- Email: [email protected]
Two novel CYP3A isoforms in marine mussel Mytilus coruscus: Identification and response to cadmium and benzo[a]pyrene
Aquatic Toxicology 214 (2019) 105239
Contents lists available at ScienceDirect
Aquatic Toxicology journal homepage: www.elsevier.com/locate/aqtox
Two novel CYP3A isoforms in marine mussel Mytilus coruscus: Identification and response to cadmium and benzo[a]pyrene
T
Jianshe Zhanga, Yuehua Hea, Xiaojun Yana, Chengkai Qub, Jiji Lia, Sheng Zhaoa, Xiaoyan Wanga, ⁎ Baoying Guoa, Huihui Liua, Pengzhi Qia, a
NationalEngineering Research Center of Marine Facilities Aquaculture, Marine Science and Technology College, Zhejiang Ocean University, Zhoushan, 316004, China Shaanxi Key Laboratory of Earth Surface System and Environmental Carrying Capacity, College of Urban and Environmental Sciences, Northwest University, Xi'an, 710127, China
b
A R T I C LE I N FO
A B S T R A C T
Keywords: Mytilus coruscus CYP3A Cadmium Benzo[a]pyrene qRT-PCR Erythromycin N-demethylase
CYP3A enzymes play a crucial role in metabolic clearance of a variety of xenobiotics. However, their genetic information and function remain unclear in molluscs. In the present study, two novel CYP3A genes i.e. McCYP3A-1 and McCYP3A-2 were identified and characterized from the thick shell mussel Mytilus coruscus, and their tissue distribution as well as the response to cadmium (Cd) and benzo[a]pyrene (B[α]P) exposure were addressed using real time quantitative RT-PCR (qRT-PCR) and erythromycin N-demethylase (ERND) assay. McCYP3A-1 and McCYP3A-2 possess typically domains of CYP family such as helix-C, helix-I, helix-K, PERF and the heme binding domain as well as the characteristic domains of CYP3s including six SRS motifs. McCYP3A-1 and McCYP3A-2 transcripts were constitutively expressed in all examined tissues with high expression level in digestive glands, hepatopancreas and gonads. Upon B[α]P exposure, McCYP3A-1 and McCYP3A-2 mRNA expression in digestive glands showed a pattern of up-regulation followed by down-regulation, while under Cd exposure, showed a time-dependent induction profile. In addition, ERND activity, generally used as an indicator of CYP3, increased in a time-dependent manner after exposure to Cd and B[α]P. These results collectively indicated that McCYP3A-1 and McCYP3A-2 are CYP3A family member and may play a potential role in metabolic clearance of xenobiotics. Meanwhile, the current results may provide some baseline data to support McCYP3A-1 and McCYP3A-2 as candidate biomarkers for monitoring of PAHs and heavy metal pollution.
1. Introduction Coastal area is the most dynamic area in the national economy. With the large-scale development of industrialization, urbanization and maritime transportation, it inevitably leads to the continuous discharge of various organic and inorganic substances into the aquatic environment, resulting in adverse impact on marine organisms. Polycyclic aromatic hydrocarbons (PAHs) and metals have been the focus of attention as typical organic and inorganic contaminants (Benedetti et al., 2015). PAHs, affiliated to the aromatic hydrocarbons, consists of two or more fused benzene rings (Haritash and Kaushik, 2009). Most of these compounds show high carcinogenic and mutagenic activities, and lead to oxidative stress, reproductive impairment, growth inhibition and locomotion difficulties. Benzo[ɑ]pyrene (B[ɑ]P), structurally characterized with five fused benzene rings (Juhasz and Naidu, 2000), has been considered to be a model PAH with the highest toxicity equivalent
⁎
factor (TEF) including high carcinogenesis and mutagenesis. B[ɑ]P is mainly released from human activities related to coal, oil, wood, diesel and gasoline combustion, especially after oil spills accidents, and commonly found in marine environments (Banni et al., 2010; Maria and Bebianno, 2011). Cadmium (Cd) is a non-essential metal that can be found throughout the environment (Waisberg et al., 2003). In humans, chronic Cd exposure could lead to nonspecific inflammation and apoptosis in liver (Habeebu et al., 2000; Włostowski et al., 2004), tubular degeneration, apoptosis, interstitial inflammation, and glomerular swelling in kidneys (Liu et al., 1998; Prozialeck et al., 2009). It has also been reported that Cd adversely affects the physiology and biochemistry of aquatic invertebrates (Kim et al., 2018; Sharma and Agrawal, 2005). Cytochrome P450 (CYP) superfamily is a heme-thiolate protein widely distributed in organisms from bacteria to mammals, it plays an important role in the biosynthesis of endogenous compounds and the biotransformation of xenobiotics (Bernard et al., 2004; Nelson et al.,
Corresponding author. E-mail address: [email protected] (P. Qi).
https://doi.org/10.1016/j.aquatox.2019.105239 Received 5 May 2019; Received in revised form 28 June 2019; Accepted 1 July 2019 Available online 02 July 2019 0166-445X/ © 2019 Elsevier B.V. All rights reserved.
Aquatic Toxicology 214 (2019) 105239
J. Zhang, et al.
substrates in subtidal zones and forms extensive subtidal beds that play an important ecological role and affect the community structure of the associated macrofauna (Wang et al., 2015). Therefore, this species may be suitable organisms to study the biological impacts of marine environment factors across China coastal area (Liu et al., 2016). Here, we focus on the identification of two novel CYP3A isoforms from M. coruscus, as well as their response to Cd and B[α]P. The objectives of this study were to: i) supplement the database for toxicity of Cd and B[α]P, especially for mussel species endemic to China; ii) provide some basic information for using CYP3As as biomarkers; iii) enrich the baseline of M. coruscus as model species in China coastal environmental biomonitoring.
1996, 2013; Rocha-E-Silva et al., 2001). CYPs catalyze a variety of redox reactions, including aliphatic or aromatic hydroxylation, epoxidation, dealkylation, N-hydroxylation, sulfoxidation, desulfuration and oxidative dehalogenation (Mansuy, 1998), and play a key role in the first stage detoxification systems of vertebrates, invertebrates, and plants (Baldwin et al., 2009). Among these compounds, CYP3A enzymes are taken as the first line of defense to prevent the body from accumulating lipophilic substances, mainly through the respiratory and digestive tracts (Hegelund and Celander, 2003), additionally, CYP3As are also involved in metabolic clearance of a variety of chemical compounds including toxins, carcinogens, pesticides, therapeutic drugs, dietary products and hormones (reviewed by Maurel, 1996). CYP3Alike proteins have been comprehensively identified in vertebrates from higher mammals to lower fish (Chang et al., 2013; Mckinnon et al., 1995). In comparison, the information on CYP3As in invertebrates is still obscure and scarce. Nevertheless, CYP3A gene has been found the existence in some invertebrates, for instance in marine copepod (reviewed by Han et al., 2016), in freshwater rotifer (Han et al., 2017), in tunicate Ciona spp. (Verslycke and Goldstone, 2006), and in molluscs containing the mussel Mytilus spp. (Cubero-Leon et al., 2012; Wootton et al., 1995; Zanette et al., 2010), the oyster Crassostrea gigas (Rodrigues-Silva et al., 2015; Zanette et al., 2010) and the scallop Chlamys farreri (Tian et al., 2014). These studies provided some helpful information to prove the crucial role of CYP3A subfamily in biological metabolism of endogenous compounds and xenobiotics in invertebrates. Biomarkers, covering biochemical, cellular, and physiological endpoints as diagnostic screening tools in environmental monitoring, have been traditionally used to assess and predict the impact of marine pollution (Galloway, 2006; Shugart and Theodorakis, 1996). Since the changes in gene expression were known as one of the earliest cellular responses to environmental stress, molecular environmental biologists have taken advantage of a model system for studying the regulation of gene expression, as different endpoints in response to various toxicants can be easily turned on and off by changing environmental factors (reviewed by Han et al., 2016). Bivalve molluscs are widely used as model species in several biomonitoring programs because of their sessile nature, filter-feeding habits, and the capacity to bio-accumulate contaminants (Goldberg et al., 1978). Recently, in marine bivalve molluscs, the CYP genes have been widely concerned as biomarkers for environmental biomonitoring. In Mytilus edulis gonad, CYP3A-like 1 and CYP3A-like 2 genes showed significant modulation in 17β-estradiol (E2) and tributyltin (TBT) (Cubero-Leon et al., 2012). In the digestive gland of the clam Ruditapes philippinarum, CYP4 gene was also significantly induced in response to B[α]P (Pan et al., 2011), whereas R. philippinarum CYP414A1 gene was responded to B[a]P, cadiumm, and copper exposures (Zhang et al., 2012). In the oyster Crassostrea gigas, CYP356 gene was cloned and localized their expression by immunohistochemistry (Rodrigues-Silva et al., 2015). These studies provided some helpful information for elucidation the response of CYPs in bivalve molluscs against xenobiotics and enriched the utilization of molluscan CYPs as biomarkers for marine environmental monitoring. Notably, the potential use of toxicity data for non-native species to develop local criteria is controversial due to uncertainty whether criteria based on species from one geographical region provide appropriate protection for species in a different region (Davies et al., 1994). Information on the toxicity of xenobiotics to native species in that can be used in site-specific risk assessments and establishing water quality guidelines or criteria (WQC) in China has been lacking (Jin et al., 2012; Yin et al., 2003). It is urgent to develop site-specific WQC for China based on indigenous species. The thick shell mussel Mytilus coruscus represents an economic important marine mussel species, mainly distributed in Chinese Yellow Sea, Korean Peninsula, and Japanese Hokkaido coastal areas, especially Zhoushan (China) coast (Xu et al., 2018). As a common calcified marine species inhabiting coastal ecosystem, M. coruscus attaches to hard
2. Materials and methods 2.1. Animals Healthy adult Mytilus coruscus (shell length, 8.17 ± 0.65 cm), were obtained from Dongji, Zhoushan, Zhejiang Province, China. After removing debris on shell surface, M. coruscus individuals were acclimated in tanks filled with aerated seawater of pH 8.0, temperature 25 ± 1 °C, salinity 28‰ for one week. The seawater was renewed 100% every day, and spirulina powder was fed daily. 2.2. Treatment and sampling A total of 240 mussels were randomly divided into four groups: blank, control, Cd and B[a]P. Tests were performed in triplicate, with twenty individuals per replicate. All chemicals containing B[α]P (99.8%) and CdCl2·2.5H2O (99.8%) were purchased from Sigma company. Mother liquors of chemicals were prepared by dissolving CdCl2·2.5H2O into deionized water while B[α]P into dimethyl sulfoxide (DMSO). According to previous investigations, B[α]P concentrations in different waters of the world range from 0.16 to 115.20 ng/L (Manoli and Samara, 1999), but B[a]P pollution in parts of China sea was more serious and its concentration was up to 663 ng/L in Daya Bay (Shenzhen, China) on average, while the total PAHs in Daya Bay could even reach 10, 984 ng/L (Qiu et al., 2004). In the present study, 10 μg/L B[a]P was selected to mimic the natural contaminant concentrations of total PAHs. The vehicle DMSO concentration of each B[α]P treatment was maintained at 0.001%, which had been proved to have no influence on mussel pre-experiment. According to Peng et al. (2015), the 96 h median lethal concentration (LC50) of Cd in M. coruscus was 3.1 mg/L, basing on, the concentration of Cd at 30 μg/L corresponding to one percent of 96 h-LC50 was chosen to perform the chronic exposure of Cd. In the control group, DMSO was added and its concentration was maintained at 0.001%. The experiment lasted for 21 days. During the experiment, the cultivation seawater and pollutant were renewed every day to maintain the concentration of B[α]P and Cd at the corresponding setting concentration. Three mussels per replicate from each treatment were dissected at 0, 3, 6, 14 and 21 days. The digestive glands of Mytilus coruscus were collected and immediately frozen in liquid nitrogen and stored at −80 °C for subsequent examination. Seven tissues, including the gills, gonads, digestive glands, hepatopancreas, adductor, haemocytes and mantles were chosen for examination of tissue distribution of McCYP3A-1 and McCYP3A-2 transcripts. All tissue samples were dissected from eight mussels and immediately frozen at -80 ℃ until use. 2.3. RNA isolation and cDNA synthesis Total RNA was isolated using the RNAsimple Total RNA Kit (TIANGEN, China) according to the manufacture's instructions, and the quality as well as the concentration were determined by Nanodrop (Thermo, USA). The first-strand cDNA synthesis was performed on the 2
Aquatic Toxicology 214 (2019) 105239
J. Zhang, et al.
Table 1 PCR primer pairs used in the present study. Primer
Sequences (5’–3’)
Usage
CYP3A-1
ATCGAAGAAAGAAGGTCGGACA CTATCTCTTCTCCAATTTCAGTTT TGGATTTATAAATGTACCAGGATG ACTGATTTTCATCACGACGAGC GGCATCCTTTAGGTAGG GAAGACATGTTTCCAAATACT GGCCTAGGCCAGGAATACCAA GAGGTCCTTCGGTTGTATGGTTCGGCTGC GCGTGGTTACCATTTGGTGTTGGTCCTCG GCAGCAACACCACTAG TCTGGATCAGATACTAACAA CCTATCGGTCTTGGTCCTGC CTGACAGATTCACTAAAGAGAATAAAGC GGAATAGGTCCAAGAATATGTATAGGAAT ACGTGACGAACACTGGAAGT ACGAACCACAGTACTTGCACA GTACGGATCGGTTGTGGGAAT AAGCAGCAGCAACACCACTA GCTACGAATTACCTGACGGACAG TTCCCAAGAAAGATGGTTGTAACAT
For CYP3A-1 ORF cloning
CYP3A-2 CYP3A-1-5'
CYP3A-1-3' CYP3A-2-5'
CYP3A-2-3' Real-CYP3A-1 Real-CYP3A-2 β-actin
For CYP3A-2 ORF cloning For CYP3A-1 5' RACE
For CYP3A-1 3' RACE For CYP3A-2 5' RACE
For CYP3A-2 3' RACE For CYP3A-1 qRT-PCR For CYP3A-2 qRT-PCR Internal reference
2.6. Enzyme activities
basis of M-MLV reverse transcriptase (Promega, USA) with an oligo-d (T) primer. The detailed methods were in accordance with the manufacturer's protocol.
