Urotensin II differentially regulates macrophage and hepatic cholesterol homeostasis

Peptides 32 (2011) 956–963

Contents lists available at ScienceDirect

Peptides journal homepage: www.elsevier.com/locate/peptides

Urotensin II differentially regulates macrophage and hepatic cholesterol homeostasis Robert S. Kiss a , Zhipeng You a , Jacques Genest Jr. a , David J. Behm b , Adel Giaid a,∗ a b

Division of Cardiology, McGill University Health Center, Montreal, Quebec, Canada GlaxoSmithKline Pharmaceuticals, PA, USA

a r t i c l e

i n f o

Article history: Received 17 December 2010 Received in revised form 21 February 2011 Accepted 22 February 2011 Available online 2 March 2011 Keywords: LDL Cholesterol ester ACAT1 ApolipoproteinB HPLC Western blot

a b s t r a c t Urotensin II (UII) is a vasoactive peptide with pleotropic activity. Interestingly, UII levels are elevated in hyperlipidemic patients, and UII induces lipase activity in some species. However, the exact role UII plays in cholesterol homeostasis remains to be elucidated. UII knockout (UII KO) mice were generated and a plasma lipoprotein profile, and hepatocytes and macrophages cholesterol uptake, storage and synthesis was determined. UII KO had a decreased LDL cholesterol profile and liver steatosis compared to wildtype mice (WT). UII KO macrophages demonstrated enhanced ACAT activity and LDL uptake in the short term (up to 4 h), of which more LDL-delivered exogenously derived cholesterol was incorporated into cholesteryl ester (CE) than the WT macrophages. UII KO macrophages generated more than two times the amount of de novo endogenously synthesized cholesterol, and of this cholesterol more than two times the relative amount was esterified to CE. In comparison, results in hepatocytes demonstrated that far more exogenously derived cholesterol was incorporated into CE in the WT cells, generating almost ten times the amount of CE than UII KO. WT cells synthesize de novo almost ten times the amount of cholesterol than UIIKO, and of that cholesterol, almost two times the amount of CE in WT than UII KO hepatocytes. In addition, more ApoB lipoproteins were secreted from WT than UII KO hepatocytes. These results demonstrate a fundamental difference between macrophages and hepatocytes in terms of cholesterol homeostasis, and suggest an important role for UII in modulating cholesterol regulation. Crown Copyright © 2011 Published by Elsevier Inc. All rights reserved.

1. Introduction Urotensin II (UII) is a potent vasoactive peptide that was first isolated from the goby fish, but is present in non-mammalian and mammalian species and its C-terminus is conserved among species [1,3,10,11,19,22]. UII has both potent vasoconstrictive properties that are greater than that of endothelin-1, and a vasodilative action mediated by release of endothelial-derived relaxing factors such as nitric oxide and prostacycline [4,13,17,18,24]. UII exerts its action by binding to a G-protein coupled receptor, GPR14, that has been cloned from rats, mice, monkeys and humans and is now known as UT [1,10,11]. Both UII and UT are expressed in liver and pancreas [1,5,8,27]. UII affects glucose metabolism [27,28,31], possibly stimulating glucose mobilization by increasing liver glucose-6-phosphatase activity [26]. Intracerebroventricular administration of UII in sheep causes hyperglycemia, which may be mediated by UII-stimulated increases in circulating lev-

∗ Corresponding author at: The Montreal General Hospital, 1650 Cedar Avenue, Montreal, Quebec H3G 1A4, Canada. Tel.: +1 514 934 1934x43841; fax: +1 514 934 8448. E-mail address: [email protected] (A. Giaid).

els of epinephrine and cortisol [33]. In rat, UII expression is found in epididymal fat, but not in abdominal fat and perirenal fat [29]. Moreover, the hypothalamus, center of food intake control, expresses high levels of UT [1,14]. Intracerebroventricular administration of UII in mice not only produces an anxiogenic effect, but also increases their food intake and water consumption [12]. Indeed, plasma UII level correlates positively with body weight in the Hong Kong Chinese population [9]. Plasma UII level is elevated in human diabetic patients regardless of the presence or absence of proteinuria [31]. UII increased plasma free fatty acids in a dose-dependent manner in fish [25]. UII also causes enhanced lipogenesis by increasing glucose-6-phosphate dehydrogenase activity and NADPH production. UII enhances depot lipase activity, which may lead to hyperlipidemia [26]. Therefore, besides affecting the vascular tone, UII also affects many other pathways involved in energy metabolism. There are numerous observations and correlations involving UII and UT, however, we are specifically interested in their effect on atherosclerosis. Interestingly, plasma UII level is associated with LDL in atherosclerosis [2]. We have recently shown that deletion of UT resulted in decreased hepatic steatosis and increased serum lipid in mice fed a high-fat diet [5]. These observations were significant for three reasons: (1) UII signaling through UT

0196-9781/$ – see front matter. Crown Copyright © 2011 Published by Elsevier Inc. All rights reserved. doi:10.1016/j.peptides.2011.02.016

