TRPC6 regulate lamina cribrosa cell extracellular matrix gene transcription and proliferation

Journal Pre-proof Receptor potential channels TRPC1/TRPC6 regulate lamina cribrosa cell extracellular matrix gene transcription and proliferation M. Irnaten, G. O'Malley, A.F. Clark, C.J. O'Brien PII:

S0014-4835(19)30654-2

DOI:

https://doi.org/10.1016/j.exer.2020.107980

Reference:

YEXER 107980

To appear in:

Experimental Eye Research

Received Date: 26 August 2019 Revised Date:

13 January 2020

Accepted Date: 17 February 2020

Please cite this article as: Irnaten, M., O'Malley, G., Clark, A.F., O'Brien, C.J., Receptor potential channels TRPC1/TRPC6 regulate lamina cribrosa cell extracellular matrix gene transcription and proliferation, Experimental Eye Research (2020), doi: https://doi.org/10.1016/j.exer.2020.107980. This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. © 2020 Published by Elsevier Ltd.

Receptor Potential Channels TRPC1/TRPC6 Regulate Lamina Cribrosa Cell Extracellular Matrix Gene Transcription and Proliferation

Irnaten M1’2, O’Malley G2, Clark AF3, O’Brien CJ1,2

1

Department of Ophthalmology, Mater Misericordiae Hospital, Dublin 7, Ireland

2

School of Medicine, University College Dublin, Dublin 4, Ireland

3

Dept. Pharmacology & Neuroscience and the North Texas Eye Research Institute, U. North Texas,

Health Science Centre, Ft Worth, Texas, USA

Correspondence: Dr. Mustapha Irnaten Department of Ophthalmology Mater Misericordiae University Hospital, 60 Eccles Street, Dublin 7, Ireland

Phone: (+353)1 716 4581 e-mail: [email protected]

Key Words: Glaucoma, lamina cribrosa, fibrosis, proliferation, calcium, TRPC channels.

1

ABSTRACT

The lamina cribrosa (LC) in glaucoma is with augmented production of extracellular matrix proteins (ECM) and connective tissue fibrosis. Fundamental pathological mechanisms for this fibrosis comprise fibrotic growth factors and oxidative stress. Transient receptor potential canonical channels (TRPC) channels play a key role in ECM fibrosis. Here, we study TRPC expression in glaucomatous LC cells, and investigate the role of TRPC in oxidative stress induced-profibrotic ECM gene transcription and cell proliferation in normal LC cells. Age-matched human LC cells (normal, n=3 donors; glaucoma, n=3 donors) were used. Hydrogen peroxide (H2O2, 100 µM), was used to induce oxidative stress in LC cells in the presence or absence of the pan TRPC inhibitor SKF96365 (10 µM) or knockdown of TRPC1/6 with siRNA. After treatments, ECM gene transcription, LC cell viability and proliferation and the phosphorylation of the transcription factor NFATc3, were measured using real time RT-PCR, colorimetric cell counting with the methylthiazolyl tetrazolium salt (MTS) assay, and Western immunoblotting, respectively. Results showed that TRPC1/C6 transcript and protein expression levels were significantly (p<0.05) enhanced in glaucoma LC cells. Both SKF96365 and siRNA-TRPC1/C6 treatments significantly reduced the oxidative stress induced-ECM gene expression (transforming growth factor-β1 (TGFβ1), alpha smooth muscle actin (α-SMA), and collagen type 1A1 (Col1A1)), and cell proliferation in normal and glaucoma LC cells. Also, SKF96365 treatment inhibited the H2O2-induced NFATc3 protein dephosphorylation in LC cells. In conclusion, TRPC1/C6 expression is enhanced in glaucoma LC cells. These channels may contribute to oxidative stress-induced ECM gene transcription and cell proliferation in normal and glaucoma LC cells through Ca2+-NFATc3 signaling pathway mechanism.

2

TRPC1 and TRPC6 channels could be important therapeutic targets to prevent ECM remodeling and fibrosis development in glaucoma optic neuropathy.

1. Introduction

Glaucoma is characterized by the irreversible degeneration of retinal ganglion cell (RGC) axons leading to gradual vision impairment and blindness (Quigley et al., 2006). The lamina cribrosa (LC), located in the optic nerve head (ONH), is a key site of damage of the axons in glaucoma. Pathological features include cupping of the ONH and excessive ECM deposition in the LC region leading to remodeling and fibrosis (Quigley et al., 1983; Hernandez et al., 1990). The human glaucoma tissue is characterised by ECM remodeling that includes loss of elastin structure (Quigley et al., 1991), increased collagen deposition (Hernandez, 1994), and elevated transforming growth factor β2 (TGFβ2) and matrix metalloproteinase-2 (MMP-2) (Pena et al., 1999). In addition to LC cells, astrocytes are the other main cell type in the ONH (Hernandez, 2000; Tovar-Vidales et al., 2016). Astrocytes play an important role in ECM remodeling through synthesis of growth factors, different type of collagens, fibronectin, connective tissue growth factor (CTGF) (Schneider and Fuchshofer, 2016) and thrombospondin (TSP-1) (Fuchshofer et al., 2005). Tissue fibrosis occurs when production of ECM by myofibroblasts exceeds the rate at which they are degraded, resulting in ECM deposition and alterations in tissue structure (Travers et al., 2016). Stimuli including growth factors, injury and oxidative stress promote fibroblasts to proliferate, migrate, and acquire an activated phenotype such as their differentiation into myofibroblasts, excess ECM production and the release of cytokines and growth factors, which in turn stimulate fibroblasts, resulting in tissue stiffness and persistent fibrosis (Wynn, 2008; Leask, 2010; Norambuena-Soto et al., 2017). Fibroblast activation is a helpful process in normal tissue repair by producing and remodeling the ECM (Klingberg et al., 2013). However, in some cases, prolonged activation becomes uncontrolled, producing a pathological fibrotic response that promotes fibrotic 3

conditions affecting tissues of multiple organs, such as skin, heart, liver and lung (Hinz, 2012; Leask 2010; Wynn and Ramalingam, 2012). Oxidative stress is central to the induction of degeneration of the optic nerve and the RGCs, which determine the progressive and irreversible deficit of the visual function (Saccà et al., 2016). Oxidative stress can stimulate an extensive variety of intracellular signaling transduction pathways that lead to the release of growth factors, enhanced ECM gene expression and protein synthesis, and cell proliferation that consequently contribute to cardiac fibrosis and heart failure (Tomasek et al., 2002; Van den bome et al., 2010; Leask, 2010; Hinz, 2015). Cardiac myocytes and fibroblasts sense oxidative stress through multiple mechanisms, including Ca2+ ion channels (Robert et al., 2015). Of particular interest, the progression of cardiac fibrosis, including excess production of ECM and fibroblast proliferation, is dependent on intracellular Ca2+ levels ([Ca2+]i) (Makarewich et al., 2014; Leask, 2010; Hinz, 2015) . We previously showed that glaucoma LC cells share many properties that are characteristics of activated cardiac myocytes/fibroblasts including increased ECM gene expression and protein synthesis (collagen 1A1, periostin, fibronectin) in response to cyclic stretch (Kirwan et al., 2005), oxidative stress (Irnaten et al., 2018), in glaucoma (Kirwan et al., 2009), and also elevated [Ca2+]i, and intracellular reactive oxygen spices (ROS) levels (Irnaten et al., 2018; McElnea et al., 2011). We also reported that glaucoma LC cells have elevated Ca2+-dependent potassium ion channel (maxi-K) activity (Irnaten et al., 2013), and that this increase was considerably but not completely reduced by a combination of different specific Ca2+ channel inhibitors including verapamil (an L-type Ca2+ channel inhibitor), 2-APB (a store operated Ca2+ channels inhibitor) and gadolinium (a stretch activated channel inhibitor). Here we, hypothesize that the residual increase in [Ca2+]i (not reduced by the above inhibitors) found in glaucoma LC cells (Irnaten et al., 2013), could be reliant on class(es) of Ca2+ ion channels different from voltage-dependent channels. Transient receptor potential canonical cation channels (TRPC) are voltage-independent channels, allowing Ca2+ entry into cells (Clapham, 2003). Extensive studies showed that chronically increased levels of cytosolic 4

Ca2+ levels, acting through TRPC channels, disrupt physiological processes, leading to a wide range of diseases. Specifically, studies have described a clear association between Ca2+ influx through TRPC channels and cardiac hypertrophy (Heineke and Molkentin, 2006; Wilkins et al., 2004; Wu et al., 2010), and also prolonged activation of the calcium driven calcineurin-NFAT signaling pathway is known to stimulate the expression of maladaptive hypertrophic genes. This has been found in hypertrophic cardiac remodeling and heart failure (Houser and Molkentin, 2008; Eder and Molkentin, 2011). TRPC channel-mediated Ca2+ influx activates calcineurin. Activated calcineurin dephosphorylates the transcription factor, nuclear factor of activated T-cells (NFAT), to induce its migration into the nucleus to initiate several intracellular responses (Kuwahara et al., 2006; Gao et al., 2012). Reports show that blocking the TRPC/NFAT signalling pathway may lead to reduced ECM fibrosis and alleviate cardiac damage and disease (Chen et al., 2011; Herum et al., 2013). In the present work, we found enhanced levels of expression of TRPC1/TRPC6 in glaucoma LC cells. Additionally, we examined whether TRPC1/C6 channels contributed to the oxidative stressinduced ECM gene expression and cell proliferation in normal LC cells via calcineurin/ NFATc3 signaling pathway mechanism to explore the possible therapeutic of targeting TRPC1/6 channels.