Erythromycin N-demethylase (ERND) was used as an indicator of CYP3A catalytic activity in this study. ERND was calculated by measuring the formation of formaldehyde by the Nash colorimetric method (Nash, 1953). The formaldehyde concentration was measured at 420 nm and the results were expressed as nmol of HCHO min−1 mg-1 protein. Measurement for ERND catalytic activity was repeated twice for three separately prepared digestive glands microsome samples.
2.4. Gene cloning and sequence analysis of McCYP3A-1 and McCYP3A-2 Through scanning the transcriptional database of M. coruscus (Dong et al., 2017), the open reading frame (ORF) sequences of two CYP3A isoforms (termed McCYP3A-1 and McCYP3A-2) were obtained, following two pairs of specific primer pets (Table 1) were designed to amplify the ORF sequences. After then, the rapid amplification of cDNA ends (RACE) was conducted to amplify the 5ʹ- and 3ʹ-untranslated regions (UTRs) with specific and adaptor primers (Table 1). This experiment was performed using a RACE cDNA amplification kit (Life Technologies, USA), and the total RNA of the digestive glands was used as the template in accordance with the manufacturer's protocol. The Basic Local Alignment Search Tool (BLAST) provided by the National Center for Biotechnology Information (NCBI) website was used to analysis the obtained cDNA sequence. The ProtParam tool (http://www.expasy.org) was used to analysis the physicochemical property. The SMART online tool (http://smart.embl-heidelberg.de/ smart/set_mode.cgi) was used to predict the conserved domians. The BLAST algorithm and ClustalW software were used for the homology comparison. Phylogenetic relationships were analyzed by neighborjoining method with MEGA 7.0 with 5000 replications of bootstrap in the way of neighbor-joining method (Kumar et al., 2016).
2.7. qRT-PCR The real time quantitative RT-PCR (qRT-PCR) was performed on 7500 Real Time PCR System (Applied Biosystems, USA) with the SYBRR® premix ExTaq Kit (TaKaRa), in the total volume of 10 μL (0.4 μL F and R primers (Table 1), 5 μL 2 × SYBR® Premix Ex Taq™ II, 0.4 μL cDNA sample (100 ng/μL), 0.2 μL ROX II and 3.6 μL ddH2O). All samples were examined in triplicate. The reaction conditions were as follows: 95 °C for 10 min, followed by 40 cycles of 95 °C for 10 s and 60 °C for 45 s. The relative expression levels were calculated with the 2−ΔΔCt method, and β-actin was used as an internal reference (Livak and Schmittgen, 2001). 2.8. Statistical analysis Quantified data from analysis of qRT-PCR and ERND assay were analyzed by one-way analysis of variance (ANOVA) followed by Tukey's multiple range tests with SPSS 17.0 software (George and Mallery, 2009) and represented as means ± SD of three repeated experiments. Differences were considered significant at P < 0.05.
2.5. Preparation of digestive gland microsomes After dissected under ice-cold conditions, digestive glands were quickly removed and washed with ice-cold 0.15 M KCl, followed by homogenized using a glass tissue grinders in a buffer containing 1 mM phenylmethylsulfonyl fluoride (PMSF), 50 mM Tris−HCl pH 7.4, 0.1 mM dithiothreitol (DTT) supplemented with 30% (V/V) glycerol (Lu et al.,1969). Subsequently, the homogenate obtained was first centrifuged at 13 000g for 30 min at 4 ℃ and the supernatant was centrifuged at 105 000g for 1 h at 4 ℃. The microsomal pellet was resuspended in homogenization buffer supplemented until use. Protein concentrations of microsome samples were measured according to the method of Lowry et al. (1951), using bovine serum albumin as a standard.
3. Results 3.1. McCYP3A-1 and McCYP3A-2 cloning and molecular characterization The complete cDNA sequences of two novel CYP3A isoforms (accession number: MK570870 and MK570871, respectively) were firstly cloned from Mytilus coruscus. McCYP3A-1 and McCYP3A-2 consist of 1996 and 1898 bp nucleotide residues, with putative proteins of 511 and 493 amino residues, respectively (Fig. 1). The calculated molecular mass of McCYP3A-1 and McCYP3A-2 is 58.4 and 56.0 kDa, and pI is 7.51 and 6.69, respectively. Homology comparisons showed that McCYP3A-1 and McCYP3A-2 had more than 40% similarity to the 3
Aquatic Toxicology 214 (2019) 105239
J. Zhang, et al.
Fig. 1. The nucleotide sequences and the deduced amino acid sequences of McCYP3A-1 (A) and McCYP3A-2 (B). The complete cDNA sequence of McCYP3A-1 and McCYP3A-2 is 1996 and 1898 bp, with putative proteins of 511 and 493 amino residues, respectively.
aggregated into a distinct branch to distinguish from the CYP4 branch (Fig. 3).
invertebrate’s species, Mytilus edulis CYP3A-like isoform 1 and CYP3Alike isoform 2, Hyriopsis cumingii cytochrome P450 and Crassostrea gigas Cytochrome P4503A9 (Data not shown). McCYP3A-1 and McCYP3A-2 possess the classic protein secondary structures including the helix-C (WxxxR), helix-I (GxE/DTT), helix-K (ExxR), PERF (PxxFxPE/DRF) and the heme binding domain (xFxxGxRxCxG) (Fig. 2), as well as the characteristic domains conserved in other CYP3 orthologs with six putative substrate recognition sites (SRS) (Fig. 2). In the phylogenetic tree, McCYP3A-2 firstly grouped with its correspondent from another Mytilus species i.e. Mytilus edulis, whereas McCYP3A-1 firstly clustered Mizuhopecten yessoensis CYP3A24 and Azumapecten farreri CYP3A into one subbranch, following these molluscan CYP3s gathered together to form a well-defined clade supported by bootstrapping value of 82 (Fig. 3). In addition, these molluscan CYP3s and vertebrate CYP3s
3.2. Tissue distribution of McCYP3A-1 and McCYP3A-2 As shown in Fig. 4, these two CYP3As were detected in all examined tissues, with the highest expression level in digestive glands, followed by in hepatopancreas and gonads, and lower expressed in gills, haemocytes and mantles, with the lowest expression level in adductor. 3.3. Expressional profile analysis of McCYP3A-1 and McCYP3A-2 response to Cd and B[α]P exposure Upon B[α]P exposure, McCYP3A-1 mRNA was significantly induced 4
Aquatic Toxicology 214 (2019) 105239
J. Zhang, et al.
Fig. 2. Multiple alignment of McCYP3A-1 and McCYP3A-2 sequences with their counterparts in other animals. Amino acid residues marked with dark blue represented identical, while pink and light bule represented the similarity surpass 75% and 50%, respectively. Six substrate recognition sites (SRS 1–6) conserved in CYP3 were marked with boxes. Structural CYP signatures of conserved motifs were marked with horizontal straight line. C: helix-C (WxxxR); I: helix-I (GxE/DTT); K: helix-K (ExxR); PERF: (PxxFxPE/DRF); Heme binding: heme binding domain (xFxxGxRxCxG). Here used CYP3 sequences are all retrieved from Genebank database and accession numbers are listed as follows: McCYP3A-1: MK570870; McCYP3A-2: MK570871; MeCYP3A-like-1: BAH24057.1; MeCYP3A-like-2: BAH24058.1; CvCYP3A11-like-X1: XP_022304770.1; CvCYP3A11-like-X1: XP_022304771.1; MmCYP30: AAB66556.1; HsCYP3A4: NP_059488.2; XhCYP3A: AFH08755.1; DrCYP3A65: AAS09920.1.
Here, two novel CYP3A isoforms (designated as McCYP3A-1 and McCYP3A-2), which possess typically domains of CYP family such as helix-C, helix-I, helix-K, PERF and the heme binding domain as well as the characteristic domains of CYP3s including six SRS motifs, were identified from the thick shell mussel, M. coruscus. McCYP3A-1 and McCYP3A-2 shared high sequence similarity with molluscan CYP3s like M. edulis and M. yessoensis, simultaneously they gathered together with other molluscan CYP3s into one evident cluster, suggesting that these CYP3s from the same phylum are close relative. Therefore, it could be collectively speculated that the newly identified CYP3 congeners McCYP3A-1 and McCYP3A-2 belong to the CYP3 family, and might play the similar catalytic functional role in the metabolization of several of environmental pollutants just as their counterparts play in other animals. The tissue distribution of McCYP3A-1 and McCYP3A-2 transcripts were examined using qRT-PCR, and the results showed an ubiquitous expression profile for both two CYP3s. McCYP3A-1 and McCYP3A-2 transcripts showed a higher expression level in digestive glands, hepatopancreas and gonads. In mammals and fish, CYP3 proteins are very abundant in the liver and especially the gastrointestinal tract (Zanette et al., 2013), and it could metabolize between 40% and 60% of pharmacological compounds in humans (Guengerich, 2008). It has been previously proved the existence of CYP3As in mussel’ s digestive glands (Peters et al., 1998; Shaw et al., 2002; Tian et al., 2014). Similarly, the present CYP3A transcripts were highest expressed in digestive glands, suggesting that these CYP3As in mussels might act the xenobiotic metabolism function just as their counterparts play in mammals. In this work, McCYP3A-1 and McCYP3A-2 transcripts were found to be higher expressed in gonad tissues. In previous studies, CYP3A expression in gonads has been demonstrated in some fish species including rainbow trout, Globicephala melas, and F. heteroclitus (Celander et al., 2000; Hegelund and Celander, 2003; Lee et al., 1998), and most recently CYP3A was also found in gonads of mussel M. edulis (Cubero-Leon et al., 2012). It has been hypothesised that CYP3A enzymes are involved in
at 3 day post induction (dpi), thereafter, sharply inhibited at 6 dpi and 14 dpi, finally recovered to near normal level at 21 dpi (Fig. 5A). Similarly, the transcriptional expression of McCYP3A-2 was remarkably induced by B[α]P exposure, and the expression level peaked at 6 dpi, followed by a sharp decline at 14 dpi, however, it returned to the normal level at 21 dpi (Fig. 5B). The mRNA expressions of McCYP3A-1 and McCYP3A-2 were both significantly evoked by Cd exposure, and a peak level was detected at 14 dpi and 21 dpi, respectively (Fig. 5A and B). Generally, the induced expression of McCYP3A-1 and McCYP3A-2 mRNA by Cd presented a time-dependent expression profile besides the detected decrease at 21 dpi of McCYP3A-1 or at 14 dpi of McCYP3A-2 (Fig. 5A and B). 3.4. ERND activity ERND activity showed a time-dependent induction upon Cd and B [α]P exposure (Fig. 6). After Cd exposure, ERND activity was markedly induced at 6 dpi, then elevated gradually, and reached the peak at 21 dpi with a 5.6-fold increase compared with the control, however, it was not until 14 dpi that ERND activity was found a significant elevation with the induction of B[α]P, and showed the peak value at 21 dpi with a 3.9-fold increase compared with the control (Fig. 6). 4. Discussion P450 enzymes in the CYP3A subfamily play a crucial role in the metabolization a wide range of chemically diverse lipophilic organic compounds such as environmental pollutants, drugs and steroids (reviewed by Maurel, 1996). In comparison with the extensive studies in vertebrates, the relevant information on CYP3A in invertebrates especially in molluscs remains still scarce and obscure. Especially, due to the lack of specific substrate or antibody probes for molluscan CYPs, some present genes were wrongly designated as well as the relevant conclusions mistaken concluded (Grosvik et al., 2006; Zanette et al., 2013). 5
Aquatic Toxicology 214 (2019) 105239
J. Zhang, et al.
Fig. 3. Phylogenetic analysis of McCYP3A-1 and McCYP3A-2. The phylogenetic tree is constructed using MEGA software 7.0 with 5000 replications of bootstrap in the way of neighbor-joining method. McCYP3A-1 and McCYP3A-2 are marked with green circle and green triangle, respectively. Species included in the phylogenetic tree are all retrieved from Genebank database and accession numbers are also listed in the tree.
steroid biotransformation (Hegelund and Celander, 2003; Kullman and Hinton, 2001), the high expression of CYP3A in gonads supports this hypothesis. Besides to the high expression detected in digestive glands and gonads, McCYP3A-1 and McCYP3A-2 were also highly expressed in hepatopancreas. The similar scenario was also observed in Venerupis philippinarum with the highest expression level of CYP414A1 found in hepatopancreas (Zhang et al., 2012). In invertebrates, the hepatopancreas has been described as the major organ for metabolism of organic compounds and the main site of biotransformation activities (Livingstone, 1998), combined with the higher expression of CYPs in hepatopancreas, it provided an indirect support for the view that CYPs were involved in invertebrate xenobiotic metabolism. Bivalves have been well recognized to accumulate foreign organic chemicals (Stegeman and Teal, 1973) and metals (Huggett et al.,1973) and hence were employed extensively as sentinels in monitoring programs. The prominent use of bivalve mollusks in pollution monitoring programs has prompted numerous efforts to find some CYP genes, proteins or catalytic activities that would provide a similar marker of exposure in these organisms. Here, two novel CYP3A sequences were firstly identified in M. coruscus, basing on, their expression changes respond to metal Cd and organic chemical B[α]P exposure were addressed. McCYP3A-1 and McCYP3A-2 were observed susceptible to B[α]P, with a significant induction at the early stage. CYP enzymes play an important role in the metabolism of exogenous chemicals (Guengerich, 2001; Anzenbacher and Anzenbacherova, 2001). Recently, various invertebrate CYP3 clan genes such as CYP3A-like gene from the scallop
Fig. 4. Tissue distribution of McCYP3A-1 and McCYP3A-2 transcripts. Relative expression of McCYP3A-1 and McCYP3A-2 transcripts is addressed in various tissues including the gills, gonads, digestive glands, hepatopancreas, adductor, haemocytes and mantles using qRT-PCR. Data are shown as mean ± S.D. (n = 8) with β-actin as an internal reference.