R.S. Kiss et al. / Peptides 32 (2011) 956–963

resulted in a profound but unexpected effect on hepatocyte cholesterol metabolism; (2) the liver was demonstrated to be the most important organ for LDL uptake; (3) in the absence of a normally functioning liver in terms of LDL metabolism, macrophages are taxed with increased LDL, contributing to the cholesterol burden enhancing atherosclerosis progression. To further examine the role of these pathways in lipid metabolism, we generated UII knockout (KO) mice. In this study, we examined the effect of UII deletion on macrophage and hepatic cholesterol homeostasis. Cholesterol homeostasis is controlled by three pathways: exogenous uptake of cholesterol-containing lipoproteins, endogenous synthesis of cholesterol, and the activity of acylCoA:cholesterol acyltransferase (ACAT), the enzyme that converts free cholesterol to the storage form cholesteryl ester (reviewed in [6,16]). The LDL receptor (LDLR) mediates uptake of cholesterol-containing LDL by the liver. Cholesterol can also be synthesized de novo, in which the rate-limiting enzyme 3-hydroxy-3-methyl-glutaryl-CoA reductase (HMGCoA reductase) is strictly regulated by the concentration of free cholesterol at the regulatory site of the ER membrane. The activity of ACAT determines the concentration of free cholesterol in the ER membrane. Hence, we examined here these pathways in macrophages and hepatocytes to elucidate the role of UII in cholesterol homeostasis.

2. Methods 2.1. Targeting the preproU-II gene and generation of mutant mice Gene targeting was performed in E14 embryonic stem (ES) cells using standard homologous recombination (Fig. 1). Briefly, the KO strategy was designed to delete all the coding region downstream of the PstI restriction site in exon4, resulting in deletion of half of exon 4 and all of exons 5 and 6, ensuring deletion of the whole coding region of the mature peptide. Chimeras were bred to C57Bl6/J to generate N1 heterozygotes. These animals were backcrossed at least 10 times to the C57BL6/J background and then bred to homozygosity. Skeletal muscles of preproUII and preproUT KO mice (+/+, +/− and −/−) were extracted and preproUII [URII F2: GAAGGTGACCAAGTTCATGCTGAGTTGGGCTGG

957

AGGTAGC; URII R2a:ATGGAGCAGAGTTCAGAGTTCATA] and prepro UT [5] gene analysis was performed by PCR. Levels of “UII-like” immunoreactivity were determined by radioimmunoassay [23]. The WT (C57BL6/J) and ApoE KO mice were ordered from Jackson Laboratories (Maine, USA). 2.2. Isolation of LDL, HPLC and Western blotting LDL was isolated from a peripheral blood sample by sequential density ultracentrifugation. The concentration of LDL was calculated using the Markwell Lowry protein assay. HPLC was performed as described before [5]. Western blotting was performed by standard methods – apolipoprotein B primary antibody (1:1000 dilution), ACAT1 antibody (Santa Cruz; 1:1000 dilution) and ACAT2 (Santa Cruz; 1:500 dilution) were used. 2.3. Isolation and assay of hepatocytes All mice were maintained on a normal chow diet in a 12h light/12-h dark schedule and used between the ages of 4 and 6 months. All experiments performed were in accordance with protocols approved by the McGill University Animal Care Committee. Primary mouse hepatocytes were isolated from C57BL/6, C57BL/6 UII−/− , and C57BL/6 UT−/− mice. Primary hepatocytes were isolated from these mice by liver collagenase perfusion according to the established protocols [9,10]. Briefly, the 12-well plates were precoated with fibronectin (25 ␮g/well) and then the hepatocytes were seeded at an initial density of 1 × 106 cells/well in Williams’ Medium E with 10% fetal bovine serum (containing penicillin (100 units/ml), streptomycin sulfate (100 units/ml), Fungizone (250 ng/ml)). Cells were incubated with 10% lipoprotein deficient serum for 24 h prior to the uptake and binding assays. For the binding assay, LDL was radiolabeled with Na125 I using iodobeads (Pierce; according to manufacturer’s instructions). The binding assay was performed at 4 ◦ C and increasing concentrations of labeled lipoproteins (10–1000 ng/well) were left on the cells for 1 h before extensive washing and determination of bound radioactivity (normalized to non-specific binding and total cell protein) [12]. For the uptake assay [3 H]cholesteryl oleate (15 ␮Ci/well) was

Fig. 1. Disruption of the preproUII gene by homologous recombination.

958

R.S. Kiss et al. / Peptides 32 (2011) 956–963

Fig. 2. Hematoxylin and eosin stained paraffin sections of livers from wildtype (WT) (A) and UII KO mice. Abundant steatosis is evident in WT livers, but absent in UII KO livers.