2. Materials and methods

2.1 LC cells culture and characterization Human glial fibrillary acidic protein (GFAP) negative LC cells were a gift from Prof. Abe Clark (Alcon Labs, Fort Worth, Texas, USA). The cells used in this study were from age matched donors with no ocular or any neurological diseases (normal control LC cells) and from patients with glaucoma. Cells were cultured in Dulbecco’s Modified Medium (DMEM) supplemented with 10 % (v/v) foetal bovine serum, 1% L-glutamine and 1% penicillin-streptomycin and incubated at 37oC in 95% humidified air and 5% CO2. When confluent, cells were passaged and used between passage 5

3 and 8. To characterise the LC cells, freshly thawed cells were stained negatively for an astrocyte marker, glial fibrillary acidic protein (GFAP), and positively for a microglial marker, ionized Ca2+ binding adapter molecule-1 (IBa-1), and for α-smooth muscle actin (α-SMA) as previously described (Irnaten et al., 2018; Lambert et al., 2001).

2.2 Materials Unless otherwise stated, material for cell culture including FBS, DMEM culture medium, antibiotics L-glutamine and penicillin/streptomycin, trypsin-EDTA, flasks and Petri dishes, inhibitor (1{β-[3-(4-methoxyphenyl) propoxyl]-4-methoxyphenyl}-1 H-imidazole hydrochloride) (SKF96365), primers, radio-immuno-precipitation assay (RIPA) buffer and protease and phosphatase inhibitors cocktail were purchased from Sigma-Aldrich, Dublin, Ireland. Costar 96 well flat-bottom plates were from Fisher Scientific, Dublin, Ireland. TRPC1/TRPC6 and total (phosphorylated & nonphosphorylated) NFATc3 primary antibodies were from Santa Cruz Biotechnology, Inc., Texas, USA. Anti-mouse and anti-rabbit secondary antibodies, and Anti-beta-actin and antiglyceraldehyde 3-phosphate dehydrogenase (GAPDH) loading control antibodies were purchased from Cell Signaling, Ireland CellTiter 96® aqueous cell proliferation assay was from Promega Corporation., Ireland.

2.3 Cell Treatments 2.3.1 Hydrogen peroxide and SKF96365 treatment.

LC cells were serum-starved for 24 hours before treatment. For SKF96365 treatment, the product was added to LC cells in culture at a final concentration of 10 µM. The cells were subjected to oxidative stress using hydrogen peroxide (H2O2, 100 µM) for 6 h in the presence or absence of SKF96365 (10 µM). Three independent experiments from different LC cell donors have been performed. 6

2.3.2 Hydrogen peroxide and siRNA treatment

After 24h incubation in serum free medium, the culture medium was removed and the cells were transfected with siRNA in serum free and antibiotics free medium for 24h, transferred into serum free medium containing antibiotics for another 24h, then the cells were exposed to hydrogen peroxide (100 µM) for an additional 6h. 2.4 siRNA transfection A mixture of 4 pooled siRNA (ON-TARGET plus SMART pool siRNA) coding for human TRPC6 gene and a control siRNA (scrambled siRNA) were acquired from Dharmacon (Research. Inc, Ireland). The four targeted sequences of the siRNA pool, (Accell Human TRPC6 (7225) siRNASMART pool), are as follow: sequence 1: 5’- GCAGCAUCAUUCAUUGCGA-3’; sequence 2 : 5’GCUGUAGUUUUAAGUU UCU-3’; sequence 3: 5’-CAAUAAUCCUCCAAGACAA-3’ and sequence 4: 5’-CCAGCAUACAUGUUUAG UG-3’ was designed to knockdown TRPC6 gene expression (siTRPC6). ON-TARGETplus Human TRPC1 (7220) siRNA was used to knockdown TRPC1 expression (siTRPC1). Target sequence 5’-GGACUACGGUUGUCAGAAA-3’, a noncoding siRNA, which has been tested to assure that it does not target any gene product in the human genome, was used as negative control siRNA (Dharmacon Research Inc, Ireland). Human LC cells were seeded at 30 to 40 % confluence and serum starved in low glucose medium Opti-MEM® for 24 h prior to transfection. Cells were transfected using a mixture of siRNA reagents in “difficult-to-transfect cell lines” using Lonza™ and NucleofectorTM solution to overcome the limitations associated with lipid reagent-mediated transfection, and the cells were assayed after 4 to 5 days post-transfection in accordance with the manufacturer’s protocol (Dharmacon Research Inc, Ireland). 2.5 RNA extraction and qRT- PCR

7

For RNA: Total RNA was isolated from treated or untreated LC cells using pure TRIReagent (Sigma, Ireland) following the manufactures’ guidance. To obtain cDNA templates, we conducted conventional PCR using enhanced avian reverse transcriptase (eAMV), oligo-dT primers, deoxy-nucleotides (dNTPs) and primers as per the manufacturer’s instructions. The specific primers for quantification were designed using primer-3 online software (http://simgene.com/Primer3) and synthesised for transient receptor potential canonical 1-7 (TRPC1-7), transforming growth factor (TGF-β1) , α-smooth muscle actin (αSMA), collagen 1 A1 (Col1A1) and periostin. Primer sequences used for conventional RT-PCR are given in Table 1. For quantitative real time PCR: qRT-PCR was performed to measure mRNA transcription levels in LC cells using a Rotorgene 3000 real time PCR thermocycler (Labortechnik, Wasserburg, Germany). The relative transcription levels of the target genes were assayed using Quanti-Tect-SYBR green PCR master mix (Qiagen, Ireland). All gene expression levels were expressed as the difference in Ct values normalized to GAPDH for all samples according to the method of Livak (Livak and Schmittgen, 2001).

2.6 Cell lysate preparation and Western Blot Analysis

Normal and glaucoma LC cells were grown to confluence in culture dishes. At confluence cells were placed in serum-free medium for 24h and subjected to oxidative stress (H2O2, 6h, 37oC), or treated as indicated. Following treatment, cells were rinsed twice with ice-cold phosphatebuffered saline (PBS) and collected by scraping the culture dishes with cell scrapers into ice cold PBS. Cells were centrifuged (1000×g, 10 min, 4 °C) and the supernatant removed. The cells were then lysed in radio immuno-precipitation assay (RIPA) buffer supplemented with protease and phosphatase inhibitor cocktail (Sigma Aldrich, Ireland), incubated on ice for 5 mins and centrifuged at 4°C at 13.000xg for 10 min to remove cell debris. The supernatant containing proteins was collected, flash-frozen, and stored at −80 °C until processing. Protein concentrations were

8

measured by BCA protein assay kit (Sigma-Aldrich, Ireland). Equal amounts of cellular proteins (20 µg) were mixed with Laemmli’s sample buffer and boiled at 95°C for 5 min (Laemmli, 1970). The proteins were separated by 10% SDS-PAGE and transferred to nitrocellulose membranes (Millipore, UK). The membranes were incubated in 5% skim milk in Tris-buffered saline containing Tween 20 (TBST, 20 mM Tris-Cl, pH 7.4, 150 mM NaCl, and 0.02% Tween 20) for 30 min at room temperature to block the nonspecific binding sites. Then, the blots were incubated at 4°C overnight with primary antibodies: TRPC1 (1:200, sc-133076, Santa Cruz, USA), TRPC6 (1:200, sc-515837, Santa Cruz, USA), p-NFATc3 (1:500, sc-365786, Santa Cruz, USA) and total NFATc3 (1:500, sc8405, Santa Cruz, USA). After three washes), membranes were incubated in TBS-Tween at RT for 1 h, with anti-mouse or anti-rabbit secondary antibodies (1:10,000 dilution in TBS-T), respectively. Membranes are re-probed with GAPDH or anti-beta-actin antibodies as loading controls. Immunoblotting was visualised using the ECL-plus detection system (Fisher Scientific, Ireland). Bands were quantified, relative to GAPDH or β-actin levels, by densitometry using the Gene Tools software (Syngene, UK). 2.7 Cell viability assay The cytotoxicity of H2O2 was assessed by an MTT (M5655, Sigma-Aldrich, Ireland) assay. LC Cells (1 × 104 cells/well) were seeded into 96-well plates. After 24h incubation, the culture medium was removed, the cells were rinsed with PBS, and the cells were treated with H2O2, (100 µM, 6h). After H2O2 treatment, 0.5 mg/ml MTT was added to each well and incubated for 4 h to allow mitochondrial dehydrogenase to convert MTT to insoluble formazan crystals. The medium was then aspirated, and the formazan was solubilized by the addition of 100 µl of DMSO. The plates were gently shaken to ensure complete solubilization of the formazan and the absorbance at 570 nm was measured using Spectra Max Multiple microplate reader (Molecular Devices, UK). Each experiment was performed in triplicate and repeated three times to assess the reproducibility of the results. 9

2.8 Cell Proliferation Assay To test whether TRPC1/TRPC6 cation channels contribute to H2O2-induced LC cell proliferation, we employed a cell counting assay (G3582, Promega Corporation., Ireland) on the indicated days after the cells were seeded and siRNA transfected. Freshly thawed normal LC cells were seeded onto T25 tissue culture flasks at the required density. When confluent, LC cells were seeded into “CellTiter 96®” 96-well plates in a final volume of 100 µl/well, at a density of 103 cell/well. Cells were first cultured overnight in serum free medium. Cells were assigned into untreated (control) or treated with H2O2 in the presence or absence of SKF96365 (10 µM) (Singh et al., 2010), siRNA-TRPC1 or siRNA-TRPC6-treated groups (triplicated wells per condition). A final concentration of 10 nM siRNA against TRPC1 and TRPC6 was used in each well. Cell proliferation was measured at day 5 post-transfection using the methyl thiazolyl tetrazolium salt (MTS) colorimetric cell counting assay as per the manufacturers’ instructions. After adding 20 µl of the CellTiter-96® Aqueous One Solution Reagent to each well, the plates were incubated in 5% CO2 for one hour. Then, the supernatant was discarded, and formazan was solubilized by the addition of 150 µl of DMSO. The plates were gently shaken to ensure complete solubilization of the formazan and cells were let to settle down for 10 mins at RT. Spectra Max Multiple microplate reader (Molecular Devices, UK) was used to read and record the absorbance at 490 nm. Each experiment was performed in triplicate and repeated at least three times to assess the reproducibility of the results. 2.9 Statistical analysis Experiments were performed in LC cells derived from three normal controls and three glaucoma eye donors. The results were expressed as mean ± SD. Paired and unpaired student’s ttests were used to compare 2 groups and one-way analysis of variance (ANOVA) to compare three or more groups. Differences were considered as statistically significant when p< 0.05. “n” indicates

10

the number of eye donors. Results were analysed using the Origin version 7.0 software (Origin Lab, Bucks, UK).