6
Aquatic Toxicology 214 (2019) 105239
J. Zhang, et al.
Fig. 5. Expression changes of McCYP3A-1 (A) and McCYP3A-2 (B) respond to Cd and B[α]P exposure. The results are expressed as mean ± S.D. (n = 3). Significant difference relative to control is indicated with asterisk symbol (*P < 0.05, **P < 0.01).
organism (Zheng et al., 2015). This could be used to explain the increase at the early stage followed by a decrease with the exposure duration. ERND, susceptible to the external environment and contaminants, is generally used as an indicator of CYP3 (Dong et al., 2013; Wang et al., 2016). During B[α]P exposure, ERND activity gradually increased. We assumed that with the extension of exposure, the CYP3A enzymes gradually accumulated, and the expression of CYP3A transcripts returned to normal level when it was able to completely resist xenobiotics. Our results have shown that the identified CYP3A isoforms in M.coruscus can be regulated by PAHs, but which pathway it invoked cannot be demonstrated. In mammals, CYP3As are induced by PAH via the nuclear transcription factor (the pregnane X receptor, PXR) (Kumagai et al., 2012). However, despite of the existence of the PXR dimer partner RXR (retinoid X receptor), homologues of PXR have not been found in molluscs (Horiguchi et al., 2007; Nishikawa et al., 2004; Sternberg et al., 2008). In addition, PXR-related constitutive androstane receptor (NR1I3, CAR) evolved in the mammalian line and does not occur in invertebrates (Krasowski et al., 2005). These studies suggested that CYP3A possibly invoke a different pathway in invertebrates than in vertebrates. In addition to CYP3A, members of the CYP1 families are also known for the oxidative transformation of xenobiotics in vertebrates (Nebert and Russell, 2002). Vertebrate CYP1 genes can be induced via the aryl-hydrocarbon receptor (AHR), activated by xenobiotic chemicals, such as PAHs (Denison et al., 2002). In mollusks, AHR homolog sequences that were similar to mammals have been reported, however, there is evidence showing that invertebrate AHRs do not bind known ligands for vertebrate AHRs (Butler et al., 2004; Hahn, 2002; Liu et al., 2010; Qin and Powell-Coffman, 2004). Most recently, Zanette et al. (2013) reported that MeCYP3-like-1 and MeCYP3-like-2 genes can be induced slightly by mammalian AHR agonist β-naphthoflavone (BNF) in M. edulis gills, and hence they considered it was tempting to invoke the AHR. The pathway involved for CYPs in invertebrates needs to be further elucidated by future studies. Cd, as a non-redox metal, is unlikely to participate in Fenton-type reactions. Nevertheless, Cd is known to enhance the intracellular formation of reactive oxygen species and promote cellular oxidative stress (Company et al., 2004). Also, Cd can compete with essential metals in protein binding sites leading to the release of Fe2+ and Cu2+ ions, causing increased production of reactive oxygen species and oxidative stress (Pruski and Dixon, 2002). Cd has been demonstrated to stimulate or inhibit the liver and kidney CYPs in rat (Plewka et al., 2004). Henczová et al. (2008) had reported that heavy metals can interact with
Fig. 6. Effects of Cd and B[α]P on erythromycin N-demethylase (ERND) activity in M. coruscus digestive glands. ERND was calculated by measuring the formation of formaldehyde by the Nash colorimetric method. The formaldehyde concentration was measured at 420 nm and the results were expressed as nmol of HCHO min-1 mg-1 protein. Data represents the mean of three replicates. Significant difference relative to control was indicated with asterisk symbol (*P < 0.05, **P < 0.01).
Chlamys farreri (Tian et al., 2014), CYP3-like 2 from the tunicate Oikopleura dioica (Yadetie et al., 2012) and CYP3 clan genes from polychaete (Li et al., 2004; Zheng et al., 2013; Won et al., 2013) have been identified and found to respond to PAHs. These results suggested that these invertebrate CYP3 clan genes might be involved in the metabolism of PAHs just as their correspondents act in vertebrates. It was noticeable that the transcriptional level of McCYPA3-1 and McCYP3A-2 sharply decreased with the prolongation of time and finally recovered to the normal level when the experiment terminated. CYP often catalyzes xenobiotics into more toxic metabolites, causing negative effects (Zheng et al., 2013). We speculated that at the early stage of exposure to B[α]P, two CYP3A isoforms were primarily triggered to metabolise the toxicant, with the increasing time, the mussels cannot eliminate the xenobiotics in a timely manner, and thus the xenobiotics and their toxic metabolites accumulate destroying the detoxification system of the 7
Aquatic Toxicology 214 (2019) 105239
J. Zhang, et al.
hepatic microsomal CYPs, and cause complex changes in the CYP-dependent metabolism in fish. Here, a time-dependent induction was detected in both CYP3A isoforms after the Cd exposure. These results suggested that the expression of McCYP3A-1 and McCYP3A-2 might be regulated by the production of reactive oxygen species generated by Cd exposure. In addition, the increased ERNA activity could mean the complex interactions between Cd and microsomal CYPs. With respect to the underlying mechanism of this interaction and the effects on CYPdependent metabolism, it should be further investigated in future studies. In conclusion, two newly CYP3A homologues were first identified from M. coruscus, and demonstrated to be members of CYP superfamily through BLAST results, conserved domain searching and phylogenetic analysis. Their transcripts constitutively expressed in all examined tissues with the high expression level in digestive glands, hepatopancreas and gonads, as well as a significant induction in digestive glands by Cd and B[α]P exposure. Further, ERND activity showed a time-dependent increase after exposure to Cd and B[α]P. The present study shed a new light on the mechanism of molluscan CYP3s respond to xenobiotics.
Risebrough, R.W., William, R., Eric, S., Eric, G., 1978. The mussel watch. Environ. Conserv. 5, 101. Grosvik, B.E., Jonsson, H., Rodriguez-Ortega, M.J., Roepstorff, P., Goksoyr, A., 2006. CYP1A-immunopositive proteins in bivalves identified as cytoskeletal and major vault proteins. Aquat. Toxicol. 79, 334–340. Guengerich, F.P., 2001. Common and uncommon cytochrome P450 reactions related to metabolism and chemical toxicity. Chem. Res. Toxicol. 14, 611–650. Guengerich, F.P., 2008. Cytochrome P450 and chemical toxicology. Chem. Res. Toxicol. 21, 70–83. Habeebu, S.S., Liu, J., Liu, Y., Klaassen, C.D., 2000. Metallothionein-null mice are more sensitive than wild-type mice to liver injury induced by repeated exposure to cadmium. Toxicol. Sci. 55, 223–232. Hahn, M.E., 2002. Aryl hydrocarbon receptors: diversity and evolution. Chem-Biol. Interac. 141, 131–160. Han, J., Kim, D.H., Kim, H.S., Kim, H.J., Saj, D., Hagiwara, A., Lee, J.S., 2017. Genomewide identification of 31 cytochrome P450 (CYP) genes in the freshwater rotifer Brachionus calyciflorus and analysis of their benzo[α]pyrene-induced expression patterns. Comp. Biochem. Physiol. Part D 25 S1744117X-S17300849X. Han, J., Won, E.J., Kang, H.M., Lee, M.C., Jeong, C.B., Kim, H.S., Hwang, D.S., Lee, J.S., 2016. Marine copepod cytochrome P450 genes and their applications for molecular ecotoxicological studies in response to oil pollution. Mar. Pollut. Bull. 124, 953–961. Haritash, A.K., Kaushik, C.P., 2009. Biodegradation aspects of polycyclic aromatic hydrocarbons (PAHs): a review. J. Hazard. Mater. 169, 1–15. Hegelund, T., Celander, M.C., 2003. Hepatic versus extrahepatic expression of CYP3A30 and CYP3A56 in adult kill fish (Fundulus heteroclitus). Aquat. Toxicol. 6, 277–291. Henczová, M., Deér, A.K., Filla, A., Komlósi, V., Mink, J., 2008. Effects of Cu2+ and Pb2+ on different fish species: liver cytochrome P450-dependent monooxygenase activities and FTIR spectra. Comp. Biochem. Physiol. C. 148, 53–60. Horiguchi, T., Nishikawa, T., Ohta, Y., Shiraishi, H., Morita, M., 2007. Retinoid X receptor gene expression and protein content in tissues of the rock shell Thais clavigera. Aquat. Toxicol. 84, 379–388. Huggett, R.J., Bender, M.E., Slone, H.D., 1973. Utilizing metal concentration relationships in eastern oyster (Crassostrea virginica) to detect heavy-metal pollution. Water Res. 7, 451–460. Jin, X., Zha, J., Xu, Y., Giesy, J.P., Wang, Z., 2012. Toxicity of pentachlorophenol to native aquatic species in the Yangtze River. Environ. Sci. Pollut. R. 19, 609–618. Juhasz, A.L., Naidu, R., 2000. Bioremediation of high molecular weight polycyclic aromatic hydrocarbons: a review of the microbial degradation of benzo[α]pyrene. Int. Biodeterior. Biodegrad. 45, 57–88. Kim, B.M., Kang, S., Kim, R.O., Jung, J.H., Lee, K.W., Rhee, J.S., Lee, Y.M., 2018. De novo transcriptome assembly of brackish water flea Diaphanosoma celebensis based on short-term cadmium and benzo[a]pyrene exposure experiments. Hereditas 155, 36. Krasowski, M.D., Yasuda, K., Hagey, L.R., Schuetz, E.G., 2005. Evolutionary selection across the nuclear hormone receptor superfamily with a focus on the NR1I sub-family (vitamin D, pregnane X, and constitutive androstane receptors). Nucl. Recept. 3, 2. Kullman, S.W., Hinton, D.E., 2001. Identification, characterization, andontogeny of a second cytochrome P450 3A gene from the fresh waterteleost medaka (Oryzias latipes). Mol. Reprod. Dev. 58, 149–158. Kumagai, T., Suzuki, H., Sasaki, T., Sakaguchi, S., Miyairi, S., Yamazoe, Y., Nagata, K., 2012. Polycyclic aromatic hydrocarbons activate CYP3A4 gene transcription through human pregnane X receptor. Drug. Metab. Pharmacok. 27, 200–206. Kumar, S., Stecher, G., Tamura, K., 2016. MEGA7: molecular evolutionary geneticsanalysis version 7.0 for bigger datasets. Mol. Biol. Evol. 33, 1870–1874. Lee, S.J., Wang-Buhler, J.L., Cok, I., Yu, T.S., Yang, Y.H., Miranda, C.L., Lech, J., Buhler, D.R., 1998. Cloning, sequencing, and tissue expression of CYP3A27, a new member of the CYP3A subfamily from embryonic and adult rainbow troutlivers. Arch. Biochem. Biophys. 360, 53–61. Li, B., Bisgaarda, H.C., Forbes, V.E., 2004. Identification and expression of two novel cytochrome P450 genes, belonging to CYP4 and a new CYP331 family, in the polychaete Capitella capitata sp. I. Biochem. Biophys. Res. Commun. 325, 510–517. Liu, H., Wu, J., Xu, M., He, J., 2016. A novel biomarker for marine environmental pollution of HSP90 from Mytilus coruscus. Mar. Pollut. Bull. 111, 428–434. Liu, J., Habeebu, S.S., Liu, Y., Klaassen, C.D., 1998. Acute CdMT injection is not a good model to study chronic Cd nephropathy: comparison of chronic CdCl2 and CdMT Exposure with acute CdMT injection in rats. Toxicol. Appl. Pharmacol. 153, 48–58. Liu, N., Pan, L., Miao, J., Xu, C., Zhang, L., 2010. Molecular cloning and sequence analysis and the response of a aryl hydrocarbon receptor homologue gene inthe clam Ruditapes philippinarum exposed to benzo(a)pyrene. Comp. Biochem. Physio. C. 152, 279–287. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2−ΔΔCT method. Methods 25, 402–408. Livingstone, D.R., 1998. The fate of organic xenobiotics in aquatic ecosystems: quantitative and qualitative differences in biotransformation by invertebrates and fish. Comp. Biochem.Physio. A 120, 43–49. Lowry, O.H., Rosebrough, N.J., Farr, A.L., Randall, R.J., 1951. Protein measurement with the Folin phenol reagent. J. Biol. Chem. 193, 265–275. Lu, A.Y., Junk, K.W., Coon, M.J., 1969. Resolution of the cytochrome P-450-containing omega-hydroxylation system of liver microsomes into three components. J. Biol.Chem. 244, 3714–3721. Manoli, E., Samara, C., 1999. Polycyclic aromatic hydrocarbons in natural waters: sources, occurrence and analysis. TrAC-Trend. Anal. Chem. 18, 417–428. Mansuy, D., 1998. The great diversity of reactions catalyzed by cytochromes P450. Comp. Biochem. Phys. C. 121, 5–14. Maria, V.L., Bebianno, M.J., 2011. Antioxidant and lipid peroxidation responses in Mytilus galloprovincialis exposed to mixtures of benzo(a)pyrene and copper. Comp. Biochem. Physiol. C 154, 56–63.