2.4. Mouse peritoneal macrophages Peritoneal macrophages from WT, ApoE KO and UII KO mice were collected 3 days after an intraperitoneal injection of thioglycollate and seeded on 24-well plates in Dulbecco modified Eagle medium (DMEM) supplemented with 10% autologous serum. 2.5. Statistical analyses All values are presented as mean ± standard error. Multi-group comparisons were analyzed using ANOVA with the Tukey post hoc test. Direct two group comparisons were carried out using the student’s t-test. A p value < 0.05 was considered statistically significant. All statistical analyses were carried out using SPSS version 11.5. 3. Results Histologic staining of formalin-fixed and paraffin embedded liver sections from WT and UII KO mice [fed a high fat diet, 5] with hematoxylin and eosin revealed the presence of extensive hepatic steatosis in WT mice (Fig. 2A). In contrast, there was little to no steatosis in the liver sections of UII KO mice (Fig. 2B).

determined. The UII KO serum profile exhibited less LDL cholesterol than WT (Fig. 3), with a reduction in size of LDL and relative amount of LDL. As well, UII KO serum possessed significantly more HDL sized lipoproteins of a larger size. 3.2. ACAT activity measurements To determine basal activity of ACAT under lipid poor and lipidloaded conditions, macrophages were isolated from WT, ApoE KO and UII KO mice and grown in culture according to established protocols. Cells were grown in the absence of serum for 16 h and then provided with 10% lipoprotein deficient autologous sera (DS) or 10% autologous sera (AS; instead of FBS to assure no reintroduction of UII or ApoE), in the presence of 5 ␮Ci 3 H-cholesterol for 8 h or 24 h. To determine the ACAT-specific activity, we performed a duplicate condition with ACAT inhibitor (58035) for each time point and then subtracted it. CE formation was measured by extraction of cell lipids and thin layer chromatography and results are presented as the mean percentage CE of total radioactive cholesterol or as cpm/␮g cell protein (±SD; n = 4 for each data point). Results demonstrate that under cholesterol loading conditions, specific ACAT activity was elevated in UII KO macrophages, compared to WT and ApoE KO (Fig. 4). 3.3. Binding of LDL As a measure of plasma membrane presentation of LDLR on the surface of cells, an LDLR binding assay was performed. Hepatocytes and macrophages were isolated from WT and UII KO mice and grown in culture. Cells in culture were given autologous sera 0.45

VLDL

0.40

LDL

HDL

0.35

Optical Density

incorporated into lipoproteins according to Vassiliou et al. [12]. For some of the experiments, autologous serum was used for UII KO or ApoE KO hepatocytes and macrophages in order to prevent reintroduction. Radiolabeled lipoproteins (25 ␮g) were added to the cells (hepatocytes and macrophages) for 30 min, 1 h or 4 h, and after extensive washing, the amount of radiolabel taken up by the cells was normalized for non-specific uptake and total cell protein. For the ACAT assay, hepatocytes or macrophages were incubated with [3 H]-cholesterol incorporated into autologous serum or [3 H]mevalonate for 48 h to uniformly label the cells. Then the cells were switched to media containing cold 10% autologous serum without and with ACAT inhibitor (58035; 1 ␮g/mL). After 24 h, cells were washed 3 times in PBS, and radioactive lipids were extracted with hexane. Lipids were separated by thin layer chromatography using hexane/diethyl ether/acetic acid (105:45:1.5, v/v/v) as a solvent system. Cholesterol and cholesteryl ester (CE) spots were scraped from the plate and radioactivity determined by liquid scintillation. Results are expressed as percent CE of the total radioactive cholesterol (free and esterified) ± SD.

WT UIIKO

0.30 0.25 0.20 0.15 0.10 0.05 0.00

3.1. HPLC profile

1

6

11

16 21

26

31 36

41

46

51 56

61

66 71

Elapsed time Mice were fed a hypercholesterolemic diet and then serum from WT and UII KO mice were submitted for HPLC to separate the plasma lipoproteins based on size. Free cholesterol (FC; Fig. 3) and triacylglycerol (TG; data not shown) content of each fraction was

Fig. 3. HPLC profile of UII KO mice compared to WT. HPLC of serum samples from UIIKO mice were run on a HPLC system specifically calibrated to separate lipoproteins from small volumes of serum. This profile (average of 6 runs) was compared to serum from WT mice as described before [5].

CE formed (% of total 3H-cholesterol radioactivity in CE)

R.S. Kiss et al. / Peptides 32 (2011) 956–963

instead of FBS to assure no reintroduction of UII. Cells were then placed at 4 ◦ C and 125 I-LDL was added. In both hepatocytes and macrophages, LDL binding at 4 ◦ C is not significantly different in WT and UII KO (Figs. 5 and 6A). This shows that under these conditions the same amount of LDL receptor is expressed on the cell surface.

12 WT 10

ApoE KO UII KO

8

959

6 4

3.4. Uptake of LDL

2

To measure the functional endocytosis of LDL via the LDLR, we performed an LDL uptake assay according to a previously published protocol [5]. In macrophages, UII KO cells take up more LDL over time in the short term (1–4 h), compared to WT (Fig. 5B). In hepatocytes, there was no significant increase in LDL uptake over time (1–4 h) comparing the WT and UII KO (Fig. 6B). These results complement the ACAT activity results and demonstrate a fundamental difference between macrophages and hepatocytes.

