- Email: [email protected]
Upregulation of miR-3607 promotes lung adenocarcinoma proliferation by suppressing APC expression
Biomedicine & Pharmacotherapy 95 (2017) 497–503
Contents lists available at ScienceDirect
Biomedicine & Pharmacotherapy journal homepage: www.elsevier.com/locate/biopha
Original article
Upregulation of miR-3607 promotes lung adenocarcinoma proliferation by suppressing APC expression
MARK
Yong Lina, Qiangye Gub, Zongwen Sunc, Baowei Shenga, Congcong Qia, Bing Liua, Tian Fua, ⁎ Cun Liud, Yan Zhanga, a
Department of Respiratory Medicine, Jining NO.1 People’s Hospital, Jining 272011, China Department of tuberculousis, Jining Infectious Disease Hospital, Jining 272031, China c Department of Oncology, Jining NO.1 People’s Hospital, Jining 272011, China d Department of Clinical Laboratory, Jining NO.1 People’s Hospital, Jining 272011, China b
A R T I C L E I N F O
A B S T R A C T
Keywords: miR-3607 Lung cancer APC Cell proliferation c-Myc
Lung cancer is the leading cause of worldwide cancer-related deaths, although many drugs and new therapeutic approaches have been used, the 5-years survival rate is still low for lung cancer patients. microRNAs have been shown to regulate lung cancer initiation and development, here we studied the role of miR-3607 in lung cancer cell proliferation. We found miR-3607 was upregulated in lung cancer tissues and cells, miR-3607 overexpression promoted lung cancer cell A549 proliferation determined by MTT assay, colony formation assay, anchorage-independent growth ability assay and bromodeoxyuridine incorporation assay, while the opposite phenotypes were shown when miR-3607 was knocked down. Predicted analysis suggested a Wnt signaling pathway regulator adenomatous polyposis coli (APC) was the target of miR-3607, miR-3607 could directly bind to the 3′UTR of APC, and promoted Cyclin D1 and c-Myc expression which can be suppressed by APC. Double knockdown of miR-3607 and APC copied the phenotypes of miR-3607 overexpression, suggesting miR-3607 promoted lung cancer cell A549 proliferation by targeting APC. In conclusion, our study suggested miR-3607 contributes to lung cancer cell proliferation by inhibiting APC.
1. Introduction Lung cancer is the most frequently diagnosed cancer, it’s difficult to detect lung cancer in early stages. Moreover, lung cancer has high metastatic ability and resistance to chemoradiotherapy, so the 5-year survival rate is still low [1,2]. New therapeutic approaches must be found. microRNA (miRNA) is about 23nt non-coding, single-stranded RNA, and inhibiting gene expression by binding to the 3′-untranslated region (3′UTR) of mRNA, the mediating mRNA degradation and/or translation repression [3,4]. Many microRNAs have been reported to regulate lung cancer progression [5,6]. for example, miR-193a-3p and 5p are downregulated in lung cancer cells, they suppress lung cancer cell proliferation, migration, invasion and epithelial-mesenchymal transition (EMT) by directly targeting ERBB4, S6K2, PIK3R3 and mTOR [7,8]. miR-338-3p inhibits lung cancer metastasis by targeting SOX4 [9]. miR454 is an unfavorable prognostic factor for lung cancer patients, and contributes to lung cancer cell proliferation, migration and invasion [10].
⁎
miR-3607 can be induced expression by ionizing radiation [11], it also is low expression in prostate cancer tissues, patients with high miR3607 levels have good outcome. miR-3607 suppresses prostate cancer proliferation and invasion, and induces apoptosis by targeting SRC family kinases, LYN and SRC [12]. In this study, we studied the role of miR-3607 in lung cancer proliferation and found miR-3607 promoted lung cancer proliferation by targeting APC. 2. Materials and methods 2.1. Clinical samples and cell culture Lung cancer tissues and corresponding noncancerous tissues which had undergone surgical resection, and different clinical stage lung cancer tissues were obtained from the Jining NO.1 People’s hospital. Institutional review board approval and written informed consent from all patients were obtained. Immortalized normal lung epithelial cell BEAS–2 B and lung cancer cells NCI-H1650, 95D, A549, NCI-H460, NCI-H358, NCI-H1975 and
Corresponding author at: Jining NO.1 People’s Hospital. No.6 Health Road, Jining 272011, China. E-mail addresses: [email protected], [email protected] (Y. Zhang).
http://dx.doi.org/10.1016/j.biopha.2017.08.052 Received 15 January 2017; Received in revised form 8 August 2017; Accepted 9 August 2017 0753-3322/ © 2017 Published by Elsevier Masson SAS.
Biomedicine & Pharmacotherapy 95 (2017) 497–503
Y. Lin et al.
Fig. 1. miR-3607 is overexpressed in lung cancer cells and tissues. A. miR-3607 was upregulated in lung cancer tissues (T) compared to normal lung tissues (N), date was downloaded from TCGA data set. B. miR-3607 was upregulated in lung cancer tissues compared to the adjacent normal lung tissues, date was downloaded from TCGA data set. C. miR-3607 was upregulated in lung cancer tissues (T) compared to the tumor adjacent normal lung tissues (TAT). D. miR-3607 was upregulated in lung cancer cells compared to the immortalized normal lung epithelial cell. Data were presented as means ± SEM for three-independent experiments. *P < 0.05; **P < 0.01.
2.5. Colony formation assay
NCI-H1299 were maintained in RPMI-1640 medium (Life Technologies) supplemented with 10% fetal bovine serum at 37 °C in a humidified atmosphere containing 5% CO2 and 95% air.
2 × 104 A549 was seeded in six-well plates, and cultured for one week, the colonies were fixed with 10% formaldehyde for 5 min, then stained with 1.0% crystal violet for 30 s and photographed.
2.2. RNA isolation and quantitative real-time PCR (qRT-PCR)
2.6. Anchorage-independent growth ability assay
miRNA was isolated from cells or human tissues using mirVana miRNA isolation kit (Ambion) according to the manufacturer’s instructions. qRT-PCR was carried out using TaqMan miRNA assays (Applied Biosystems) according to the manufacturer’s instructions in the Applied Biosystems 7500 real-time detection system (Life Technologies). The miRNA expression level was normalized by U6 small nuclear RNA and calculated according to the 2−ΔΔCt method.
Anchorage-independent growth ability assay was performed according to previous method [13]. 2.7. Bromodeoxyuridine (BrdU) incorporation assay BrdU incorporation assay was performed according to previous method [13]. Briefly, cells were seeded on coverslips, and incubated with BrdU for 1 h, the cells were stained with anti-BrdU antibody (Millipore), an Alexa Fluor 594 conjugated secondary antibody (Life Technologies) was used. Nuclei were stained blue with DAPI. Images were acquired using a fluorescence microscope.
2.3. Oligonucleotide transfection miR-3607 mimic, miR-3607 inhibitor, mutational miR-3607 mimic and their negative control were synthesized by RiboBio (Guangzhou), they were transfected into lung cancer cell A549 using Lipofectamine RNAiMAX reagent (Life Technologies) according to the manufacturer’s protocol.