Acknowledgment This research was supported by Zhejiang public welfare project (2017C32009), the Special Fund for the Key Research and Development Project of Zhejiang Province (2019C02056), Zhoushan science and technology planning project (2019F12004) and NSFC-Zhejiang Joint Fund for the Integration of Industrialization and Informatization (U1609204). References Anzenbacher, P., Anzenbacherova, E., 2001. Cytochromes P450 and metabolism ofxenobiotics. Cell. Mol. Life Sci. 58, 737–747. Baldwin, W.S., Marko, P.B., Nelson, D.R., 2009. The cytochrome P450 (CYP) gene superfamily in Daphnia pulex. BMC Genomics 10, 169. Banni, M., Negri, A., Dagnino, A., Jebali, J., Ameur, S., Boussetta, H., 2010. Acute effects of benzo[a]pyrene on digestive gland enzymatic biomarkers and DNA damage on mussel Mytilus galloprovincialis. Ecotoxicol. Environ. Saf. 73, 842–848. Benedetti, M., Giuliani, M.E., Regoli, F., 2015. Oxidative metabolism of chemical pollutants in marine organisms: molecular and biochemical biomarkers in environmental toxicology. Ann. N. Y. Acad. Sci. 1340, 8–19. Bernard, M., Visser, S.L.P.D., Sason, S., 2004. Mechanism of oxidation reactions catalyzed by cytochrome p450 enzymes. Chem. Rev. 104, 3947. Butler, R.A., Kelley, M.L., Olberding, K.E., Gardner, G.R., Van Beneden, R.J., 2004. Aryl hydrocarbon receptor (AHR)-independent effects of 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) on soft shell clam (Mya arenaria) reproductive tissue. Comp. Biochem. Physiol. C. 138, 375–381. Celander, M.C., Moore, M.J., Stegeman, J.J., 2000. Cellular localization of CYP3A proteins in various tissues from pilot whale (Globicephala melas). Environ.Toxicol. Pharmacol. 8, 245–253. Chang, C., Chung, H., Su, H., Tseng, H., Tzou, W., Hu, C., 2013. Regulation of zebrafish CYP3A65 transcription by AHR2. Toxicol. Appl. Pharm. 270, 174–184. Company, R., Serafim, A., Bebianno, M.J., Cosson, R., Shillito, B., Fiala-Médioni, A., 2004. Effect of cadmium, copper and mercury on antioxidant enzyme activities and lipidperoxidation on the gills of the hydrothermal vent mussel Bathymodiolus axoricus. Mar. Environ. Res. 58, 377–381. Cubero-Leon, E., Puinean, A.M., Labadie, P., Ciocan, C., Itoh, N., Kishida, M., Osada, M., Minier, C., Hill, E.M., Rotchell, J.M., 2012. Two CYP3A-like genes in the marine mussel Mytilus edulis: mRNA expression modulation following short-term exposure to endocrine disruptors. Mar. Environ. Res. 74, 32–39. Davies, P.E., Cook, L.S.J., Goenarso, D., 1994. Sublethal responses to pesticides of severalspecies of Australian freshwater fish and crustaceans and rainbow trout. Environ.Toxicol. Chemosphere 13, 1341–1354. Denison, M.S., Pandini, A., Nagy, S.R., Baldwin, E.P., Bonati, L., 2002. Ligand binding and activation of the Ah receptor. Chem-Biol. Interac. 141, 3–24. Dong, M., Zhu, L.S., Shao, B., Zhu, S.Y., Wang, J., Xie, H., Wang, J.H., Wang, F.H., 2013. The effects of endosulfan on cytochrome P450 enzymes and glutathione S-transferases in zebrafish (Danio rerio) livers. Ecotoxicol. Environ. Saf. 92, 1–9. Dong, W., Chen, Y., Lu, W., Wu, B., Qi, P., 2017. Transcriptome analysis of Mytilus coruscus hemocytes in response to Vibrio alginnolyficus infection. Fish Shellfish Immunol. 70, 560–567. Galloway, T.S., 2006. Biomarkers in environmental and human health risk assessment. Mar. Pollut. Bull. 53, 606–613. George, D., Mallery, P., 2009. SPSS for Windows Step by Step: a Simple Study Guide and Reference. 17.0 Update. Allyn and Bacon, Inc. Goldberg, E.D., Bowen, V.T., Farrington, J.W., George, H., Martin, J.H., Parker, P.L.,
8
Aquatic Toxicology 214 (2019) 105239
J. Zhang, et al.
approach. Comp. Biochem. Physiol. C Toxicol. Pharmacol. 113, 273–276. Stegeman, J.J., Teal, J.M., 1973. Accumulation, release and retention of petroleum hydrocarbons by oyster Crassostrea virginica. Mar. Biol. 22, 37–44. Sternberg, R.M., Hotchkiss, A.K., Leblanc, G.A., 2008. Synchronized expressionof retinoid X receptor mRNA with reproductive tract recrudescence in an imposex-susceptible mollusc. Environ. Sci. Technol. 42, 1345–1351. Tian, S., Pan, L., Zhang, H., 2014. Identification of a CYP3A-like gene and CYPs mRNA expression modulation following exposure to benzo[a]pyrene in the bivalve mollusk Chlamys farreri. Mar. Environ. Res. 94, 7–15. Verslycke, T., Goldstone, J.J., 2006. Isolation and phylogeny of novel cytochrome P450 genes from tunicates (Ciona spp.): a CYP3 line in early deuterostomes? Mole. Phylogenet. Evol. 40, 760–771. Waisberg, M., Joseph, P., Hale, B., Beyersmann, D., 2003. Molecular and cellular mechanisms of cadmium carcinogenesis. Toxicology 192, 95–117. Wang, L., Peng, Y., Nie, X.P., Pan, B.B., Ku, P.J., Bao, S., 2016. Gene response of CYP360A, CYP314, and GST and whole-organism changes in Daphnia magna exposed to ibuprofen. Comp. Biochem. Physiol. C 179, 49–56. Wang, Y., Li, L., Hu, M., Lu, W., 2015. Physiological energetics of the thick shell mussel Mytilus coruscus exposed to seawater acidification and thermal stress. Sci. Total Environ. 514, 261–272. Włostowski, T., Bonda, E., Krasowska, A., 2004. Photoperiod affects hepatic and renal cadmium accumulation, metallothionein induction, and cadmium toxicity in the wild bank vole (Clethrionomys glareolus). Ecotoxicol. Environ. Saf. 58, 29–36. Won, E.J., Rhee, J.S., Shin, K.H., Jung, J.H., Shim, W.J., Lee, Y.M., Lee, J.S., 2013. Expression of three novel cytochrome P450 (CYP) and antioxidative genes from the polychaete, Perinereis nuntia exposed to water accommodatedfraction (WAF) of Iranian crude oil and Benzo[a]pyrene. Mar. Environ. Res. 90, 75–84. Wootton, A.N., Herring, C., Spry, J.A., Wiseman, A., Livingstone, D.R., Goldfarb, P.S., 1995. Evidence for the existence of cytochrome P450 gene families (CYP1A, 3A, 4A, 11A) and modulation of gene expression (CYP1A) in the mussel Mytilus spp. Mar. Environ. Res. 39, 21–26. Xu, K., Tang, Z., Liu, S., Liao, Z., Xia, H., Liu, L., Wang, Z., Qi, P., 2018. Effects of low concentrations copper on antioxidant responses, DNA damage and genotoxicity in thick shell mussel Mytilus coruscus. Fish Shellfish Immunol. 82, 77–83. Yadetie, F., Butcher, S., Førde, H.E., Campsteijn, C., Bouquet, J.M., Karlsen, O.A., Denoeud, F., Metpally, R., Thompson, E.M., Manak, J.R., Gok søyr, A., Chourrout, D., 2012. Conservation and divergence of chemical defense systemin the tunicate Oikopleura dioica revealed by genome wide response to two xenobiotics. BMC Genomics 2, 55. Yin, D., Jin, H., Yu, L., Hu, S., 2003. Deriving freshwater quality criteria for 2,4-dichlorophenol for protection of aquatic life in China. Chemosphere 122, 217–222. Zanette, J., Goldstone, J.V., Bainy, A.C.D., Stegeman, J.J., 2010. Identification of CYP genes in Mytilus (mussel) and Crassostrea (oyster) species: first approach to the full complement of cytochrome P450 genes in bivalves. Mar. Environ. Res. 69, S1–S3. Zanette, J., Jenny, M.J., Goldstone, J.V., Parente, T., Woodin, B.R., Bainy, A.C.D., Stegeman, J.J., 2013. Identification and expression of multiple CYP1-like and CYP3like genes in the bivalve mollusk Mytilus edulis. Aquat. Toxicol. 128, 101–112. Zhang, L., Gan, J., Ke, C., Liu, X., Zhao, J., You, L., Yu, J., Wu, H., 2012. Identification and expression profile of a new cytochrome P450 isoform (CYP414A1) in the hepatopancreas of Venerupis (ruditapes) philippinarum exposed to benzo[α]pyrene, cadmium and copper. Environ. Toxicol. Phar. 33, 85–91. Zheng, J., Mao, Y., Qiao, Y., Shi, Z., Su, Y., Wang, J., 2015. Identification of two isoforms of CYP4 in Marsupenaeus japonicus and their mRNA expression profile response to benzo[a]pyrene. Mar. Environ. Res. 112, 96–103. Zheng, S., Chen, B., Qui, X., Lin, K., Yu, X., 2013. Three novel cytochrome P450 genes identified in the marine polychaete Perinereis nuntia and their transcriptional responses to xenobiotics. Aquat. Toxicol. 134, 11–22.
Maurel, P., 1996. The CYP3 family. In: Ioannides, C. (Ed.), Cytochromes P450: Metabolic and Toxicological Aspects. CRC Press, Boca Raton, FL, pp. 241–270. Mckinnon, R.A., Burgess, W.M., Hall, P.M., Roberts-Thomson, S.J., Gonzalez, F.J., Mcmanus, M.E., 1995. Characterisation of CYP3A gene subfamily expression in human gastrointestinal tissues. Gut 36, 259–267. Nash, T., 1953. The colorimetric estimation of formaldehyde by means of the Hantzsch reaction. Biochem. J. 55, 416. Nebert, D.W., Russell, D.W., 2002. Clinical importance of the cytochromes P450. Lancet 360, 1155–1162. Nelson, D.R., Goldstone, J.V., Stegeman, J.J., 2013. The cytochrome P450 genesis locus: the origin and evolution of animal cytochrome P450s. Philos. T. Royal. Soc. Lon. 368, 20120474. Nelson, D.R., Koymans, L., Kamataki, T., Stegeman, J.J., Feyereisen, R., Waxman, D.J., Waterman, M.R., Gotoh, O., Coon, M.J., Estabrook, R.W., 1996. P450 superfamily: update on new sequences, gene mapping, accession numbers and nomenclature. Pharmacogenetics 6, 1–42. Nishikawa, J., Mamiya, S., Kanayama, T., Nishikawa, T., Shiraishi, F., Horiguchi, T., 2004. Involvement of the retinoid X receptor in the development of imposex caused by organotins in gastropods. Environ. Sci. Technol. 38, 6271–6276. Pan, L., Liu, N., Xu, C., Miao, J., 2011. Identification of a novel P450 gene belonging tothe CYP4 family in the clam Ruditapes philippinarum, and analysis of basal- and benzo(a) pyrene-induced mRNA expression levels in selected tissues. Environ.Toxicol. Phar. 32, 390–398. Peng, L., Zeng, J., Chen, Q., Huang, W., Ping, D.U., 2015. Effects of cadmium on antioxidant enzyme activity in gill of Mytilus coruscus and acute toxicity of cadmium on Mytilus coruscus. Environ. Sci. Technol. 38, 13–18. Peters, L.D., Nasci, C., Livingstone, D.R., 1998. Immunochemical investigations of cytochrome P450 forms/epitopes (CYP1A, 2B, 2E, 3A and 4A) in digestive gland of Mytilus spp. Comp. Biochem. Physiol. C. 121, 361–369. Plewka, A., Nowaczyk, G., Brzóska, M.M., Kami ´nski, M., Moniuszko-Jakoniuk, J., 2004. Effects of chronic exposure to cadmium on renal cytochrome P450-dependent monooxygenase system in rats. Arch. Toxicol. 78, 194–200. Prozialeck, W.C., Edwards, J.R., Lamar, P.C., Liu, J., Vaidya, V.S., Bonventre, J.V., 2009. Expression ofkidney injury molecule1 (Kim-1) in relation to necrosis and apoptosis during the early stages of Cd-induced proximal tubule injury. Toxicol. Appl. Pharmacol. 238, 306–314. Pruski, A.M., Dixon, D.R., 2002. Effects of cadmium on nuclear integrity and DNA repair efficiency in the gill cells of Mytilus edulis L. Aquat. Toxicol. 57, 127–137. Qin, H., Powell-Coffman, J.A., 2004. The Caenorhabditis elegans aryl hydrocarbon receptor, AHR-1, regulates neuronal development. Dev. Biol. 270, 64–75. Qiu, Y.W., Zhou, J.L., Maskaoui, K., Hong, H.S., Wang, Z.D., 2004. Distribution of polycyclic aromatic hydrocarbons in water and sediments from Daya bay and their ecological hazard assessment. J. Tropic. Oceangr. 23, 72–80. Rocha-E-Silva, T.A.A., Farley, B., Nonaka, K.O., Selistre-De-Araujo, H.S., Rantin, F.T., Degterev, I.A., 2001. Spectral characteristics of a compound altering cytochrome P450 spectra from vertebrate microsomes suggest that it is a functional protein. Comp. Biochem. Phys. C. 130, 53–66. Rodrigues-Silva, C., Flores-Nunes, F., Vernal, J.I., Cargnin-Ferreira, E., Bainy, A.C.D., 2015. Expression and immunohistochemical localization of the cytochrome P450 isoform 356A1 (CYP356A1) in oyster Crassostrea gigas. Aquat. Toxicol. 159, 267–275. Sharma, R.K., Agrawal, M., 2005. Biological effects of heavy metals: and overview. J. Environ. Biol. 26, 301–313. Shaw, J.P., Large, A.T., Livingstone, D.R., Doyotte, A., Renger, J., Chipman, J.K., Peters, L.D., 2002. Elevation of cytochrome P450-immunopositive protein and DNA damage in mussels (Mytilus edulis) transplanted to a contaminated site. Mar. Environ. Res. 54, 505–509. Shugart, L.R., Theodorakis, C.W., 1996. Genetic ecotoxicology: the genotypic diversity
9
Contents lists available at ScienceDirect
Aquatic Toxicology journal homepage: www.elsevier.com/locate/aqtox
Two novel CYP3A isoforms in marine mussel Mytilus coruscus: Identification and response to cadmium and benzo[a]pyrene
T
Jianshe Zhanga, Yuehua Hea, Xiaojun Yana, Chengkai Qub, Jiji Lia, Sheng Zhaoa, Xiaoyan Wanga, ⁎ Baoying Guoa, Huihui Liua, Pengzhi Qia, a
NationalEngineering Research Center of Marine Facilities Aquaculture, Marine Science and Technology College, Zhejiang Ocean University, Zhoushan, 316004, China Shaanxi Key Laboratory of Earth Surface System and Environmental Carrying Capacity, College of Urban and Environmental Sciences, Northwest University, Xi'an, 710127, China
b
A R T I C LE I N FO
A B S T R A C T
Keywords: Mytilus coruscus CYP3A Cadmium Benzo[a]pyrene qRT-PCR Erythromycin N-demethylase
CYP3A enzymes play a crucial role in metabolic clearance of a variety of xenobiotics. However, their genetic information and function remain unclear in molluscs. In the present study, two novel CYP3A genes i.e. McCYP3A-1 and McCYP3A-2 were identified and characterized from the thick shell mussel Mytilus coruscus, and their tissue distribution as well as the response to cadmium (Cd) and benzo[a]pyrene (B[α]P) exposure were addressed using real time quantitative RT-PCR (qRT-PCR) and erythromycin N-demethylase (ERND) assay. McCYP3A-1 and McCYP3A-2 possess typically domains of CYP family such as helix-C, helix-I, helix-K, PERF and the heme binding domain as well as the characteristic domains of CYP3s including six SRS motifs. McCYP3A-1 and McCYP3A-2 transcripts were constitutively expressed in all examined tissues with high expression level in digestive glands, hepatopancreas and gonads. Upon B[α]P exposure, McCYP3A-1 and McCYP3A-2 mRNA expression in digestive glands showed a pattern of up-regulation followed by down-regulation, while under Cd exposure, showed a time-dependent induction profile. In addition, ERND activity, generally used as an indicator of CYP3, increased in a time-dependent manner after exposure to Cd and B[α]P. These results collectively indicated that McCYP3A-1 and McCYP3A-2 are CYP3A family member and may play a potential role in metabolic clearance of xenobiotics. Meanwhile, the current results may provide some baseline data to support McCYP3A-1 and McCYP3A-2 as candidate biomarkers for monitoring of PAHs and heavy metal pollution.