3. RESULTS

3.1 mRNA expression of TRPC family members in normal and glaucoma LC cells We first used conventional reverse transcriptase PCR to explore mRNA transcription profile of the TRPC family members (TRPC1–7) in LC cells. Analysis of TRPC transcripts showed that normal LC cells have a different pattern of TRPC transcription than glaucoma LC cells. TRPC1/C3/C5/C6 and C7 were expressed in normal LC cells, TRPC4 was detected at a very low level, whereas TRPC2 was not detected (Fig. 1A). In glaucoma samples TRPC1, C2, C3, C6 and C7 were expressed, TRPC4 was detected at a very low level, whereas C5 was not (Fig. 1B). The amplified transcripts were all found at the predicted size of: TRPC1, 272bp; TRPC2, 322 bp; TRPC3, 414 bp; TRPC4, 369 bp; TRPC5, 319 bp; TRPC6, 324 bp and TRPC7, 300 bp. All the transcripts were sequenced and recognized as TRPC1-7 using sequence data homology search (BLAST). Next, we wished to determine which channels are differentially expressed on the mRNA level in glaucoma LC cells. Therefore, quantitative real-time PCR (qRT-PCR) was performed to determine the relative significance of each TRPC channel that was detected in conventional PCR. As shown in Figure 1C, TRPC1 and TRPC6 gene expression were the most significantly upregulated (p<0.02) in glaucomatous LC cells compared to normal control LC cells. We also found that mRNA expression level of TRPC2 in glaucoma LC cells was about 2 fold higher than that of TRPC2 in normal LC cells (p <0.05), but there was high variation among the biologic replicates, while the expression of TRPC3 was reduced in glaucoma cells. The mean of the TRPC4, TRPC5 and TRPC7 mRNA expression levels were similar between normal and glaucoma LC cells. Oneway ANOVA showed there was no significant difference among these isoforms. TRPC4 showed the

11

lowest mRNA expression in both normal and glaucoma LC cells. For further experiments, we only focus on TRPC1 and TRPC6 as these two protein channels have been found to be stress and mechanosensitive cation channels (Maroto et al., 2005; Spassova et al., 2006) that are involved in fibrosis (Seth et al., 2009; Wu et al., 2010). 3.2 Protein expression analysis of TRPC1 and TRPC6 in normal and glaucoma LC cells Both TRPC1/C6 are known to function as stress/mechanosensitive channels allowing Ca2+ influx in response to mechanical stress in other tissues (Maroto et al., 2005; Spassova et al., 2006). Also because of their involvement in fibrosis (Seth et al., 2009; Wu et al., 2010) and according to our qRT-PCR data, TRPC1/6 transcription levels were the most enhanced in the TRPC subfamily in glaucoma LC cells, we assessed their protein expression levels. Figure 2 shows a representative Western blot for TRPC1 (Fig. 2A) and TRPC6 (Fig. 2C) obtained in three normal eye donors (N1, N2, N3) and three glaucoma patients (G1, G2, G3), respectively. Western blot analysis of averaged data shows that both TRPC1 (Fig. 2B) and TRPC6 (Fig. 2D) proteins were expressed in low levels in normal LC cells, while their expression levels were significantly enhanced in glaucoma cells (p<0.05).

3.3 SKF96365 and TRPC1/C6 siRNA knockdown reduce the H2O2-induced ECM gene expression in normal and glaucoma LC cells. The fibrotic ECM genes including TGFβ, αSMA, Col1A1 and periostin are key hallmarks of fibroblast-myofibroblast differentiation. Consequently, we investigated whether TRPC channels are involved in the oxidative stress-induced change of expression of these ECM genes, using SKF96365, a pan TRPC channel inhibitor, and siRNA-TRPC1/C6 knockdown. To elucidate the role of TRPC channels in LC cells under oxidative stress, the cytotoxic effect of hydrogen peroxide (H2O2) was first determined. Human LC cells were treated with various 12

concentrations of H2O2 (100 µM, 200 µM, 500 µM,) for 6h. As shown in Fig. 3A, H2O2 treatment resulted in loss of LC cell viability in a dose-dependent manner with a significant induction of cytotoxicity at concentrations of 200 to 500 µM, while no apoptotic (or cytotoxic) effect was observed with a concentration of H2O2 up to 100 µM. In addition, we further observed the cellular morphology of LC cells following H2O2 treatment. We found that LC cells kept their normal shape with 100 µM H2O2 treatment (data not shown). We next addressed whether TGFβ1 (a fundamental ECM gene of interest) mRNA expression in LC cells is regulated under oxidative stress. Treatment with H2O2 (100 µM), a noncytotoxic concentration, markedly increased TGFβ1 mRNA expression level from 1.0 ± 0.075 to 1.24 ± 0.081 (gene expression level relative to GAPDH) (Fig.3B). To test whether SKF96365, a pan TRPC inhibitor, affects the transcription levels of under oxidative stress, a dose-response control experiment was first performed (Fig. 3B). SKF96365 (10 µM) treatment significantly reduced the H2O2-induced TGFβ1 expression levels, although SKF96365 (0.1, 1.0 µM) had no significant effect (Fig.3B). Based on these results, a concentration of 10 µM of SKF96365 was used for further experiments. This finding accords with previously reports showing that the same concentration of SKF96365 (10 µM) has been used in numerous cell types and tissues (Singh et al., 2010) and also no non-specific effects have been reported at this concentration. To determine whether the TRPC channels are involved in H2O2-induced ECM gene expression in LC cells, we divided LC cells into untreated (control) or H2O2-treated groups (100 µM, 6h, 37oC) in the presence or absence of SKF96365 (10µM). qRT-PCR results show that exposure of LC cells to H2O2 induced a significant (p<0.05) enhancement in fibrotic ECM gene transcription in three of four ECM genes tested (TGFβ1, αSMA and Col1A1) but not periostin (Fig. 3C). This rise was significantly (p<0.05) reduced for TGFβ1 (from 1.42 ± 0.18 to 1.13 ± 0.08 fold change), αSMA (from 1.51 ± 0.15 to 1.12 ± 0.09 fold change), Col1A1 (from 1.53 ± 0.16 to 1.04 ± 0.08 fold change) gene transcription following SKF96365 treatment (Fig. 3C). However, SKF96365 had no significant effect on the H2O2-induced periostin gene transcription (Fig. 3C). 13

To further evaluate the specific involvement of these channels (TRPC1/C6) in oxidative-induced profibrotic ECM gene expression in normal and glaucoma LC cells, we investigated the effect of silencing TRPC1 and/or TRPC6 on the transcription of pro-fibrotic gene transcription. As shown in Figure 4A, the H2O2 treatment in normal LC cells resulted in a significant (p<0.05) enhancement, while silencing either TRPC1 or TRPC6 or both significantly (p<0.05) inhibited the H2O2-induced enhancement of TGFβ1 gene transcription (from 1.11 ± 0.10 to 0.63 ± 0.06 fold change in siRNATRPC1, to 0.67 ± 0.06 fold change in siRNA-TRPC6 and to 0.41 ± 0.043 fold change in siTRPC1 + siTRPC6), αSMA (from 1.05 ± 0.09 to 0.631 ± 0.07 fold change in siRNA-TRPC1, to 0.58 ± 0.038 fold change in siRNA-TRPC6 and to 0.581 ± 0.068 fold change in siTRPC1 + siTRPC6) and Col1A1 (from 1.18 ± 0.11 to 0.61 ± 0.04 fold change in siRNA-TRPC1, to 0.66 ± 0.05 fold change in siRNA-TRPC6 and to 0.523 ± 0.065 fold change in siTRPC1 + siTRPC6 ) following siRNA-TRPC1/6 treatment (Fig. 4A). In glaucoma LC cells, this rise was similarly significantly reduced for TGFβ1 (from 1.18 ± 0.09 to 0.67 ± 0.05 fold change in siRNA-TRPC1, to 0.71 ± 0.07 fold change in siRNATRPC6 and to 0.49 ± 0.04 fold change in siTRPC1 + C6), αSMA (from 1.21 ± 0.09 to 0.61 ± 0.074 fold change in siRNA-TRPC1, to 0.594 ± 0.06 fold change in siRNA-TRPC6 and to 0.56 ± 0.053 fold change in siTRPC1+ siTRPC6) and Col1A1 (from (1.304 ± 0.012 to 0.642 ± 0.085 fold change in siRNA-TRPC1, to 0.681 ± 0.692 fold change in siRNA-TRPC6 and to 0.521 ± 0.0677 fold change in siTRPC1 + siTRPC6) following siRNA-TRPC1/6 treatment (Fig. 4B). To further pursue the specificity of the siRNA knockdown of TRPC1 and TRPC6 effect on H2O2induced ECM genes expression, normal and glaucoma LC cells were transfected with TRPC1 and TRPC6-specific siRNAs and their respective protein expression level was evaluated 48h posttransfection. TRPC1 and TRPC6-specific siRNA treatment significantly (p<0.05) reduced the H2O2induced TRPC1/6 protein expression levels (Fig. 5 A,B,C,D). However, non-coding or scrambled siRNA had no significant effect on either TRPC1 or TRPC6 protein expression (Fig. 5 A,B,C,D).