0 8hrs LPDS

8hrs FBS

24hrs LPDS 24hrs FBS

Fig. 4. Lipidation state of macrophages determines the relative response to cholesterol esterification. Peritoneal macrophages from WT, ApoE KO or UII KO mice were grown in culture either in delipidated autologous serum (DS) or 10% autologous serum (AS) and then the relative amounts of cholesterol esterification was measured after 8 or 24 h.

Binding

40000

Uptake

LDL uptake [cpm/mg cell protein] x 10 -5

LDL bound cpm/mg cell protein

A

B 30000 20000 10000 0 WT

UII KO

*

20 15

WT UII KO

*

10 5 0 0

1

2

3

4

hours

Exogenously-derived CE

*

2

0

Cholesterol (cpm of 3H-mevalonate incorporated into total cholesterol; cpm/ug cell protein)

WT

E

**

20000

10000

(14

1

30000

0 WT

UII KO

Endogenous cholesterol 70000

UII KO

Endogenously derived CE

F 15

60000

*

50000 40000 30000 20000 10000

CE formed (% of total de novo synthesized cholesterol incorporated into CE)

CE formed (% of total cholesterol incorporated into CE)

3

CE formed C-oleate incorporated into CE; cpm/mg cell protein)

4

C

Total CE

D

*

10

5

0

0 WT

UII KO

WT

UII KO

Fig. 5. Macrophage UII KO leads to enhanced cholesterol esterification. Peritoneal macrophages from WT and UII KO mice were submitted to standard measures of cholesterol homeostasis: uptake of exogenous cholesterol and de novo synthesis of cholesterol. (A) 125 I-labeled LDL was added to macrophages at 4 ◦ C for 1 h to measure specific LDL binding as a measure of LDL receptor expression on the cell surface. WT and UII KO macrophages were statistically identical. (B) Uptake of 3 H-cholesteryl oleate loaded LDL was measured as described. Although some variation can occur, a moderate but statistically significant increase in LDL uptake was measured for UII KO macrophages. (C) Esterification of LDL-derived exogenously added 3 H-cholesterol was measured as described. CE formation was measured by extraction of cell lipids and thin layer chromatography and results are presented as the mean total radioactivity in CE as cpm/mg cell protein (±SD; n = 4 for each datapoint). (D) Total CE formation was measured by addition of 14 C-oleate. CE formation was measured by extraction of cell lipids and thin layer chromatography and results are presented as the mean total radioactivity in CE as cpm/mg cell protein (±SD; n = 4 for each data point). (E) We determined endogenous synthesis by incorporation of 3 H-mevalonate into cholesterol and CE, and measured by extraction of cell lipids and thin layer chromatography. Results are presented as the mean total radioactivity in cholesterol and CE as cpm/mg cell protein (±SD; n = 4 for each data point). (F) As above, CE formation from de novo synthesized cholesterol was measured. The amount of CE formed is relative to the total amount of de novo cholesterol synthesis (i.e. eventhough WT macrophages synthesize less cholesterol, they produce relatively less CE as well). *p < 0.05, **p < 0.001.

960

R.S. Kiss et al. / Peptides 32 (2011) 956–963

LDL bound (cpm/ug cell protein)

Binding

Uptake

LDL uptake [cpm/mg cell protein] x 10 -3

5000

A

B

4000 3000 2000 1000 0 WT

UII KO

8

WT UII KO

6 4 2 0 0

1

2

3

4

15000 10000 5000

** 0

Cholesterol (cpm of 3H-mevalonate incorparated into total cholesterol; cpm/ug cell protein)

WT

E

Total CE

D

UII KO

200000 150000 100000

0 WT

Endogenous cholesterol 400000

200000

100000

** 0

UII KO

Endogenously derived CE

F

300000

**

50000

8

CE formed (% of total de novo synthesized cholesterol incorporated into CE)

CE formed (cpm/mg cell protein)

20000

(14

Exogenously-derived CE

C

CE formed C-oleate incorparated into CE; cpm/mg cell protein)

hours

6 4

*

2 0

WT

UII KO

WT

UII KO

Fig. 6. Hepatocyte UII KO prevents normal cholesterol homeostasis. Hepatocytes from WT and UII KO mice were submitted to standard measures of cholesterol homeostasis: uptake of exogenous cholesterol and de novo synthesis of cholesterol. (A) 125 I-labeled LDL was added to hepatocytes at 4 ◦ C for 1 h to measure specific LDL binding as a measure of LDL receptor expression on the cell surface. WT and UII KO hepatocytes were statistically identical. (B) Uptake of 3 H-cholesteryl oleate loaded LDL was measured as described. Although some variation can occur, no statistically significant increase in LDL uptake was measured for the hepatocytes. (C) Esterification of LDL-derived exogenously added 3 H-cholesterol was measured as described. CE formation was measured by extraction of cell lipids and thin layer chromatography and results are presented as the mean total radioactivity in CE as cpm/mg cell protein (±SD; n = 4 for each datapoint). (D) Total CE formation was measured by addition of 14 C-oleate. CE formation was measured by extraction of cell lipids and thin layer chromatography and results are presented as the mean total radioactivity in CE as cpm/mg cell protein (±SD; n = 4 for each datapoint). (E) We determined endogenous synthesis by incorporation of 3 H-mevalonate into cholesterol and CE, and measured by extraction of cell lipids and thin layer chromatography. Results are presented as the mean total radioactivity in cholesterol and CE as cpm/mg cell protein (±SD; n = 4 for each datapoint). (F) As above, CE formation from de novo synthesized cholesterol was measured. The amount of CE formed is relative to the total amount of de novo cholesterol synthesis. *p < 0.05, **p < 0.001.

