregnancy at the Royal Victoria Infirmary, Newcastle upon Tyne. An initial ultrasound scan was performed to confirm fetal viability and to determine gestational age and placental position. After evacuation of the uterine contents, three placental bed biopsies were taken under ultrasound guidance using biopsy forceps (Wolf, UK) introduced through the cervix. Placental samples were collected from all cases. The study was approved by the Joint Ethics Committee of Newcastle and North Tyneside Health Authority and the University of Newcastle. All samples were snap frozen in liquid nitrogen-cooled isopentane and stored sealed at 70C until required. Cryostat sections (7 m) from each specimen were stained with haematoxylin and eosin for histological analysis. The number of cases at each studied at each gestation for each particular technique is shown in the appropriate section.
Antibodies and reagents Desmin (NCL-DES-DERII, 1 : 100) and cytokeratin (NCLLP34, 1 : 800) monoclonal antibodies were obtained from Novocastra, Newcastle upon Tyne, UK. A monoclonal antibody to Factor VIII related antigen was obtained from DAKO, Cambridge, UK and used at 1 : 800. Rabbit polyclonal antibodies raised against TGF-1 (SC146), TGF-2 (SC90)
45
and TGF-3 (SC820) were purchased from Santa Cruz Biotechnology Inc., California, USA. The antibodies bind both the latent and active forms of the TGF-. Full length human recombinant TGF-1 (12.5 kDa), TGF-2 (12.5 kDa), and TGF-3 (12.5 kDa) were obtained from Santa Cruz and used as positive controls in Western blots. All other reagents were obtained from Sigma Chemical Co. Poole, UK unless stated otherwise. SDS-PAGE and Western blots The detailed methodology of the Western blot analysis is described in our previous work (Simpson et al., 2001). Placentas were studied from 21 cases spread evenly between 7–19 weeks’ gestation. Prior to homogenization, a cryostat section from each block was cut and stained with haematoxylin and eosin (H&E) to confirm that the specimens were placenta. Each frozen piece of tissue was weighed, ground to a fine powder in liquid nitrogen and added to lysis buffer. The powder was homogenized, then spun to remove debris. The supernatant was aliquoted and stored at 70C until required. Protein concentrations were determined by the method of Bradford (1976) using bovine serum albumin (BSA) as a standard, and then diluted to the required concentration. Samples were mixed 1 : 1 with loading buffer and separated on 15 per cent sodium-dodecyl-sulphate polyacrylamide resolving gels. Each well was loaded with 75 g of protein. Low molecular weight range markers (Bio-Rad Laboratories, California, USA 20–106 kDa range) were loaded beside the samples. Following transfer to BioBlot NC nitrocellulose membranes Canada) filters were blocked for 1 h at room temperature (RT) in phosphate buffered saline (PBS) containing 5 per cent Marvel and 0.25 per cent Tween-20. The antibodies (diluted 1 : 1000 in PBS containing 3 per cent Marvel and 0.25 per cent Tween-20) were added for 1 h at room temperature (RT). The filters were rinsed once and then washed twice for 5 min in PBS containing 0.25 per cent Tween-20 and were then incubated with horseradish peroxidase-conjugated donkey anti-rabbit IgG (Diagnostics Scotland, Carluke, UK) diluted 1 : 2000 in PBS containing 0.25 per cent Tween-20 for 1 h at RT. Blots were washed once for 5 min followed by two 15 min washes in PBS containing 0.25 per cent Tween-20 followed by one 5 min wash in distilled water. Proteins were detected using the Amersham ECL detection system and filters were exposed to Hyperfilm ECL (Amersham, Buckinghamshire, UK). The data sheet accompanying the TGF- antibodies reported no cross-reactivity with other TGF-s. However prior to performing experiments, each of the antibodies was checked for cross-reactivity with the control TGF-1, 2 and 3. The results confirmed that each TGF- antibody did not cross react with the other TGF-s. The specificity of the antibodies was further validated in immunohistochemical studies (below). Immunohistochemistry Immunohistochemistry was performed using an avidin-biotin peroxidase method (Vectastain Elite rabbit kit, Vector
46
Laboratories, Peterborough, UK). Cryostat sections of placenta and placental bed sections (7 m) were mounted on APES-coated slides, air dried over night, fixed in acetone for 10 min at RT then wrapped in pairs and frozen at 20C until required. Each specimen was stained with H&E for histological analysis. In addition for placental bed biopsies, to assist in identification of spiral arteries and trophoblast, all sections were immunostained for cytokeratin (1 : 800) to detect trophoblast, desmin (1 : 100) to detect muscle and Factor VIII (1 : 800) detect endothelium. For TGF- immunolocalization sections were blocked with 1 per cent BSA for 30 min followed by the kit blocker for 20 min. Sections then underwent a further 45 min incubation in 0.1 per cent phenylhydrazine to block endogenous peroxidase staining. These and all subsequent steps were performed at RT. Sections were then incubated with for 1 h with antibodies to TGF-1, 2 or 3 at a dilution of 1 : 200 for TGF-1 and 1 : 250 for TGF-2 and TGF-3. The remaining steps were performed according to the instructions supplied with the kit using a biotinylated second antibody and reagents supplied with the kit. The reaction was developed with Fast diaminobenzidine tablets. Washes between each step were performed in TBS (0.15 mol/l TRIS, 0.15 mol/l buffered saline, pH 7.6). Sections were counterstained in Mayer’s haematoxylin (BDH, Poole, UK) and mounted in DPX synthetic resin (Raymond Lamb, London, UK). Omission of primary antibody or substitution with non-immune rabbit serum for the primary antibody were both included as controls. Sections were all stained on the same day for each antibody to eliminate day to day variations in immunostaining. Parallel sections of all placental and placental bed cases were immunostained with the cytokertain antibody to confirm whether immunostaining was associated with extravillous trophoblast. Intensity of immunostaining was scored 0–3 where 0 represented no staining, 1 represented weak staining, 2 represented moderate staining and 3 represented strong staining. Scoring was performed independently by two observers (FL and HS) blinded to the tissue identity. As there was no significant differences between the two sets of scores (ANOVA; P>0.05 for all comparisons), the results for one observer (FL) was used for subsequent analysis. Since the antibodies for this study had previously been used on skin, (Frank et al., 1996) normal human skin was used as a positive control tissue in the present study. Skin tissue was processed as for placental samples.
RNA extraction and RT-PCR for TGF- RT-PCR was performed on RNA prepared from frozen placental tissue. Gestational ages selected were chosen to span the period previously reported to show striking changes in TGF-3 expression (Caniggia et al., 1999). Hence two cases were studied at 7–12 weeks’ gestation. Prior to RNA extraction, a cryostat section was removed from each block on the cryostat to confirm that the samples comprised predominately placenta. Total RNA was prepared using the TRIzoL
Placenta (2002), Vol. 23
Reagent method (Life Technologies, Paisley, UK) from tissue samples which had been ground to a fine powder in liquid nitrogen with a mortar and pestle. Integrity of RNA was validated on agarose gels and RNA purity was confirmed by spectrophotometry as described previously (Lyall, 1998). First-strand cDNA synthesis was performed using the Superscript Preamplification System (Life Technologies, Paisley, UK). Ten g (22 l) of each RNA sample was reverse transcribed using oligo dT priming. Briefly, a 40 l reaction was prepared by adding 2 l 10 mmol/l dNTP mix, 4 l of 10 PCR buffer, 4 l 0.1 mol/l dithiothreitol, 2 l Superscript II and 4 l 25 mmol/l magnesium chloride. To this was added a mixture containing 2 l of oligo dT primers and 22 l of RNA (10 g) which had been first heated to 70C for 10 min and then cooled on ice. The resulting mix was incubated for 1 h at 42C. Control reactions were prepared for every sample where the reverse transcriptase was omitted. Two separate methods of PCR were performed. In the first PCR method the reaction mixture contained TGF-3 (Derynck, 1988) and actin primers, (Vandekarckhove, 1978) the latter serving as an internal control. Both sets of primers were synthesized commercially (Life Technologies, Paisley, UK) and were obtained from published human sequences of TGF-3 and actin. Each primer was synthesized with a fluorescein at the 5 end. The left (Fluoro-CAAAGGGCT CTGGTGGTCCTG) and right (Fluoro-TGGAGGTA AT TCCTTTAGGGC) TGF-3 primers were used to amplify a 373 base pair region of TGF-3 cDNA. The left (FluoroCTTCTACAATGAGCTGCGTG) and right (Fluoro-TCA TGAGGTAGTCAGTCAGG) actin primers were used to amplify a 305 base pair region of actin cDNA. The primers were selected to span an intron exon boundary so that should a genomic region be amplified, the expected product would be much larger than that of the mRNA region. No such genomic region was amplified in any sample. The PCR protocol was followed from the Superscript Preamplification System for First Strand cDNA Synthesis (Life Technologies, Paisley, UK) manual. For a 25 l reaction, 1 l of sample cDNA and negative control was placed in separate tubes. To each tube 24 l of master mix was added containing 2.5 l 10 PCR buffer, 1.5 l 25 mmol/l magnesium chloride, 0.5 l 10 mmol/l dNTP mix, 2.5 l of each of the four primers (1 mol/l), 0.25 l of Platinum Taq polymerase (Life Technologies, Paisley, UK) and 9.25 l of sterile water per reaction. An OMN-E Thermal Cycler (Hybaid, Ashford, UK) with heated lid was used for the PCR reactions. In preliminary experiments PCR reactions were performed for increasing cycle numbers to ensure that the reactions were performed when the reaction product was still increasing exponentially. For all subsequent experiments PCR was performed for 22 cycles. Amplification was achieved by an initial 94C soak for 5 min followed by 22 cycles of 94C for 30 sec, 60C for 30 sec and 72C for 30 sec. Two l of the final reaction was added to 3 l deionized formamide, 0.5 l loading dye and 0.5 l molecular weight standards (GeneScan 500 Rox size standards, Applied Biosystems). The reactions were
Simpson et al.: TGF- and Human Trophoblast Invasion
47
Figure 1. (a) and (b).
48
Placenta (2002), Vol. 23
Figure 1. (c). Figure 1. (A) Western blot analysis of placental samples from 7–19 weeks’ gestation using TGF-1 antibody. C, positive control (TGF-1; 20 ng recombinant full-length human protein). (B) Western blot analysis of placental samples from 7–19 weeks’ gestation using TGF-2 antibody. C, positive control (TGF-2; 2 ng recombinant full-length human protein). (C) Western blot analysis of placental samples from 7–19 weeks’ gestation using TGF-3 antibody. C, positive control (TGF-3; 10 ng recombinant full-length human protein).
heated to 94C for 5 min and cooled on ice. Three l of this mixture was separated on a 6 mm 6 per cent acrylamide gel (6 per cent sequencing gel solution-Sequa Gel-6, National Diagnostics, Atlanta, USA). Bands were scanned using standard Applied Biosystems GeneScan 672 software for a Macinotosh computer. The final results were expressed as a ratio of TGF-3 : actin. In the second PCR method the BioSource International Inc. (California, USA) multiplex PCR kit was used. This kit allows simultaneous detection of TGF- (328 base pairs), TGF-2 (497 base pairs), TGF-3 (222 base pairs) and GAPDH (615 base pairs) as an internal control. The kit also contains primers for TGF- (282 base pairs) and connective tissue growth factor (CTGF, 402 base pairs), a peptide that exhibits plateletderived growth factor-like activities and is secreted by fibroblast after activation with TGF- although neither were the focus of this study. The PCR primers have no 3 -end overlap and have similar Tm. The manufacturer’s instructions were followed exactly with 5 l of cDNA to start. The final products were separated on 1.5 per cent agarose gels.