2.8. Western blot assay Cells lysates were extracted from A549 using RIPA buffer supplement with protease inhibitor Cocktail (Roche). Equal amount protein samples were loaded and separated using 12% SDS-PAGE, and transferred to PVDF membranes (GE Health). The membranes were blocked using 5% non-fat milk, the membranes were incubated with the antiAPC (#2504, Cell signaling), c-Myc (sc-4048, Santa Cruz), and Cyclin D1 (sc-753, Santa Cruz) antibodies for overnight at 4 °C, and were washed using TBST for three time, 5 min every time. Then the membranes were incubated with secondary antibody for 1 h at room temperature, and washed using TBST for three time, 5 min every time. The
2.4. MTT assay 200-500 A549 cells were plated in 96-well plates at a density of 0.5 × 103 cells/well, and transfected with miR-3607 mimic, miR-3607 inhibitor or negative control. MTT (Sigma) at a concentration of 0.5 mg/ml was added into wells at indicated time point, and incubated for 4 h at 37 °C. Then medium was removed, DMSO (Sigma) was added into wells to dissolve the formazan crystals. The absorbance was measured at 490 nm using a microplate reader. 498
Biomedicine & Pharmacotherapy 95 (2017) 497–503
Y. Lin et al.
Fig. 2. miR-3607 overexpression promotes lung cancer cell A549 proliferation. A. miR-3607 was significantly overexpressed after miR-3607 mimic was transfected into A549 cells. B. MTT assay suggested miR-3607 overexpression increased A549 proliferation rate. C. Colony formation assay suggested miR-3607 overexpression promoted A549 proliferation. D. Soft agar growth assay revealed that miR-3607 overexpression increased A549 anchorage-independent growth ability. E. BrdU incorporation assay suggested miR-3607 overexpression increased BrdU positive cell number. Data were presented as means ± SEM for three-independent experiments. *P < 0.05.
3. Results
bands were detected with SuperSignal West Femto Maximum Sensitivity Substrate (Thermo Fisher Scientific). α-Tubulin was used as the loading control.
3.1. MiR-3607 is upregulated in lung cancer tissues and cells We used TCGA database to analysis miR-3607 expression in lung cancer tissues, miR-3607 was significantly upregulated in lung cancer tissues compared to normal lung tissues (Fig. 1A), miR-3607 was significantly upregulated in lung cancer tissues compared to the adjacent normal lung tissues (Fig. 1B). We further examined miR-3607 expression in lung cancer tissues, and found miR-3607 was upregulated in lung cancer tissues compared to the adjacent normal lung tissues (Fig. 1C). miR-3607 was also upregulated in lung cancer cells (Fig. 1D). These results suggested miR-3607 was upregulated in lung cancer tissues and cells.
2.9. Luciferase reporter assay The fragment of the 3′UTR of APC was cloned into the psiChECK2 vector (Promega) using specific primers, forward, 5′ TTGTTGCAAA CCACTTCAAG 3′ and reverse, 5′ CTTGTTTGTTCATGTCTGGC 3′. A549 cells were plated in 48-well plates, and transfected with a mixture of vector and miR-3607 mimic, miR-3607 inhibitor or mutational miR3607 mimic using Lipofectamine 2000 (Life Technologies). Luciferase activity was analyzed using Dual Luciferase Reporter Assay System (Promega) after 48 h of transfection.
3.2. MiR-3607 overexpression promotes lung cancer cell A549 proliferation 2.10. Statistical analysis
To determine miR-3607’s role in lung cancer proliferation, we chose a most used lung cancer cell A549 with moderate miR-3607 expression for further research. miR-3607 mimic was transfected into lung cancer cell line A549 to upregulate miR-3607 level (Fig. 2A). MTT assay suggested miR-3607 overexpression promoted A549 proliferation compared to negative control (NC) (Fig. 2B). Colony formation assay suggested miR-3607 overexpression significantly increased the colony
The data were analyzed using SPSS 19.0 (SPSS). Student’s t-test was used to analyze the significance of the difference levels between two groups. P values < 0.05 were considered significant.
499
Biomedicine & Pharmacotherapy 95 (2017) 497–503
Y. Lin et al.
Fig. 3. miR-3607 knockdown inhibits lung cancer cell A549 proliferation. A. miR-3607 was significantly downregulated after miR-3607 inhibitor was transfected into A549 cells. B. MTT assay suggested miR-3607 knockdown reduced A549 proliferation rate. C. Colony formation assay suggested miR-3607 knockdown inhibited A549 proliferation. D. Soft agar growth assay revealed that miR-3607 knockdown reduced A549 anchorage-independent growth ability. E. BrdU incorporation assay suggested miR-3607 knockdown reduced BrdU positive cell number. Data were presented as means ± SEM for three-independent experiments. *P < 0.05.
Among the candidates, a Wnt pathway regulator APC was chosen for further study (Fig. 4A). Western blot assay suggested miR-3607 overexpression inhibited APC expression, while miR-3607 knockdown promoted APC expression (Fig. 4B). Luciferase reporter assay suggested luciferase activity was significantly reduced when reporter vector and miR-3607 mimic were co-transfected into A549, luciferase activity was significantly increased when reporter vector and miR-3607 were cotransfected into A549. However, luciferase activity almost didn’t change when reporter vector and mutant miR-3607 were co-transfected into A549 (Fig. 4C). These results suggested APC was the target of miR3607. Cyclin D1 and c-Myc are important regulatory for cell cycle progression, especially for G1/S transition. Meanwhile, APC is a wellcharacterized negative regulator for Wnt pathway, and can promote cell cycle inhibitor p21 and p27 expression, and inhibits c-Myc and Cyclin D1 expression [14–16], we found miR-3607 inhibited APC and conferred that miR-3607 promoted c-Myc and Cyclin D1 expression. qRTPCR and western blot assay suggested miR-3607 overexpression promoted c-Myc and Cyclin D1 expression, its knockdown inhibited c-Myc and Cyclin D1 expression (Fig. 4D and 4E). This finding suggested miR3607 promoted A549 proliferation through inhibiting APC which can inhibit Cyclin D1 and c-Myc expression.
number (Fig. 2C). Soft agar growth assay suggested miR-3607 overexpression increased the anchorage-independent growth ability (Fig. 2D). BrdU incorporation assay suggested miR-3607 overexpression significantly increased BrdU positive cell number compared to NC (Fig. 2E). These results revealed miR-3607 overexpression promoted A549 proliferation. 3.3. MiR-3607 knockdown inhibits lung cancer cell A549 proliferation To confirm above results, miR-3607 was knock-downed using miR3607 inhibitor (Fig. 3A). MTT assay suggested miR-3607 knockdown inhibited A549 proliferation compared to negative control (NC) (Fig. 3B). Colony formation assay suggested miR-3607 knockdown significantly reduced the colony number (Fig. 3C). Soft agar growth assay suggested miR-3607 knockdown reduced the anchorage-independent growth ability (Fig. 3D). BrdU incorporation assay suggested miR-3607 knockdown significantly reduced BrdU positive cell number compared to NC (Fig. 3E). These results revealed miR-3607 knockdown inhibited A549 proliferation. These results suggested miR-3607 knockdown inhibited A549 proliferation. 3.4. Wnt pathway regulator APC is the target of miR-3607 We used miRNA-PicTar and TargetScan to predict mRNA target, 500
Biomedicine & Pharmacotherapy 95 (2017) 497–503
Y. Lin et al.
Fig. 4. APC is the target of miR-3607. A. APC was a target of miR-3607 predicted by online software. The seed sites were shown as red. The mutation in seed sites was shown as green. B. Western blot assay revealed miR-3607 expression was opposite to APC levels in A549 cells. C. Luciferase reporter assay suggested luciferase activity was significantly reduced after cotransfecting miR-3607 mimic and luciferase reporter vector cloned with 3′UTR of APC, luciferase activity was significantly increased after cotransfecting miR-3607 inhibitor and luciferase reporter vector. D. qRT-PCR assay suggested miR-3607 promoted c-Myc and Cyclin D1 expression. E. Western blot assay suggested miR-3607 promoted c-Myc and Cyclin D1 expression. Data were presented as means ± SEM for three-independent experiments. *P < 0.05.