3.5. Esterification of exogenous cholesterol

3.6. Total cholesteryl ester synthesis

We measured specifically the esterification of LDL-derived, exogenously added 3 H-cholesterol. CE formation was measured by extraction of cell lipids and thin layer chromatography and results are presented as the mean total radioactivity in CE as cpm/mg cell protein (±SD; n = 4 for each data point). In macrophages, UII KO cells incorporated more CE than the WT cells (Fig. 5C). This result also correlates with a higher ACAT activity in UII KO macrophages and confirms the results from Fig. 4. On the other hand, in hepatocytes, despite UII KO cells taking up as much LDL cholesterol in the short term, far more cholesterol was incorporated into CE in the WT cells (Fig. 6C). This result would clearly correlate with a higher ACAT activity in WT cells. However, these results do demonstrate a fundamental difference between hepatocytes and macrophages.

CE formation from all sources can be measured by incorporation of 14 C-oleate into CE. CE formation was measured by extraction of cell lipids and thin layer chromatography and results are presented as the mean total radioactivity in CE as cpm/mg cell protein (±SD; n = 4 for each data point). In macrophages, UII KO cells synthesized more than two times the amount of CE (Fig. 5D). In hepatocytes, WT cells synthesized almost ten times the amount of CE than UII KO (Fig. 6D). These results confirm CE formation and ACAT activity measurements. 3.7. Endogenous cholesterol synthesis Cholesterol homeostasis also regulates endogenous cholesterol synthesis. We determined endogenous synthesis by incorpora-

R.S. Kiss et al. / Peptides 32 (2011) 956–963

Fig. 7. Less apolipoproteinB particles are secreted in UII KO hepatocytes. Western blotting of concentrated media samples from WT and UII KO hepatocytes showed that more ApoB protein is secreted from WT hepatocytes than UII KO hepatocytes. Lanes 1–3 represent three independent replicates of WT media and Lanes 4–6 represent three independent replicates of UII KO media. **p < 0.001.

tion of 3 H-mevalonate into cholesterol and CE, and measured by extraction of cell lipids and thin layer chromatography. Results are presented as the mean total radioactivity in cholesterol and CE as cpm/mg cell protein (±SD; n = 4 for each datapoint). In macrophages, UII KO cells synthesize more than two times the amount of cholesterol (Fig. 5E). In hepatocytes, WT cells synthesize almost ten times the amount of cholesterol than UII KO (Fig. 6E). 3.8. Esterification of endogenously synthesized cholesterol We measured the relative percent of CE formation from de novo synthesized cholesterol. We determined endogenous synthesis by incorporation of 3 H-mevalonate into CE, and measured as above. Results are presented as the mean percent of total radioactivity in CE (±SD; n = 4 for each data point). In macrophages, UII KO cells synthesized more than two times the relative amount of CE (Fig. 5F). In hepatocytes, WT cells synthesized almost two times the relative amount of CE than UII KO (Fig. 6F). 3.9. Secretion of apolipoproteinB In response to elevated ACAT activity and CE generation, hepatocytes can secrete CE containing lipoproteins (VLDL). Hepatocytes were cultured in serum free media for up to 24 h, and then the media was collected, concentrated and submitted for Western blotting. We measured the amount of ApoB protein secreted from WT and UII KO hepatocytes (three independent replicates for each are shown). WT hepatocytes secreted significantly more ApoB than UII KO hepatocytes correlating generally with the amount of CE produced (Fig. 7). 3.10. Macrophage ACAT1 expression To demonstrate that the ACAT1 expression correlates with ACAT activity in macrophages, we performed multiple Western blots (a typical western blot is presented here; Fig. 8). ACAT1 protein was demonstrably upregulated in UII KO macrophages compared to WT macrophages. This result correlates well with the measured activity of ACAT.

961

Fig. 8. ACAT1 expression is upregulated in UII KO macrophages. Western blotting of lysates from WT and UII KO macrophages showed that ACAT1 protein expression is higher in UII KO macrophages. Total cell protein loading was normalized by GAPDH expression. *p < 0.05.