ELISAS TGF-2 ELISA TGF-2 was measured using the Promega Emax Immunoassay System. Assays were performed on aliquots of the homogenates prepared for Western blot analysis as described previously (Simpson et al., 2001). The assay detects biologically active TGF-2 in an antibody sandwich format. The range of the assay is 32–1000 pg/ml. The specificity of the assay is <5 per cent cross reactivity with TGF-1 and TGF-3 at 10 ng/ml. Since some of the samples were higher than the highest standard a separate standard curve was made and the samples were reassayed so that they were measured within the linear range of the standards. In vivo TGF-2 is processed from a latent to a bioactive form. Only the bioactive form is immunoreactive with this kit. The bioactive form of TGF-2 can be produced in vitro by acid treatment of samples thus allowing the total amount of TGF-2 (bioactive and latent combined) in a sample to be
Simpson et al.: TGF- and Human Trophoblast Invasion
49
Table 1. Number of samples studied at each gestation in immunohistochemistry experiments TGF-1
TGF-2
TGF-3
Gestation (weeks)
Placenta
Placental bed
Placenta
Placental bed
Placenta
Placental bed
7 8 9 10 11 12 13 14 15 16 17 18 19
4 3 3 7 1 4 4 4 3 1 2 2 2
1 1 3 3 4 2 3 9 2 3 2 2 2
6 5 5 9 2 6 6 6 5 1 4 4 3
1 3 3 3 4 3 4 10 3 4 3 3 3
8 11 3 18 1 15 4 14 3 10 2 8 7
1 2 3 2 4 3 4 10 3 3 3 3 3
measured. However since it is the bioactive form which is most likely to influence trophoblast invasion the samples were not acid treated. For assays the samples were diluted 1 : 100 in the sample buffer supplied with the kit. After assay the final concentration of TGF-2 in the sample was calculated and expressed as pg TGF-2 per mg protein. TGF-3 ELISA The assay for TGF-3, which measures active protein, was performed on the same samples as for TGF-2 using an in house assay developed from reagents obtained from R&D Systems, Oxon, UK. The assay was modified from their suggested protocol as described previously (Lyall et al., 2001). Samples were diluted 1 : 2 or 1 : 5 in TBS pH 7.3 containing 0.05 per cent Tween-20 and 0.1 per cent BSA. Standards ranged from 2000 pg/ml to 4 pg/ml and all measurements obtained were above the minimal detectable level. As for TGF-2, after assay the final concentration of TGF-3 in the sample was calculated and expressed as pg TGF-3 per mg protein. Statistical analysis For immunohistochemical studies, statistical comparisons were performed using the Kruskal-Wallis 1-way ANOVA test. Comparison between gestations was then performed using the Mann–Whitney U test. For RT-PCR and ELISA statistical analysis was performed using Simple Regression analysis. Statistical differences were considered to be significant at P<0.05. RESULTS Western blots Figure 1 shows the results of Western blot analysis of placental samples from 7–19 weeks’ gestation using antibodies against
TGF-1 (a), TGF-2 (b) and TGF-3 (c). The number of samples necessitated running the samples on two gels. Running of gels, blotting and labelling were performed over the same two days to eliminate day to day variability for each antibody. Positive controls for TGF-1, TGF-2 and TGF-3 were clearly visible but neither active TGF-1, TGF-2 or TGF-3 were detectable in any of the samples. These data suggest that either there is very little or no active TGF-1, 2 and 3 in the placenta between 7 and 19 weeks’ gestation or that they are present at concentrations below the sensitivity of Western blot analysis which was approximately 0.5 ng for the positive control TGF-2 and >2 ng for TGF-1 and TGF-2. The nature of the higher molecular weight species may represent non-specific binding however this issue was not taken further.
Immunohistochemistry Table 1 shows the number of placental and placental bed samples used for immunohistochemical studies. Normal human skin was used as the positive control for all three antibodies (Figure 2). TGF-1 was expressed predominantly in the basal layer of the epidermis and in pilosebaceous units. TGF-2 was detected in all epidermal layers, although immunoreactivity was stronger in the basal layer. TGF-2 was also detected in pilosebaceous units and there was weak diffuse dermal reactivity. TGF-3 was present in all layers of the epidermis, and diffusely throughout the dermis. Reactivity of TGF-3 was also most prominent in the basal layer but TGF-3 immunoreactivity was generally weaker than that for TGF-1 and TGF-2. These results are largely in agreement with Frank et al. (1996). Controls in which primary antibody was omitted were negative. However, controls in which the primary antibody was replaced with appropriately diluted normal rabbit serum showed inconsistent weak to moderate reactivity with Hofbauer cells in the chorionic villous stroma in
50
Placenta (2002), Vol. 23
receptors on Hofbauer cells. The findings are illustrated in Figures 3 and 4. TGF-1. Villous syncytiotrophoblast and villous cytotrophoblast were consistently negative for TGF-1 throughout gestation [Figure 3(A)]. Cytotrophoblast columns and cytotrophoblast islands showed extracellular reactivity for TGF-1 (2) [Figure 3(E)] and this was consistent across the gestational age range examined. Perivillous and intervillous fibrin was positive (2–3) in all samples. Hofbauer cells were also positive in some samples (0–2) [Figure 3(A)] but as stated above, similar reactivity was observed in the normal rabbit serum control. In the placental bed there was focal extracellular reactivity in decidua (2) [Figure 3(H)] but decidual cells themselves were negative. All extravillous trophoblast populations in the placental bed were negative for TGF-1 [Figure 4(A,D)]. Extracellular reactivity (2) was noted in areas of fibrinoid surrounding transformed spiral arteries in both decidua and myometrium [Figure 4(A,D)]. Myometrial cells were negative. When present the cytotrophoblast shell showed extracellular reactivity (2) [Figure 3(D)]. There were no significant changes across gestation.
Figure 2. Immunohistochemical analysis of TGF-1 (upper panel), TGF-2 (middle panel) and TGF-3 (lower panel) antibodies on human breast skin. D (dermis), E (epidermis).
some placental samples. This serum reactivity was also observed in the same cases with all three anti-TGF- antibodies and most probably reflected nonspecific binding to Fc
TGF-2. Villous trophoblast was negative for TGF-2 [Figure 3(B)]. Hofbauer cells in villous stroma were variably positive (0–2) but reactivity mirrored that of normal rabbit serum and was considered non-specific. When identified, cytotrophoblast columns were variably positive (1). Cytotrophoblast islands showed both intracellular and extracellular staining, extracellular reactivity (2–3) being stronger than that in the cytoplasm (1–2) [Figure 3(F)]. In the placental bed decidual cells were consistently positive (1 or 2) with diffuse cytoplasmic reactivity [Figure 2(I)]. Extracellular positivity (2) was noted around transformed decidual and myometrial spiral arteries, although reactivity was more diffuse than for TGF-1 [Figure 4(B,E)]. Myometrial cells were weakly positive (1) [Figure 4(E,G,H)]. Interstitial and endovascular trophoblast populations were variably positive for TGF-2 in all specimens throughout the gestational range examined. Reactivity in interstitial trophoblast, including trophoblast giant cells, ranged from negative (0) to strongly positive (3) [Figure 4(G,H)]. There was no obvious pattern to this reactivity, negative and positive cells being detected in both decidua and myometrium and in both a perivascular location and distant from vessels. Endovascular trophoblast reactivity was weaker ranging from negative to moderate (0–2) [Figure 4(B,E)]. Reactivity for TGF-2 did not vary significantly with gestation. TGF-3. A total of 104 placental samples were stained for TGF- across a range of gestation (Table 1). TGF-3 was not detected in villous syncytiotrophoblast or cytotrophoblast nor in cytotrophoblast columns or islands in any of the samples [Figure 3(C,G)]. In common with anti-TGF-1 and TGF-2 there was non-specific reactivity with Hofbauer cells. In the
Figure 3. Cryostat sections of placenta and placental bed immunostained for TGF-1 (a,d,e,h), TGF-2 (b,f,i) and TGF-3 (c,g,j). (a) placenta 17 weeks’ gestation shows TGF-1 in fibrin (arrowed). Non-specific staining of Hofbauer cells is seen in the villous stroma (VS). (b) 16 weeks’ placenta shows only nonspecific Hofbauer cell reactivity for TGF-2. (c) 12 weeks’ placenta shows no reactivity for TGF-3 in villous trophoblast or in cytotrophoblast column (COL). (d) shows cytotrophoblast shell (SHELL) and superficial decidua (DEC) in 19 weeks’ sample. Note extracellular reactivity, especially in the shell. (e,f,g) cytotrophoblast island in 9 weeks’ gestation placenta. Note extracellular reactivity for TGF-1 (e), intracellular and extracellular TGF-2 reactivity (f) and no reactivity for TGF-3 (g). Syncytiotrophoblast (arrowed) is negative. (h,i) 15 weeks’ gestation decidua shows extracellular TGF-1 immunostaining and cytoplasmic TGF-2 reactivity. (j) shows no reactivity in 11 week decidua for TGF-3. Endovascular trophoblast in a spiral artery (SA; lumen arrowed) is also negative. Original magnifications: a–g,j 200; h,i 400.
Figure 4. Cryostat sections of placental bed immunostained for cytokeratin (c), TGF-1 (a,d), TGF-2 (b,e,g,h) and TGF-3 (f). (a,b) 11 week sample showing endovascular trophoblast in a decidual spiral artery (SA). TGF-1 in detected only extracellularly, whereas TGF-2 is present in decidua (DEC), weakly in endovascular trophoblast as well as extracellularly. (c,d,e,f) myometrial spiral artery (SA) at 16 weeks’ gestation. Cytokeratin-positive trophoblast (c) in the spiral artery (SA) and surrounding myometrium is negative for TGF-1 (d) and TGF-3 (f) but shows variable reactivity for TGF-2 (e). Perivascular extracellular reactivity for TGF-1 and TGF-2 is also present. (g,h) variable TGF-2 immunoreactivity in mononuclear and multinucleate interstitial trophoblast (arrowed) in myometrium at (g) 19 weeks, (h) 17 weeks’ gestation. Original magnifications: a,b,g 200; c–f 160; h 400.
Simpson et al.: TGF- and Human Trophoblast Invasion
53
pairs) was expressed in all samples with no differences across the gestations studied. This was the most abundant of the TGF- forms investigated. TGF-1 mRNA was only just detectable in some samples but no differences were noted across gestation. Finally TGF-3 was identified in all samples. While there was variation in the amount of TGF-3 in the samples, as for TGF-1 and TGF-2, no pattern across gestation was identified. While not the focus of the study, TGF- and CTGF were present in all samples but at much lower levels than TGF-1, 2 or 3.
ELISA The results for the TGF-2 ELISA on placental homogenates are shown in Figure 8. TGF-2 was detectable in all samples. There was no evidence of any consistent variation across gestation (P<0.05), consistent with the immunohistochemical and RT-PCR findings. The results for the TGF-3 ELISA are shown in Figure 9. Concentrations of TGF-3 in the placental samples were much lower than those of TGF-2. There was no evidence of a rise followed by a decrease in TGF-3 concentrations at any gestation. These results are again consistent with the immunohistochemical and RT-PCR findings.
Figure 5. Gel analysis of RNA from cases used for RT-PCR.
0.8
TGF β3:actin
0.6
DISCUSSION
0.4
0.2
0
7
8
9 10 11 Gestational age (weeks)
12
Figure 6. RT-PCR analysis of TGF-3 using fluorescent primers. Results are obtained as ratio of TGF-3.actin. Two samples from each gestation are shown.
placental bed TGF-3 was not detected in extravillous trophoblast [Figure 3(J,F)], the only reactivity being with occasional lymphocytes in decidua and myometrium.
RT-PCR Figure 5 shows the RNA for each of the samples studied confirming that the RNA was intact prior to spectrophotometric analysis. Figure 6 shows the results of the PCR method using the fluorescein-labelled primers. RNA for TGF-3 was identified in all of the samples. There were no statistically significant differences in TGF-3 mRNA across the gestational ages studied (7–12 weeks). Figure 7 shows analysis of the same samples using the Multiplex PCR kit as an alternative method of assessing TGF- mRNA levels. TGF-2 (497 base
We believe that the present study is the most comprehensive investigation of TGF- expression in the placenta and placental bed during the key period of trophoblast invasion and spiral artery transformation. Several different techniques were used to determine mRNA and protein expression and results were generally consistent. TGF-1 protein was undetectable by Western blot analysis. However the more sensitive method of RT-PCR confirmed the presence of TGF-1 mRNA in placental homogenates between 7–19 weeks’ gestation. TGF-2 was produced in both the placenta and placental bed where it was localized mainly to cytotrophoblast islands and decidua. Villous trophoblast was consistently negative. Much lower levels of TGF-3 were present in placental homogenates. Immunolocalization studies showed no reactivity for TGF-3 in placenta apart from non-specific binding to Hofbauer cells. The low levels of TGF-3 detected by ELISA were presumably below the sensitivity of the immunostaining. Levels of TGF-1, TGF-2 and TGF-3 did not change between 7–19 weeks of pregnancy. These results suggest that TGF-2, but not TGF-1 or TGF-3, may play a role in trophoblast invasion. Specifically we have been unable to confirm a dramatic reduction in trophoblast TGF-3 expression at the time of the first or second wave of trophoblast invasion. Western blotting proved to be insufficiently sensitive to detect bioactive TGF-1, TGF-2 or TGF-3. The antibodies bind both the latent and active forms of the TGF-.