1. Introduction Coastal area is the most dynamic area in the national economy. With the large-scale development of industrialization, urbanization and maritime transportation, it inevitably leads to the continuous discharge of various organic and inorganic substances into the aquatic environment, resulting in adverse impact on marine organisms. Polycyclic aromatic hydrocarbons (PAHs) and metals have been the focus of attention as typical organic and inorganic contaminants (Benedetti et al., 2015). PAHs, affiliated to the aromatic hydrocarbons, consists of two or more fused benzene rings (Haritash and Kaushik, 2009). Most of these compounds show high carcinogenic and mutagenic activities, and lead to oxidative stress, reproductive impairment, growth inhibition and locomotion difficulties. Benzo[ɑ]pyrene (B[ɑ]P), structurally characterized with five fused benzene rings (Juhasz and Naidu, 2000), has been considered to be a model PAH with the highest toxicity equivalent
⁎
factor (TEF) including high carcinogenesis and mutagenesis. B[ɑ]P is mainly released from human activities related to coal, oil, wood, diesel and gasoline combustion, especially after oil spills accidents, and commonly found in marine environments (Banni et al., 2010; Maria and Bebianno, 2011). Cadmium (Cd) is a non-essential metal that can be found throughout the environment (Waisberg et al., 2003). In humans, chronic Cd exposure could lead to nonspecific inflammation and apoptosis in liver (Habeebu et al., 2000; Włostowski et al., 2004), tubular degeneration, apoptosis, interstitial inflammation, and glomerular swelling in kidneys (Liu et al., 1998; Prozialeck et al., 2009). It has also been reported that Cd adversely affects the physiology and biochemistry of aquatic invertebrates (Kim et al., 2018; Sharma and Agrawal, 2005). Cytochrome P450 (CYP) superfamily is a heme-thiolate protein widely distributed in organisms from bacteria to mammals, it plays an important role in the biosynthesis of endogenous compounds and the biotransformation of xenobiotics (Bernard et al., 2004; Nelson et al.,
Corresponding author. E-mail address: [email protected] (P. Qi).
https://doi.org/10.1016/j.aquatox.2019.105239 Received 5 May 2019; Received in revised form 28 June 2019; Accepted 1 July 2019 Available online 02 July 2019 0166-445X/ © 2019 Elsevier B.V. All rights reserved.
Aquatic Toxicology 214 (2019) 105239
J. Zhang, et al.
substrates in subtidal zones and forms extensive subtidal beds that play an important ecological role and affect the community structure of the associated macrofauna (Wang et al., 2015). Therefore, this species may be suitable organisms to study the biological impacts of marine environment factors across China coastal area (Liu et al., 2016). Here, we focus on the identification of two novel CYP3A isoforms from M. coruscus, as well as their response to Cd and B[α]P. The objectives of this study were to: i) supplement the database for toxicity of Cd and B[α]P, especially for mussel species endemic to China; ii) provide some basic information for using CYP3As as biomarkers; iii) enrich the baseline of M. coruscus as model species in China coastal environmental biomonitoring.
1996, 2013; Rocha-E-Silva et al., 2001). CYPs catalyze a variety of redox reactions, including aliphatic or aromatic hydroxylation, epoxidation, dealkylation, N-hydroxylation, sulfoxidation, desulfuration and oxidative dehalogenation (Mansuy, 1998), and play a key role in the first stage detoxification systems of vertebrates, invertebrates, and plants (Baldwin et al., 2009). Among these compounds, CYP3A enzymes are taken as the first line of defense to prevent the body from accumulating lipophilic substances, mainly through the respiratory and digestive tracts (Hegelund and Celander, 2003), additionally, CYP3As are also involved in metabolic clearance of a variety of chemical compounds including toxins, carcinogens, pesticides, therapeutic drugs, dietary products and hormones (reviewed by Maurel, 1996). CYP3Alike proteins have been comprehensively identified in vertebrates from higher mammals to lower fish (Chang et al., 2013; Mckinnon et al., 1995). In comparison, the information on CYP3As in invertebrates is still obscure and scarce. Nevertheless, CYP3A gene has been found the existence in some invertebrates, for instance in marine copepod (reviewed by Han et al., 2016), in freshwater rotifer (Han et al., 2017), in tunicate Ciona spp. (Verslycke and Goldstone, 2006), and in molluscs containing the mussel Mytilus spp. (Cubero-Leon et al., 2012; Wootton et al., 1995; Zanette et al., 2010), the oyster Crassostrea gigas (Rodrigues-Silva et al., 2015; Zanette et al., 2010) and the scallop Chlamys farreri (Tian et al., 2014). These studies provided some helpful information to prove the crucial role of CYP3A subfamily in biological metabolism of endogenous compounds and xenobiotics in invertebrates. Biomarkers, covering biochemical, cellular, and physiological endpoints as diagnostic screening tools in environmental monitoring, have been traditionally used to assess and predict the impact of marine pollution (Galloway, 2006; Shugart and Theodorakis, 1996). Since the changes in gene expression were known as one of the earliest cellular responses to environmental stress, molecular environmental biologists have taken advantage of a model system for studying the regulation of gene expression, as different endpoints in response to various toxicants can be easily turned on and off by changing environmental factors (reviewed by Han et al., 2016). Bivalve molluscs are widely used as model species in several biomonitoring programs because of their sessile nature, filter-feeding habits, and the capacity to bio-accumulate contaminants (Goldberg et al., 1978). Recently, in marine bivalve molluscs, the CYP genes have been widely concerned as biomarkers for environmental biomonitoring. In Mytilus edulis gonad, CYP3A-like 1 and CYP3A-like 2 genes showed significant modulation in 17β-estradiol (E2) and tributyltin (TBT) (Cubero-Leon et al., 2012). In the digestive gland of the clam Ruditapes philippinarum, CYP4 gene was also significantly induced in response to B[α]P (Pan et al., 2011), whereas R. philippinarum CYP414A1 gene was responded to B[a]P, cadiumm, and copper exposures (Zhang et al., 2012). In the oyster Crassostrea gigas, CYP356 gene was cloned and localized their expression by immunohistochemistry (Rodrigues-Silva et al., 2015). These studies provided some helpful information for elucidation the response of CYPs in bivalve molluscs against xenobiotics and enriched the utilization of molluscan CYPs as biomarkers for marine environmental monitoring. Notably, the potential use of toxicity data for non-native species to develop local criteria is controversial due to uncertainty whether criteria based on species from one geographical region provide appropriate protection for species in a different region (Davies et al., 1994). Information on the toxicity of xenobiotics to native species in that can be used in site-specific risk assessments and establishing water quality guidelines or criteria (WQC) in China has been lacking (Jin et al., 2012; Yin et al., 2003). It is urgent to develop site-specific WQC for China based on indigenous species. The thick shell mussel Mytilus coruscus represents an economic important marine mussel species, mainly distributed in Chinese Yellow Sea, Korean Peninsula, and Japanese Hokkaido coastal areas, especially Zhoushan (China) coast (Xu et al., 2018). As a common calcified marine species inhabiting coastal ecosystem, M. coruscus attaches to hard
2. Materials and methods 2.1. Animals Healthy adult Mytilus coruscus (shell length, 8.17 ± 0.65 cm), were obtained from Dongji, Zhoushan, Zhejiang Province, China. After removing debris on shell surface, M. coruscus individuals were acclimated in tanks filled with aerated seawater of pH 8.0, temperature 25 ± 1 °C, salinity 28‰ for one week. The seawater was renewed 100% every day, and spirulina powder was fed daily. 2.2. Treatment and sampling A total of 240 mussels were randomly divided into four groups: blank, control, Cd and B[a]P. Tests were performed in triplicate, with twenty individuals per replicate. All chemicals containing B[α]P (99.8%) and CdCl2·2.5H2O (99.8%) were purchased from Sigma company. Mother liquors of chemicals were prepared by dissolving CdCl2·2.5H2O into deionized water while B[α]P into dimethyl sulfoxide (DMSO). According to previous investigations, B[α]P concentrations in different waters of the world range from 0.16 to 115.20 ng/L (Manoli and Samara, 1999), but B[a]P pollution in parts of China sea was more serious and its concentration was up to 663 ng/L in Daya Bay (Shenzhen, China) on average, while the total PAHs in Daya Bay could even reach 10, 984 ng/L (Qiu et al., 2004). In the present study, 10 μg/L B[a]P was selected to mimic the natural contaminant concentrations of total PAHs. The vehicle DMSO concentration of each B[α]P treatment was maintained at 0.001%, which had been proved to have no influence on mussel pre-experiment. According to Peng et al. (2015), the 96 h median lethal concentration (LC50) of Cd in M. coruscus was 3.1 mg/L, basing on, the concentration of Cd at 30 μg/L corresponding to one percent of 96 h-LC50 was chosen to perform the chronic exposure of Cd. In the control group, DMSO was added and its concentration was maintained at 0.001%. The experiment lasted for 21 days. During the experiment, the cultivation seawater and pollutant were renewed every day to maintain the concentration of B[α]P and Cd at the corresponding setting concentration. Three mussels per replicate from each treatment were dissected at 0, 3, 6, 14 and 21 days. The digestive glands of Mytilus coruscus were collected and immediately frozen in liquid nitrogen and stored at −80 °C for subsequent examination. Seven tissues, including the gills, gonads, digestive glands, hepatopancreas, adductor, haemocytes and mantles were chosen for examination of tissue distribution of McCYP3A-1 and McCYP3A-2 transcripts. All tissue samples were dissected from eight mussels and immediately frozen at -80 ℃ until use. 2.3. RNA isolation and cDNA synthesis Total RNA was isolated using the RNAsimple Total RNA Kit (TIANGEN, China) according to the manufacture's instructions, and the quality as well as the concentration were determined by Nanodrop (Thermo, USA). The first-strand cDNA synthesis was performed on the 2
Aquatic Toxicology 214 (2019) 105239
J. Zhang, et al.
Table 1 PCR primer pairs used in the present study. Primer
Sequences (5’–3’)
Usage
CYP3A-1
ATCGAAGAAAGAAGGTCGGACA CTATCTCTTCTCCAATTTCAGTTT TGGATTTATAAATGTACCAGGATG ACTGATTTTCATCACGACGAGC GGCATCCTTTAGGTAGG GAAGACATGTTTCCAAATACT GGCCTAGGCCAGGAATACCAA GAGGTCCTTCGGTTGTATGGTTCGGCTGC GCGTGGTTACCATTTGGTGTTGGTCCTCG GCAGCAACACCACTAG TCTGGATCAGATACTAACAA CCTATCGGTCTTGGTCCTGC CTGACAGATTCACTAAAGAGAATAAAGC GGAATAGGTCCAAGAATATGTATAGGAAT ACGTGACGAACACTGGAAGT ACGAACCACAGTACTTGCACA GTACGGATCGGTTGTGGGAAT AAGCAGCAGCAACACCACTA GCTACGAATTACCTGACGGACAG TTCCCAAGAAAGATGGTTGTAACAT
For CYP3A-1 ORF cloning
CYP3A-2 CYP3A-1-5'
CYP3A-1-3' CYP3A-2-5'
CYP3A-2-3' Real-CYP3A-1 Real-CYP3A-2 β-actin
For CYP3A-2 ORF cloning For CYP3A-1 5' RACE
For CYP3A-1 3' RACE For CYP3A-2 5' RACE
For CYP3A-2 3' RACE For CYP3A-1 qRT-PCR For CYP3A-2 qRT-PCR Internal reference
2.6. Enzyme activities
basis of M-MLV reverse transcriptase (Promega, USA) with an oligo-d (T) primer. The detailed methods were in accordance with the manufacturer's protocol.