Fig. 5. miR-3607 promoted A549 proliferation by targeting APC. A. Western blot assay revealed that APC was downregulated in A549 cell with miR-3607 knockdown after transfecting APC small interference RNAs. B. Colony formation assay suggested double knockdown of APC and miR-3607 significantly promoted cell proliferation. C. Soft agar growth assay revealed that double knockdown of APC and miR-3607 significantly promoted increased A549 anchorage-independent growth ability. D. BrdU incorporation assay suggested double knockdown of APC and miR-3607 significantly increased BrdU positive cell number. Data were presented as means ± SEM for three-independent experiments. *P < 0.05.
501
Biomedicine & Pharmacotherapy 95 (2017) 497–503
Y. Lin et al.
Institutional review board approval and written informed consent from all patients were obtained. This article does not contain any studies with animals performed by any of the authors.
3.5. MiR-3607 promotes lung cancer cell A549 proliferation by inhibiting APC To confirm whether miR-3607 promotes A549 proliferation by inhibiting APC, we knock-downed miR-3607 and APC in A549 (Fig. 5A). If they can reverse the phenotype caused by miR-3607 knockdown, suggesting miR-3607 promotes A549 proliferation by inhibiting APC. In fact, colony formation assay suggested the cell number was significantly increased, when miR-3607 and APC were knock-downed simultaneously (Fig. 5B). Soft agar growth assay revealed knockdown of miR3607 and APC significantly increased the anchorage-independent growth ability (Fig. 5C). BrdU incorporation assay suggested knockdown of miR-3607 and APC significantly increased the number of BrdU positive cells (Fig. 5D). These results suggested miR-3607 indeed promotes lung cancer cell A549 proliferation by inhibiting APC. We also analyzed the expression of APC and miR-3607 in lung cancer specimens including different clinical stage, and found miR3607 was increased in the advanced clinical stage, but APC was reduced in the advanced clinical stage. There was a negative correction between the expression of miR-3607 and APC (Supplemental Fig. 1).
Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.biopha.2017.08.052. References [1] S.E. Franks, R. Briah, R.A. Jones, R.A. Moorehead, Unique roles of Akt1 and Akt2 in IGF-IR mediated lung tumorigenesis, Oncotarget 7 (3) (2016) 3297–3316. [2] C. Zhang, X.P. Ding, Q.N. Zhao, X.J. Yang, S.M. An, H. Wang, L. Xu, L. Zhu, H.Z. Chen, Role of a7-nicotinic acetylcholine receptor in nicotine-induced invasion and epithelial-to-mesenchymal transition in human non-small cell lung cancer cells, Oncotarget (2016). [3] D.P. Bartel, MicroRNAs: target recognition and regulatory functions, Cell 136 (2) (2009) 215–233. [4] G.C. Shukla, J. Singh, S. Barik, MicroRNAs: Processing, Maturation, Target Recognition and Regulatory Functions, Mol. Cell. Pharmacol. 3 (3) (2011) 83–92. [5] Y. Chen, L. Lu, B. Feng, S. Han, S. Cui, X. Chu, L. Chen, R. Wang, Non-coding RNAs as emerging regulators of epithelial to mesenchymal transition in non-small cell lung cancer, Oncotarget, 2017. [6] Y. Tutar, A. Ozgur, E. Tutar, L. Tutar, A. Pulliero, A. Izzotti, Regulation of oncogenic genes by MicroRNAs and pseudogenes in human lung cancer, Biomed. Pharmacother. 83 (2016) 1182–1190. [7] T. Yu, J. Li, M. Yan, L. Liu, H. Lin, F. Zhao, L. Sun, Y. Zhang, Y. Cui, F. Zhang, J. Li, X. He, M. Yao, MicroRNA-193a-3p and −5p suppress the metastasis of human nonsmall-cell lung cancer by downregulating the ERBB4/PIK3R3/mTOR/S6K2 signaling pathway, Oncogene 34 (4) (2015) 413–423. [8] H. Liang, M. Liu, X. Yan, Y. Zhou, W. Wang, X. Wang, Z. Fu, N. Wang, S. Zhang, Y. Wang, K. Zen, C.Y. Zhang, D. Hou, J. Li, X. Chen, miR-193a-3p functions as a tumor suppressor in lung cancer by down-regulating ERBB4, The Journal of biological chemistry 290 (2) (2015) 926–940. [9] Y. Li, P. Chen, L. Zu, B. Liu, M. Wang, Q. Zhou, MicroRNA-338-3p suppresses metastasis of lung cancer cells by targeting the EMT regulator Sox4, American journal of cancer research 6 (2) (2016) 127–140. [10] D.Y. Zhu, X.N. Li, Y. Qi, D.L. Liu, Y. Yang, J. Zhao, C.Y. Zhang, K. Wu, S. Zhao, MiR454 promotes the progression of human non-small cell lung cancer and directly targets PTEN, Biomed. Pharmacother. 81 (2016) 79–85. [11] M.A. Chaudhry, R.A. Omaruddin, C.D. Brumbaugh, M.A. Tariq, N. Pourmand, Identification of radiation-induced microRNA transcriptome by next-generation massively parallel sequencing, J. Radiat. Res. (Tokyo) 54 (5) (2013) 808–822. [12] S. Saini, S. Majid, V. Shahryari, Z.L. Tabatabai, S. Arora, S. Yamamura, Y. Tanaka, R. Dahiya, G. Deng, Regulation of SRC kinases by microRNA-3607 located in a frequently deleted locus in prostate cancer, Mol. Cancer Ther. 13 (7) (2014) 1952–1963. [13] H. Lin, T. Dai, H. Xiong, X. Zhao, X. Chen, C. Yu, J. Li, X. Wang, L. Song, Unregulated miR-96 induces cell proliferation in human breast cancer by downregulating transcriptional factor FOXO3a, PLoS One 5 (12) (2010) e15797. [14] J.N. Anastas, R.T. Moon, WNT signalling pathways as therapeutic targets in cancer, Nat. Rev. Cancer 13 (1) (2013) 11–26. [15] M. Kim, Y.A. Suh, J.H. Oh, B.R. Lee, J. Kim, S.J. Jang, KIF3A binds to beta-arrestin for suppressing Wnt/beta-catenin