54
Placenta (2002), Vol. 23
Figure 7. RT-PCR analysis of TGF-1, TGF-2 and TGF-3 using the Multiplex PCR kit. L; molecular weight ladder, C, control cDNAs supplied with the kit.
The upper complex of bands seen in the blots represents some non-specific binding to very high molecular weight components (typical of most polyclonal antibodies) and probably also to the latent form of the protein. No differences in these higher molecular weight components were found across gestation. These bands would not be present in the recombinant sample. Interpretation of early immunohistochemical studies of TGF- in the human placenta is confounded by the use of antibodies which are not specific for individual isoforms (Lysiak et al., 1995; Selick et al., 1994; Vuckovic et al., 1992). More recent studies, including the present one, have used antibodies specific for each isoform. Comparison of studies is further confounded by the variability of techniques used for tissue preparation and immunostaining with many studies using paraffin sections. Furthermore all previous studies have reported results only for on total TGF protein, much of which is latent. Incorporation of an ELISA immunoassay, which measures only bioactive forms, is therefore likely to yield additional, and probably more functionally relevant information. Lysiak et al. (1995) examined TGF- expression at 11, 14 and 18 weeks’ gestation in paraffin-embedded placentae. Two
antibodies, one which recognizes TGF-1 and 2 and one which recognizes TGF-2, were used. Both antibodies produced extracellular decidual staining and staining in syncytiotrophoblast and some Hofbauer cells. With this combination of antibodies only conclusions on TGF-2 could be drawn. A systematic coverage of gestations between 7–19 weeks’ gestation was not performed. Placental bed biopsies were not studied. Vuckovick et al. (1992) reported that TGF- was expressed solely in syncytiotrophoblast in paraffin embedded placentae at 6–8 weeks’ gestation. The 7–19 week gestational age was not covered. No details of which isoforms of TGF- were detected by the antibody were reported. The expression of TGF-1, 2 and 3 in placenta and decidua in 21 cases between 5–12 weeks’ gestation has been examined by Ando et al. (1998). The data were collectively presented as two groups, from 5–8 weeks’ gestation and from 9–12 weeks’ gestation. Using RT-PCR TGF-1 was present in both groups in villous and decidual tissue. Similar findings for TGF-2 were reported but TGF-2 expression was lower than TGF1. TGF-3 was expressed at the lowest level of the TGF-s and expression was also similar in the 5–8 and 9–12 week group suggesting there was very little TGF-3 in placentae in
Simpson et al.: TGF- and Human Trophoblast Invasion
55
4000
[TGF β2] pg/mg protein
3000
2000
1000
0 7
8
9
10
11
12 13 14 Gestation (weeks)
15
16
17
18
19
Figure 8. ELISA for biologically active TGF-2 in placenta samples from 7–19 weeks’ gestation.
25
[TGF β3] pg/mg protein
20
15
10
5
0
7
7
7
8
8
8
9
9
9
10 10
11 11
12 12 12
14 14 14
15
16 16
17 17
18 19
Gestation (weeks) Figure 9. ELISA for biologically active TGF-3 in placenta samples from 7–19 weeks’ gestation.
the first trimester. In situ hybridization studies revealed that TGF-1 was expressed in decidual cells and villous cytotrophoblast. TGF-2 expression was weak in placenta and present in decidual cells. In situ localization of TGF-3 mRNA was not studied. A further study (Selick et al., 1994) examined TGF- expression in eight first trimester decidua and placental samples and in four second trimester placental samples. These samples were embedded in paraffin. Two antibodies, one which recognizes TGF-1 and one which recognizes TGF-1
and TGF-2 were used. Similar findings were found with each antibody. TGF- staining was found in all tissues examined. The authors did not report the gestations studied and the inference from the study was that, while the numbers were small, no gestational age effects were noted. TGF- staining was reported to be moderate in villous cytotrophoblast, syncytiotrophoblast and in non-villous cytotrophoblast adjacent to villi but light in non-villous cytotrophoblast distal to villi. Trophoblast surrounding maternal vessels exhibited moderate to intense staining. Staining was also reported within the
56
decidua. Due to the antibodies used, the authors pointed out that the subtype of TGF- identified is not unequivocal but is likely to be TGF-1 and/or TGF-2. The absence of any documented changes over the time of invasion is consistent with trophoblast-derived TGF-1 not involved in the regulation of this process. Our immunohistochemical data suggest that TGF-1 is present in fibrin and fibrinoid in spiral arteries and is present extracellularly in decidua, cytotrophoblast islands and cell columns but not in villous trophoblast across the gestational range studied. TGF-1 was undetectable in villous tissue by Western blot analysis in placental samples. However the more sensitive method of RT-PCR confirmed the presence of TGF-1 mRNA. Collectively, our data support a role for decidual TGF-1 in regulating trophoblast invasion although there was no evidence of a temporal or spatial regulation of this cytokine from 7–19 weeks’ gestation. Our RT-PCR findings on TGF-1 in placenta are consistent with Caniggia et al. (1999) however the group did not report immunohistochemical data for TGF-1. We did however find similar staining patterns for TGF-1 when using the identical methodology of Caniggia et al. (not shown) although greater non-specific staining was found in the control samples than was observed with our standard technique. The placental bed was not studied by this group for any of the TGF-s. With regard to TGF-2 our immunohistochemical findings suggest that TGF-2 is variably present in cytotrophoblast, cytotrophoblast islands showed both intracellular and extracellular staining, extracellular reactivity being stronger than that in the cytoplasm. In the placental bed decidual cells were consistently positive. Extracellular positivity was noted around transformed decidual and myometrial spiral arteries, although reactivity was more diffuse than for TGF-1. Myometrial cells were weakly positive. Interstitial and endovascular trophoblast populations were variably positive for TGF-2 in all specimens throughout the gestational range examined. Reactivity in interstitial trophoblast, including trophoblast giant cells, ranged from negative to strongly positive. There was no obvious pattern to this reactivity, negative and positive cells being detected in both decidua and myometrium and in both a perivascular location and distant from vessels. Endovascular trophoblast reactivity was weaker ranging from negative to moderate. Reactivity for TGF-2 did not vary significantly with gestation. Our RT-PCR findings on TGF-2 are consistent with Caniggia et al. however, as for TGF-1, they did not report immunohistochemical data for TGF-2. Our data on TGF-2 do not support a role in the temporal regulation of trophoblast invasion however the fact that this cytokine is continually expressed throughout pregnancy does suggest it plays some role in trophoblast function. It is impossible to determine the precise cellular source of the extracellular matrix immunostaining. Our findings for TGF-3 were quite unexpected. We set out to extend the observations of Caniggia et al. by focussing on EVT in the placental bed during the period of spiral artery transformation. However we were unable to confirm their
Placenta (2002), Vol. 23
observation of a downregulation of TGF-3 in placental tissue at 9 weeks’ gestation using any of the techniques. Immunohistochemical analysis showed TGF-3 was not detected in villous syncytiotrophoblast or cytotrophoblast nor in cytotrophoblast columns or islands in any of the samples. In common with anti-TGF-1 and TGF-2 there was nonspecific reactivity with Hofbauer cells. In the placental bed TGF-3 was not detected in extravillous trophoblast, the only reactivity being with occasional lymphocytes in decidua and myometrium. While our data suggest that TGF-3 is present at very low levels in placenta and placental bed, most importantly we found no changes across gestation even though our study extended to 19 weeks’ gestation. We attempted to use the same primers for the RT-PCR as Caniggia et al. however since their published right primer only matched the rat and not the human sequence it was necessary to use a different right primer. Our mRNA results were confirmed with a multiplex PCR kit. Western blots confirmed the low levels of TGF-3. TGF-3 is synthesized as a latent protein and then cleaved to form a biologically active protein. As a further confirmation we measured TGF-3 levels between 7–19 weeks of pregnancy using ELISA. Unlike other methods to study TGF-3, the ELISA used in the present study only detects biologically active protein. Thus the results are more likely to be biologically relevant. Our findings for placental TGF-3 are in agreement with Ando et al. (1998). Thus it seems unlikely that TGF-3 is a key regulator of trophoblast in vivo. There is evidence that TGF- can regulate trophoblast invasion in vitro although the data are not consistent: Graham et al. (1992) reported that exposure of first trimester trophoblast to TGF-1 or TGF-2 significantly inhibited proliferation, the first step in the invasive process. This group also reported that decidual cell extract and TGF-1 suppressed invasion of trophoblast cells. The authors concluded that decidual, and to a minor extent, trophoblast derived TGF-1 is a prime mediator of trophoblast invasion. However Bass et al. (1994) found that while epidermal growth factor increased invasiveness of trophoblast in vitro, TGF-1 had no effect. The effects of TGF-3 were not reported. Caniggia et al. (1998) found that while TGF-3 antibodies and antisense oligonucleotides inhibited outgrowth from villous explants, inhibition of TGF-1 or TGF-2 had no effect. It is not clear why in vitro data are not consistent between groups but the discrepancies may be related to the cell preparation techniques or the culture conditions employed. The environment of the early placenta is hypoxic (Jaffe et al., 1987). At this time plugs of trophoblast block the maternal spiral arteries (Burton et al., 1999). The plugs are subsequently displaced and blood flow begins at approximately 11 weeks of pregnancy. As a result partial pressure of oxygen increases from 18 mm Hg at 8–10 weeks’ gestation to 60 mm Hg at 12–13 weeks’ gestation. Studies using placental villous explants cultured on three-dimensional extracellular matrix have shown that trophoblast are sensitive to oxygen; first trimester villi explanted in 20 per cent oxygen form new columns at their tips (Aplin, 1999; Genbacev, 1997; Vicovac
Simpson et al.: TGF- and Human Trophoblast Invasion
et al., 1996) whereas low oxygen (2–3 per cent) maintains trophoblast in a proliferative non-invasive phenotype (Genbacev et al., 1996). It has been known for some time that proliferation of cytotrophoblasts is higher at low oxygen concentrations (Fox, 1964; Kingdom and Kaufmann, 1997) although the mechanisms whereby the placenta sensed changes in oxygen concentration were hitherto unknown. However, insight into possible mechanisms has come from studies by Caniggia et al. who suggested that transcription factor, hypoxia inducible factor (HIF)-1 (Semenza et al., 1998) is involved (Caniggia et al., 2000). Interpretation of the findings by Caniggia et al. are not straightforward for several reasons. Firstly, interstitial invasion occurs as a result of trophoblast migrating through the decidua and reaching the inner myometrium at 8 weeks’ gestation (Pijnenborg et al., 1980). The precise time when decidual invasion begins but is thought to be in very early pregnancy. In rhesus monkeys endovascular trophoblast is present as early as 5 days after implantation (Enders et al., 1956). Thus cytotrophoblast proliferation occurs before and after the oxygen transition and there is no morphological evidence that maximal trophoblast invasion occurs at 9 weeks’ gestation, the time when TGF-3 expression was reported to decline. Second, trophoblast invasion occurs via both an interstitial pathway and an intravascular pathway the latter being reported to occur in
57
two waves (Pijnenborg et al., 1998); the first into the decidual segments of spiral arteries at 8–10 weeks’ gestation and the second wave of invasion into myometrial segments at 16–18 weeks’ gestation (Pijnenborg et al., 1983). The temporal expression of TGF-3 is not in keeping with these morphological observations. Thirdly Aplin has pointed out that de novo column formation occurs in 20 per cent oxygen (Genbacev et al., 1996; Aplin et al., 1999). Finally TGF- is expressed in decidua, the very environment where trophoblast migration occurs. There are obvious advantages for the mother to limit the extent of trophoblast invasion; decidual expression of TGF-1 and TGF-2 appears to be one possible mechanism. Finally in comparing the present study with that of Caniggia et al. it is important to note that in a subsequent study (Caniggia et al., 2000) the authors reported that placental ages were based on embryonic age (based on Carnegie classification) rather than gestational age based on last menstrual period or ultrasound. This would mean that the ages reported would be two weeks earlier than true gestational ages. In summary while our data agree with the concept that TGF-s may be involved in trophoblast invasion our data do not suggest temporal changes in expression of any of the isoforms with gestation.
ACKNOWLEDGEMENTS We are grateful to Action Research for the main funding of the project, to Elizabeth Duffie and Barbara Innes for technical assistance and to the British Heart Foundation and Tommy’s Campaign for additional support.