Erythromycin N-demethylase (ERND) was used as an indicator of CYP3A catalytic activity in this study. ERND was calculated by measuring the formation of formaldehyde by the Nash colorimetric method (Nash, 1953). The formaldehyde concentration was measured at 420 nm and the results were expressed as nmol of HCHO min−1 mg-1 protein. Measurement for ERND catalytic activity was repeated twice for three separately prepared digestive glands microsome samples.
2.4. Gene cloning and sequence analysis of McCYP3A-1 and McCYP3A-2 Through scanning the transcriptional database of M. coruscus (Dong et al., 2017), the open reading frame (ORF) sequences of two CYP3A isoforms (termed McCYP3A-1 and McCYP3A-2) were obtained, following two pairs of specific primer pets (Table 1) were designed to amplify the ORF sequences. After then, the rapid amplification of cDNA ends (RACE) was conducted to amplify the 5ʹ- and 3ʹ-untranslated regions (UTRs) with specific and adaptor primers (Table 1). This experiment was performed using a RACE cDNA amplification kit (Life Technologies, USA), and the total RNA of the digestive glands was used as the template in accordance with the manufacturer's protocol. The Basic Local Alignment Search Tool (BLAST) provided by the National Center for Biotechnology Information (NCBI) website was used to analysis the obtained cDNA sequence. The ProtParam tool (http://www.expasy.org) was used to analysis the physicochemical property. The SMART online tool (http://smart.embl-heidelberg.de/ smart/set_mode.cgi) was used to predict the conserved domians. The BLAST algorithm and ClustalW software were used for the homology comparison. Phylogenetic relationships were analyzed by neighborjoining method with MEGA 7.0 with 5000 replications of bootstrap in the way of neighbor-joining method (Kumar et al., 2016).
2.7. qRT-PCR The real time quantitative RT-PCR (qRT-PCR) was performed on 7500 Real Time PCR System (Applied Biosystems, USA) with the SYBRR® premix ExTaq Kit (TaKaRa), in the total volume of 10 μL (0.4 μL F and R primers (Table 1), 5 μL 2 × SYBR® Premix Ex Taq™ II, 0.4 μL cDNA sample (100 ng/μL), 0.2 μL ROX II and 3.6 μL ddH2O). All samples were examined in triplicate. The reaction conditions were as follows: 95 °C for 10 min, followed by 40 cycles of 95 °C for 10 s and 60 °C for 45 s. The relative expression levels were calculated with the 2−ΔΔCt method, and β-actin was used as an internal reference (Livak and Schmittgen, 2001). 2.8. Statistical analysis Quantified data from analysis of qRT-PCR and ERND assay were analyzed by one-way analysis of variance (ANOVA) followed by Tukey's multiple range tests with SPSS 17.0 software (George and Mallery, 2009) and represented as means ± SD of three repeated experiments. Differences were considered significant at P < 0.05.
2.5. Preparation of digestive gland microsomes After dissected under ice-cold conditions, digestive glands were quickly removed and washed with ice-cold 0.15 M KCl, followed by homogenized using a glass tissue grinders in a buffer containing 1 mM phenylmethylsulfonyl fluoride (PMSF), 50 mM Tris−HCl pH 7.4, 0.1 mM dithiothreitol (DTT) supplemented with 30% (V/V) glycerol (Lu et al.,1969). Subsequently, the homogenate obtained was first centrifuged at 13 000g for 30 min at 4 ℃ and the supernatant was centrifuged at 105 000g for 1 h at 4 ℃. The microsomal pellet was resuspended in homogenization buffer supplemented until use. Protein concentrations of microsome samples were measured according to the method of Lowry et al. (1951), using bovine serum albumin as a standard.
3. Results 3.1. McCYP3A-1 and McCYP3A-2 cloning and molecular characterization The complete cDNA sequences of two novel CYP3A isoforms (accession number: MK570870 and MK570871, respectively) were firstly cloned from Mytilus coruscus. McCYP3A-1 and McCYP3A-2 consist of 1996 and 1898 bp nucleotide residues, with putative proteins of 511 and 493 amino residues, respectively (Fig. 1). The calculated molecular mass of McCYP3A-1 and McCYP3A-2 is 58.4 and 56.0 kDa, and pI is 7.51 and 6.69, respectively. Homology comparisons showed that McCYP3A-1 and McCYP3A-2 had more than 40% similarity to the 3
Aquatic Toxicology 214 (2019) 105239
J. Zhang, et al.
Fig. 1. The nucleotide sequences and the deduced amino acid sequences of McCYP3A-1 (A) and McCYP3A-2 (B). The complete cDNA sequence of McCYP3A-1 and McCYP3A-2 is 1996 and 1898 bp, with putative proteins of 511 and 493 amino residues, respectively.
aggregated into a distinct branch to distinguish from the CYP4 branch (Fig. 3).
invertebrate’s species, Mytilus edulis CYP3A-like isoform 1 and CYP3Alike isoform 2, Hyriopsis cumingii cytochrome P450 and Crassostrea gigas Cytochrome P4503A9 (Data not shown). McCYP3A-1 and McCYP3A-2 possess the classic protein secondary structures including the helix-C (WxxxR), helix-I (GxE/DTT), helix-K (ExxR), PERF (PxxFxPE/DRF) and the heme binding domain (xFxxGxRxCxG) (Fig. 2), as well as the characteristic domains conserved in other CYP3 orthologs with six putative substrate recognition sites (SRS) (Fig. 2). In the phylogenetic tree, McCYP3A-2 firstly grouped with its correspondent from another Mytilus species i.e. Mytilus edulis, whereas McCYP3A-1 firstly clustered Mizuhopecten yessoensis CYP3A24 and Azumapecten farreri CYP3A into one subbranch, following these molluscan CYP3s gathered together to form a well-defined clade supported by bootstrapping value of 82 (Fig. 3). In addition, these molluscan CYP3s and vertebrate CYP3s
3.2. Tissue distribution of McCYP3A-1 and McCYP3A-2 As shown in Fig. 4, these two CYP3As were detected in all examined tissues, with the highest expression level in digestive glands, followed by in hepatopancreas and gonads, and lower expressed in gills, haemocytes and mantles, with the lowest expression level in adductor. 3.3. Expressional profile analysis of McCYP3A-1 and McCYP3A-2 response to Cd and B[α]P exposure Upon B[α]P exposure, McCYP3A-1 mRNA was significantly induced 4
Aquatic Toxicology 214 (2019) 105239
J. Zhang, et al.
Fig. 2. Multiple alignment of McCYP3A-1 and McCYP3A-2 sequences with their counterparts in other animals. Amino acid residues marked with dark blue represented identical, while pink and light bule represented the similarity surpass 75% and 50%, respectively. Six substrate recognition sites (SRS 1–6) conserved in CYP3 were marked with boxes. Structural CYP signatures of conserved motifs were marked with horizontal straight line. C: helix-C (WxxxR); I: helix-I (GxE/DTT); K: helix-K (ExxR); PERF: (PxxFxPE/DRF); Heme binding: heme binding domain (xFxxGxRxCxG). Here used CYP3 sequences are all retrieved from Genebank database and accession numbers are listed as follows: McCYP3A-1: MK570870; McCYP3A-2: MK570871; MeCYP3A-like-1: BAH24057.1; MeCYP3A-like-2: BAH24058.1; CvCYP3A11-like-X1: XP_022304770.1; CvCYP3A11-like-X1: XP_022304771.1; MmCYP30: AAB66556.1; HsCYP3A4: NP_059488.2; XhCYP3A: AFH08755.1; DrCYP3A65: AAS09920.1.
Here, two novel CYP3A isoforms (designated as McCYP3A-1 and McCYP3A-2), which possess typically domains of CYP family such as helix-C, helix-I, helix-K, PERF and the heme binding domain as well as the characteristic domains of CYP3s including six SRS motifs, were identified from the thick shell mussel, M. coruscus. McCYP3A-1 and McCYP3A-2 shared high sequence similarity with molluscan CYP3s like M. edulis and M. yessoensis, simultaneously they gathered together with other molluscan CYP3s into one evident cluster, suggesting that these CYP3s from the same phylum are close relative. Therefore, it could be collectively speculated that the newly identified CYP3 congeners McCYP3A-1 and McCYP3A-2 belong to the CYP3 family, and might play the similar catalytic functional role in the metabolization of several of environmental pollutants just as their counterparts play in other animals. The tissue distribution of McCYP3A-1 and McCYP3A-2 transcripts were examined using qRT-PCR, and the results showed an ubiquitous expression profile for both two CYP3s. McCYP3A-1 and McCYP3A-2 transcripts showed a higher expression level in digestive glands, hepatopancreas and gonads. In mammals and fish, CYP3 proteins are very abundant in the liver and especially the gastrointestinal tract (Zanette et al., 2013), and it could metabolize between 40% and 60% of pharmacological compounds in humans (Guengerich, 2008). It has been previously proved the existence of CYP3As in mussel’ s digestive glands (Peters et al., 1998; Shaw et al., 2002; Tian et al., 2014). Similarly, the present CYP3A transcripts were highest expressed in digestive glands, suggesting that these CYP3As in mussels might act the xenobiotic metabolism function just as their counterparts play in mammals. In this work, McCYP3A-1 and McCYP3A-2 transcripts were found to be higher expressed in gonad tissues. In previous studies, CYP3A expression in gonads has been demonstrated in some fish species including rainbow trout, Globicephala melas, and F. heteroclitus (Celander et al., 2000; Hegelund and Celander, 2003; Lee et al., 1998), and most recently CYP3A was also found in gonads of mussel M. edulis (Cubero-Leon et al., 2012). It has been hypothesised that CYP3A enzymes are involved in
at 3 day post induction (dpi), thereafter, sharply inhibited at 6 dpi and 14 dpi, finally recovered to near normal level at 21 dpi (Fig. 5A). Similarly, the transcriptional expression of McCYP3A-2 was remarkably induced by B[α]P exposure, and the expression level peaked at 6 dpi, followed by a sharp decline at 14 dpi, however, it returned to the normal level at 21 dpi (Fig. 5B). The mRNA expressions of McCYP3A-1 and McCYP3A-2 were both significantly evoked by Cd exposure, and a peak level was detected at 14 dpi and 21 dpi, respectively (Fig. 5A and B). Generally, the induced expression of McCYP3A-1 and McCYP3A-2 mRNA by Cd presented a time-dependent expression profile besides the detected decrease at 21 dpi of McCYP3A-1 or at 14 dpi of McCYP3A-2 (Fig. 5A and B). 3.4. ERND activity ERND activity showed a time-dependent induction upon Cd and B [α]P exposure (Fig. 6). After Cd exposure, ERND activity was markedly induced at 6 dpi, then elevated gradually, and reached the peak at 21 dpi with a 5.6-fold increase compared with the control, however, it was not until 14 dpi that ERND activity was found a significant elevation with the induction of B[α]P, and showed the peak value at 21 dpi with a 3.9-fold increase compared with the control (Fig. 6). 4. Discussion P450 enzymes in the CYP3A subfamily play a crucial role in the metabolization a wide range of chemically diverse lipophilic organic compounds such as environmental pollutants, drugs and steroids (reviewed by Maurel, 1996). In comparison with the extensive studies in vertebrates, the relevant information on CYP3A in invertebrates especially in molluscs remains still scarce and obscure. Especially, due to the lack of specific substrate or antibody probes for molluscan CYPs, some present genes were wrongly designated as well as the relevant conclusions mistaken concluded (Grosvik et al., 2006; Zanette et al., 2013). 5
Aquatic Toxicology 214 (2019) 105239
J. Zhang, et al.
Fig. 3. Phylogenetic analysis of McCYP3A-1 and McCYP3A-2. The phylogenetic tree is constructed using MEGA software 7.0 with 5000 replications of bootstrap in the way of neighbor-joining method. McCYP3A-1 and McCYP3A-2 are marked with green circle and green triangle, respectively. Species included in the phylogenetic tree are all retrieved from Genebank database and accession numbers are also listed in the tree.
steroid biotransformation (Hegelund and Celander, 2003; Kullman and Hinton, 2001), the high expression of CYP3A in gonads supports this hypothesis. Besides to the high expression detected in digestive glands and gonads, McCYP3A-1 and McCYP3A-2 were also highly expressed in hepatopancreas. The similar scenario was also observed in Venerupis philippinarum with the highest expression level of CYP414A1 found in hepatopancreas (Zhang et al., 2012). In invertebrates, the hepatopancreas has been described as the major organ for metabolism of organic compounds and the main site of biotransformation activities (Livingstone, 1998), combined with the higher expression of CYPs in hepatopancreas, it provided an indirect support for the view that CYPs were involved in invertebrate xenobiotic metabolism. Bivalves have been well recognized to accumulate foreign organic chemicals (Stegeman and Teal, 1973) and metals (Huggett et al.,1973) and hence were employed extensively as sentinels in monitoring programs. The prominent use of bivalve mollusks in pollution monitoring programs has prompted numerous efforts to find some CYP genes, proteins or catalytic activities that would provide a similar marker of exposure in these organisms. Here, two novel CYP3A sequences were firstly identified in M. coruscus, basing on, their expression changes respond to metal Cd and organic chemical B[α]P exposure were addressed. McCYP3A-1 and McCYP3A-2 were observed susceptible to B[α]P, with a significant induction at the early stage. CYP enzymes play an important role in the metabolism of exogenous chemicals (Guengerich, 2001; Anzenbacher and Anzenbacherova, 2001). Recently, various invertebrate CYP3 clan genes such as CYP3A-like gene from the scallop
Fig. 4. Tissue distribution of McCYP3A-1 and McCYP3A-2 transcripts. Relative expression of McCYP3A-1 and McCYP3A-2 transcripts is addressed in various tissues including the gills, gonads, digestive glands, hepatopancreas, adductor, haemocytes and mantles using qRT-PCR. Data are shown as mean ± S.D. (n = 8) with β-actin as an internal reference.