signalling independently of primary cilia in lung cancer, Sci. Rep. 6 (2016) 32770. [16] N. Meyer, L.Z. Penn, Reflecting on 25 years with MYC, Nat. Rev. Cancer 8 (12) (2008) 976–990. [17] L.E. Dow, K.P. O'Rourke, J. Simon, D.F. Tschaharganeh, J.H. van Es, H. Clevers, S.W. Lowe, Apc restoration promotes cellular differentiation and reestablishes crypt homeostasis in colorectal cancer, Cell 161 (7) (2015) 1539–1552. [18] T.J. Phesse, M. Buchert, E. Stuart, D.J. Flanagan, M. Faux, S. Afshar-Sterle, F. Walker, H.H. Zhang, C.J. Nowell, R. Jorissen, C.W. Tan, Y. Hirokawa, M.F. Eissmann, A.R. Poh, J. Malaterre, H.B. Pearson, D.G. Kirsch, P. Provero, V. Poli, R.G. Ramsay, O. Sieber, A.W. Burgess, D. Huszar, E. Vincan, M. Ernst, Partial inhibition of gp130-Jak-Stat3 signaling prevents Wnt-beta-catenin-mediated intestinal tumor growth and regeneration, Sci. Signal. 7 (345) (2014) ra92. [19] J.Y. Zhu, X. Yang, Y. Chen, Y. Jiang, S.J. Wang, Y. Li, X.Q. Wang, Y. Meng, M.M. Zhu, X. Ma, C. Huang, R. Wu, C.F. Xie, X.T. Li, S.S. Geng, J.S. Wu, C.Y. Zhong, H.Y. Han, Curcumin suppresses lung cancer stem cells via inhibiting wnt/beta-catenin and sonic hedgehog pathways, Phytother. Res.: PTR 31 (4) (2017) 680–688. [20] L. Wan, L. Zhang, K. Fan, Z.X. Cheng, Q.C. Sun, J.J. Wang, Circular RNA-ITCH suppresses lung cancer proliferation via inhibiting the wnt/beta-catenin pathway, BioMed Res. Int. 2016 (2016) 1579490. [21] S. Debouki-Joudi, F. Trifa, A. Khabir, T. Sellami-Boudawara, M. Frikha, J. Daoud, R. Mokdad-Gargouri, CpG methylation of APC promoter 1A in sporadic and familial breast cancer patients, Cancer Biomarkers A Dis. Markers 18 (2) (2017) 133–141. [22] S.S. Jiang, J.J. Li, Y. Li, L.J. He, Q.J. Wang, D.S. Weng, K. Pan, Q. Liu, J.J. Zhao, Q.Z. Pan, X.F. Zhang, Y. Tang, C.L. Chen, H.X. Zhang, G.L. Xu, Y.X. Zeng, J.C. Xia, A novel pathogenic germline mutation in the adenomatous polyposis coli gene in a Chinese family with familial adenomatous coli, Oncotarget 6 (29) (2015) 27267–27274.
4. Discussion In this study, we studied the role of miR-3607 in lung cancer cell proliferation, we found miR-3607 was upregulated in lung cancer tissues and cells, miR-3607 overexpression promoted lung cancer cell A549 proliferation, knockdown of miR-3607 could inhibited A549 proliferation. Mechanism analysis revealed that APC was the target of miR-3607, miR-3607 directly bound to the 3′UTR of APC, inhibition of miR-3607 and APC promoted lung cancer cell proliferation. So miR3607 promoted lung cancer proliferation by inhibiting APC. APC which is a tumor suppressor interacts with Axin and GSK3β to form β-catenin destruction complex, and promotes the phosphorylation and degradation of β-catenin, inhibiting Wnt signaling pathway [17,18]. Wnt signaling pathway promotes lung cancer initiation, proliferation, invasion and metastasis [19,20]. APC mutation is found in various tumors, like breast cancer and colorectal cancer [21–23]. APC and GSK3 have the same functions in many biological processes, mechanism analysis suggests that APC enhances directly Glycogen Synthase Kinase-3 (GSK3) activity [24]. GSK3 can phosphorylate many prooncogenes, such as c-Myc, c-Jun, Cyclin D1 and β-Catenin, and mediates them degradation by proteasome or inactivates them to inhibit tumor progression [25,26]. GSK3 can phosphorylate Cyclin D1 at threonine 286 and mediates Cyclin D1 degradation. PSAT1 promotes the proliferation of non-small cell lung cancer cells (NSCLC) by increasing phosphorylation of GSK3 at Ser9, leading the inactivation of GSK3, so Cyclin D1 is upregulated and cell cycle progression is acceleration [27]. mTORC1 inhibitors can inhibit cancer development, and they also phosphorylate GSK3 and mediate GSK3 inactivation to attenuate their therapy effect. When they combine with Akt inhibitor perifosine which increases the activity of GSK3 enhance the anticancer efficacy in NSCLC cells [28–30]. We conferred miR-3607 promoted lung cancer cell proliferation by targeting APC, in turn reducing GSK3 activity. In summary, we found miR-3607 was upregulated in lung cancer cells and tissues, and contributes to lung cancer cell A549 proliferation by targeting APC. Conflicts of interest The authors declare no conflict of interest. Research involving human participants and/or animals All procedures performed in studies involving human participants were in accordance with the ethical standards of the institutional, 502
Biomedicine & Pharmacotherapy 95 (2017) 497–503
Y. Lin et al.
cyclin D1 degradation and sustains proliferation of non-small cell lung cancer cells, Int. J. Cancer 136 (4) (2015) E39–50. [28] Z. Ma, L. Zhu, X. Luo, S. Zhai, P. Li, X. Wang, Perifosine enhances mTORC1-targeted cancer therapy by activation of GSK3beta in NSCLC cells, Cancer. Biol. Ther. 13 (11) (2012) 1009–1017. [29] J. Koo, P. Yue, A.A. Gal, F.R. Khuri, S.Y. Sun, Maintaining glycogen synthase kinase3 activity is critical for mTOR kinase inhibitors to inhibit cancer cell growth, Cancer Res. 74 (9) (2014) 2555–2568. [30] J. Koo, X. Wang, T.K. Owonikoko, S.S. Ramalingam, F.R. Khuri, S.Y. Sun, GSK3 is required for rapalogs to induce degradation of some oncogenic proteins and to suppress cancer cell growth, Oncotarget 6 (11) (2015) 8974–8987.