REFERENCES Ando N, Hirahara F, Fukushima J, Kawamoto S, Okuda K, Funabashi T, Gorai I & Minaguchi H (1998) Differential gene expression of TGF-beta isoforms and TGF-beta receptors during the first trimester of pregnancy at the human maternal-fetal interface. Am J Reprod Immunol, 40, 48–56. Aplin JD, Haigh T, Jones CJP, Church HJ & Vicovac LJ (1999) Development of cytotrophoblast columns from explanted first trimester placental villi: role of fibronectin and integrin 51. Biol Reprod, 60, 828–838. Bass KE, Morrish DW, Roth I, Bhardwaj D, Taylor R, Zhou Y & Fisher SJ (1994) Human cytotrophoblast invasion is upregulated by epidermal growth factor. Evidence that paracrine factors modify this process. Dev Biol, 164, 560–561. Blankenship TN, Enders AC & King BF (1993) Trophoblastic invasion and modification of uterine veins during placental development macaques. Cell Tissue Res, 274, 135–244. Bradford MM (1976) A refined and sensitive method for the quantitation of proteins utilizing the principle of protein-dye binding. Anal Biochem, 72, 248–254. Brosens I, Robertson WB & Dixon HG (1967) The physiological response of the vessels of the placental bed to normal pregnancy. J Path Bacteriol, 93, 569–579. Burton GJ, Jauniaux E & Watson AL (1999) Maternal arterial connections to the placental intervillous space during the first trimester of human pregnancy: the Boyd collection revisited. Am J Obstet Gynecol, 181, 718–724. Caniggia I, Post M & Lye SJ (1998) Restoration of trophoblast invasion capability in preeclamptic villous explants by antisense knock-down of TGF3. J Soc Gynecol Invest, 5, 66A.
Caniggia I, Grisaru-Gravnosky S, Kuliszewsky M, Post M & Lye SJ (1999) Inhibition of TGFB3 restores the invasive capability of extravillous trophoblasts in pre-eclamptic pregnancies. J Clin Invest, 103, 1641–1650. Caniggia I, Mostachfi H, Winter J, Grassmann M, Lye SJ, Kuliszewski M & Post M (2000) Hypoxia-inducible factor-1 mediates the biological effects of oxygen on human trophoblast differentiation through TGF-3. J Clin Invest, 105, 577–587. Derynck R, Lindequist PB, Lee A, Wen D, Tamm J, Graycar JL, Rhee L, Mason AJ, Miller DA, Coffey RJ, Moses HL & Chen EY (1988) A new type of transforming growth factor beta 3. EMBO J, 7, 3737–3743. De Wolf F, De Wolf-Peeters C & Brosens I (1973) Ultrastructure of the spiral arteries in human placental bed at the end of normal pregnancy. Am J Obstet Gynecol, 117, 833–848. Enders AC, Rock J & Adams AC (1956) Implantation in the rhesus monkey: initial penetration of endometrium. Am J Anat, 167, 275–298. Fox H (1964) The villous trophoblast as an index of placental ischaemia. J Obstet Gynaecol, Br Commwlth, 71, 885–893. Frank S, Madlener M & Werner S (1996) Transforming growth factors TGF 1, 2 and 3 and their receptors are differentially regulated during normal and impaired wound healing. J Biol Chem, 271, 10188–10193. Genbacev O, Joslin R, Damsky CH, Polliotti BM & Fisher SJ (1996) Hypoxia alters early gestation human cytotrophoblast differentiation/ invasion in vitro and models the placental defects that occur in preeclampsia. J Clin Invest, 97, 540–550. Genbacev O, Zhou Y, Ludlow JW & Fisher SJ (1997) Regulation of human placental development by oxygen tension. Science, 277, 1669–1672. Graham CH, Lysiak JJ, McCrae KR & Lala PK (1992) Localization of transforming growth factor-B at the human fetal-maternal interface: role in trophoblast growth and differentiation. Biol Reprod, 46, 561–572. Hustin J, Jauniaux E & Schaaps JP (1990) Histological study of the materno-embryonic interface in spontaneous abortion. Placenta, 11, 477– 486.
58 Jaffe R, Jauniaux E & Hustin J (1987) Maternal circulation in the first trimester human placenta: myth or reality? Am J Obstet Gynecol, 176, 695–705. Jauniaux E, Zaidi J, Jurkovic D, Campbell S & Hustin J (1994) Comparison of colour Doppler features and pathological findings in complicated early pregnancy. Hum Reprod, 12, 2432–2437. Khong TY, De Wolf F, Robertson WB & Brosens I (1986) Inadequate maternal vascular response to placentation in pregnancies complicated by pre-eclampsia and by small-for-gestational age infants. Br J Obstet Gynaecol, 93, 1049–1059. Khong TY, Liddell HS & Robertson WB (1987) Defective haemochorial placentation as a cause of miscarriage: a preliminary study. Br J Obstet Gynaecol, 94, 649–655. Khong TY (1995) Placental changes in fetal growth retardation. Fetus and Neonate. In Physiology and Clinical Applications (vol 3) (Eds) Hanson MA, Spencer JAD & Rodeck CH. Cambridge: Cambridge University Press. Kingdom JCP & Kaufmann P (1997) Oxygen and placental villous development: origins of fetal hypoxia. Placenta, 18, 613–621. Lala PK & Hamilton GS (1996) Growth factors, proteases and protease inhibitors in the maternal-fetal dialogue. Placenta, 17, 545–555. Lyall F, Jablonka-Shariff A, Johnson RD, Olson LM & Nelson DM (1998) Gene expression of nitric oxide synthase in cultured human term placental trophoblast during in vitro differentiation. Placenta, 17, 253–260. Lyall F, Barber A, Myatt L, Bulmer JN & Robson SC (2000) Hemeoxygenase expression in human placenta and placental bed implies a role in regulation of trophoblast invasion and placental function. FASEB J, 14, 208–219. Lyall F, Robson SC, Bulmer JN, Kelly H & Duffie E (1999) Human trophoblast invasion and spiral artery transformation: the role of nitric oxide. Am J Pathol, 154, 1105–1114. Lyall F & Kaufmann P (2000) The uteroplacental circulation: Extravillous trophoblast. In Intrauterine Growth Restriction (Eds) Baker PN & Kingdom JCP, pp. 85–119. London: Springer-Verlag. Lyall F & Robson SC (2000) Defective extravillous trophoblast function and pre-eclampsia. In The Placenta: Basic science and clinical practice (Eds) Kingdom JCP, Jauniaux ERM & O’Brien SPM, pp. 79–96. London: RCOG Press. Lyall F, Simpson H, Bulmer JN, Barber A & Robson SC (2001) Transforming growth factor b expression in human placenta and placental bed in third trimester normal pregnancy, preeclampsia and fetal growth restriction. Am J Pathol, 159(5) (in press).
Placenta (2002), Vol. 23 Lysiak JJ, Hunt J, Pringle GA & Lala PK (1965) Localization of transforming growth factor beta and its natural inhibitor decorin in the human placenta and decidua throughout gestation. Placenta, 16, 221–231. Michel MZ, Khong TY, Clark DA & Beard RWA (1990) Morphological and immunological study of human placental bed biopsies in miscarriage. Br J Obstet Gynaecol, 97, 984–988. Pepper MS (1997) Transforming growth factor-beta: Vasculogenesis and vessel wall integrity. Cytokine and Growth Factor Reviews, 8, 21–24. Pijnenborg R, Dixon G, Robertson WB & Brosens I (1980) Trophoblastic invasion of human decidua from 8 to 18 weeks of pregnancy. Placenta, 1, 3–19. Pijnenborg R, Bland JM, Robertson WB & Brosens I (1983) Uteroplacental arterial changes related to interstitial trophoblast migration in early human pregnancy. Placenta, 4, 397–414. Pijnenborg R, Anthony J, Davey DA, Rees A, Tiltman A, Vercruysse L & Van Assche FA (1991) Placental bed spiral arteries in the hypertensive disorders of pregnancy. Br J Obstet Gynaecol, 98, 648–655. Roberts JM & Redman CW (1993) Pre-eclampsia: more than pregnancyinduced hypertension. Lancet, 341, 1447–1451. Selick CE, Horowitz GM, Gratch M, Scott RT Jr, Navot D & Hofmann GE (1994) Immunohistochemical localization of transforming growth factor- in human implantation sites. J Clin Endocrinol Metabol, 78, 592–596. Semenza GL (1998) Hypoxia-inducible factor-1 and the molecular physiology of oxygen homeostasis. J Lab Clin Med, 131, 207–214. Sheppard BL & Bonnar J (1976) The ultrastructure of the arterial supply of the human placenta in pregnancy complicated by fetal growth retardation. J Obstet Gynaecol Br Cwlth, 83, 948–959. Sheppard BL & Bonnar J (1981) An ultrastructural study of utero placental arteries in hypertensive and normotensive pregnancy and fetal growth retardation. Br J Obstet Gynaecol, 88, 695–705. Vandekarckhove J & Weber K (1978) Mammalian cytoplasmic actins are the products of at least two genes and differ in primary structure in at least twenty five identified positions from skeletal muscle actins. Proc Natl Acad Sci USA, 75, 1106–1110. Vicovac L & Aplin JD (1996) Epithelial-mesenchymal transition during trophoblast differentiation. Acta Acta Anat, 156, 202–216. Vuckovic M, Genbacev O & Kumar S (1992) Immunolocalization of transforming growth factor beta in 1st and 3rd trimester human placenta. Pathobiol, 60, 149–150.
Transforming Growth Factor Expression in Human Placenta and Placental Bed During Early Pregnancy H. Simpsona, S. C. Robsona, J. N. Bulmerb, A. Barberc and F. Lyallc,d a Department of Obstetrics and Gynaecology, and b Department of Pathology, University of Newcastle upon Tyne, Royal Victoria Infirmary, Newcastle-upon-Tyne, NE1 4LP, UK and c,dMaternal and Fetal Medicine Section, Institute of Medical Genetics, University of Glasgow, Yorkhill, Glasgow, G3 8SJ, UK Paper accepted 5 October 2001
Normal human pregnancy depends on physiological transformation of spiral arteries. Pre-eclampsia and fetal growth restriction are associated with impaired trophoblast invasion and spiral artery transformation. Recent data obtained from studies on placenta suggest that temporal changes in expression of TGF-3 play a key role in trophoblast invasion and that over-expression of TGF-3 in pre-eclampsia is responsible for inadequate trophoblast invasion. There are, however, no studies of specific TGF-s in the placental bed throughout pregnancy although this is where the invasive trophoblast and spiral arteries are located. In this study we have used immunohistochemistry, Western blot analysis, ELISA and RT-PCR to examine the expression of TGF-1, TGF-2 and TGF-3 in placental bed biopsies and placentas from 7–19 weeks’ gestation. The results show that TGF-1, 2 and 3 are expressed in the placenta throughout this time but the striking temporal changes in TGF-3 expression previously reported were not observed. Extravillous trophoblast within the placental bed expressed TGF-2 but not TGF-1 or TGF-3 while extracellular TGF-1 and cytoplasmic TGF-2 were detected in decidua. These data suggest that TGF-1 and TGF-2 but not TGF-3 may play a role in trophoblast invasion. 2002 Harcourt Publishers Ltd Placenta (2002), 23, 44–58
INTRODUCTION During early human pregnancy, extravillous cytotrophoblast (CTB) from anchoring villi invade the decidualized endometrium and myometrium (interstitial trophoblast) and also migrate in a retrograde direction along the spiral arteries (endovascular trophoblast) transforming them into large diameter vessels of low resistance (Pijnenborg et al., 1983). Endovascular trophoblast invasion has been reported to occur in two waves; the first into the decidual segments of spiral arteries at 8–10 weeks’ gestation and the second into myometrial segments at 16–18 weeks’ gestation (Pijnenborg et al., 1983). This physiological transformation is characterized by a gradual loss of the normal musculoelastic structure of the arterial wall and replacement by amorphous fibrinoid material in which trophoblast cells are embedded (Brosens et al., 1967; De Wolf et al., 1973; Khong et al., 1986; Pijnenborg et al., 1980; Sheppard et al., 1976). These physiological changes are required for a successful pregnancy. Failure of trophoblast invasion and spiral artery transformation has been documented in pre-eclampsia (PE), one of the d To whom correspondence should be addressed at: Maternal and Fetal Medicine Section, Institute of Medical Genetics, Yorkhill, Glasgow, G3 8SJ, UK. Tel: 0044 (0)141 201 0657; Fax: 0044 (0)141 357 4277; E-mail: [email protected]
0143–4004/02/010044+15 $35.00/0
leading causes of maternal death. In this syndrome reduced utero-placental perfusion is associated with widespread endothelial dysfunction and fetal growth restriction (FGR) leading to significant maternal and perinatal morbidity (Roberts and Redman, 1993). Similar spiral artery abnormalities have been reported in the placental bed of women with FGR in the absence of maternal hypertension as well as miscarriage (Hustin et al., 1990; Jauniaux et al., 1994; Khong et al., 1987, 1995; Michel et al., 1990; Pijnenborg et al., 1991; Sheppard et al., 1976, 1981). Thus failure of the spiral arteries to undergo physiological transformation may lead to a spectrum of pregnancy failure. Despite the importance of trophoblast invasion and vascular remodelling the processes controlling them are still not well understood. However they are thought to include changes in expression of cell adhesion molecules, matrix metalloproteinases and their tissue inhibitors and growth factors and their receptors (Lyall and Kaufmann, 2000; Lyall and Robson, 2000). Transforming growth factor-s (TGF-s) are members of a large superfamily of cytokines including activins, inhibins, bone morphogenic proteins and others (Pepper, 1997). The TGF family is composed of three related 25 kDa homodimeric proteins TGF-1, 2 and 3. TGF-s exert their biological effects by binding to cell surface receptors designated types I, II and III. A number of studies have suggested that TGF-, 2002 Harcourt Publishers Ltd
Simpson et al.: TGF- and Human Trophoblast Invasion
produced primarily by the decidua, may regulate trophoblast invasion (Lala and Hamilton, 1996). Recently it was reported that TGF-3 in trophoblast is a major regulator of trophoblast invasion in vivo and in vitro (Caniggia et al., 1999). Expression of TGF-3 in placental villous tissue was reported to be low at 5–6 weeks’ gestation, peaking at 7–8 weeks’ gestation and then was virtually undetectable by 9 weeks. It was reported that this coincided with the time of maximal trophoblast invasion. Furthermore this group also reported that TGF-3 was weakly expressed in third trimester placentas but was strongly expressed in placentas obtained from women with PE. It was suggested that over-expression of TGF-3 in PE may account for failure of trophoblast invasion. Despite the possible importance of TGF-s in trophoblast invasion no study has systematically investigated expression of TGF-s in the placental bed throughout the period of trophoblast invasion and spiral artery transformation. Thus in this paper we have used immunohistochemistry, ELISA, Western blotting and RT-PCR to examine the expression of TGF-1, 2 and 3 in placental bed biopsies and placentas from 7–19 weeks’ gestation.