6
Aquatic Toxicology 214 (2019) 105239
J. Zhang, et al.
Fig. 5. Expression changes of McCYP3A-1 (A) and McCYP3A-2 (B) respond to Cd and B[α]P exposure. The results are expressed as mean ± S.D. (n = 3). Significant difference relative to control is indicated with asterisk symbol (*P < 0.05, **P < 0.01).
organism (Zheng et al., 2015). This could be used to explain the increase at the early stage followed by a decrease with the exposure duration. ERND, susceptible to the external environment and contaminants, is generally used as an indicator of CYP3 (Dong et al., 2013; Wang et al., 2016). During B[α]P exposure, ERND activity gradually increased. We assumed that with the extension of exposure, the CYP3A enzymes gradually accumulated, and the expression of CYP3A transcripts returned to normal level when it was able to completely resist xenobiotics. Our results have shown that the identified CYP3A isoforms in M.coruscus can be regulated by PAHs, but which pathway it invoked cannot be demonstrated. In mammals, CYP3As are induced by PAH via the nuclear transcription factor (the pregnane X receptor, PXR) (Kumagai et al., 2012). However, despite of the existence of the PXR dimer partner RXR (retinoid X receptor), homologues of PXR have not been found in molluscs (Horiguchi et al., 2007; Nishikawa et al., 2004; Sternberg et al., 2008). In addition, PXR-related constitutive androstane receptor (NR1I3, CAR) evolved in the mammalian line and does not occur in invertebrates (Krasowski et al., 2005). These studies suggested that CYP3A possibly invoke a different pathway in invertebrates than in vertebrates. In addition to CYP3A, members of the CYP1 families are also known for the oxidative transformation of xenobiotics in vertebrates (Nebert and Russell, 2002). Vertebrate CYP1 genes can be induced via the aryl-hydrocarbon receptor (AHR), activated by xenobiotic chemicals, such as PAHs (Denison et al., 2002). In mollusks, AHR homolog sequences that were similar to mammals have been reported, however, there is evidence showing that invertebrate AHRs do not bind known ligands for vertebrate AHRs (Butler et al., 2004; Hahn, 2002; Liu et al., 2010; Qin and Powell-Coffman, 2004). Most recently, Zanette et al. (2013) reported that MeCYP3-like-1 and MeCYP3-like-2 genes can be induced slightly by mammalian AHR agonist β-naphthoflavone (BNF) in M. edulis gills, and hence they considered it was tempting to invoke the AHR. The pathway involved for CYPs in invertebrates needs to be further elucidated by future studies. Cd, as a non-redox metal, is unlikely to participate in Fenton-type reactions. Nevertheless, Cd is known to enhance the intracellular formation of reactive oxygen species and promote cellular oxidative stress (Company et al., 2004). Also, Cd can compete with essential metals in protein binding sites leading to the release of Fe2+ and Cu2+ ions, causing increased production of reactive oxygen species and oxidative stress (Pruski and Dixon, 2002). Cd has been demonstrated to stimulate or inhibit the liver and kidney CYPs in rat (Plewka et al., 2004). Henczová et al. (2008) had reported that heavy metals can interact with
Fig. 6. Effects of Cd and B[α]P on erythromycin N-demethylase (ERND) activity in M. coruscus digestive glands. ERND was calculated by measuring the formation of formaldehyde by the Nash colorimetric method. The formaldehyde concentration was measured at 420 nm and the results were expressed as nmol of HCHO min-1 mg-1 protein. Data represents the mean of three replicates. Significant difference relative to control was indicated with asterisk symbol (*P < 0.05, **P < 0.01).
Chlamys farreri (Tian et al., 2014), CYP3-like 2 from the tunicate Oikopleura dioica (Yadetie et al., 2012) and CYP3 clan genes from polychaete (Li et al., 2004; Zheng et al., 2013; Won et al., 2013) have been identified and found to respond to PAHs. These results suggested that these invertebrate CYP3 clan genes might be involved in the metabolism of PAHs just as their correspondents act in vertebrates. It was noticeable that the transcriptional level of McCYPA3-1 and McCYP3A-2 sharply decreased with the prolongation of time and finally recovered to the normal level when the experiment terminated. CYP often catalyzes xenobiotics into more toxic metabolites, causing negative effects (Zheng et al., 2013). We speculated that at the early stage of exposure to B[α]P, two CYP3A isoforms were primarily triggered to metabolise the toxicant, with the increasing time, the mussels cannot eliminate the xenobiotics in a timely manner, and thus the xenobiotics and their toxic metabolites accumulate destroying the detoxification system of the 7
Aquatic Toxicology 214 (2019) 105239
J. Zhang, et al.
hepatic microsomal CYPs, and cause complex changes in the CYP-dependent metabolism in fish. Here, a time-dependent induction was detected in both CYP3A isoforms after the Cd exposure. These results suggested that the expression of McCYP3A-1 and McCYP3A-2 might be regulated by the production of reactive oxygen species generated by Cd exposure. In addition, the increased ERNA activity could mean the complex interactions between Cd and microsomal CYPs. With respect to the underlying mechanism of this interaction and the effects on CYPdependent metabolism, it should be further investigated in future studies. In conclusion, two newly CYP3A homologues were first identified from M. coruscus, and demonstrated to be members of CYP superfamily through BLAST results, conserved domain searching and phylogenetic analysis. Their transcripts constitutively expressed in all examined tissues with the high expression level in digestive glands, hepatopancreas and gonads, as well as a significant induction in digestive glands by Cd and B[α]P exposure. Further, ERND activity showed a time-dependent increase after exposure to Cd and B[α]P. The present study shed a new light on the mechanism of molluscan CYP3s respond to xenobiotics.
Risebrough, R.W., William, R., Eric, S., Eric, G., 1978. The mussel watch. Environ. Conserv. 5, 101. Grosvik, B.E., Jonsson, H., Rodriguez-Ortega, M.J., Roepstorff, P., Goksoyr, A., 2006. CYP1A-immunopositive proteins in bivalves identified as cytoskeletal and major vault proteins. Aquat. Toxicol. 79, 334–340. Guengerich, F.P., 2001. Common and uncommon cytochrome P450 reactions related to metabolism and chemical toxicity. Chem. Res. Toxicol. 14, 611–650. Guengerich, F.P., 2008. Cytochrome P450 and chemical toxicology. Chem. Res. Toxicol. 21, 70–83. Habeebu, S.S., Liu, J., Liu, Y., Klaassen, C.D., 2000. Metallothionein-null mice are more sensitive than wild-type mice to liver injury induced by repeated exposure to cadmium. Toxicol. Sci. 55, 223–232. Hahn, M.E., 2002. Aryl hydrocarbon receptors: diversity and evolution. Chem-Biol. Interac. 141, 131–160. Han, J., Kim, D.H., Kim, H.S., Kim, H.J., Saj, D., Hagiwara, A., Lee, J.S., 2017. Genomewide identification of 31 cytochrome P450 (CYP) genes in the freshwater rotifer Brachionus calyciflorus and analysis of their benzo[α]pyrene-induced expression patterns. Comp. Biochem. Physiol. Part D 25 S1744117X-S17300849X. Han, J., Won, E.J., Kang, H.M., Lee, M.C., Jeong, C.B., Kim, H.S., Hwang, D.S., Lee, J.S., 2016. Marine copepod cytochrome P450 genes and their applications for molecular ecotoxicological studies in response to oil pollution. Mar. Pollut. Bull. 124, 953–961. Haritash, A.K., Kaushik, C.P., 2009. Biodegradation aspects of polycyclic aromatic hydrocarbons (PAHs): a review. J. Hazard. Mater. 169, 1–15. Hegelund, T., Celander, M.C., 2003. Hepatic versus extrahepatic expression of CYP3A30 and CYP3A56 in adult kill fish (Fundulus heteroclitus). Aquat. Toxicol. 6, 277–291. Henczová, M., Deér, A.K., Filla, A., Komlósi, V., Mink, J., 2008. Effects of Cu2+ and Pb2+ on different fish species: liver cytochrome P450-dependent monooxygenase activities and FTIR spectra. Comp. Biochem. Physiol. C. 148, 53–60. Horiguchi, T., Nishikawa, T., Ohta, Y., Shiraishi, H., Morita, M., 2007. Retinoid X receptor gene expression and protein content in tissues of the rock shell Thais clavigera. Aquat. Toxicol. 84, 379–388. Huggett, R.J., Bender, M.E., Slone, H.D., 1973. Utilizing metal concentration relationships in eastern oyster (Crassostrea virginica) to detect heavy-metal pollution. Water Res. 7, 451–460. Jin, X., Zha, J., Xu, Y., Giesy, J.P., Wang, Z., 2012. Toxicity of pentachlorophenol to native aquatic species in the Yangtze River. Environ. Sci. Pollut. R. 19, 609–618. Juhasz, A.L., Naidu, R., 2000. Bioremediation of high molecular weight polycyclic aromatic hydrocarbons: a review of the microbial degradation of benzo[α]pyrene. Int. Biodeterior. Biodegrad. 45, 57–88. Kim, B.M., Kang, S., Kim, R.O., Jung, J.H., Lee, K.W., Rhee, J.S., Lee, Y.M., 2018. De novo transcriptome assembly of brackish water flea Diaphanosoma celebensis based on short-term cadmium and benzo[a]pyrene exposure experiments. Hereditas 155, 36. Krasowski, M.D., Yasuda, K., Hagey, L.R., Schuetz, E.G., 2005. Evolutionary selection across the nuclear hormone receptor superfamily with a focus on the NR1I sub-family (vitamin D, pregnane X, and constitutive androstane receptors). Nucl. Recept. 3, 2. Kullman, S.W., Hinton, D.E., 2001. Identification, characterization, andontogeny of a second cytochrome P450 3A gene from the fresh waterteleost medaka (Oryzias latipes). Mol. Reprod. Dev. 58, 149–158. Kumagai, T., Suzuki, H., Sasaki, T., Sakaguchi, S., Miyairi, S., Yamazoe, Y., Nagata, K., 2012. Polycyclic aromatic hydrocarbons activate CYP3A4 gene transcription through human pregnane X receptor. Drug. Metab. Pharmacok. 27, 200–206. Kumar, S., Stecher, G., Tamura, K., 2016. MEGA7: molecular evolutionary geneticsanalysis version 7.0 for bigger datasets. Mol. Biol. Evol. 33, 1870–1874. Lee, S.J., Wang-Buhler, J.L., Cok, I., Yu, T.S., Yang, Y.H., Miranda, C.L., Lech, J., Buhler, D.R., 1998. Cloning, sequencing, and tissue expression of CYP3A27, a new member of the CYP3A subfamily from embryonic and adult rainbow troutlivers. Arch. Biochem. Biophys. 360, 53–61. Li, B., Bisgaarda, H.C., Forbes, V.E., 2004. Identification and expression of two novel cytochrome P450 genes, belonging to CYP4 and a new CYP331 family, in the polychaete Capitella capitata sp. I. Biochem. Biophys. Res. Commun. 325, 510–517. Liu, H., Wu, J., Xu, M., He, J., 2016. A novel biomarker for marine environmental pollution of HSP90 from Mytilus coruscus. Mar. Pollut. Bull. 111, 428–434. Liu, J., Habeebu, S.S., Liu, Y., Klaassen, C.D., 1998. Acute CdMT injection is not a good model to study chronic Cd nephropathy: comparison of chronic CdCl2 and CdMT Exposure with acute CdMT injection in rats. Toxicol. Appl. Pharmacol. 153, 48–58. Liu, N., Pan, L., Miao, J., Xu, C., Zhang, L., 2010. Molecular cloning and sequence analysis and the response of a aryl hydrocarbon receptor homologue gene inthe clam Ruditapes philippinarum exposed to benzo(a)pyrene. Comp. Biochem. Physio. C. 152, 279–287. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2−ΔΔCT method. Methods 25, 402–408. Livingstone, D.R., 1998. The fate of organic xenobiotics in aquatic ecosystems: quantitative and qualitative differences in biotransformation by invertebrates and fish. Comp. Biochem.Physio. A 120, 43–49. Lowry, O.H., Rosebrough, N.J., Farr, A.L., Randall, R.J., 1951. Protein measurement with the Folin phenol reagent. J. Biol. Chem. 193, 265–275. Lu, A.Y., Junk, K.W., Coon, M.J., 1969. Resolution of the cytochrome P-450-containing omega-hydroxylation system of liver microsomes into three components. J. Biol.Chem. 244, 3714–3721. Manoli, E., Samara, C., 1999. Polycyclic aromatic hydrocarbons in natural waters: sources, occurrence and analysis. TrAC-Trend. Anal. Chem. 18, 417–428. Mansuy, D., 1998. The great diversity of reactions catalyzed by cytochromes P450. Comp. Biochem. Phys. C. 121, 5–14. Maria, V.L., Bebianno, M.J., 2011. Antioxidant and lipid peroxidation responses in Mytilus galloprovincialis exposed to mixtures of benzo(a)pyrene and copper. Comp. Biochem. Physiol. C 154, 56–63.