[23] J.L. Stamos, W.I. Weis, The beta-catenin destruction complex, Cold Spring Harbor Perspect. Biol. 5 (1) (2013) a007898. [24] A.J. Valvezan, F. Zhang, J.A. Diehl, P.S. Klein, Adenomatous polyposis coli (APC) regulates multiple signaling pathways by enhancing glycogen synthase kinase-3 (GSK-3) activity, J. Biol. Chem. 287 (6) (2012) 3823–3832. [25] S. Frame, P. Cohen, GSK3 takes centre stage more than 20 years after its discovery, Biochem. J. 359 (Pt 1) (2001) 1–16. [26] X.J. Yu, Q.B. Han, Z.S. Wen, L. Ma, J. Gao, G.B. Zhou, Gambogenic acid induces G1 arrest via GSK3beta-dependent cyclin D1 degradation and triggers autophagy in lung cancer cells, Cancer Lett. 322 (2) (2012) 185–194. [27] Y. Yang, J. Wu, J. Cai, Z. He, J. Yuan, X. Zhu, Y. Li, M. Li, H. Guan, PSAT1 regulates
503
Contents lists available at ScienceDirect
Biomedicine & Pharmacotherapy journal homepage: www.elsevier.com/locate/biopha
Original article
Upregulation of miR-3607 promotes lung adenocarcinoma proliferation by suppressing APC expression
MARK
Yong Lina, Qiangye Gub, Zongwen Sunc, Baowei Shenga, Congcong Qia, Bing Liua, Tian Fua, ⁎ Cun Liud, Yan Zhanga, a
Department of Respiratory Medicine, Jining NO.1 People’s Hospital, Jining 272011, China Department of tuberculousis, Jining Infectious Disease Hospital, Jining 272031, China c Department of Oncology, Jining NO.1 People’s Hospital, Jining 272011, China d Department of Clinical Laboratory, Jining NO.1 People’s Hospital, Jining 272011, China b
A R T I C L E I N F O
A B S T R A C T
Keywords: miR-3607 Lung cancer APC Cell proliferation c-Myc
Lung cancer is the leading cause of worldwide cancer-related deaths, although many drugs and new therapeutic approaches have been used, the 5-years survival rate is still low for lung cancer patients. microRNAs have been shown to regulate lung cancer initiation and development, here we studied the role of miR-3607 in lung cancer cell proliferation. We found miR-3607 was upregulated in lung cancer tissues and cells, miR-3607 overexpression promoted lung cancer cell A549 proliferation determined by MTT assay, colony formation assay, anchorage-independent growth ability assay and bromodeoxyuridine incorporation assay, while the opposite phenotypes were shown when miR-3607 was knocked down. Predicted analysis suggested a Wnt signaling pathway regulator adenomatous polyposis coli (APC) was the target of miR-3607, miR-3607 could directly bind to the 3′UTR of APC, and promoted Cyclin D1 and c-Myc expression which can be suppressed by APC. Double knockdown of miR-3607 and APC copied the phenotypes of miR-3607 overexpression, suggesting miR-3607 promoted lung cancer cell A549 proliferation by targeting APC. In conclusion, our study suggested miR-3607 contributes to lung cancer cell proliferation by inhibiting APC.
1. Introduction Lung cancer is the most frequently diagnosed cancer, it’s difficult to detect lung cancer in early stages. Moreover, lung cancer has high metastatic ability and resistance to chemoradiotherapy, so the 5-year survival rate is still low [1,2]. New therapeutic approaches must be found. microRNA (miRNA) is about 23nt non-coding, single-stranded RNA, and inhibiting gene expression by binding to the 3′-untranslated region (3′UTR) of mRNA, the mediating mRNA degradation and/or translation repression [3,4]. Many microRNAs have been reported to regulate lung cancer progression [5,6]. for example, miR-193a-3p and 5p are downregulated in lung cancer cells, they suppress lung cancer cell proliferation, migration, invasion and epithelial-mesenchymal transition (EMT) by directly targeting ERBB4, S6K2, PIK3R3 and mTOR [7,8]. miR-338-3p inhibits lung cancer metastasis by targeting SOX4 [9]. miR454 is an unfavorable prognostic factor for lung cancer patients, and contributes to lung cancer cell proliferation, migration and invasion [10].
⁎
miR-3607 can be induced expression by ionizing radiation [11], it also is low expression in prostate cancer tissues, patients with high miR3607 levels have good outcome. miR-3607 suppresses prostate cancer proliferation and invasion, and induces apoptosis by targeting SRC family kinases, LYN and SRC [12]. In this study, we studied the role of miR-3607 in lung cancer proliferation and found miR-3607 promoted lung cancer proliferation by targeting APC. 2. Materials and methods 2.1. Clinical samples and cell culture Lung cancer tissues and corresponding noncancerous tissues which had undergone surgical resection, and different clinical stage lung cancer tissues were obtained from the Jining NO.1 People’s hospital. Institutional review board approval and written informed consent from all patients were obtained. Immortalized normal lung epithelial cell BEAS–2 B and lung cancer cells NCI-H1650, 95D, A549, NCI-H460, NCI-H358, NCI-H1975 and
Corresponding author at: Jining NO.1 People’s Hospital. No.6 Health Road, Jining 272011, China. E-mail addresses: [email protected], [email protected] (Y. Zhang).
http://dx.doi.org/10.1016/j.biopha.2017.08.052 Received 15 January 2017; Received in revised form 8 August 2017; Accepted 9 August 2017 0753-3322/ © 2017 Published by Elsevier Masson SAS.
Biomedicine & Pharmacotherapy 95 (2017) 497–503
Y. Lin et al.
Fig. 1. miR-3607 is overexpressed in lung cancer cells and tissues. A. miR-3607 was upregulated in lung cancer tissues (T) compared to normal lung tissues (N), date was downloaded from TCGA data set. B. miR-3607 was upregulated in lung cancer tissues compared to the adjacent normal lung tissues, date was downloaded from TCGA data set. C. miR-3607 was upregulated in lung cancer tissues (T) compared to the tumor adjacent normal lung tissues (TAT). D. miR-3607 was upregulated in lung cancer cells compared to the immortalized normal lung epithelial cell. Data were presented as means ± SEM for three-independent experiments. *P < 0.05; **P < 0.01.
2.5. Colony formation assay
NCI-H1299 were maintained in RPMI-1640 medium (Life Technologies) supplemented with 10% fetal bovine serum at 37 °C in a humidified atmosphere containing 5% CO2 and 95% air.
2 × 104 A549 was seeded in six-well plates, and cultured for one week, the colonies were fixed with 10% formaldehyde for 5 min, then stained with 1.0% crystal violet for 30 s and photographed.
2.2. RNA isolation and quantitative real-time PCR (qRT-PCR)
2.6. Anchorage-independent growth ability assay
miRNA was isolated from cells or human tissues using mirVana miRNA isolation kit (Ambion) according to the manufacturer’s instructions. qRT-PCR was carried out using TaqMan miRNA assays (Applied Biosystems) according to the manufacturer’s instructions in the Applied Biosystems 7500 real-time detection system (Life Technologies). The miRNA expression level was normalized by U6 small nuclear RNA and calculated according to the 2−ΔΔCt method.
Anchorage-independent growth ability assay was performed according to previous method [13]. 2.7. Bromodeoxyuridine (BrdU) incorporation assay BrdU incorporation assay was performed according to previous method [13]. Briefly, cells were seeded on coverslips, and incubated with BrdU for 1 h, the cells were stained with anti-BrdU antibody (Millipore), an Alexa Fluor 594 conjugated secondary antibody (Life Technologies) was used. Nuclei were stained blue with DAPI. Images were acquired using a fluorescence microscope.
2.3. Oligonucleotide transfection miR-3607 mimic, miR-3607 inhibitor, mutational miR-3607 mimic and their negative control were synthesized by RiboBio (Guangzhou), they were transfected into lung cancer cell A549 using Lipofectamine RNAiMAX reagent (Life Technologies) according to the manufacturer’s protocol.