MATERIALS AND METHODS Sample collection The procedure for collection of placentas and placental bed biopsies had been published previously (Lyall et al., 2000, 1999). Paired first and second trimester samples were obtained from women undergoing termination of apparently normal pregnancy at the Royal Victoria Infirmary, Newcastle upon Tyne. An initial ultrasound scan was performed to confirm fetal viability and to determine gestational age and placental position. After evacuation of the uterine contents, three placental bed biopsies were taken under ultrasound guidance using biopsy forceps (Wolf, UK) introduced through the cervix. Placental samples were collected from all cases. The study was approved by the Joint Ethics Committee of Newcastle and North Tyneside Health Authority and the University of Newcastle. All samples were snap frozen in liquid nitrogen-cooled isopentane and stored sealed at 70C until required. Cryostat sections (7 m) from each specimen were stained with haematoxylin and eosin for histological analysis. The number of cases at each studied at each gestation for each particular technique is shown in the appropriate section.
Antibodies and reagents Desmin (NCL-DES-DERII, 1 : 100) and cytokeratin (NCLLP34, 1 : 800) monoclonal antibodies were obtained from Novocastra, Newcastle upon Tyne, UK. A monoclonal antibody to Factor VIII related antigen was obtained from DAKO, Cambridge, UK and used at 1 : 800. Rabbit polyclonal antibodies raised against TGF-1 (SC146), TGF-2 (SC90)
45
and TGF-3 (SC820) were purchased from Santa Cruz Biotechnology Inc., California, USA. The antibodies bind both the latent and active forms of the TGF-. Full length human recombinant TGF-1 (12.5 kDa), TGF-2 (12.5 kDa), and TGF-3 (12.5 kDa) were obtained from Santa Cruz and used as positive controls in Western blots. All other reagents were obtained from Sigma Chemical Co. Poole, UK unless stated otherwise. SDS-PAGE and Western blots The detailed methodology of the Western blot analysis is described in our previous work (Simpson et al., 2001). Placentas were studied from 21 cases spread evenly between 7–19 weeks’ gestation. Prior to homogenization, a cryostat section from each block was cut and stained with haematoxylin and eosin (H&E) to confirm that the specimens were placenta. Each frozen piece of tissue was weighed, ground to a fine powder in liquid nitrogen and added to lysis buffer. The powder was homogenized, then spun to remove debris. The supernatant was aliquoted and stored at 70C until required. Protein concentrations were determined by the method of Bradford (1976) using bovine serum albumin (BSA) as a standard, and then diluted to the required concentration. Samples were mixed 1 : 1 with loading buffer and separated on 15 per cent sodium-dodecyl-sulphate polyacrylamide resolving gels. Each well was loaded with 75 g of protein. Low molecular weight range markers (Bio-Rad Laboratories, California, USA 20–106 kDa range) were loaded beside the samples. Following transfer to BioBlot NC nitrocellulose membranes Canada) filters were blocked for 1 h at room temperature (RT) in phosphate buffered saline (PBS) containing 5 per cent Marvel and 0.25 per cent Tween-20. The antibodies (diluted 1 : 1000 in PBS containing 3 per cent Marvel and 0.25 per cent Tween-20) were added for 1 h at room temperature (RT). The filters were rinsed once and then washed twice for 5 min in PBS containing 0.25 per cent Tween-20 and were then incubated with horseradish peroxidase-conjugated donkey anti-rabbit IgG (Diagnostics Scotland, Carluke, UK) diluted 1 : 2000 in PBS containing 0.25 per cent Tween-20 for 1 h at RT. Blots were washed once for 5 min followed by two 15 min washes in PBS containing 0.25 per cent Tween-20 followed by one 5 min wash in distilled water. Proteins were detected using the Amersham ECL detection system and filters were exposed to Hyperfilm ECL (Amersham, Buckinghamshire, UK). The data sheet accompanying the TGF- antibodies reported no cross-reactivity with other TGF-s. However prior to performing experiments, each of the antibodies was checked for cross-reactivity with the control TGF-1, 2 and 3. The results confirmed that each TGF- antibody did not cross react with the other TGF-s. The specificity of the antibodies was further validated in immunohistochemical studies (below). Immunohistochemistry Immunohistochemistry was performed using an avidin-biotin peroxidase method (Vectastain Elite rabbit kit, Vector
46
Laboratories, Peterborough, UK). Cryostat sections of placenta and placental bed sections (7 m) were mounted on APES-coated slides, air dried over night, fixed in acetone for 10 min at RT then wrapped in pairs and frozen at 20C until required. Each specimen was stained with H&E for histological analysis. In addition for placental bed biopsies, to assist in identification of spiral arteries and trophoblast, all sections were immunostained for cytokeratin (1 : 800) to detect trophoblast, desmin (1 : 100) to detect muscle and Factor VIII (1 : 800) detect endothelium. For TGF- immunolocalization sections were blocked with 1 per cent BSA for 30 min followed by the kit blocker for 20 min. Sections then underwent a further 45 min incubation in 0.1 per cent phenylhydrazine to block endogenous peroxidase staining. These and all subsequent steps were performed at RT. Sections were then incubated with for 1 h with antibodies to TGF-1, 2 or 3 at a dilution of 1 : 200 for TGF-1 and 1 : 250 for TGF-2 and TGF-3. The remaining steps were performed according to the instructions supplied with the kit using a biotinylated second antibody and reagents supplied with the kit. The reaction was developed with Fast diaminobenzidine tablets. Washes between each step were performed in TBS (0.15 mol/l TRIS, 0.15 mol/l buffered saline, pH 7.6). Sections were counterstained in Mayer’s haematoxylin (BDH, Poole, UK) and mounted in DPX synthetic resin (Raymond Lamb, London, UK). Omission of primary antibody or substitution with non-immune rabbit serum for the primary antibody were both included as controls. Sections were all stained on the same day for each antibody to eliminate day to day variations in immunostaining. Parallel sections of all placental and placental bed cases were immunostained with the cytokertain antibody to confirm whether immunostaining was associated with extravillous trophoblast. Intensity of immunostaining was scored 0–3 where 0 represented no staining, 1 represented weak staining, 2 represented moderate staining and 3 represented strong staining. Scoring was performed independently by two observers (FL and HS) blinded to the tissue identity. As there was no significant differences between the two sets of scores (ANOVA; P>0.05 for all comparisons), the results for one observer (FL) was used for subsequent analysis. Since the antibodies for this study had previously been used on skin, (Frank et al., 1996) normal human skin was used as a positive control tissue in the present study. Skin tissue was processed as for placental samples.
RNA extraction and RT-PCR for TGF- RT-PCR was performed on RNA prepared from frozen placental tissue. Gestational ages selected were chosen to span the period previously reported to show striking changes in TGF-3 expression (Caniggia et al., 1999). Hence two cases were studied at 7–12 weeks’ gestation. Prior to RNA extraction, a cryostat section was removed from each block on the cryostat to confirm that the samples comprised predominately placenta. Total RNA was prepared using the TRIzoL
Placenta (2002), Vol. 23
Reagent method (Life Technologies, Paisley, UK) from tissue samples which had been ground to a fine powder in liquid nitrogen with a mortar and pestle. Integrity of RNA was validated on agarose gels and RNA purity was confirmed by spectrophotometry as described previously (Lyall, 1998). First-strand cDNA synthesis was performed using the Superscript Preamplification System (Life Technologies, Paisley, UK). Ten g (22 l) of each RNA sample was reverse transcribed using oligo dT priming. Briefly, a 40 l reaction was prepared by adding 2 l 10 mmol/l dNTP mix, 4 l of 10 PCR buffer, 4 l 0.1 mol/l dithiothreitol, 2 l Superscript II and 4 l 25 mmol/l magnesium chloride. To this was added a mixture containing 2 l of oligo dT primers and 22 l of RNA (10 g) which had been first heated to 70C for 10 min and then cooled on ice. The resulting mix was incubated for 1 h at 42C. Control reactions were prepared for every sample where the reverse transcriptase was omitted. Two separate methods of PCR were performed. In the first PCR method the reaction mixture contained TGF-3 (Derynck, 1988) and actin primers, (Vandekarckhove, 1978) the latter serving as an internal control. Both sets of primers were synthesized commercially (Life Technologies, Paisley, UK) and were obtained from published human sequences of TGF-3 and actin. Each primer was synthesized with a fluorescein at the 5 end. The left (Fluoro-CAAAGGGCT CTGGTGGTCCTG) and right (Fluoro-TGGAGGTA AT TCCTTTAGGGC) TGF-3 primers were used to amplify a 373 base pair region of TGF-3 cDNA. The left (FluoroCTTCTACAATGAGCTGCGTG) and right (Fluoro-TCA TGAGGTAGTCAGTCAGG) actin primers were used to amplify a 305 base pair region of actin cDNA. The primers were selected to span an intron exon boundary so that should a genomic region be amplified, the expected product would be much larger than that of the mRNA region. No such genomic region was amplified in any sample. The PCR protocol was followed from the Superscript Preamplification System for First Strand cDNA Synthesis (Life Technologies, Paisley, UK) manual. For a 25 l reaction, 1 l of sample cDNA and negative control was placed in separate tubes. To each tube 24 l of master mix was added containing 2.5 l 10 PCR buffer, 1.5 l 25 mmol/l magnesium chloride, 0.5 l 10 mmol/l dNTP mix, 2.5 l of each of the four primers (1 mol/l), 0.25 l of Platinum Taq polymerase (Life Technologies, Paisley, UK) and 9.25 l of sterile water per reaction. An OMN-E Thermal Cycler (Hybaid, Ashford, UK) with heated lid was used for the PCR reactions. In preliminary experiments PCR reactions were performed for increasing cycle numbers to ensure that the reactions were performed when the reaction product was still increasing exponentially. For all subsequent experiments PCR was performed for 22 cycles. Amplification was achieved by an initial 94C soak for 5 min followed by 22 cycles of 94C for 30 sec, 60C for 30 sec and 72C for 30 sec. Two l of the final reaction was added to 3 l deionized formamide, 0.5 l loading dye and 0.5 l molecular weight standards (GeneScan 500 Rox size standards, Applied Biosystems). The reactions were
Simpson et al.: TGF- and Human Trophoblast Invasion
47
Figure 1. (a) and (b).