14

3.4 SKF96365 and TRPC1/C6 siRNA knockdown reduced the H2O2-induced proliferation of normal LC cells The enhanced TRPC1 and C6 expression levels in glaucoma LC cells and their impact on ECM gene transcription regulation prompted us to test if these channels are involved in oxidative stress-induced cell proliferation. Normal LC cell proliferation was assessed in control (untreated) or H2O2-treated cells with or without SKF96365 groups. After cells were cultured for 24h in serum free medium, they were exposed to oxidative stress conditions (H2O2) for 6h in the presence or absence of SKF96365 (10 µM). Proliferation was assessed using the colorimetric MTS assay 5 days later. H2O2 treatment significantly increased (137.72 ± 11.76 %) cell proliferation (Fig. 6), while SKF96365 significantly reduced both, the basal (without H2O2) treatment and the H2O2-induced cell proliferation to 49.2 ± 8.1 % (Fig. 6). Furthermore, the effect of siTRPC1 or siTRPC6 on cell proliferation was also examined. Following 48h transfection with siRNA-TRPC1 or siRNA-TRPC6, the cells were treated with H2O2 (100 µM, 6h). Cells were assigned into untreated controls, and cells treated with H2O2 (100 µM, 6h) in the presence or absence of siTRPC1 or siTRPC6. The proliferation was assessed 5 days post-transfection. The results showed that normal LC cells treated with siTRPC1 or siTRPC6, significantly (p<0.05) decreased both, the basal (without H2O2) and the H2O2-induced cell proliferation (Fig. 7). Also, combined siTRPC1 and siTRPC6 transfection resulted in an additional significant (0.05) reduction of the H2O2-induced cell proliferation. We found that both siTRPC1 significantly reduced the H2O2-induced cell proliferation to 74.9 ± 10.6% and siTRPC6 to 90.2 ±13.8% when transfected each alone, however combined siTRPC1 and siTRPC6 transfection further reduced the cell proliferation to 59.5 ± 9.2%. 3.5 SKF96365 reduced profibrotic ECM genes and cell proliferation involving Ca2+-calcineurinNFATc3 signaling pathway in LC cells

15

Next, we examined the signaling pathways that are critically involved in ECM gene production and proliferation in different tissues (Houser and Molkentin, 2008). Among the various signaling pathways regulators, NFATc3 isoform is considered a crucial factor in ECM gene regulation and proliferation (Houser and Molkentin, 2008; Irnaten et al., 2018). To determine whether NFATc3 is involved in H2O2-induced ECM gene production and proliferation in LC cells, we estimated the activity of the NFATc3 signaling pathway by measuring its protein expression (phosphorylation/ dephosphorylation) levels in normal and glaucoma LC cells. The experiments using an anti-phosphorylated NFATc3 antibody (pNFATc3) were assessed in control (untreated) as well as in LC cells treated with H2O2 in the presence or absence of the TRPC inhibitor SKF96365. As shown in Fig.7 A,B, SKF96365 (10 µM) treatment, significantly (p<0.05) suppressed the H2O2induced NFATc3 dephosphorylation in normal LC cells (Fig. 8A). Interestingly, similar results were also found in H2O2-treated glaucoma LC cells (Fig.8B).

4. DISCUSSION

In this study, we show that glaucoma LC cells have a different profile of TRPC mRNA transcription, including enhanced transcript and protein levels of TRPC1/TRPC6 compared to that in normal LC cells, while TRPC3 transcript levels are lower in glaucoma LC cells. Pre-treatment with the pan TRPC inhibitor SKF96365 or siRNA-TRPC1/C6 knockdown significantly reduced the oxidative stress-induced fibrotic ECM gene transcription of TGFβ1, αSMA and Col1A1 as well as cell proliferation in normal and glaucoma LC cells. More importantly, we find that this SKF96365induced reduction was mediated by the activity of NFATc3 signaling pathway in normal and glaucoma LC cells. Since the TRPC family includes 7 subtypes, it became necessary to first investigate their expression pattern in LC cells. We initially compared the transcription levels of TRPC members between normal and glaucoma LC cells. The results showed that TRPC1 and TRPC6 genes are the 16

most significantly over expressed in glaucomatous LC cells. Both TRPC1 and TRPC6 are weakly transcribed in normal LC cells, while their transcription level was significantly higher in glaucoma LC cells, and this was confirmed at the protein level. We also found that mRNA expression level of TRPC2 in glaucoma LC cells was about 2 fold higher than that of TRPC2 in normal LC cells (p<0.05), though there was variation among the biologic replicates, while the expression of TRPC3 was reduced in glaucoma cells. This study focused on TRPC1 and TRPC6 protein channels as they have been found to be stress and mechano-sensitive channels (Maroto et al., 2005; Spassova et al., 2006) which are involved in fibrosis in other tissues (Seth et al., 2009; Wu et al., 2010), and there is no evidence to date that TRPC2 is a stress or a mechanosensitive cation channel. These findings are similar to numerous studies in the heart which have reported that TRPC1/C6 proteins are weakly expressed in normal cardiomyocytes, though both their transcription and activity levels were found to be higher in pathological cardiac hypertrophy (Seth et al., 2009; Fernandez et al., 2015; Ross et al., 2017). Our finding is comparable to that shown in normal optic nerve head (ONH) tissue and astrocytes dissociated from ONH in a mouse model (Choi et al., 2015). This group reported that TRPC1-6 are expressed in the ONH but not TRPC7 isoform; and TRPC1-2 and TRPC6 were expressed in isolated astrocytes. They also showed that TRPC1 is the most abundant isoform in the TRPC subfamily in both ONH tissues and astrocytes dissociated from ONH. They further compared TRPC mRNA levels in the optic nerve head between control C57BL/6 mice and DBA/2J strains, they found that TRPC1 expression levels are elevated in control C57BL/6. Ca2+ is a well-known second messenger involved in numerous physiological and pathological mechanisms, including its key role in regulating gene transcription, cell migration, apoptosis and proliferation. Alterations of TRPC1/6 expression and/or activity has been extensively reported in various pathologies including cardiac hypertrophy and heart failure (Eder and Molkentin, 2011; Kuwahara et al., 2006), as well as pancreatic (Nielsen et al., 2017), liver (Iyer et al., 2015) and renal fibrosis (Ma and Chaudhari, 2016). Further reports showed a key role of TRPC channel in fibrotic 17

gene expression in glaucoma. For example, a study by Chen and colleagues (Chen et al., 2013) showed a significantly enhanced TRPC6 expression level in blood leucocytes of glaucomatous patients (Chen et al., 2013). We believe that upregulation of transcription, expression and/or elevated activity of these channels contributes to the excessive LC ECM production and enhanced LC cell proliferation found in glaucoma. TRP channels are also expressed in the eye. Their presence has been reported in the optic nerve head astrocytes (Choi et al 2015), the trabecular meshwork, the retina, corneal epithelial cells and retinal ganglion cells (RGC) (see review by Reinach et al., 2015), and based on our own work, the optic nerve head lamina cribrosa cells. Additionally, their functional role has also been studied in the eye. For example, TRP channel members mediate Ca2+ influx into retinal pigment epithelial cells (Wimmers and Strauss, 2007); TRPV1 channels were expressed and contribute to apoptosis in retinal ganglion cells (RGC) (Sappington et al., 2009), and TRPV4 channels have been found to regulate Ca2+ homeostasis, cytoskeletal remodeling and intraocular pressure in trabecular meshwork cells (Ryskamp et al., 2016). The activation mechanisms of TRPC channels are diverse. Several studies showed that some TRPC channels are constitutively active, while others are activated by oxidative stress, increased levels of intracellular Ca2+ or activation of G-protein coupled receptors (Villereal, 2006). Furthermore, it has been shown that TRPC3/6/7 isoforms are activated by depletion of [Ca2+]i stores (store operated channels) (Parekh and Putney, 2005; He et al., 2017), while TRPC1/4/5 isoforms are activated by G protein-coupled receptor signaling pathways ( receptor operated channels) (Gudermann et al., 2004). As very limited studies have been performed on TRPC channels in LC cells, more studies are needed to examine the mechanism (s) of activation of TRPC channels in these cells. We next tested whether TRPC channels could contribute to the oxidative stress-induced profibrotic ECM gene production and proliferation in normal and glaucoma LC cells. The H2O2-induced transcription of LC cell ECM genes and LC cell proliferation were markedly reduced by the 18