2.8. Western blot assay Cells lysates were extracted from A549 using RIPA buffer supplement with protease inhibitor Cocktail (Roche). Equal amount protein samples were loaded and separated using 12% SDS-PAGE, and transferred to PVDF membranes (GE Health). The membranes were blocked using 5% non-fat milk, the membranes were incubated with the antiAPC (#2504, Cell signaling), c-Myc (sc-4048, Santa Cruz), and Cyclin D1 (sc-753, Santa Cruz) antibodies for overnight at 4 °C, and were washed using TBST for three time, 5 min every time. Then the membranes were incubated with secondary antibody for 1 h at room temperature, and washed using TBST for three time, 5 min every time. The
2.4. MTT assay 200-500 A549 cells were plated in 96-well plates at a density of 0.5 × 103 cells/well, and transfected with miR-3607 mimic, miR-3607 inhibitor or negative control. MTT (Sigma) at a concentration of 0.5 mg/ml was added into wells at indicated time point, and incubated for 4 h at 37 °C. Then medium was removed, DMSO (Sigma) was added into wells to dissolve the formazan crystals. The absorbance was measured at 490 nm using a microplate reader. 498
Biomedicine & Pharmacotherapy 95 (2017) 497–503
Y. Lin et al.
Fig. 2. miR-3607 overexpression promotes lung cancer cell A549 proliferation. A. miR-3607 was significantly overexpressed after miR-3607 mimic was transfected into A549 cells. B. MTT assay suggested miR-3607 overexpression increased A549 proliferation rate. C. Colony formation assay suggested miR-3607 overexpression promoted A549 proliferation. D. Soft agar growth assay revealed that miR-3607 overexpression increased A549 anchorage-independent growth ability. E. BrdU incorporation assay suggested miR-3607 overexpression increased BrdU positive cell number. Data were presented as means ± SEM for three-independent experiments. *P < 0.05.
3. Results
bands were detected with SuperSignal West Femto Maximum Sensitivity Substrate (Thermo Fisher Scientific). α-Tubulin was used as the loading control.
3.1. MiR-3607 is upregulated in lung cancer tissues and cells We used TCGA database to analysis miR-3607 expression in lung cancer tissues, miR-3607 was significantly upregulated in lung cancer tissues compared to normal lung tissues (Fig. 1A), miR-3607 was significantly upregulated in lung cancer tissues compared to the adjacent normal lung tissues (Fig. 1B). We further examined miR-3607 expression in lung cancer tissues, and found miR-3607 was upregulated in lung cancer tissues compared to the adjacent normal lung tissues (Fig. 1C). miR-3607 was also upregulated in lung cancer cells (Fig. 1D). These results suggested miR-3607 was upregulated in lung cancer tissues and cells.
2.9. Luciferase reporter assay The fragment of the 3′UTR of APC was cloned into the psiChECK2 vector (Promega) using specific primers, forward, 5′ TTGTTGCAAA CCACTTCAAG 3′ and reverse, 5′ CTTGTTTGTTCATGTCTGGC 3′. A549 cells were plated in 48-well plates, and transfected with a mixture of vector and miR-3607 mimic, miR-3607 inhibitor or mutational miR3607 mimic using Lipofectamine 2000 (Life Technologies). Luciferase activity was analyzed using Dual Luciferase Reporter Assay System (Promega) after 48 h of transfection.
3.2. MiR-3607 overexpression promotes lung cancer cell A549 proliferation 2.10. Statistical analysis
To determine miR-3607’s role in lung cancer proliferation, we chose a most used lung cancer cell A549 with moderate miR-3607 expression for further research. miR-3607 mimic was transfected into lung cancer cell line A549 to upregulate miR-3607 level (Fig. 2A). MTT assay suggested miR-3607 overexpression promoted A549 proliferation compared to negative control (NC) (Fig. 2B). Colony formation assay suggested miR-3607 overexpression significantly increased the colony
The data were analyzed using SPSS 19.0 (SPSS). Student’s t-test was used to analyze the significance of the difference levels between two groups. P values < 0.05 were considered significant.
499
Biomedicine & Pharmacotherapy 95 (2017) 497–503
Y. Lin et al.
Fig. 3. miR-3607 knockdown inhibits lung cancer cell A549 proliferation. A. miR-3607 was significantly downregulated after miR-3607 inhibitor was transfected into A549 cells. B. MTT assay suggested miR-3607 knockdown reduced A549 proliferation rate. C. Colony formation assay suggested miR-3607 knockdown inhibited A549 proliferation. D. Soft agar growth assay revealed that miR-3607 knockdown reduced A549 anchorage-independent growth ability. E. BrdU incorporation assay suggested miR-3607 knockdown reduced BrdU positive cell number. Data were presented as means ± SEM for three-independent experiments. *P < 0.05.
Among the candidates, a Wnt pathway regulator APC was chosen for further study (Fig. 4A). Western blot assay suggested miR-3607 overexpression inhibited APC expression, while miR-3607 knockdown promoted APC expression (Fig. 4B). Luciferase reporter assay suggested luciferase activity was significantly reduced when reporter vector and miR-3607 mimic were co-transfected into A549, luciferase activity was significantly increased when reporter vector and miR-3607 were cotransfected into A549. However, luciferase activity almost didn’t change when reporter vector and mutant miR-3607 were co-transfected into A549 (Fig. 4C). These results suggested APC was the target of miR3607. Cyclin D1 and c-Myc are important regulatory for cell cycle progression, especially for G1/S transition. Meanwhile, APC is a wellcharacterized negative regulator for Wnt pathway, and can promote cell cycle inhibitor p21 and p27 expression, and inhibits c-Myc and Cyclin D1 expression [14–16], we found miR-3607 inhibited APC and conferred that miR-3607 promoted c-Myc and Cyclin D1 expression. qRTPCR and western blot assay suggested miR-3607 overexpression promoted c-Myc and Cyclin D1 expression, its knockdown inhibited c-Myc and Cyclin D1 expression (Fig. 4D and 4E). This finding suggested miR3607 promoted A549 proliferation through inhibiting APC which can inhibit Cyclin D1 and c-Myc expression.
number (Fig. 2C). Soft agar growth assay suggested miR-3607 overexpression increased the anchorage-independent growth ability (Fig. 2D). BrdU incorporation assay suggested miR-3607 overexpression significantly increased BrdU positive cell number compared to NC (Fig. 2E). These results revealed miR-3607 overexpression promoted A549 proliferation. 3.3. MiR-3607 knockdown inhibits lung cancer cell A549 proliferation To confirm above results, miR-3607 was knock-downed using miR3607 inhibitor (Fig. 3A). MTT assay suggested miR-3607 knockdown inhibited A549 proliferation compared to negative control (NC) (Fig. 3B). Colony formation assay suggested miR-3607 knockdown significantly reduced the colony number (Fig. 3C). Soft agar growth assay suggested miR-3607 knockdown reduced the anchorage-independent growth ability (Fig. 3D). BrdU incorporation assay suggested miR-3607 knockdown significantly reduced BrdU positive cell number compared to NC (Fig. 3E). These results revealed miR-3607 knockdown inhibited A549 proliferation. These results suggested miR-3607 knockdown inhibited A549 proliferation. 3.4. Wnt pathway regulator APC is the target of miR-3607 We used miRNA-PicTar and TargetScan to predict mRNA target, 500
Biomedicine & Pharmacotherapy 95 (2017) 497–503
Y. Lin et al.
Fig. 4. APC is the target of miR-3607. A. APC was a target of miR-3607 predicted by online software. The seed sites were shown as red. The mutation in seed sites was shown as green. B. Western blot assay revealed miR-3607 expression was opposite to APC levels in A549 cells. C. Luciferase reporter assay suggested luciferase activity was significantly reduced after cotransfecting miR-3607 mimic and luciferase reporter vector cloned with 3′UTR of APC, luciferase activity was significantly increased after cotransfecting miR-3607 inhibitor and luciferase reporter vector. D. qRT-PCR assay suggested miR-3607 promoted c-Myc and Cyclin D1 expression. E. Western blot assay suggested miR-3607 promoted c-Myc and Cyclin D1 expression. Data were presented as means ± SEM for three-independent experiments. *P < 0.05.