48
Placenta (2002), Vol. 23
Figure 1. (c). Figure 1. (A) Western blot analysis of placental samples from 7–19 weeks’ gestation using TGF-1 antibody. C, positive control (TGF-1; 20 ng recombinant full-length human protein). (B) Western blot analysis of placental samples from 7–19 weeks’ gestation using TGF-2 antibody. C, positive control (TGF-2; 2 ng recombinant full-length human protein). (C) Western blot analysis of placental samples from 7–19 weeks’ gestation using TGF-3 antibody. C, positive control (TGF-3; 10 ng recombinant full-length human protein).
heated to 94C for 5 min and cooled on ice. Three l of this mixture was separated on a 6 mm 6 per cent acrylamide gel (6 per cent sequencing gel solution-Sequa Gel-6, National Diagnostics, Atlanta, USA). Bands were scanned using standard Applied Biosystems GeneScan 672 software for a Macinotosh computer. The final results were expressed as a ratio of TGF-3 : actin. In the second PCR method the BioSource International Inc. (California, USA) multiplex PCR kit was used. This kit allows simultaneous detection of TGF- (328 base pairs), TGF-2 (497 base pairs), TGF-3 (222 base pairs) and GAPDH (615 base pairs) as an internal control. The kit also contains primers for TGF- (282 base pairs) and connective tissue growth factor (CTGF, 402 base pairs), a peptide that exhibits plateletderived growth factor-like activities and is secreted by fibroblast after activation with TGF- although neither were the focus of this study. The PCR primers have no 3 -end overlap and have similar Tm. The manufacturer’s instructions were followed exactly with 5 l of cDNA to start. The final products were separated on 1.5 per cent agarose gels.
ELISAS TGF-2 ELISA TGF-2 was measured using the Promega Emax Immunoassay System. Assays were performed on aliquots of the homogenates prepared for Western blot analysis as described previously (Simpson et al., 2001). The assay detects biologically active TGF-2 in an antibody sandwich format. The range of the assay is 32–1000 pg/ml. The specificity of the assay is <5 per cent cross reactivity with TGF-1 and TGF-3 at 10 ng/ml. Since some of the samples were higher than the highest standard a separate standard curve was made and the samples were reassayed so that they were measured within the linear range of the standards. In vivo TGF-2 is processed from a latent to a bioactive form. Only the bioactive form is immunoreactive with this kit. The bioactive form of TGF-2 can be produced in vitro by acid treatment of samples thus allowing the total amount of TGF-2 (bioactive and latent combined) in a sample to be
Simpson et al.: TGF- and Human Trophoblast Invasion
49
Table 1. Number of samples studied at each gestation in immunohistochemistry experiments TGF-1
TGF-2
TGF-3
Gestation (weeks)
Placenta
Placental bed
Placenta
Placental bed
Placenta
Placental bed
7 8 9 10 11 12 13 14 15 16 17 18 19
4 3 3 7 1 4 4 4 3 1 2 2 2
1 1 3 3 4 2 3 9 2 3 2 2 2
6 5 5 9 2 6 6 6 5 1 4 4 3
1 3 3 3 4 3 4 10 3 4 3 3 3
8 11 3 18 1 15 4 14 3 10 2 8 7
1 2 3 2 4 3 4 10 3 3 3 3 3
measured. However since it is the bioactive form which is most likely to influence trophoblast invasion the samples were not acid treated. For assays the samples were diluted 1 : 100 in the sample buffer supplied with the kit. After assay the final concentration of TGF-2 in the sample was calculated and expressed as pg TGF-2 per mg protein. TGF-3 ELISA The assay for TGF-3, which measures active protein, was performed on the same samples as for TGF-2 using an in house assay developed from reagents obtained from R&D Systems, Oxon, UK. The assay was modified from their suggested protocol as described previously (Lyall et al., 2001). Samples were diluted 1 : 2 or 1 : 5 in TBS pH 7.3 containing 0.05 per cent Tween-20 and 0.1 per cent BSA. Standards ranged from 2000 pg/ml to 4 pg/ml and all measurements obtained were above the minimal detectable level. As for TGF-2, after assay the final concentration of TGF-3 in the sample was calculated and expressed as pg TGF-3 per mg protein. Statistical analysis For immunohistochemical studies, statistical comparisons were performed using the Kruskal-Wallis 1-way ANOVA test. Comparison between gestations was then performed using the Mann–Whitney U test. For RT-PCR and ELISA statistical analysis was performed using Simple Regression analysis. Statistical differences were considered to be significant at P<0.05. RESULTS Western blots Figure 1 shows the results of Western blot analysis of placental samples from 7–19 weeks’ gestation using antibodies against
TGF-1 (a), TGF-2 (b) and TGF-3 (c). The number of samples necessitated running the samples on two gels. Running of gels, blotting and labelling were performed over the same two days to eliminate day to day variability for each antibody. Positive controls for TGF-1, TGF-2 and TGF-3 were clearly visible but neither active TGF-1, TGF-2 or TGF-3 were detectable in any of the samples. These data suggest that either there is very little or no active TGF-1, 2 and 3 in the placenta between 7 and 19 weeks’ gestation or that they are present at concentrations below the sensitivity of Western blot analysis which was approximately 0.5 ng for the positive control TGF-2 and >2 ng for TGF-1 and TGF-2. The nature of the higher molecular weight species may represent non-specific binding however this issue was not taken further.
Immunohistochemistry Table 1 shows the number of placental and placental bed samples used for immunohistochemical studies. Normal human skin was used as the positive control for all three antibodies (Figure 2). TGF-1 was expressed predominantly in the basal layer of the epidermis and in pilosebaceous units. TGF-2 was detected in all epidermal layers, although immunoreactivity was stronger in the basal layer. TGF-2 was also detected in pilosebaceous units and there was weak diffuse dermal reactivity. TGF-3 was present in all layers of the epidermis, and diffusely throughout the dermis. Reactivity of TGF-3 was also most prominent in the basal layer but TGF-3 immunoreactivity was generally weaker than that for TGF-1 and TGF-2. These results are largely in agreement with Frank et al. (1996). Controls in which primary antibody was omitted were negative. However, controls in which the primary antibody was replaced with appropriately diluted normal rabbit serum showed inconsistent weak to moderate reactivity with Hofbauer cells in the chorionic villous stroma in
50
Placenta (2002), Vol. 23
receptors on Hofbauer cells. The findings are illustrated in Figures 3 and 4. TGF-1. Villous syncytiotrophoblast and villous cytotrophoblast were consistently negative for TGF-1 throughout gestation [Figure 3(A)]. Cytotrophoblast columns and cytotrophoblast islands showed extracellular reactivity for TGF-1 (2) [Figure 3(E)] and this was consistent across the gestational age range examined. Perivillous and intervillous fibrin was positive (2–3) in all samples. Hofbauer cells were also positive in some samples (0–2) [Figure 3(A)] but as stated above, similar reactivity was observed in the normal rabbit serum control. In the placental bed there was focal extracellular reactivity in decidua (2) [Figure 3(H)] but decidual cells themselves were negative. All extravillous trophoblast populations in the placental bed were negative for TGF-1 [Figure 4(A,D)]. Extracellular reactivity (2) was noted in areas of fibrinoid surrounding transformed spiral arteries in both decidua and myometrium [Figure 4(A,D)]. Myometrial cells were negative. When present the cytotrophoblast shell showed extracellular reactivity (2) [Figure 3(D)]. There were no significant changes across gestation.
Figure 2. Immunohistochemical analysis of TGF-1 (upper panel), TGF-2 (middle panel) and TGF-3 (lower panel) antibodies on human breast skin. D (dermis), E (epidermis).
some placental samples. This serum reactivity was also observed in the same cases with all three anti-TGF- antibodies and most probably reflected nonspecific binding to Fc
TGF-2. Villous trophoblast was negative for TGF-2 [Figure 3(B)]. Hofbauer cells in villous stroma were variably positive (0–2) but reactivity mirrored that of normal rabbit serum and was considered non-specific. When identified, cytotrophoblast columns were variably positive (1). Cytotrophoblast islands showed both intracellular and extracellular staining, extracellular reactivity (2–3) being stronger than that in the cytoplasm (1–2) [Figure 3(F)]. In the placental bed decidual cells were consistently positive (1 or 2) with diffuse cytoplasmic reactivity [Figure 2(I)]. Extracellular positivity (2) was noted around transformed decidual and myometrial spiral arteries, although reactivity was more diffuse than for TGF-1 [Figure 4(B,E)]. Myometrial cells were weakly positive (1) [Figure 4(E,G,H)]. Interstitial and endovascular trophoblast populations were variably positive for TGF-2 in all specimens throughout the gestational range examined. Reactivity in interstitial trophoblast, including trophoblast giant cells, ranged from negative (0) to strongly positive (3) [Figure 4(G,H)]. There was no obvious pattern to this reactivity, negative and positive cells being detected in both decidua and myometrium and in both a perivascular location and distant from vessels. Endovascular trophoblast reactivity was weaker ranging from negative to moderate (0–2) [Figure 4(B,E)]. Reactivity for TGF-2 did not vary significantly with gestation. TGF-3. A total of 104 placental samples were stained for TGF- across a range of gestation (Table 1). TGF-3 was not detected in villous syncytiotrophoblast or cytotrophoblast nor in cytotrophoblast columns or islands in any of the samples [Figure 3(C,G)]. In common with anti-TGF-1 and TGF-2 there was non-specific reactivity with Hofbauer cells. In the
Figure 3. Cryostat sections of placenta and placental bed immunostained for TGF-1 (a,d,e,h), TGF-2 (b,f,i) and TGF-3 (c,g,j). (a) placenta 17 weeks’ gestation shows TGF-1 in fibrin (arrowed). Non-specific staining of Hofbauer cells is seen in the villous stroma (VS). (b) 16 weeks’ placenta shows only nonspecific Hofbauer cell reactivity for TGF-2. (c) 12 weeks’ placenta shows no reactivity for TGF-3 in villous trophoblast or in cytotrophoblast column (COL). (d) shows cytotrophoblast shell (SHELL) and superficial decidua (DEC) in 19 weeks’ sample. Note extracellular reactivity, especially in the shell. (e,f,g) cytotrophoblast island in 9 weeks’ gestation placenta. Note extracellular reactivity for TGF-1 (e), intracellular and extracellular TGF-2 reactivity (f) and no reactivity for TGF-3 (g). Syncytiotrophoblast (arrowed) is negative. (h,i) 15 weeks’ gestation decidua shows extracellular TGF-1 immunostaining and cytoplasmic TGF-2 reactivity. (j) shows no reactivity in 11 week decidua for TGF-3. Endovascular trophoblast in a spiral artery (SA; lumen arrowed) is also negative. Original magnifications: a–g,j 200; h,i 400.
Figure 4. Cryostat sections of placental bed immunostained for cytokeratin (c), TGF-1 (a,d), TGF-2 (b,e,g,h) and TGF-3 (f). (a,b) 11 week sample showing endovascular trophoblast in a decidual spiral artery (SA). TGF-1 in detected only extracellularly, whereas TGF-2 is present in decidua (DEC), weakly in endovascular trophoblast as well as extracellularly. (c,d,e,f) myometrial spiral artery (SA) at 16 weeks’ gestation. Cytokeratin-positive trophoblast (c) in the spiral artery (SA) and surrounding myometrium is negative for TGF-1 (d) and TGF-3 (f) but shows variable reactivity for TGF-2 (e). Perivascular extracellular reactivity for TGF-1 and TGF-2 is also present. (g,h) variable TGF-2 immunoreactivity in mononuclear and multinucleate interstitial trophoblast (arrowed) in myometrium at (g) 19 weeks, (h) 17 weeks’ gestation. Original magnifications: a,b,g 200; c–f 160; h 400.