application of 10 µM SKF96365, a compound commonly used as TRPC channel inhibitor (Fowler et al., 2007; Zhang et al., 2008). Although, this compound specificity has been questioned (Juvin et al., 2007), the non-specific effects of this compound were obtained using concentrations significantly higher than the 10 µM concentration used in our experiments. The lack of specificity of SKF96365 renders it difficult to determine which TRPC channel is expressed and/or activated by oxidative stress in LC cells. To directly determine the involvement of TRPC1/6 channels in profibrotic ECM gene production and LC cell proliferation, we utilised siRNA to specifically knockdown transcription of these two channels. We found that siRNA silencing of TRPC1/C6 confirmed these pharmacologic results, as the siRNA-TRPC1/C6 knockdown, significantly reduced the oxidative stress induced ECM gene expression and proliferation of LC cells. In addition, cotransfection of LC cells with siRNA-TRPC1 and siRNA-TRPC6, showed a further reduction of ECM gene transcription, assuming that TRPC1 and TRPC6 channels may act in a different signaling pathway, perhaps to contribute to the pathogenesis of LC fibrosis in glaucoma. Although additional contributions from other Ca2+ entry channels cannot be ruled out, raised expression levels of TRPC1/6 protein channels are likely to contribute to the elevated levels of ECM gene expression in seen glaucoma LC cells (Irnaten et al., 2013; 2018; Kirwan et al., 2009). It is well established that elevated Ca2+ entry into cells via TRPC channels is generally associated with the pathogenesis of many diseases. According to some reports, this may be due to the presence of nuclear-factor of activated T-cell (NFAT) responsive elements found in TRPC channel promotors. These responsive elements may lead to sustained enhancement of intracellular Ca2+, leading in turn to continuous activation of Ca2+ associated genes (He et al., 2017). Furthermore, it has been found that sustained increase in intracellular Ca2+ levels and subsequent NFAT activation mediate pathological cardiac hypertrophy (Houser and Molkentin, 2008). Based on these reports, plus our recent report (Irnaten et al., 2018), and the results from the present study, we hypothesise that calcineurin/NFATc3 signaling pathway might be reliant on TRPC channels in LC cells, as blockade

19

of TRPC with SKF96365 treatment resulted in H2O2-induced NFATc3 dephosphorylation inhibition in LC cells. These results are in close agreement with those found in an animal model of calcineurin-mediated cardiomyopathy where TRPC1 and TRPC6 were shown to attenuate the pressure overload-induced cardiac hypertrophy via the calcineurin/NFAT signaling pathway, and this effect was inhibited by SKF96365 pre-treatment (Nakayama et al., 2006). In addition, knockdownof TRPC3/6 with siRNA also promoted the angiotensin II-induced NFAT activation and cardiac hypertrophy (Onohara et al., 2006). Furthermore, increased [Ca2+]i levels acting through TRPC ion channels (specifically TRPC1 and TRPC6) activate the calcineurin/NFAT pathway in cardiac myocytes, and siRNA-TRPC1 knockdown reduced the hypertrophic phenotype of cardiac myocytes (Watanabee et al., 2013). In addition, TRPC1-deficient mice had no effect on the stress–induced maladaptive cardiac hypertrophy (Seth et al., 2009). Also, TRPC6-deficient mice were not affected in chronic hypoxiainduced pulmonary hypertension (Yu et al., 2004), and TRPC6-deficient mice failed to develop pulmonary hypertension in response to chronic hypoxia (Weissmann et al., 2012). Other reports show that upregulation of TRPC1 and TRPC6 promotes cell proliferation via activation of Ca2+/calmodulin/ calcineurin/ NFAT signaling pathway (Pigozzi et al., 2006; Thebault et al., 2006). Considering the similarities between the role of TRPC1/C6 hetero-tetramer channels in cardiac myocytes/fibroblasts and glaucoma LC cells, we believe that the TRPC1/C6 protein signaling complex may also function as stress-activated channels to promote the fibrotic ECM genes and LC cell proliferation in glaucoma. We used oxidative stress in this in-vitro model of disease as there is considerable reported evidence of elevated ROS in aqueous humour, blood and tissue such as the trabecular meshwork and retina in glaucoma patients (Saccà et al., 2016; McElnea et al., 2011; Tezel et al., 2012; Hondur et al., 2017).

20

In conclusion, the present study provides proof of a new Ca2+-NFAT-calcineurin signalling pathway linking oxidative stress, TRPC channels, fibrotic ECM gene expression and proliferation in human LC cells. Therefore, interventions designed to suppress oxidative stress or inhibit TRPC and/or calcineurin-NFAT signalling pathways in LC region of the optic nerve head can prevent progressive LC fibrosis and cupping in glaucoma. Acknowledgements This work was supported by “The 2014 Shaffer Grants for Innovative Glaucoma Research Foundation”.

Disclosures None.

References 1.

Quigley HA, Broman AT. The number of people with glaucoma worldwide in 2010 and 2020. Br J Ophthalmol. 2006;90(3):262-7.

2.

Quigley HA, Hohman RM, Addicks EM, et al. Morphological changes in the lamina cribrosa correlated with neural loss in open-angle glaucoma. Am J Ophthalmol. 1983; 95:673-91.

3.

Hernandez MR., Andrzejewska WM, Neufeld AH. Changes in the extracellular matrix of the human optic nerve head in primary open-angle glaucoma. Am J Ophthalmol. 1990;109(2):1808.

4.

Quigley HA, Brown A, Dorman-Pease ME. Alterations in elastin of the optic nerve head in human and experimental glaucoma. Br J Ophthalmol. 1991;75:552–557.

21

5.

Hernandez MR, Ye H, Roy S. Collagen type IV gene expression in human optic nerve heads with primary open angle glaucoma. Exp Eye Res. 1994; 59:41–51.

6.

Pena JD, Taylor AW, Ricard CS, et al. Transforming growth factor beta isoforms in human optic nerve heads. Br J Ophthalmol. 1999;83(2):209-18.

7.

Hernandez MR. The optic nerve head in glaucoma: role of astrocytes in tissue remodeling. Prog Retin Eye Res. 2000 May;19(3):297-321.

8.

Tovar-Vidales T, Fitzgerald AM, Clark AF Human trabecular meshwork cells express BMP antagonist mRNAs and proteins. Exp Eye Res. 2016 Jun;147:156-60.

9.

Schneider M, Fuchshofer R. The role of astrocytes in optic nerve head fibrosis in glaucoma. Exp Eye Res. 2016 Jan;142:49-55.

10. Fuchshofer R, Birke M, Welge-Lussen U, Kook D, Lütjen-Drecoll E. Transforming growth factor-beta 2 modulated extracellular matrix component expression in cultured human optic nerve head astrocytes. Invest Ophthalmol Vis Sci. 2005 Feb;46(2):568-78.

11. Travers JG, Kamal FA, Robbins J, Yutzey KE, Blaxall BC. Cardiac Fibrosis: The Fibroblast Awakens. Circ Res. 2016 Mar 18; 118(6):1021-40. doi: 10.1161/CIRCRESAHA.115.306565. 12. Wynn TA. Cellular and molecular mechanisms of fibrosis. J Pathol. 2008 Jan;214(2):199-210. 13. Leask A. Potential therapeutic targets for cardiac fibrosis: TGFbeta, angiotensin, endothelin, CCN2, and PDGF, partners in fibroblast activation. Circ Res. 2010; 106:1675–1680. 14. Norambuena-Soto I, Núñez-Soto C, Sanhueza-Olivares F, Cancino-Arenas N, Mondaca-Ruff D, Vivar R, Díaz-Araya G, Mellado R, Chiong M. Transforming growth factor-beta and Forkhead box O transcription factors as cardiac fibroblast regulators. Biosci Trends. 2017 May 23;11(2):154-162.

22

15. Klingberg F, Hinz B, White ES. The myofibroblast matrix: implications for tissue repair and fibrosis. J Pathol. 2013 Jan;229(2):298-309. doi: 10.1002/path.4104. Review. 16. Hinz B. Mechanical aspects of lung fibrosis: a spotlight on the myofibroblast. Proc Am Thorac Soc. 2012 Jul; 9(3):137-47. 17. Wynn TA, Ramalingam TR (2012) Mechanisms of fibrosis: therapeutic translation for fibrotic disease. Nat Med 18: 1028–1040. 18. Saccà SC, Gandolfi S, Bagnis A, Manni G, Damonte G, Traverso CE, Izzotti A. From DNA damage to functional changes of the trabecular meshwork in aging and glaucoma. Ageing Res Rev. 2016 Aug;29:26-41. 19. Tomasek JJ, Gabbiani G, Hinz B, Chaponnier C, Brown RA. Myofibroblasts and mechanoregulation of connective tissue remodeling. Nat Rev Mol Cell Biol. 2002;3:349–363. 20. Van den Borne SW1, Diez J, Blankesteijn WM, Verjans J, Hofstra L, Narula J. Myocardial remodeling after infarction: the role of myofibroblasts. Nat Rev Cardiol. 2010 Jan;7(1):30-7. 21. Hinz B. The extracellular matrix and transforming growth factor-β1: Tale of a strained relationship. Matrix Biol. 2015 Sep;47:54-65. 22. Robert C. Lyon, Fabian Zanella, et al., Mechanotransduction in Cardiac Hypertrophy and Failure. Circ Res. 2015 Apr 10; 116(8): 1462–1476. 23. Makarewich CA, Zhang H, Davis J, Correll RN, Trappanese DM, et al., Transient receptor potential channels contribute to pathological structural and functional remodeling after myocardial infarction. Circ Res. 2014 Aug 29;115(6):567-80. 24. Kirwan RP, Leonard MO, Murphy M, et al., Transforming growth factor-beta-regulated gene transcription and protein expression in human GFAP-negative lamina cribrosa cells. Glia. 2005 Dec;52(4):309-24.