4. Discussion Urotensin II (UII) is the most potent vasoactive agonist and blood pressure regulator in the body [23]. However, it was not known that UII signaling has profound effects on lipoprotein metabolism or cholesterol homeostasis. The first observation came when it was shown in macrophages that UII signaling promotes expression of ACAT1 [20,32]. This enzyme promotes conversion of free cholesterol to cholesteryl ester in the ER membrane, promoting storage of cholesterol and thereby also influencing cholesterol homeostasis. There are two ACAT enzymes: ACAT1, present ubiquitously and putatively involved in general homeostatic regulation of free cholesterol levels; ACAT2, putatively responsible for CE generation in lipoprotein secretion in intestine and liver (reviewed in [7]). There is some controversy in the literature whether ACAT1, besides ACAT2, also exists in liver cells [21,30] and this has some relevance to our study as discussed later. Free cholesterol is a vital component of plasma membranes, to maintain rigidity, or to create domains within the membrane (e.g. Lipid rafts). In excess, free cholesterol is toxic to the cell, as membrane fluidity and function is compromized. The ER membrane is the site of the putative “regulatory pool” of cholesterol that is in equilibrium with the stored cholesteryl ester and the constitutive cycle of ACAT mediated esterification and cholesteryl ester hydrolysis [6,16]. The identity of the cholesteryl ester hydrolase is unclear and is partly tissue specific, as at least three enzymes have been shown to possess this activity (neutral cholesteryl ester hydrolase (nCEH); hormone sensitive lipase (HSL); and cholesteryl esterase (CES1)) [15]. What is important is that the cholesteryl ester hydrolase works in unison with ACAT to manage free cholesterol levels inside the cell. Upon influx of cholesterol, ACAT expression is upregulated and ACAT activity is stimulated. When cells are under starvation conditions, the cholesteryl ester hydrolase expression is upregulated and free cholesterol is liberated for intracellular use or efflux from the cell. In addition, free cholesterol levels in the ER membrane also influence the homeostatic mechanisms of cholesterol regulation. Sterol cleavage-activated protein (SCAP), a resident protein of the ER membrane, possesses a sterol binding domain and a high affinity for the sterol regulatory element binding protein 2 (SREBP2), a nuclear transcription factor [6,16]. Upon SCAP binding of cholesterol, SCAP traps SREBP2 on the ER membrane and prevents it from

962

R.S. Kiss et al. / Peptides 32 (2011) 956–963

translocating to the nucleus. In the absence of cholesterol, SCAP releases SREBP2, SREBP2 undergoes site-directed cleavage, and a truncated version translocates to the nucleus where it promotes transcription of many genes, including the LDLR and the ratelimiting enzyme of cholesterol biosynthesis, HMGCoA reductase. For these reasons, regulation of the balance of ACAT and cholesteryl ester hydrolase activity, and thus presence of free cholesterol in the ER membrane, is essential for proper maintenance of intracellular and extracellular levels of cholesterol. In fibroblasts or macrophages, cholesterol homeostasis is maintained in this way. The situation is complicated in liver cells as they have multiple influx pathways (LDLR, very low density lipoprotein (VLDL) receptor, remnant receptor, SR-BI) and multiple outlet or efflux pathways (bile acid production, VLDL secretion, ATP-binding cassette A1 (ABCA1)-mediated efflux). Thus, it is completely reasonable that liver hepatocytes may regulate cholesterol homeostasis differently than macrophages or other cells. In a previous manuscript we showed that UT KO has profound effects on LDLR uptake of LDL [5]. It was shown previously by other investigators and by us that ACAT1 is regulated by UIIsignaling [20,32]. We also showed that UII stimulates ACAT activity in hepatocytes [5], although we have no evidence that UII directly upregulates expression of the ACAT2 gene. UT, the receptor for UII, mediates this signaling. Under hypercholesterolemic conditions, UT KO prevents UII signaling, leading to no upregulation of ACAT1 and free cholesterol is allowed to accumulate in the ER membrane (the regulatory site of cholesterol homeostasis). SCAP binds cholesterol preventing the release of SREBP2 and there is no transcriptional upregulation of the genes LDLR and HMGCoA reductase (unpublished data) [5]. For this reason and under hypercholesterolemic conditions, LDL is not taken up by the liver to the same degree as LDL in WT mice, thereby reducing liver steatosis, and LDL accumulates in the blood. On the other hand, macrophages are left to deal with the increased load of LDL and modified LDL that accumulates over time. Foam cell formation is induced and cholesterol-derived atherosclerosis is enhanced. This is in addition to the other potentially atherosclerotic effects of UII signaling. Our observations show that UII KO hepatocytes have reduced cholesterol esterification, putatively due to impaired UII signaling. These observations are entirely consistent with the data from the UT KO hepatocytes (i.e. decreased ACAT activity). However, UT KO hepatocytes had significantly reduced uptake of LDL by the LDLR, while the UII KO hepatocytes had relatively the same uptake of LDL as the WT. Therefore UT KO and UII KO did not have exactly the same cholesterol homeostatic profile. This is also demonstrated by the fact that UT KO mice had elevated plasma LDL, while the UII KO mice had reduced plasma LDL. As the liver is the main organ responsible for cholesterol homeostasis in the body, our experiments have shed light on these differences. UII KO hepatocytes do not synthesize as much cholesterol de novo (ten fold reduction) and they do not secrete as much ApoB as WT hepatocytes. This alone can account for the decreased plasma LDL levels in UII KO mice. We can only speculate why the UT KO and UII KO do not have the same phenotype. It is possible that another ligand can bind the UT receptor (in the case of the UII KO), or another receptor can bind UII (in the case of the UTKO) which might explain some divergence. However, our experience to date has demonstrated a very specific interaction between this pair UII:UT. It is more likely that activation of UT has more pleiotropic effects than UII signaling alone and we are currently investigating this. Interestingly, UII KO macrophages showed enhanced cholesteryl ester production (two fold) which appears contradictory to the previous findings reporting that UII induce ACAT activation in the same cells. Besides UII stimulation, ACAT1 is normally upregulated in response to increased intracellular cholesterol loading. We propose that increased macrophage cholesterol