Simpson et al.: TGF- and Human Trophoblast Invasion
53
pairs) was expressed in all samples with no differences across the gestations studied. This was the most abundant of the TGF- forms investigated. TGF-1 mRNA was only just detectable in some samples but no differences were noted across gestation. Finally TGF-3 was identified in all samples. While there was variation in the amount of TGF-3 in the samples, as for TGF-1 and TGF-2, no pattern across gestation was identified. While not the focus of the study, TGF- and CTGF were present in all samples but at much lower levels than TGF-1, 2 or 3.
ELISA The results for the TGF-2 ELISA on placental homogenates are shown in Figure 8. TGF-2 was detectable in all samples. There was no evidence of any consistent variation across gestation (P<0.05), consistent with the immunohistochemical and RT-PCR findings. The results for the TGF-3 ELISA are shown in Figure 9. Concentrations of TGF-3 in the placental samples were much lower than those of TGF-2. There was no evidence of a rise followed by a decrease in TGF-3 concentrations at any gestation. These results are again consistent with the immunohistochemical and RT-PCR findings.
Figure 5. Gel analysis of RNA from cases used for RT-PCR.
0.8
TGF β3:actin
0.6
DISCUSSION
0.4
0.2
0
7
8
9 10 11 Gestational age (weeks)
12
Figure 6. RT-PCR analysis of TGF-3 using fluorescent primers. Results are obtained as ratio of TGF-3.actin. Two samples from each gestation are shown.
placental bed TGF-3 was not detected in extravillous trophoblast [Figure 3(J,F)], the only reactivity being with occasional lymphocytes in decidua and myometrium.
RT-PCR Figure 5 shows the RNA for each of the samples studied confirming that the RNA was intact prior to spectrophotometric analysis. Figure 6 shows the results of the PCR method using the fluorescein-labelled primers. RNA for TGF-3 was identified in all of the samples. There were no statistically significant differences in TGF-3 mRNA across the gestational ages studied (7–12 weeks). Figure 7 shows analysis of the same samples using the Multiplex PCR kit as an alternative method of assessing TGF- mRNA levels. TGF-2 (497 base
We believe that the present study is the most comprehensive investigation of TGF- expression in the placenta and placental bed during the key period of trophoblast invasion and spiral artery transformation. Several different techniques were used to determine mRNA and protein expression and results were generally consistent. TGF-1 protein was undetectable by Western blot analysis. However the more sensitive method of RT-PCR confirmed the presence of TGF-1 mRNA in placental homogenates between 7–19 weeks’ gestation. TGF-2 was produced in both the placenta and placental bed where it was localized mainly to cytotrophoblast islands and decidua. Villous trophoblast was consistently negative. Much lower levels of TGF-3 were present in placental homogenates. Immunolocalization studies showed no reactivity for TGF-3 in placenta apart from non-specific binding to Hofbauer cells. The low levels of TGF-3 detected by ELISA were presumably below the sensitivity of the immunostaining. Levels of TGF-1, TGF-2 and TGF-3 did not change between 7–19 weeks of pregnancy. These results suggest that TGF-2, but not TGF-1 or TGF-3, may play a role in trophoblast invasion. Specifically we have been unable to confirm a dramatic reduction in trophoblast TGF-3 expression at the time of the first or second wave of trophoblast invasion. Western blotting proved to be insufficiently sensitive to detect bioactive TGF-1, TGF-2 or TGF-3. The antibodies bind both the latent and active forms of the TGF-.
54
Placenta (2002), Vol. 23
Figure 7. RT-PCR analysis of TGF-1, TGF-2 and TGF-3 using the Multiplex PCR kit. L; molecular weight ladder, C, control cDNAs supplied with the kit.
The upper complex of bands seen in the blots represents some non-specific binding to very high molecular weight components (typical of most polyclonal antibodies) and probably also to the latent form of the protein. No differences in these higher molecular weight components were found across gestation. These bands would not be present in the recombinant sample. Interpretation of early immunohistochemical studies of TGF- in the human placenta is confounded by the use of antibodies which are not specific for individual isoforms (Lysiak et al., 1995; Selick et al., 1994; Vuckovic et al., 1992). More recent studies, including the present one, have used antibodies specific for each isoform. Comparison of studies is further confounded by the variability of techniques used for tissue preparation and immunostaining with many studies using paraffin sections. Furthermore all previous studies have reported results only for on total TGF protein, much of which is latent. Incorporation of an ELISA immunoassay, which measures only bioactive forms, is therefore likely to yield additional, and probably more functionally relevant information. Lysiak et al. (1995) examined TGF- expression at 11, 14 and 18 weeks’ gestation in paraffin-embedded placentae. Two
antibodies, one which recognizes TGF-1 and 2 and one which recognizes TGF-2, were used. Both antibodies produced extracellular decidual staining and staining in syncytiotrophoblast and some Hofbauer cells. With this combination of antibodies only conclusions on TGF-2 could be drawn. A systematic coverage of gestations between 7–19 weeks’ gestation was not performed. Placental bed biopsies were not studied. Vuckovick et al. (1992) reported that TGF- was expressed solely in syncytiotrophoblast in paraffin embedded placentae at 6–8 weeks’ gestation. The 7–19 week gestational age was not covered. No details of which isoforms of TGF- were detected by the antibody were reported. The expression of TGF-1, 2 and 3 in placenta and decidua in 21 cases between 5–12 weeks’ gestation has been examined by Ando et al. (1998). The data were collectively presented as two groups, from 5–8 weeks’ gestation and from 9–12 weeks’ gestation. Using RT-PCR TGF-1 was present in both groups in villous and decidual tissue. Similar findings for TGF-2 were reported but TGF-2 expression was lower than TGF1. TGF-3 was expressed at the lowest level of the TGF-s and expression was also similar in the 5–8 and 9–12 week group suggesting there was very little TGF-3 in placentae in
Simpson et al.: TGF- and Human Trophoblast Invasion
55
4000
[TGF β2] pg/mg protein
3000
2000
1000
0 7
8
9
10
11
12 13 14 Gestation (weeks)
15
16
17
18
19
Figure 8. ELISA for biologically active TGF-2 in placenta samples from 7–19 weeks’ gestation.
25
[TGF β3] pg/mg protein
20
15
10
5
0
7
7
7
8
8
8
9
9
9
10 10
11 11
12 12 12
14 14 14
15
16 16
17 17
18 19
Gestation (weeks) Figure 9. ELISA for biologically active TGF-3 in placenta samples from 7–19 weeks’ gestation.
the first trimester. In situ hybridization studies revealed that TGF-1 was expressed in decidual cells and villous cytotrophoblast. TGF-2 expression was weak in placenta and present in decidual cells. In situ localization of TGF-3 mRNA was not studied. A further study (Selick et al., 1994) examined TGF- expression in eight first trimester decidua and placental samples and in four second trimester placental samples. These samples were embedded in paraffin. Two antibodies, one which recognizes TGF-1 and one which recognizes TGF-1
and TGF-2 were used. Similar findings were found with each antibody. TGF- staining was found in all tissues examined. The authors did not report the gestations studied and the inference from the study was that, while the numbers were small, no gestational age effects were noted. TGF- staining was reported to be moderate in villous cytotrophoblast, syncytiotrophoblast and in non-villous cytotrophoblast adjacent to villi but light in non-villous cytotrophoblast distal to villi. Trophoblast surrounding maternal vessels exhibited moderate to intense staining. Staining was also reported within the
56
decidua. Due to the antibodies used, the authors pointed out that the subtype of TGF- identified is not unequivocal but is likely to be TGF-1 and/or TGF-2. The absence of any documented changes over the time of invasion is consistent with trophoblast-derived TGF-1 not involved in the regulation of this process. Our immunohistochemical data suggest that TGF-1 is present in fibrin and fibrinoid in spiral arteries and is present extracellularly in decidua, cytotrophoblast islands and cell columns but not in villous trophoblast across the gestational range studied. TGF-1 was undetectable in villous tissue by Western blot analysis in placental samples. However the more sensitive method of RT-PCR confirmed the presence of TGF-1 mRNA. Collectively, our data support a role for decidual TGF-1 in regulating trophoblast invasion although there was no evidence of a temporal or spatial regulation of this cytokine from 7–19 weeks’ gestation. Our RT-PCR findings on TGF-1 in placenta are consistent with Caniggia et al. (1999) however the group did not report immunohistochemical data for TGF-1. We did however find similar staining patterns for TGF-1 when using the identical methodology of Caniggia et al. (not shown) although greater non-specific staining was found in the control samples than was observed with our standard technique. The placental bed was not studied by this group for any of the TGF-s. With regard to TGF-2 our immunohistochemical findings suggest that TGF-2 is variably present in cytotrophoblast, cytotrophoblast islands showed both intracellular and extracellular staining, extracellular reactivity being stronger than that in the cytoplasm. In the placental bed decidual cells were consistently positive. Extracellular positivity was noted around transformed decidual and myometrial spiral arteries, although reactivity was more diffuse than for TGF-1. Myometrial cells were weakly positive. Interstitial and endovascular trophoblast populations were variably positive for TGF-2 in all specimens throughout the gestational range examined. Reactivity in interstitial trophoblast, including trophoblast giant cells, ranged from negative to strongly positive. There was no obvious pattern to this reactivity, negative and positive cells being detected in both decidua and myometrium and in both a perivascular location and distant from vessels. Endovascular trophoblast reactivity was weaker ranging from negative to moderate. Reactivity for TGF-2 did not vary significantly with gestation. Our RT-PCR findings on TGF-2 are consistent with Caniggia et al. however, as for TGF-1, they did not report immunohistochemical data for TGF-2. Our data on TGF-2 do not support a role in the temporal regulation of trophoblast invasion however the fact that this cytokine is continually expressed throughout pregnancy does suggest it plays some role in trophoblast function. It is impossible to determine the precise cellular source of the extracellular matrix immunostaining. Our findings for TGF-3 were quite unexpected. We set out to extend the observations of Caniggia et al. by focussing on EVT in the placental bed during the period of spiral artery transformation. However we were unable to confirm their
Placenta (2002), Vol. 23
observation of a downregulation of TGF-3 in placental tissue at 9 weeks’ gestation using any of the techniques. Immunohistochemical analysis showed TGF-3 was not detected in villous syncytiotrophoblast or cytotrophoblast nor in cytotrophoblast columns or islands in any of the samples. In common with anti-TGF-1 and TGF-2 there was nonspecific reactivity with Hofbauer cells. In the placental bed TGF-3 was not detected in extravillous trophoblast, the only reactivity being with occasional lymphocytes in decidua and myometrium. While our data suggest that TGF-3 is present at very low levels in placenta and placental bed, most importantly we found no changes across gestation even though our study extended to 19 weeks’ gestation. We attempted to use the same primers for the RT-PCR as Caniggia et al. however since their published right primer only matched the rat and not the human sequence it was necessary to use a different right primer. Our mRNA results were confirmed with a multiplex PCR kit. Western blots confirmed the low levels of TGF-3. TGF-3 is synthesized as a latent protein and then cleaved to form a biologically active protein. As a further confirmation we measured TGF-3 levels between 7–19 weeks of pregnancy using ELISA. Unlike other methods to study TGF-3, the ELISA used in the present study only detects biologically active protein. Thus the results are more likely to be biologically relevant. Our findings for placental TGF-3 are in agreement with Ando et al. (1998). Thus it seems unlikely that TGF-3 is a key regulator of trophoblast in vivo. There is evidence that TGF- can regulate trophoblast invasion in vitro although the data are not consistent: Graham et al. (1992) reported that exposure of first trimester trophoblast to TGF-1 or TGF-2 significantly inhibited proliferation, the first step in the invasive process. This group also reported that decidual cell extract and TGF-1 suppressed invasion of trophoblast cells. The authors concluded that decidual, and to a minor extent, trophoblast derived TGF-1 is a prime mediator of trophoblast invasion. However Bass et al. (1994) found that while epidermal growth factor increased invasiveness of trophoblast in vitro, TGF-1 had no effect. The effects of TGF-3 were not reported. Caniggia et al. (1998) found that while TGF-3 antibodies and antisense oligonucleotides inhibited outgrowth from villous explants, inhibition of TGF-1 or TGF-2 had no effect. It is not clear why in vitro data are not consistent between groups but the discrepancies may be related to the cell preparation techniques or the culture conditions employed. The environment of the early placenta is hypoxic (Jaffe et al., 1987). At this time plugs of trophoblast block the maternal spiral arteries (Burton et al., 1999). The plugs are subsequently displaced and blood flow begins at approximately 11 weeks of pregnancy. As a result partial pressure of oxygen increases from 18 mm Hg at 8–10 weeks’ gestation to 60 mm Hg at 12–13 weeks’ gestation. Studies using placental villous explants cultured on three-dimensional extracellular matrix have shown that trophoblast are sensitive to oxygen; first trimester villi explanted in 20 per cent oxygen form new columns at their tips (Aplin, 1999; Genbacev, 1997; Vicovac
Simpson et al.: TGF- and Human Trophoblast Invasion
et al., 1996) whereas low oxygen (2–3 per cent) maintains trophoblast in a proliferative non-invasive phenotype (Genbacev et al., 1996). It has been known for some time that proliferation of cytotrophoblasts is higher at low oxygen concentrations (Fox, 1964; Kingdom and Kaufmann, 1997) although the mechanisms whereby the placenta sensed changes in oxygen concentration were hitherto unknown. However, insight into possible mechanisms has come from studies by Caniggia et al. who suggested that transcription factor, hypoxia inducible factor (HIF)-1 (Semenza et al., 1998) is involved (Caniggia et al., 2000). Interpretation of the findings by Caniggia et al. are not straightforward for several reasons. Firstly, interstitial invasion occurs as a result of trophoblast migrating through the decidua and reaching the inner myometrium at 8 weeks’ gestation (Pijnenborg et al., 1980). The precise time when decidual invasion begins but is thought to be in very early pregnancy. In rhesus monkeys endovascular trophoblast is present as early as 5 days after implantation (Enders et al., 1956). Thus cytotrophoblast proliferation occurs before and after the oxygen transition and there is no morphological evidence that maximal trophoblast invasion occurs at 9 weeks’ gestation, the time when TGF-3 expression was reported to decline. Second, trophoblast invasion occurs via both an interstitial pathway and an intravascular pathway the latter being reported to occur in
57
two waves (Pijnenborg et al., 1998); the first into the decidual segments of spiral arteries at 8–10 weeks’ gestation and the second wave of invasion into myometrial segments at 16–18 weeks’ gestation (Pijnenborg et al., 1983). The temporal expression of TGF-3 is not in keeping with these morphological observations. Thirdly Aplin has pointed out that de novo column formation occurs in 20 per cent oxygen (Genbacev et al., 1996; Aplin et al., 1999). Finally TGF- is expressed in decidua, the very environment where trophoblast migration occurs. There are obvious advantages for the mother to limit the extent of trophoblast invasion; decidual expression of TGF-1 and TGF-2 appears to be one possible mechanism. Finally in comparing the present study with that of Caniggia et al. it is important to note that in a subsequent study (Caniggia et al., 2000) the authors reported that placental ages were based on embryonic age (based on Carnegie classification) rather than gestational age based on last menstrual period or ultrasound. This would mean that the ages reported would be two weeks earlier than true gestational ages. In summary while our data agree with the concept that TGF-s may be involved in trophoblast invasion our data do not suggest temporal changes in expression of any of the isoforms with gestation.