23

25. Irnaten M, Zhdanov A, Brennan D, Crotty T, Clark A, Papkovsky D, O'Brien C. Activation of the NFAT-Calcium Signaling Pathway in Human Lamina Cribrosa Cells in Glaucoma. Invest Ophthalmol Vis Sci. 2018 Feb 1;59(2):831-842 26. Kirwan RP, Wordinger RJ, Clark AF, O'Brien CJ. Differential global and extra-cellular matrix focused gene expression patterns between normal and glaucomatous human lamina cribrosa cells. Mol Vis. 2009;15:76-88. 27. McElnea EM, Quill B, Docherty NG, Irnaten M, Siah WF, Clark AF, O'Brien CJ, Wallace DM. Oxidative stress, mitochondrial dysfunction and calcium overload in human lamina cribrosa cells from glaucoma donors. Mol Vis. 2011;17:1182-91. 28. Irnaten M, Barry RC, Wallace DM, Docherty NG, Quill B, Clark AF, O'Brien CJ. Elevated maxiK(+) ion channel current in glaucomatous lamina cribrosa cells. Exp Eye Res. 2013 Oct;115:224-9. 29. Clapham DE: TRP channels as cellular sensors. Nature 426: 517–524, 2003. 30. Heineke J, Molkentin JD. Regulation of cardiac hypertrophy by intracellular signaling pathways. Nat Rev Mol Cell Biol. 2006;7:589–600. 31. Wilkins BJ, Dai YS, Bueno OF, Parsons SA, Xu J, Plank DM, Jones F, Kimball TR, Molkentin. JD.Calcineurin/NFAT coupling participates in pathological, but not physiological, cardiac hypertrophy. Circ Res. 2004 Jan 9;94(1):110-8. 32. Wu X, Eder P, Chang B, Molkentin JD. TRPC channels are necessary mediators of pathologic cardiac hypertrophy. Proc Natl Acad Sci USA. 2010 Apr 13;107(15):7000-5. 33. Houser SR, Molkentin JD. Does contractile Ca2+ control calcineurin-NFAT signaling and pathological hypertrophy in cardiac myocytes? Sci Signal. 2008 Jun 24;1(25):pe31.

24

34. Eder P, Molkentin JD.TRPC channels as effectors of cardiac hypertrophy. Circ Res. 2011 Jan 21;108(2):265-72. 35. Kuwahara K, Wang Y, McAnally J, Richardson JA, Bassel-Duby R, Hill JA, Olson EN. TRPC6 fulfills a calcineurin signaling circuit during pathologic cardiac remodeling. J Clin Invest. 2006 Dec;116(12):3114-26. Epub 2006 Nov 9. 36. Gao H, Wang F, Wang W, Makarewich CA, Zhang H, Kubo H, Berretta RM, Barr LA, Molkentin JD, Houser SR.Ca2+ influx through L-type Ca2+ channels and transient receptor potential channels activates pathological hypertrophy signaling. J Mol Cell Cardiol. 2012 Nov;53(5):65767. 37. Chen X, Nakayama H, Zhang X, Ai X, Harris DM, Tang M, et al. Calcium influx through Cav1.2 is a proximal signal for pathological cardiomyocyte hypertrophy. Mol. Cell. Cardiol. 2011;50: 460–70. 38. Herum KM, Lunde IG, Skrbic B, Florholmen G, Behmen D, Sjaastad I, Carlson CR, Gomez MF, Christensen G. Syndecan-4 signaling via NFAT regulates extracellular matrix production and cardiac myofibroblast differentiation in response to mechanical stress. J Mol Cell Cardiol. 2013 Jan;54: 73-81. 39. Lambert W, Agarwal R, Howe W, Clark AF, Wordinger RJ. Neurotrophin and neurotrophin receptor expression by cells of the human lamina cribrosa. Invest Ophthalmol Vis Sci. 2001 Sep;42(10):2315-23. 40. Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem. 1976 May 7;72:248-54. 41. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001;25(4):402–8.

25

42. Laemmli U. K., “Cleavage of structural proteins during the assembly of the head of bacteriophage T4,” Nature, vol. 227, no. 5259, pp. 680–685, 1970. 43. Singh A., Hildebrand ME, Garcia E, and Snutch TP. The transient receptor potential channel antagonist SKF96365 is a potent blocker of low-voltage-activated T-type calcium channels. Br J Pharmacol. 2010 Jul; 160(6): 1464–1475. 44. Maroto R, Raso A, Wood TG, Kurosky A, Martinac B, Hamill OP. TRPC1 forms the stretchactivated cation channel in vertebrate cells. Nat Cell Biol. 2005 Feb;7(2):179-85. 45. Spassova MA, Hewavitharana T, Xu W, Soboloff J, Gill DL. A common mechanism underlies stretch activation and receptor activation of TRPC6 channels. Proc Natl Acad Sci U S A. 2006 Oct 31;103(44):16586-91. 46. Seth M, Zhang ZS, Mao L, Graham V, Burch J, Stiber J, Tsiokas L, Winn M, Abramowitz J, Rockman HA, Birnbaumer L, Rosenberg P. TRPC1 channels Are Critical for Hypertrophic Signaling in the Heart. Circ Res. 2009; 105:1023–1030. 47. Fernandez, R. A., Wan, J., Song, S., Smith, K. A., Gu, Y., Tauseef, M., Tang, H., Makino, A., Mehta, D. and Yuan, J. X.-J. (2015). Upregulated expression of STIM2, TRPC6, and Orai2 contributes to the transition of pulmonary arterial smooth muscle cells from a contractile to proliferative phenotype. Am. J. Physiol. Cell Physiol. 308, C581-C593. 48. Ross GR, Bajwa T.Jr, et al., Enhanced store-operated Ca2+ influx and ORAI1 expression in ventricular fibroblasts from human failing heart. Biology Open 2017. 6: 326-332. 49. Nielsen N, Kondratska K, Ruck T, Hild B, Kovalenko I4,, Schimmelpfennig S, Welzig J, et al., TRPC6 channels modulate the response of pancreatic stellate cells to hypoxia. Pflugers Arch. 2017 Dec;469(12):1567-1577.

26

50. Iyer SC, Kannan A, Gopal A, Devaraj N, Halagowder D. Receptor channel TRPC6 orchestrate the activation of human hepatic stellate cell under hypoxia condition. Exp Cell Res. 2015 Aug 1;336(1):66-75. 51. Ma R, Chaudhari S, Li W. Canonical Transient Receptor Potential 6 Channel: A New Target of Reactive Oxygen Species in Renal Physiology and Pathology. Antioxid Redox Signal. 2016 Nov 1;25(13):732-748. 52. Chen S, Fan Q, Gao X, Wang X, Huang R, Laties AM, Zhang X. Increased expression of the transient receptor potential cation channel 6 gene in patients with primary open-angle glaucoma. Clin Experiment Ophthalmol. 2013 Nov;41(8):753-60. 53. Reinach PS, Mergler S, Okada Y, Saika S. Ocular transient receptor potential channel function in health and disease. BMC Ophthalmol. 2015 Dec 17;15 Suppl 1:153. 54. Choi HJ, Sun D, Jakobs TC. Astrocytes in the optic nerve head express putative mechanosensitive channels. Mol Vis. 2015 Jul 14;21:749-66.Wimmers S, Strauss O. Basal calcium entry in retinal pigment epithelial cells is mediated by TRPC channels. Invest Ophthalmol Vis Sci. 2007;48(12):5767–5772. 55. Sappington RM, Sidorova T, Long DJ, Calkins DJ., TRPV1: contribution to retinal ganglion cell apoptosis and increased intracellular Ca2+ with exposure to hydrostatic pressure. Invest Ophthalmol Vis Sci, 2009. 50(2): p. 717-28. 56. Ryskamp DA, Frye AM, Phuong TT, Yarishkin O, et al., TRPV4 regulates calcium homeostasis, cytoskeletal remodeling, conventional outflow and intraocular pressure in the mammalian eye. Sci Rep. 2016 Aug 11; 6:30583. 57. Villereal ML. Mechanism and functional significance of TRPC channel multimerization. Semin Cell Dev Biol 2006; 17:618–629. 27

58. Parekh AB and Putney JW. Store-operated calcium channels. Physiol Rev 85: 757–810, 2005. 59. Gudermann T, Schnitzler M, and Dietrich A. Receptor operated cation entry-more than esoteric terminology? Sci STKE. 2004 Jul 20;2004(243):pe35. 60. Fowler MA, Sidiropoulou K, Ozkan ED, Phillips CW, Cooper DC. Corticolimbic expression of TRPC4 and TRPC5 channels in the rodent brain. PLoS One. 2007 Jun 27;2(6):e573. 61. Zhang C, Roepke TA, Kelly MJ, Rønnekleiv OK. Kisspeptin depolarizes gonadotropin-releasing hormone neurons through activation of TRPC-like cationic channels. J Neurosci. 2008 Apr 23; 28(17):4423-34. 62. Juvin V, Penna A, Chemin J, Lin YL, Rassendren FA. Pharmacological characterization and molecular determinants of the activation of transient receptor potential V2 channel orthologs by 2-amino-ethoxy-diphenyl borate. Mol Pharmacol. 2007 Nov;72(5):1258-68. 63. He X, Li S, Liu B, Susperreguy S, et al., Major contribution of the 3/6/7 class of TRPC channels to myocardial ischemia/reperfusion and cellular hypoxia/reoxygenation injuries. Proc Natl Acad Sci U S A. 2017 Jun 6;114(23): E4582- E4591. 64. Nakayama H, Wilkin BJ, Bodi I, Molkentin JD. Calcineurin-dependent cardiomyopathy is activated by TRPC in the adult mouse heart. FASEB J. 2006 Aug;20(10):1660-70. 65. Onohara N, Nishida M, Inoue R, et al. TRPC3 and TRPC6 are essential for angiotensin IIinduced cardiac hypertrophy. EMBO J. 2006; 25: 5305–16. 66. Watanabe H, Iino K, Ohba T, Ito H. Possible involvement of TRP channels in cardiac hypertrophy and arrhythmia. Curr Top Med Chem. 2013;13(3):283-94. Review.