load may do this independently of UII signaling. The effect of UT KO in macrophages is masked by the massive accumulation of LDL in the plasma that must be taken up and degraded. On the other hand, the decreased plasma LDL concentration in UII KO may have the converse effect (i.e. promoting macrophage endogenous synthesis and LDLR uptake) that we measured. Therefore, we see a significant difference in cholesterol metabolism and homeostasis in hepatocytes and macrophages. These effects are dependent on the gene makeup (UT KO or UII KO or WT) and the cholesterol environment (normal vs. hypercholesterolemic conditions). If we were to grow the macrophages in culture for longer to normalize the cholesterol levels, we may see a normalization of the difference between WT and UII KO cholesterol esterification. The fact that hepatocytes use a different ACAT gene to generate CE and this CE is preferentially re-secreted within a VLDL particle may also explain the differences we observed between hepatocytes and macrophages. To summarize, UII KO mice have a significantly decreased LDL cholesterol profile and hepatic steatosis that is consistent with decreased hepatocyte de novo cholesterol synthesis and ApoB secretion. Although, much more research needs to be performed on this model system, UII deletion or UT blockade may prove to be beneficial in reducing plasma LDL cholesterol levels and their contribution to atherosclerosis. Acknowledgments Dr. Adel Giaid is supported by the Canadian Institute of Health Research and the Heart and Stroke Foundation of Canada. Dr. Robert Kiss is supported by the Canadian Institute of Health Research and the Heart and Stroke Foundation of Quebec. References [1] Ames RS, Sarau HM, Chambers JK, Willette RN, Aiyar NV, Romanic AM, et al. Human urotensin-II is a potent vasoconstrictor and agonist for the orphan receptor GPR14. Nature 1999;401:282–6. [2] Ban Y, Watanabe T, Suguro T, Matsuyama TA, Iso Y, Sakai T, et al. Increased plasma urotensin-II and carotid atherosclerosis are associated with vascular dementia. J Atheroscler Thromb 2009;16:179–87. [3] Bern HA, Pearson D, Larson BA, Nishioka RS. Neurohormones from fish tails: the caudal neurosecretory system. I. “Urophysiology” and the caudal neurosecretory system of fishes. Recent Prog Horm Res 1985;41:533–52. [4] Bohm F, Pernow J. Urotensin II evokes potent vasoconstriction in humans in vivo. Br J Pharmacol 2002;135:25–7. [5] Bousette N, D’Orleans-Juste P, Kiss RS, You Z, Genest J, Al-Ramli W, et al. Urotensin II receptor knockout mice on an ApoE knockout background fed a high-fat diet exhibit an enhanced hyperlipidemic and atherosclerotic phenotype. Circ Res 2009;105:686–95. [6] Brown MS, Goldstein JL. Cholesterol feedback: from Schoenheimer’s bottle to Scap’s MELADL. J Lipid Res 2009;50:S15–27. [7] Chang TY, Li BL, Chang CC, Urano Y. Acyl-coenzyme A:cholesterol acyltransferases. Am J Physiol Endocrinol Metab 2009;297:E1–9. [8] Charles CJ, Rademaker MT, Richards AM, Yandle TG. Urotensin II: evidence for cardiac, hepatic and renal production. Peptides 2005;26:2211–4. [9] Cheung BM, Leung R, Man YB, Wong LY. Plasma concentration of urotensin II is raised in hypertension. J Hypertens 2004;22:1341–4. [10] Conlon JM, Yano K, Waugh D, Hazon N. Distribution and molecular forms of urotensin II and its role in cardiovascular regulation in vertebrates. J Exp Zool 1996;275:226–38. [11] Coulouarn Y, Jegou S, Tostivint H, Vaudry H, Lihrmann I. Cloning, sequence analysis and tissue distribution of the mouse and rat urotensin II precursors. FEBS Lett 1999;45:28–32. [12] Do-Rego JC, Chatenet D, Orta MH, Naudin B, Le CC, Leprince J, et al. Behavioral effects of urotensin-II centrally administered in mice. Psychopharmacology (Berl) 2005;183:103–17. [13] Douglas SA, Sulpizio AC, Piercy V, Sarau HM, Ames RS, Aiyar NV, et al. Differential vasoconstrictor activity of human urotensin-II in vascular tissue isolated from the rat, mouse, dog, pig, marmoset and cynomolgus monkey. Br J Pharmacol 2000;131:1262–74. [14] Gartlon J, Parker F, Harrison DC, Douglas SA, Ashmeade TE, Riley GJ, et al. Central effects of urotensin-II following ICV administration in rats. Psychopharmacology (Berl) 2001;155:426–33. [15] Ghosh S, Zhao B, Bie J, Song J. Macrophage cholesteryl ester mobilization and atherosclerosis. Vascul Pharmacol 2010;52:1–10.