ACKNOWLEDGEMENTS We are grateful to Action Research for the main funding of the project, to Elizabeth Duffie and Barbara Innes for technical assistance and to the British Heart Foundation and Tommy’s Campaign for additional support.
REFERENCES Ando N, Hirahara F, Fukushima J, Kawamoto S, Okuda K, Funabashi T, Gorai I & Minaguchi H (1998) Differential gene expression of TGF-beta isoforms and TGF-beta receptors during the first trimester of pregnancy at the human maternal-fetal interface. Am J Reprod Immunol, 40, 48–56. Aplin JD, Haigh T, Jones CJP, Church HJ & Vicovac LJ (1999) Development of cytotrophoblast columns from explanted first trimester placental villi: role of fibronectin and integrin 51. Biol Reprod, 60, 828–838. Bass KE, Morrish DW, Roth I, Bhardwaj D, Taylor R, Zhou Y & Fisher SJ (1994) Human cytotrophoblast invasion is upregulated by epidermal growth factor. Evidence that paracrine factors modify this process. Dev Biol, 164, 560–561. Blankenship TN, Enders AC & King BF (1993) Trophoblastic invasion and modification of uterine veins during placental development macaques. Cell Tissue Res, 274, 135–244. Bradford MM (1976) A refined and sensitive method for the quantitation of proteins utilizing the principle of protein-dye binding. Anal Biochem, 72, 248–254. Brosens I, Robertson WB & Dixon HG (1967) The physiological response of the vessels of the placental bed to normal pregnancy. J Path Bacteriol, 93, 569–579. Burton GJ, Jauniaux E & Watson AL (1999) Maternal arterial connections to the placental intervillous space during the first trimester of human pregnancy: the Boyd collection revisited. Am J Obstet Gynecol, 181, 718–724. Caniggia I, Post M & Lye SJ (1998) Restoration of trophoblast invasion capability in preeclamptic villous explants by antisense knock-down of TGF3. J Soc Gynecol Invest, 5, 66A.
Caniggia I, Grisaru-Gravnosky S, Kuliszewsky M, Post M & Lye SJ (1999) Inhibition of TGFB3 restores the invasive capability of extravillous trophoblasts in pre-eclamptic pregnancies. J Clin Invest, 103, 1641–1650. Caniggia I, Mostachfi H, Winter J, Grassmann M, Lye SJ, Kuliszewski M & Post M (2000) Hypoxia-inducible factor-1 mediates the biological effects of oxygen on human trophoblast differentiation through TGF-3. J Clin Invest, 105, 577–587. Derynck R, Lindequist PB, Lee A, Wen D, Tamm J, Graycar JL, Rhee L, Mason AJ, Miller DA, Coffey RJ, Moses HL & Chen EY (1988) A new type of transforming growth factor beta 3. EMBO J, 7, 3737–3743. De Wolf F, De Wolf-Peeters C & Brosens I (1973) Ultrastructure of the spiral arteries in human placental bed at the end of normal pregnancy. Am J Obstet Gynecol, 117, 833–848. Enders AC, Rock J & Adams AC (1956) Implantation in the rhesus monkey: initial penetration of endometrium. Am J Anat, 167, 275–298. Fox H (1964) The villous trophoblast as an index of placental ischaemia. J Obstet Gynaecol, Br Commwlth, 71, 885–893. Frank S, Madlener M & Werner S (1996) Transforming growth factors TGF 1, 2 and 3 and their receptors are differentially regulated during normal and impaired wound healing. J Biol Chem, 271, 10188–10193. Genbacev O, Joslin R, Damsky CH, Polliotti BM & Fisher SJ (1996) Hypoxia alters early gestation human cytotrophoblast differentiation/ invasion in vitro and models the placental defects that occur in preeclampsia. J Clin Invest, 97, 540–550. Genbacev O, Zhou Y, Ludlow JW & Fisher SJ (1997) Regulation of human placental development by oxygen tension. Science, 277, 1669–1672. Graham CH, Lysiak JJ, McCrae KR & Lala PK (1992) Localization of transforming growth factor-B at the human fetal-maternal interface: role in trophoblast growth and differentiation. Biol Reprod, 46, 561–572. Hustin J, Jauniaux E & Schaaps JP (1990) Histological study of the materno-embryonic interface in spontaneous abortion. Placenta, 11, 477– 486.
58 Jaffe R, Jauniaux E & Hustin J (1987) Maternal circulation in the first trimester human placenta: myth or reality? Am J Obstet Gynecol, 176, 695–705. Jauniaux E, Zaidi J, Jurkovic D, Campbell S & Hustin J (1994) Comparison of colour Doppler features and pathological findings in complicated early pregnancy. Hum Reprod, 12, 2432–2437. Khong TY, De Wolf F, Robertson WB & Brosens I (1986) Inadequate maternal vascular response to placentation in pregnancies complicated by pre-eclampsia and by small-for-gestational age infants. Br J Obstet Gynaecol, 93, 1049–1059. Khong TY, Liddell HS & Robertson WB (1987) Defective haemochorial placentation as a cause of miscarriage: a preliminary study. Br J Obstet Gynaecol, 94, 649–655. Khong TY (1995) Placental changes in fetal growth retardation. Fetus and Neonate. In Physiology and Clinical Applications (vol 3) (Eds) Hanson MA, Spencer JAD & Rodeck CH. Cambridge: Cambridge University Press. Kingdom JCP & Kaufmann P (1997) Oxygen and placental villous development: origins of fetal hypoxia. Placenta, 18, 613–621. Lala PK & Hamilton GS (1996) Growth factors, proteases and protease inhibitors in the maternal-fetal dialogue. Placenta, 17, 545–555. Lyall F, Jablonka-Shariff A, Johnson RD, Olson LM & Nelson DM (1998) Gene expression of nitric oxide synthase in cultured human term placental trophoblast during in vitro differentiation. Placenta, 17, 253–260. Lyall F, Barber A, Myatt L, Bulmer JN & Robson SC (2000) Hemeoxygenase expression in human placenta and placental bed implies a role in regulation of trophoblast invasion and placental function. FASEB J, 14, 208–219. Lyall F, Robson SC, Bulmer JN, Kelly H & Duffie E (1999) Human trophoblast invasion and spiral artery transformation: the role of nitric oxide. Am J Pathol, 154, 1105–1114. Lyall F & Kaufmann P (2000) The uteroplacental circulation: Extravillous trophoblast. In Intrauterine Growth Restriction (Eds) Baker PN & Kingdom JCP, pp. 85–119. London: Springer-Verlag. Lyall F & Robson SC (2000) Defective extravillous trophoblast function and pre-eclampsia. In The Placenta: Basic science and clinical practice (Eds) Kingdom JCP, Jauniaux ERM & O’Brien SPM, pp. 79–96. London: RCOG Press. Lyall F, Simpson H, Bulmer JN, Barber A & Robson SC (2001) Transforming growth factor b expression in human placenta and placental bed in third trimester normal pregnancy, preeclampsia and fetal growth restriction. Am J Pathol, 159(5) (in press).
Placenta (2002), Vol. 23 Lysiak JJ, Hunt J, Pringle GA & Lala PK (1965) Localization of transforming growth factor beta and its natural inhibitor decorin in the human placenta and decidua throughout gestation. Placenta, 16, 221–231. Michel MZ, Khong TY, Clark DA & Beard RWA (1990) Morphological and immunological study of human placental bed biopsies in miscarriage. Br J Obstet Gynaecol, 97, 984–988. Pepper MS (1997) Transforming growth factor-beta: Vasculogenesis and vessel wall integrity. Cytokine and Growth Factor Reviews, 8, 21–24. Pijnenborg R, Dixon G, Robertson WB & Brosens I (1980) Trophoblastic invasion of human decidua from 8 to 18 weeks of pregnancy. Placenta, 1, 3–19. Pijnenborg R, Bland JM, Robertson WB & Brosens I (1983) Uteroplacental arterial changes related to interstitial trophoblast migration in early human pregnancy. Placenta, 4, 397–414. Pijnenborg R, Anthony J, Davey DA, Rees A, Tiltman A, Vercruysse L & Van Assche FA (1991) Placental bed spiral arteries in the hypertensive disorders of pregnancy. Br J Obstet Gynaecol, 98, 648–655. Roberts JM & Redman CW (1993) Pre-eclampsia: more than pregnancyinduced hypertension. Lancet, 341, 1447–1451. Selick CE, Horowitz GM, Gratch M, Scott RT Jr, Navot D & Hofmann GE (1994) Immunohistochemical localization of transforming growth factor- in human implantation sites. J Clin Endocrinol Metabol, 78, 592–596. Semenza GL (1998) Hypoxia-inducible factor-1 and the molecular physiology of oxygen homeostasis. J Lab Clin Med, 131, 207–214. Sheppard BL & Bonnar J (1976) The ultrastructure of the arterial supply of the human placenta in pregnancy complicated by fetal growth retardation. J Obstet Gynaecol Br Cwlth, 83, 948–959. Sheppard BL & Bonnar J (1981) An ultrastructural study of utero placental arteries in hypertensive and normotensive pregnancy and fetal growth retardation. Br J Obstet Gynaecol, 88, 695–705. Vandekarckhove J & Weber K (1978) Mammalian cytoplasmic actins are the products of at least two genes and differ in primary structure in at least twenty five identified positions from skeletal muscle actins. Proc Natl Acad Sci USA, 75, 1106–1110. Vicovac L & Aplin JD (1996) Epithelial-mesenchymal transition during trophoblast differentiation. Acta Acta Anat, 156, 202–216. Vuckovic M, Genbacev O & Kumar S (1992) Immunolocalization of transforming growth factor beta in 1st and 3rd trimester human placenta. Pathobiol, 60, 149–150.