28

67. Yu Y, Fantozzi I, Remillard CV, et al., Enhanced expression of transient receptor potential channels in idiopathic pulmonary arterial hypertension. Proc Natl Acad Sci U S A 101: 13861– 13866, 2004. 68. Weissmann N, Sydykov A, Kalwa H, et al. Activation of TRPC6 channels is essential for lung ischaemia-reperfusion induced oedema in mice. Nat Commun. 2012 Jan 31;3:649. 69. Pigozzi, D.; Ducret, T.; Tajeddine, N.; et al. Calcium store contents control the expression of TRPC1, TRPC3 and TRPV6 proteins in LNCaP prostate cancer cell line. Cell Calcium, 2006, 39(5), 401-415. 70. Thebault, S.; Flourakis, M.; Vanoverberghe, K. et al. Differential role of transient receptor potential channels in Ca2+ entry and proliferation of prostate cancer epithelial cells. Cancer Res., 2006, 66(4), 2038-2047. 71. Tezel G, Thornton IL, Tong MG et al., Immunoproteomic analysis of potential serum biomarker candidates in human glaucoma. Invest Ophthalmol Vis Sci. 2012 Dec 13;53(13):8222-31. 72. Hondur G, Göktas E, Yang X et al., Oxidative Stress-Related Molecular Biomarker Candidates for Glaucoma. Invest Ophthalmol Vis Sci. 2017 Aug 1;58(10):4078-4088.

29

Figures legends Figure 1: TRPC1-7 mRNA expression in normal and glaucoma LC cells Conventional standard reverse transcriptase PCR (A, B) and quantitative real-time RT-PCR (C) performed in 3 normal controls and 3 glaucoma LC cell donors. A) Typical experiment of an agarose gel electrophoresis of PCR amplicons showed that TRPC1, -3, -5, -6 and -7 were detected in normal LC cells, while expression of TRPC4 was very low and TRPC2 was not detected. B) In glaucoma samples TRPC1, -2, -3, -6 and -7 were expressed, while expression of TRPC4 and TRPC5 were detected a very low level. C) Average data of quantitative real time RT-PCR comparing the transcription levels of TRPC1-7 in LC cells obtained from 3 normal controls ( ) and 3 glaucoma ( ) LC cell donors. Note that TRPC1 and TRPC6 are the most highly transcribed in glaucoma LC cells relative to normal control LC cells.

Figure 2: Protein expression analysis of TRPC1 and TRPC6 protein in normal and glaucoma LC cells Protein expression of TRPC1 and TRPC6 was performed by western immunoblotting using specific anti-TRPC1 (A) and anti-TRPC6 (C) antibodies in normal (N1, N2, N3) and glaucoma (G1, G2, G3) LC cells. Average data illustrating the expression of TRPC1 (B) and TRPC6 (D) in LC cell lines obtained from 3 normal control donors ( ) and 3 glaucoma ( ) individuals. Note that both TRPC1 and TRPC6 were expressed at lower levels in normal LC cells; while, their expression level was significantly enhanced in glaucoma LC cells (*P<0.02, 2-tailed unpaired Student’s t-test). Results are expressed as relative pixel intensity versus normal control LC cell samples. GAPDH was used as a loading control, with the same level of expression seen in normal non-stressed cell lysates. Values that are significantly different to control are denoted by asterisks **p<0.02.

30

Figure 3: Effect of SKF96365 on H2O2-induced profibrotic gene transcription in normal LC cells A) Effect of dose-response of H2O2 treatment on LC cell viability. Following 24h of culture in serum free medium, LC cells were treated with increasing concentrations of H2O2 (0, 100, 200, 500 µM) for 6h. Cell viability was measured by MTT assay. Note that during the 6h incubation, both 200 µM and 500 µM H2O2 significantly (p<0.05) reduced the cell survival rate, while 100 µM H2O2 had no effect on LC cell viability. Data are represented as mean ± SD from three biological replicates. *p < 0.05, **p<0.02 versus control. B) Effect of dose-response of SKF96365 on H2O2-induced TGFβ expression. Following serum-starvation for 24 hours, normal cells were incubated with Increasing concentrations of SKF96365 (0, 0.1, 1.0, 10, 100 µM) in the presence or absence of H2O2 (100 µM) for 6 hours. The mRNA expression of TGFβ1 was analysed by quantitative RT-PCR in triplicates and repeated three times to assess the reproducibility of the results. Note that H2O2 treatment significantly (p<0.05) enhanced TGFβ1 mRNA expression level (gene expression level relative to GAPDH). # (p<0.05) denotes the difference between H2O2 treated cells and untreated controls. SKF96365 (10 µM) treatment significantly (p<0.05) reduced the H2O2-induced increase in TGFβ1 gene expression, while low SKF96365 concentrations (0.1, 1.0 µM) had no significant effect. Data are means ± SD; *p < 0.05, **p<0.02 versus (control). C) Following 24 h of culture in serum free medium, cells were assigned into untreated (control) or H2O2-treated cells in the presence or absence of SKF96365 (10 µM) treated groups (triplicated wells per condition). Quantitative real time RT-PCR analysis of TGFβ1, αSMA, Col 1A1 and periostin shows that SKF96365 treatment significantly (p<0.02) blocked the H2O2-induced increase in transcription levels of TGFβ1, αSMA, Col 1A1 but not periostin, (**P < 0.02, 2-tailed unpaired Student’s t-test). GAPDH was used as a positive control, with the same level of transcription in untreated (control) and H2O2-treated LC cells. All qRT-PCRs were performed in triplicate and repeated at least three times to assess the reproducibility of the results.

31

Significantly different values compared to untreated controls are denoted by ∗ or #. Data were expressed as mean ± S. D; **p < 0.02 vs. control.

Figure 4: Effect of siRNA-TRPC1/C6 on H2O2-induced profibrotic gene transcription in normal and glaucoma LC cells. Quantitative real time RT-PCR performed in triplicates normal (A) and glaucoma LC cells (B). Following 24h incubation in serum free medium, LC cells were transfected with siRNA in serum free and antibiotics free medium for 24h, transferred into serum free medium containing antibiotics for another 24h, then the cells were exposed to H2O2 (100 µM) for an additional 6h. In this experiment, LC cells were divided into: 1) Untreated control cells (without H2O2), 2) Cells treated with noncoding siRNA (NC siRNA), 3) Cells transfected with siTRPC1/6, 4) Cells treated with H2O2 alone, and 5) Cells transfected with siTRPC1, siTRPC6 or siTRPC1+ siTRPC6 in the presence of H2O2 (100 µM). Quantitative real time RT-PCR analysis on TGFβ1, αSMA, Col 1A1 and periostin was measured and shows that siRNA silencing of TRPC1/C6 significantly (p<0.02) blocked the H2O2-induced increase in transcription of TGFβ1, αSMA, and Col1A1, (**P < 0.02, 1-way ANOVA with Tukey-Kramer post-test). GAPDH was used as a positive control, with the same level of transcription in untreated controls and H2O2-treated LC cells. Values which are significantly different to controls are denoted by an asterisk. Data were expressed as mean ± S.D., (**p < 0.02) vs. normal control. Figure 5: Effect of siRNATRPC1/C6 silencing on TRPC1/C6 protein expression in LC cells. Normal and glaucoma LC cells were transfected with TRPC1 and TRPC6-specific siRNAs in serum free and antibiotics free medium for 24h, transferred into serum free medium containing antibiotics for another 24, then the cells were exposed to H2O2 (100 µM) for an additional 6h, and their respective protein expression level was evaluated using Western blot analysis. Representative experiment and average data of Western blot in normal (A,C) and in glaucoma LC cells (B,D). Lane