Acknowledgment This research was supported by Zhejiang public welfare project (2017C32009), the Special Fund for the Key Research and Development Project of Zhejiang Province (2019C02056), Zhoushan science and technology planning project (2019F12004) and NSFC-Zhejiang Joint Fund for the Integration of Industrialization and Informatization (U1609204). References Anzenbacher, P., Anzenbacherova, E., 2001. Cytochromes P450 and metabolism ofxenobiotics. Cell. Mol. Life Sci. 58, 737–747. Baldwin, W.S., Marko, P.B., Nelson, D.R., 2009. The cytochrome P450 (CYP) gene superfamily in Daphnia pulex. BMC Genomics 10, 169. Banni, M., Negri, A., Dagnino, A., Jebali, J., Ameur, S., Boussetta, H., 2010. Acute effects of benzo[a]pyrene on digestive gland enzymatic biomarkers and DNA damage on mussel Mytilus galloprovincialis. Ecotoxicol. Environ. Saf. 73, 842–848. Benedetti, M., Giuliani, M.E., Regoli, F., 2015. Oxidative metabolism of chemical pollutants in marine organisms: molecular and biochemical biomarkers in environmental toxicology. Ann. N. Y. Acad. Sci. 1340, 8–19. Bernard, M., Visser, S.L.P.D., Sason, S., 2004. Mechanism of oxidation reactions catalyzed by cytochrome p450 enzymes. Chem. Rev. 104, 3947. Butler, R.A., Kelley, M.L., Olberding, K.E., Gardner, G.R., Van Beneden, R.J., 2004. Aryl hydrocarbon receptor (AHR)-independent effects of 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) on soft shell clam (Mya arenaria) reproductive tissue. Comp. Biochem. Physiol. C. 138, 375–381. Celander, M.C., Moore, M.J., Stegeman, J.J., 2000. Cellular localization of CYP3A proteins in various tissues from pilot whale (Globicephala melas). Environ.Toxicol. Pharmacol. 8, 245–253. Chang, C., Chung, H., Su, H., Tseng, H., Tzou, W., Hu, C., 2013. Regulation of zebrafish CYP3A65 transcription by AHR2. Toxicol. Appl. Pharm. 270, 174–184. Company, R., Serafim, A., Bebianno, M.J., Cosson, R., Shillito, B., Fiala-Médioni, A., 2004. Effect of cadmium, copper and mercury on antioxidant enzyme activities and lipidperoxidation on the gills of the hydrothermal vent mussel Bathymodiolus axoricus. Mar. Environ. Res. 58, 377–381. Cubero-Leon, E., Puinean, A.M., Labadie, P., Ciocan, C., Itoh, N., Kishida, M., Osada, M., Minier, C., Hill, E.M., Rotchell, J.M., 2012. Two CYP3A-like genes in the marine mussel Mytilus edulis: mRNA expression modulation following short-term exposure to endocrine disruptors. Mar. Environ. Res. 74, 32–39. Davies, P.E., Cook, L.S.J., Goenarso, D., 1994. Sublethal responses to pesticides of severalspecies of Australian freshwater fish and crustaceans and rainbow trout. Environ.Toxicol. Chemosphere 13, 1341–1354. Denison, M.S., Pandini, A., Nagy, S.R., Baldwin, E.P., Bonati, L., 2002. Ligand binding and activation of the Ah receptor. Chem-Biol. Interac. 141, 3–24. Dong, M., Zhu, L.S., Shao, B., Zhu, S.Y., Wang, J., Xie, H., Wang, J.H., Wang, F.H., 2013. The effects of endosulfan on cytochrome P450 enzymes and glutathione S-transferases in zebrafish (Danio rerio) livers. Ecotoxicol. Environ. Saf. 92, 1–9. Dong, W., Chen, Y., Lu, W., Wu, B., Qi, P., 2017. Transcriptome analysis of Mytilus coruscus hemocytes in response to Vibrio alginnolyficus infection. Fish Shellfish Immunol. 70, 560–567. Galloway, T.S., 2006. Biomarkers in environmental and human health risk assessment. Mar. Pollut. Bull. 53, 606–613. George, D., Mallery, P., 2009. SPSS for Windows Step by Step: a Simple Study Guide and Reference. 17.0 Update. Allyn and Bacon, Inc. Goldberg, E.D., Bowen, V.T., Farrington, J.W., George, H., Martin, J.H., Parker, P.L.,
8
Aquatic Toxicology 214 (2019) 105239
J. Zhang, et al.
approach. Comp. Biochem. Physiol. C Toxicol. Pharmacol. 113, 273–276. Stegeman, J.J., Teal, J.M., 1973. Accumulation, release and retention of petroleum hydrocarbons by oyster Crassostrea virginica. Mar. Biol. 22, 37–44. Sternberg, R.M., Hotchkiss, A.K., Leblanc, G.A., 2008. Synchronized expressionof retinoid X receptor mRNA with reproductive tract recrudescence in an imposex-susceptible mollusc. Environ. Sci. Technol. 42, 1345–1351. Tian, S., Pan, L., Zhang, H., 2014. Identification of a CYP3A-like gene and CYPs mRNA expression modulation following exposure to benzo[a]pyrene in the bivalve mollusk Chlamys farreri. Mar. Environ. Res. 94, 7–15. Verslycke, T., Goldstone, J.J., 2006. Isolation and phylogeny of novel cytochrome P450 genes from tunicates (Ciona spp.): a CYP3 line in early deuterostomes? Mole. Phylogenet. Evol. 40, 760–771. Waisberg, M., Joseph, P., Hale, B., Beyersmann, D., 2003. Molecular and cellular mechanisms of cadmium carcinogenesis. Toxicology 192, 95–117. Wang, L., Peng, Y., Nie, X.P., Pan, B.B., Ku, P.J., Bao, S., 2016. Gene response of CYP360A, CYP314, and GST and whole-organism changes in Daphnia magna exposed to ibuprofen. Comp. Biochem. Physiol. C 179, 49–56. Wang, Y., Li, L., Hu, M., Lu, W., 2015. Physiological energetics of the thick shell mussel Mytilus coruscus exposed to seawater acidification and thermal stress. Sci. Total Environ. 514, 261–272. Włostowski, T., Bonda, E., Krasowska, A., 2004. Photoperiod affects hepatic and renal cadmium accumulation, metallothionein induction, and cadmium toxicity in the wild bank vole (Clethrionomys glareolus). Ecotoxicol. Environ. Saf. 58, 29–36. Won, E.J., Rhee, J.S., Shin, K.H., Jung, J.H., Shim, W.J., Lee, Y.M., Lee, J.S., 2013. Expression of three novel cytochrome P450 (CYP) and antioxidative genes from the polychaete, Perinereis nuntia exposed to water accommodatedfraction (WAF) of Iranian crude oil and Benzo[a]pyrene. Mar. Environ. Res. 90, 75–84. Wootton, A.N., Herring, C., Spry, J.A., Wiseman, A., Livingstone, D.R., Goldfarb, P.S., 1995. Evidence for the existence of cytochrome P450 gene families (CYP1A, 3A, 4A, 11A) and modulation of gene expression (CYP1A) in the mussel Mytilus spp. Mar. Environ. Res. 39, 21–26. Xu, K., Tang, Z., Liu, S., Liao, Z., Xia, H., Liu, L., Wang, Z., Qi, P., 2018. Effects of low concentrations copper on antioxidant responses, DNA damage and genotoxicity in thick shell mussel Mytilus coruscus. Fish Shellfish Immunol. 82, 77–83. Yadetie, F., Butcher, S., Førde, H.E., Campsteijn, C., Bouquet, J.M., Karlsen, O.A., Denoeud, F., Metpally, R., Thompson, E.M., Manak, J.R., Gok søyr, A., Chourrout, D., 2012. Conservation and divergence of chemical defense systemin the tunicate Oikopleura dioica revealed by genome wide response to two xenobiotics. BMC Genomics 2, 55. Yin, D., Jin, H., Yu, L., Hu, S., 2003. Deriving freshwater quality criteria for 2,4-dichlorophenol for protection of aquatic life in China. Chemosphere 122, 217–222. Zanette, J., Goldstone, J.V., Bainy, A.C.D., Stegeman, J.J., 2010. Identification of CYP genes in Mytilus (mussel) and Crassostrea (oyster) species: first approach to the full complement of cytochrome P450 genes in bivalves. Mar. Environ. Res. 69, S1–S3. Zanette, J., Jenny, M.J., Goldstone, J.V., Parente, T., Woodin, B.R., Bainy, A.C.D., Stegeman, J.J., 2013. Identification and expression of multiple CYP1-like and CYP3like genes in the bivalve mollusk Mytilus edulis. Aquat. Toxicol. 128, 101–112. Zhang, L., Gan, J., Ke, C., Liu, X., Zhao, J., You, L., Yu, J., Wu, H., 2012. Identification and expression profile of a new cytochrome P450 isoform (CYP414A1) in the hepatopancreas of Venerupis (ruditapes) philippinarum exposed to benzo[α]pyrene, cadmium and copper. Environ. Toxicol. Phar. 33, 85–91. Zheng, J., Mao, Y., Qiao, Y., Shi, Z., Su, Y., Wang, J., 2015. Identification of two isoforms of CYP4 in Marsupenaeus japonicus and their mRNA expression profile response to benzo[a]pyrene. Mar. Environ. Res. 112, 96–103. Zheng, S., Chen, B., Qui, X., Lin, K., Yu, X., 2013. Three novel cytochrome P450 genes identified in the marine polychaete Perinereis nuntia and their transcriptional responses to xenobiotics. Aquat. Toxicol. 134, 11–22.
Maurel, P., 1996. The CYP3 family. In: Ioannides, C. (Ed.), Cytochromes P450: Metabolic and Toxicological Aspects. CRC Press, Boca Raton, FL, pp. 241–270. Mckinnon, R.A., Burgess, W.M., Hall, P.M., Roberts-Thomson, S.J., Gonzalez, F.J., Mcmanus, M.E., 1995. Characterisation of CYP3A gene subfamily expression in human gastrointestinal tissues. Gut 36, 259–267. Nash, T., 1953. The colorimetric estimation of formaldehyde by means of the Hantzsch reaction. Biochem. J. 55, 416. Nebert, D.W., Russell, D.W., 2002. Clinical importance of the cytochromes P450. Lancet 360, 1155–1162. Nelson, D.R., Goldstone, J.V., Stegeman, J.J., 2013. The cytochrome P450 genesis locus: the origin and evolution of animal cytochrome P450s. Philos. T. Royal. Soc. Lon. 368, 20120474. Nelson, D.R., Koymans, L., Kamataki, T., Stegeman, J.J., Feyereisen, R., Waxman, D.J., Waterman, M.R., Gotoh, O., Coon, M.J., Estabrook, R.W., 1996. P450 superfamily: update on new sequences, gene mapping, accession numbers and nomenclature. Pharmacogenetics 6, 1–42. Nishikawa, J., Mamiya, S., Kanayama, T., Nishikawa, T., Shiraishi, F., Horiguchi, T., 2004. Involvement of the retinoid X receptor in the development of imposex caused by organotins in gastropods. Environ. Sci. Technol. 38, 6271–6276. Pan, L., Liu, N., Xu, C., Miao, J., 2011. Identification of a novel P450 gene belonging tothe CYP4 family in the clam Ruditapes philippinarum, and analysis of basal- and benzo(a) pyrene-induced mRNA expression levels in selected tissues. Environ.Toxicol. Phar. 32, 390–398. Peng, L., Zeng, J., Chen, Q., Huang, W., Ping, D.U., 2015. Effects of cadmium on antioxidant enzyme activity in gill of Mytilus coruscus and acute toxicity of cadmium on Mytilus coruscus. Environ. Sci. Technol. 38, 13–18. Peters, L.D., Nasci, C., Livingstone, D.R., 1998. Immunochemical investigations of cytochrome P450 forms/epitopes (CYP1A, 2B, 2E, 3A and 4A) in digestive gland of Mytilus spp. Comp. Biochem. Physiol. C. 121, 361–369. Plewka, A., Nowaczyk, G., Brzóska, M.M., Kami ´nski, M., Moniuszko-Jakoniuk, J., 2004. Effects of chronic exposure to cadmium on renal cytochrome P450-dependent monooxygenase system in rats. Arch. Toxicol. 78, 194–200. Prozialeck, W.C., Edwards, J.R., Lamar, P.C., Liu, J., Vaidya, V.S., Bonventre, J.V., 2009. Expression ofkidney injury molecule1 (Kim-1) in relation to necrosis and apoptosis during the early stages of Cd-induced proximal tubule injury. Toxicol. Appl. Pharmacol. 238, 306–314. Pruski, A.M., Dixon, D.R., 2002. Effects of cadmium on nuclear integrity and DNA repair efficiency in the gill cells of Mytilus edulis L. Aquat. Toxicol. 57, 127–137. Qin, H., Powell-Coffman, J.A., 2004. The Caenorhabditis elegans aryl hydrocarbon receptor, AHR-1, regulates neuronal development. Dev. Biol. 270, 64–75. Qiu, Y.W., Zhou, J.L., Maskaoui, K., Hong, H.S., Wang, Z.D., 2004. Distribution of polycyclic aromatic hydrocarbons in water and sediments from Daya bay and their ecological hazard assessment. J. Tropic. Oceangr. 23, 72–80. Rocha-E-Silva, T.A.A., Farley, B., Nonaka, K.O., Selistre-De-Araujo, H.S., Rantin, F.T., Degterev, I.A., 2001. Spectral characteristics of a compound altering cytochrome P450 spectra from vertebrate microsomes suggest that it is a functional protein. Comp. Biochem. Phys. C. 130, 53–66. Rodrigues-Silva, C., Flores-Nunes, F., Vernal, J.I., Cargnin-Ferreira, E., Bainy, A.C.D., 2015. Expression and immunohistochemical localization of the cytochrome P450 isoform 356A1 (CYP356A1) in oyster Crassostrea gigas. Aquat. Toxicol. 159, 267–275. Sharma, R.K., Agrawal, M., 2005. Biological effects of heavy metals: and overview. J. Environ. Biol. 26, 301–313. Shaw, J.P., Large, A.T., Livingstone, D.R., Doyotte, A., Renger, J., Chipman, J.K., Peters, L.D., 2002. Elevation of cytochrome P450-immunopositive protein and DNA damage in mussels (Mytilus edulis) transplanted to a contaminated site. Mar. Environ. Res. 54, 505–509. Shugart, L.R., Theodorakis, C.W., 1996. Genetic ecotoxicology: the genotypic diversity
9