Fig. 5. miR-3607 promoted A549 proliferation by targeting APC. A. Western blot assay revealed that APC was downregulated in A549 cell with miR-3607 knockdown after transfecting APC small interference RNAs. B. Colony formation assay suggested double knockdown of APC and miR-3607 significantly promoted cell proliferation. C. Soft agar growth assay revealed that double knockdown of APC and miR-3607 significantly promoted increased A549 anchorage-independent growth ability. D. BrdU incorporation assay suggested double knockdown of APC and miR-3607 significantly increased BrdU positive cell number. Data were presented as means ± SEM for three-independent experiments. *P < 0.05.
501
Biomedicine & Pharmacotherapy 95 (2017) 497–503
Y. Lin et al.
Institutional review board approval and written informed consent from all patients were obtained. This article does not contain any studies with animals performed by any of the authors.
3.5. MiR-3607 promotes lung cancer cell A549 proliferation by inhibiting APC To confirm whether miR-3607 promotes A549 proliferation by inhibiting APC, we knock-downed miR-3607 and APC in A549 (Fig. 5A). If they can reverse the phenotype caused by miR-3607 knockdown, suggesting miR-3607 promotes A549 proliferation by inhibiting APC. In fact, colony formation assay suggested the cell number was significantly increased, when miR-3607 and APC were knock-downed simultaneously (Fig. 5B). Soft agar growth assay revealed knockdown of miR3607 and APC significantly increased the anchorage-independent growth ability (Fig. 5C). BrdU incorporation assay suggested knockdown of miR-3607 and APC significantly increased the number of BrdU positive cells (Fig. 5D). These results suggested miR-3607 indeed promotes lung cancer cell A549 proliferation by inhibiting APC. We also analyzed the expression of APC and miR-3607 in lung cancer specimens including different clinical stage, and found miR3607 was increased in the advanced clinical stage, but APC was reduced in the advanced clinical stage. There was a negative correction between the expression of miR-3607 and APC (Supplemental Fig. 1).
Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.biopha.2017.08.052. References [1] S.E. Franks, R. Briah, R.A. Jones, R.A. Moorehead, Unique roles of Akt1 and Akt2 in IGF-IR mediated lung tumorigenesis, Oncotarget 7 (3) (2016) 3297–3316. [2] C. Zhang, X.P. Ding, Q.N. Zhao, X.J. Yang, S.M. An, H. Wang, L. Xu, L. Zhu, H.Z. Chen, Role of a7-nicotinic acetylcholine receptor in nicotine-induced invasion and epithelial-to-mesenchymal transition in human non-small cell lung cancer cells, Oncotarget (2016). [3] D.P. Bartel, MicroRNAs: target recognition and regulatory functions, Cell 136 (2) (2009) 215–233. [4] G.C. Shukla, J. Singh, S. Barik, MicroRNAs: Processing, Maturation, Target Recognition and Regulatory Functions, Mol. Cell. Pharmacol. 3 (3) (2011) 83–92. [5] Y. Chen, L. Lu, B. Feng, S. Han, S. Cui, X. Chu, L. Chen, R. Wang, Non-coding RNAs as emerging regulators of epithelial to mesenchymal transition in non-small cell lung cancer, Oncotarget, 2017. [6] Y. Tutar, A. Ozgur, E. Tutar, L. Tutar, A. Pulliero, A. Izzotti, Regulation of oncogenic genes by MicroRNAs and pseudogenes in human lung cancer, Biomed. Pharmacother. 83 (2016) 1182–1190. [7] T. Yu, J. Li, M. Yan, L. Liu, H. Lin, F. Zhao, L. Sun, Y. Zhang, Y. Cui, F. Zhang, J. Li, X. He, M. Yao, MicroRNA-193a-3p and −5p suppress the metastasis of human nonsmall-cell lung cancer by downregulating the ERBB4/PIK3R3/mTOR/S6K2 signaling pathway, Oncogene 34 (4) (2015) 413–423. [8] H. Liang, M. Liu, X. Yan, Y. Zhou, W. Wang, X. Wang, Z. Fu, N. Wang, S. Zhang, Y. Wang, K. Zen, C.Y. Zhang, D. Hou, J. Li, X. Chen, miR-193a-3p functions as a tumor suppressor in lung cancer by down-regulating ERBB4, The Journal of biological chemistry 290 (2) (2015) 926–940. [9] Y. Li, P. Chen, L. Zu, B. Liu, M. Wang, Q. Zhou, MicroRNA-338-3p suppresses metastasis of lung cancer cells by targeting the EMT regulator Sox4, American journal of cancer research 6 (2) (2016) 127–140. [10] D.Y. Zhu, X.N. Li, Y. Qi, D.L. Liu, Y. Yang, J. Zhao, C.Y. Zhang, K. Wu, S. Zhao, MiR454 promotes the progression of human non-small cell lung cancer and directly targets PTEN, Biomed. Pharmacother. 81 (2016) 79–85. [11] M.A. Chaudhry, R.A. Omaruddin, C.D. Brumbaugh, M.A. Tariq, N. Pourmand, Identification of radiation-induced microRNA transcriptome by next-generation massively parallel sequencing, J. Radiat. Res. (Tokyo) 54 (5) (2013) 808–822. [12] S. Saini, S. Majid, V. Shahryari, Z.L. Tabatabai, S. Arora, S. Yamamura, Y. Tanaka, R. Dahiya, G. Deng, Regulation of SRC kinases by microRNA-3607 located in a frequently deleted locus in prostate cancer, Mol. Cancer Ther. 13 (7) (2014) 1952–1963. [13] H. Lin, T. Dai, H. Xiong, X. Zhao, X. Chen, C. Yu, J. Li, X. Wang, L. Song, Unregulated miR-96 induces cell proliferation in human breast cancer by downregulating transcriptional factor FOXO3a, PLoS One 5 (12) (2010) e15797. [14] J.N. Anastas, R.T. Moon, WNT signalling pathways as therapeutic targets in cancer, Nat. Rev. Cancer 13 (1) (2013) 11–26. [15] M. Kim, Y.A. Suh, J.H. Oh, B.R. Lee, J. Kim, S.J. Jang, KIF3A binds to beta-arrestin for suppressing Wnt/beta-catenin signalling independently of primary cilia in lung cancer, Sci. Rep. 6 (2016) 32770. [16] N. Meyer, L.Z. Penn, Reflecting on 25 years with MYC, Nat. Rev. Cancer 8 (12) (2008) 976–990. [17] L.E. Dow, K.P. O'Rourke, J. Simon, D.F. Tschaharganeh, J.H. van Es, H. Clevers, S.W. Lowe, Apc restoration promotes cellular differentiation and reestablishes crypt homeostasis in colorectal cancer, Cell 161 (7) (2015) 1539–1552. [18] T.J. Phesse, M. Buchert, E. Stuart, D.J. Flanagan, M. Faux, S. Afshar-Sterle, F. Walker, H.H. Zhang, C.J. Nowell, R. Jorissen, C.W. Tan, Y. Hirokawa, M.F. Eissmann, A.R. Poh, J. Malaterre, H.B. Pearson, D.G. Kirsch, P. Provero, V. Poli, R.G. Ramsay, O. Sieber, A.W. Burgess, D. Huszar, E. Vincan, M. Ernst, Partial inhibition of gp130-Jak-Stat3 signaling prevents Wnt-beta-catenin-mediated intestinal tumor growth and regeneration, Sci. Signal. 