32

1: Untreated control cells (without H2O2). Lane 2: Cells treated with non-coding siRNA (NC siRNA). Lane 3: Cells transfected with siTRPC1 or siTRPC6, respectively. Lane 4: Cells treated with H2O2 alone, and Lane 5: Cells transfected with siTRPC1 or siTRPC6 in the presence of H2O2 (100 µM). TRPC1/C6 protein expression in LC cells was assessed by Western blot analysis. Note that siRNATRPC1/C6 treatment, significantly inhibited H2O2-induced TRPC1/C6 protein expression (*P<0.05, 2-tailed unpaired Student’s t-test). Results expressed as relative pixel intensity (1 x 103 absorption units) versus control LC samples. Protein was quantified by densitometry. TRPC1 and C6 densities were normalized to GAPDH values and plotted as relative pixel intensity of the untreated control (mean ± SD for 3 different experiments). *Significance from control. *p < 0.05; **p < 0.02. Figure 6: Effect of SKF96365 on H2O2-induced proliferation in normal LC cells Following 24 h of serum starvation, LC cells were divided into untreated controls or H2O2-treated cells (100 µM H2O2, 6h) in the presence or absence of the TRPC inhibitor SKF96365 (10 µM). Cell proliferation was assessed by the colorimetric MTS assay 5 days later, as indicated. SKF96365 pretreatment significantly inhibited the H2O2-induced increase in proliferation in LC cells. (*P<0.05, 2tailed unpaired Student’s t-test. Data were expressed as mean ± S.D., and values which are significantly different to untreated controls are denoted by asterisks. *p < 0.05 vs. control. All cell proliferation experiments were performed in triplicate and repeated three times to assess the reproducibility of the results. Figure 7: Effect of siRNA-TRPC1/C6 on H2O2-induced proliferation in normal LC cells Following 24h incubation in serum free medium, LC cells were transfected with siRNA in serum free and antibiotics free medium for 24h, transferred into serum free medium with antibiotics for another 24h, then the cells were exposed to H2O2 (100 µM) for an additional 6h. Colorimetric MTS assay was performed to examine the effect of siRNA-TRPC1/C6 knockdown on cell proliferation in normal LC cells 5 days post-transfection. LC cells were assessed into: 1) untreated control cells, 2} cells

33

treated with non-coding siRNA (NC siRNA), cells treated with siTRPC1, siTRPC6, cells treated with H2O2 (100 µM, 6h) alone, and cells treated with H2O2 in the presence of siTRPC1 and siTRPC6 or combined siTRPC1+ siTRPC6, respectively. Note that both siTRPC1 and siTRPC6 significantly (p<0.05) reduced the cell proliferation under basal conditions (without H2O2). Also, siTRPC1, si6 treatment significantly (p<0.05) reduced the H2O2-induced proliferation in LC cells (*P<0.05), 2tailed unpaired Student’s t-test. Also note that combined transfection of LC cell with siTRPC1 + siTRPC6, further reduce the cell proliferation then LC when cells were transfected with siTRPC1 and siTRPC6 separately. The significance is represented by the symbol #. Data were expressed as mean ± S.D., *p<0.05, *p<0.02 vs. H2O2-treated cells. All qRT-PCRs experiments were performed in triplicates and repeated three times to assess the reproducibility of the results.

Figure 8: Effect of SKF96365 on H2O2-induced NFATc3 protein phosphorylation in normal LC cells. Western blot analysis of NFATc3 protein phosphorylation in normal LC cells. Phosphorylated NFATc3 protein expression was performed in untreated controls or H2O2-treated LC cells (100 µM) for 6 hours in the presence or absence of the TRPC inhibitor SKF96365 (10 µM). (A): Representative western immunoblot for phosphorylated NFATc3 (pNFATc3) in LC cells and (B): Averaged data of Western immunoblots densitometry analysis obtained from 3 different normal LC cell donors. The H2O2 treatment resulted in a significant decrease of pNFATc3 expression, and this NFATc3 de-phosphorylation was blocked by SKF96365 treatment (*P<0.05, 2-tailed unpaired Student’s t-test). Results expressed as relative pixel intensity (1 x 103 absorption units) versus control LC samples. GAPDH was used as a loading control, with the same level of expression seen in untreated and hydrogen peroxide treated cell lysates. Western blot experiments were repeated three times to assess the reproducibility of the results and the values that are significantly different to untreated controls are denoted by asterisks. *p<0.05.vs untreated controls.

34

Table 1: Pro-fibrotic and TRPC gene primers used for RT-PCR and real time qRT-PCR Orientatio Human Genes

Primer Sequence

Location

Forward

CTTCCTCTCCATCCTCTTCC

196—215

Reverse

GTTTCTGACACCCGTAGTCC

449—468

Forward

TCTCACTATCCCGAATCAAC

1531-1550

Size bp

n

hTRPC1

272

hTRPC2

322 Reverse

ATGGGATGTGCTACAAACTG

1881-1900

Forward

GACATATTCAAGTTCATGGTCCTC

1888-1911

Reverse

ACATCACTGTCATCCTCAATTTCT

2187-2210

hTRPC3

414

TCTGCAGATATCTCTGGGAAGGA Forward

1-26 TGC

hTRPC4

369 AAGCTTTGTTCGAGCAAATTTCCA Reverse

389-415 TTC

Forward hTRPC5

CGCCTCTAAGTCAAGCCCTAATCA

3832-3855 319

ATGGGTGAGAAAAGCAAAGCAAA Reverse

4127-4150 A

Forward

TTGGAAGAACAGTCAAAGACATCT

1897-1920

Reverse

CAATTTCCTGGAATGAACTGTTGA

2197-2220

Forward

GGTTGAGGAACAGCACCTTC

2-21

Reverse

TCTTGGACTCCTCCAGCATT

283-302

Forward

GCAGTGGCTGAACCAAGGA

Reverse

GCAGTGAGCGCTGAATCGA

Forward

CCGACCGAATGCAGAAGGA

hTRPC6

324

hTRPC7

300

TGFβ1

αSMA

35

Reverse

ACAGAGTATTTGCGCTCCGAA

Forward

ACGAAGACATCCCACCAATC

Reverse

ATGGTACCTGAGGCCGTTC

Forward

GAAAGGGAGTAAGCAAGGGAG

Reverse

ATAATGTCCAGTCTCCAGGTTG

Forward

CTGGGACGACATGGAGAAAA

Reverse

AAGGAAGGCTGGAAGAGTGC

Col1A1

Periostin

GAPDH

36

Figure 1 A

B

Gene expression levels relative to GAPDH

C **

** 1.0 Normal 0.9 Glaucoma

0.8 0.7 0.6 0.5

*

0.4 0.3 0.2

*

0.1 0 TRPC1

TRPC2

TRPC3

TRPC4

TRPC5

TRPC6

TRPC7

GAPDH

Figure 2

A

N1

N2

N3

G1

G2

G3

C

N1

N2

N3

G1

G2

G3

TRPC1

TRPC6

GAPDH

GAPDH

Normal

10 8 6 4 2 0

Glaucoma

**

Relative Pixel Intensity (1x 103 a.u)

D Relative Pixel Intensity (1x 103 a.u)

B

Normal

10 8 6 4 2 0

Glaucoma

**

Figure 3A

Figure 3B

TGFb1 TGFb1 gene expression levels relative to GAPDH

Survival rate (%)

120

80

* * 40

*

1.6

**

#

1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0

0 untreated

100

200

H2O2

500

[µM]

SKF96365 untreated

0

1.0

10

100

H2O 2 (100 µM)

[µM]

Figure 3C

Gene expression levels relative to GAPDH

1.6

TGFb1

αSMA

**

**

Col1A1 **

GAPDH

1.4

Periostin

1.2 1.0 0.8 0.6 0.4

0.2 Cont.

0.0 SKF96365 H2O2

-

+ -

+

+ +

-

+ -

+

+ +

-

+ -

+

+ +

-

+ -

+

+ +

-

+ -

+

+ +

Figure 4A

1.4

Gene expression levels relative to GAPDH

1.2

TGFb1 **

SMA **

Col1A1 ** GAPDH Periostin

1.0 0.8 0.6 0.4 0.2 0.0

H2O 2 (100 µM)

H2O 2 (100 µM)

H2O 2 (100 µM)

H2O 2 (100 µM)

H2O 2 (100 µM)

Figure 4B

1.4

Gene expression levels relative to GAPDH

1.2

TGFb1 **

SMA **

Col1A1

** Periostin

GAPDH

1.0 0.8 0.6 0.4 0.2 0.0

H2O 2 (100 µM)

H2O 2 (100 µM)

H2O 2 (100 µM)

H2O 2 (100 µM)

H2O 2 (100 µM)

6

4

2 0

4

H2O2

5 0

1 2 3

siTRPC1

B

H2O2

8

siTRPC1

**

NC-siRNA

10

Relative Pixel Intensity (1x 103 a.u)

A

Untreated

siTRPC1

3

H2O2

2

siTRPC1

1

NC-siRNA

C

Untreated

Relative Pixel Intensity (1x 103 a.u)

Figure 5

** **

**

10 8

6

4

2

4

TRPC1 TRPC6

H2O2

D

GAPDH GAPDH

Figure 6

*

Absorbance at 490 nm relative to control

200

*

150

100

50

0

SKF96365

-

+

-

+

H2O2 [100 µM]

Figure 7

** *

200

*

Absorbance at 490 nm relative to control

* 150

* #

100

# #

50

0

H2O2 [100 µM]

Figure 8

A

C 10

*

8

Relative Pixel Intensity (1x 103 a.u)

Relative Pixel Intensity (1x 103 a.u)

10

6 4 2 0

*

8 6 4 2 0

1

2

3

4

B

1

2

3

4

-

+

-

+

pNFATc3 b-Actin SKF96365

-

+

-

+

H2O2 [100 µM]

SKF96365

H2O2 [100 µM]

D

Highlights

• •

• •

•

The lamina cribrosa in glaucoma is associated with increased synthesis of extracellular matrix (ECM) proteins and connective tissue fibrosis. Underlying pathological mechanisms for this fibrosis include oxidative stress. Transient receptor potential canonical channels (TRPC) channels play a key role in ECM fibrosis. TRPC1/C6 expression is enhanced in glaucoma LC cells. These channels contribute to oxidative stress-induced ECM related gene transcription and cell proliferation in normal LC cells through a mechanism involving the Ca2+-NFATc3 signaling pathway. TRPC1/C6 channels might constitute important therapeutic targets to prevent ECM remodeling and fibrosis progression in glaucoma optic neuropathy.