7 (345) (2014) ra92. [19] J.Y. Zhu, X. Yang, Y. Chen, Y. Jiang, S.J. Wang, Y. Li, X.Q. Wang, Y. Meng, M.M. Zhu, X. Ma, C. Huang, R. Wu, C.F. Xie, X.T. Li, S.S. Geng, J.S. Wu, C.Y. Zhong, H.Y. Han, Curcumin suppresses lung cancer stem cells via inhibiting wnt/beta-catenin and sonic hedgehog pathways, Phytother. Res.: PTR 31 (4) (2017) 680–688. [20] L. Wan, L. Zhang, K. Fan, Z.X. Cheng, Q.C. Sun, J.J. Wang, Circular RNA-ITCH suppresses lung cancer proliferation via inhibiting the wnt/beta-catenin pathway, BioMed Res. Int. 2016 (2016) 1579490. [21] S. Debouki-Joudi, F. Trifa, A. Khabir, T. Sellami-Boudawara, M. Frikha, J. Daoud, R. Mokdad-Gargouri, CpG methylation of APC promoter 1A in sporadic and familial breast cancer patients, Cancer Biomarkers A Dis. Markers 18 (2) (2017) 133–141. [22] S.S. Jiang, J.J. Li, Y. Li, L.J. He, Q.J. Wang, D.S. Weng, K. Pan, Q. Liu, J.J. Zhao, Q.Z. Pan, X.F. Zhang, Y. Tang, C.L. Chen, H.X. Zhang, G.L. Xu, Y.X. Zeng, J.C. Xia, A novel pathogenic germline mutation in the adenomatous polyposis coli gene in a Chinese family with familial adenomatous coli, Oncotarget 6 (29) (2015) 27267–27274.
4. Discussion In this study, we studied the role of miR-3607 in lung cancer cell proliferation, we found miR-3607 was upregulated in lung cancer tissues and cells, miR-3607 overexpression promoted lung cancer cell A549 proliferation, knockdown of miR-3607 could inhibited A549 proliferation. Mechanism analysis revealed that APC was the target of miR-3607, miR-3607 directly bound to the 3′UTR of APC, inhibition of miR-3607 and APC promoted lung cancer cell proliferation. So miR3607 promoted lung cancer proliferation by inhibiting APC. APC which is a tumor suppressor interacts with Axin and GSK3β to form β-catenin destruction complex, and promotes the phosphorylation and degradation of β-catenin, inhibiting Wnt signaling pathway [17,18]. Wnt signaling pathway promotes lung cancer initiation, proliferation, invasion and metastasis [19,20]. APC mutation is found in various tumors, like breast cancer and colorectal cancer [21–23]. APC and GSK3 have the same functions in many biological processes, mechanism analysis suggests that APC enhances directly Glycogen Synthase Kinase-3 (GSK3) activity [24]. GSK3 can phosphorylate many prooncogenes, such as c-Myc, c-Jun, Cyclin D1 and β-Catenin, and mediates them degradation by proteasome or inactivates them to inhibit tumor progression [25,26]. GSK3 can phosphorylate Cyclin D1 at threonine 286 and mediates Cyclin D1 degradation. PSAT1 promotes the proliferation of non-small cell lung cancer cells (NSCLC) by increasing phosphorylation of GSK3 at Ser9, leading the inactivation of GSK3, so Cyclin D1 is upregulated and cell cycle progression is acceleration [27]. mTORC1 inhibitors can inhibit cancer development, and they also phosphorylate GSK3 and mediate GSK3 inactivation to attenuate their therapy effect. When they combine with Akt inhibitor perifosine which increases the activity of GSK3 enhance the anticancer efficacy in NSCLC cells [28–30]. We conferred miR-3607 promoted lung cancer cell proliferation by targeting APC, in turn reducing GSK3 activity. In summary, we found miR-3607 was upregulated in lung cancer cells and tissues, and contributes to lung cancer cell A549 proliferation by targeting APC. Conflicts of interest The authors declare no conflict of interest. Research involving human participants and/or animals All procedures performed in studies involving human participants were in accordance with the ethical standards of the institutional, 502
Biomedicine & Pharmacotherapy 95 (2017) 497–503
Y. Lin et al.
cyclin D1 degradation and sustains proliferation of non-small cell lung cancer cells, Int. J. Cancer 136 (4) (2015) E39–50. [28] Z. Ma, L. Zhu, X. Luo, S. Zhai, P. Li, X. Wang, Perifosine enhances mTORC1-targeted cancer therapy by activation of GSK3beta in NSCLC cells, Cancer. Biol. Ther. 13 (11) (2012) 1009–1017. [29] J. Koo, P. Yue, A.A. Gal, F.R. Khuri, S.Y. Sun, Maintaining glycogen synthase kinase3 activity is critical for mTOR kinase inhibitors to inhibit cancer cell growth, Cancer Res. 74 (9) (2014) 2555–2568. [30] J. Koo, X. Wang, T.K. Owonikoko, S.S. Ramalingam, F.R. Khuri, S.Y. Sun, GSK3 is required for rapalogs to induce degradation of some oncogenic proteins and to suppress cancer cell growth, Oncotarget 6 (11) (2015) 8974–8987.
[23] J.L. Stamos, W.I. Weis, The beta-catenin destruction complex, Cold Spring Harbor Perspect. Biol. 5 (1) (2013) a007898. [24] A.J. Valvezan, F. Zhang, J.A. Diehl, P.S. Klein, Adenomatous polyposis coli (APC) regulates multiple signaling pathways by enhancing glycogen synthase kinase-3 (GSK-3) activity, J. Biol. Chem. 287 (6) (2012) 3823–3832. [25] S. Frame, P. Cohen, GSK3 takes centre stage more than 20 years after its discovery, Biochem. J. 359 (Pt 1) (2001) 1–16. [26] X.J. Yu, Q.B. Han, Z.S. Wen, L. Ma, J. Gao, G.B. Zhou, Gambogenic acid induces G1 arrest via GSK3beta-dependent cyclin D1 degradation and triggers autophagy in lung cancer cells, Cancer Lett. 322 (2) (2012) 185–194. [27] Y. Yang, J. Wu, J. Cai, Z. He, J. Yuan, X. Zhu, Y. Li, M. Li, H. Guan, PSAT1 regulates
503