R.S. Kiss et al. / Peptides 32 (2011) 956–963 [16] Goldstein JL, Brown MS. The LDL receptor. Arterioscler Thromb Vasc Biol 2009;29:431–8. [17] Lim M, Honisett S, Sparkes CD, Komesaroff P, Kompa A, Krum H. Differential effect of urotensin II on vascular tone in normal subjects and patients with chronic heart failure. Circulation 2004;109:1212–4. [18] MacLean MR, Alexander D, Stirrat A, Gallagher M, Douglas SA, Ohlstein EH, et al. Contractile responses to human urotensin-II in rat and human pulmonary arteries: effect of endothelial factors and chronic hypoxia in the rat. Br J Pharmacol 2000;130:201–4. [19] Nothacker HP, Wang Z, McNeill AM, Saito Y, Merten S, O’Dowd B, et al. Identification of the natural ligand of an orphan G-protein-coupled receptor involved in the regulation of vasoconstriction. Nat Cell Biol 1999;1:383–5. [20] Papadopoulos P, Bousette N, Al-Ramli W, You Z, Behm DJ, Ohlstein EH, et al. Targeted overexpression of the human urotensin receptor transgene in smooth muscle cells: effect of UT antagonism in ApoE knockout mice fed with Western diet. Atherosclerosis 2009;204:395–404. [21] Parini P, Davis M, Lada AT, Erickson SK, Wright TL, Gustafsson U, et al. ACAT2 is localized to hepatocytes and is the major cholesterol-esterifying enzyme in human liver. Circulation 2004;110:2017–23. [22] Pearson D, Shively JE, Clark BR, Geschwind II, Barkley M, Nishioka RS, et al. Urotensin II: a somatostatin-like peptide in the caudal neurosecretory system of fishes. Proc Natl Acad Sci U S A 1980;77:5021–4. [23] Ross B, McKendy K, Giaid A. Role of urotensin II in health and disease. Am J Physiol Regul Integr Comp Physiol 2010;298:R1156–72. [24] Saetrum OO, Nothacker H, Ehlert FJ, Krause DN. Human urotensin II mediates vasoconstriction via an increase in inositol phosphates. Eur J Pharmacol 2000;406:265–71.

963

[25] Sheridan MA, Bern HA. Both somatostatin and the caudal neuropeptide, urotensin II, stimulate lipid mobilization from coho salmon liver incubated in vitro. Regul Pept 1986;14:333–44. [26] Sheridan MA, Plisetskaya EM, Bern HA, Gorbman A. Effects of somatostatin25 and urotensin II on lipid and carbohydrate metabolism of coho salmon, Oncorhynchus kisutch. Gen Comp Endocrinol 1987;66:405–14. [27] Silvestre RA, Egido EM, Hernandez R, Leprince J, Chatenet D, Tollemer H, et al. Urotensin-II is present in pancreatic extracts and inhibits insulin release in the perfused rat pancreas. Eur J Endocrinol 2004;151:803–9. [28] Silvestre RA, Rodriguez-Gallardo J, Egido EM, Marco J. Inhibition of insulin release by urotensin II–a study on the perfused rat pancreas. Horm Metab Res 2001;33:379–81. [29] Sugo T, Murakami Y, Shimomura Y, Harada M, Abe M, Ishibashi Y, et al. Identification of urotensin II-related peptide as the urotensin II-immunoreactive molecule in the rat brain. Biochem Biophys Res Commun 2003;310:860–8. [30] Temel RE, Hou L, Rudel LL, Shelness GS. ACAT2 stimulates cholesteryl ester secretion in apoB-containing lipoproteins. J Lipid Res 2007;48:1618–27. [31] Totsune K, Takahashi K, Arihara Z, Sone M, Ito S, Murakami O. Increased plasma urotensin II levels in patients with diabetes mellitus. Clin Sci (Lond) 2003;104:1–5. [32] Watanabe T, Suguro T, Kanome T, Sakamoto Y, Kodate S, Hagiwara T, et al. Human urotensin II accelerates foam cell formation in human monocytederived macrophages. Hypertension 2005;46:738–44. [33] Watson AM, Lambert GW, Smith KJ, May CN. Urotensin II acts centrally to increase epinephrine and ACTH release and cause potent inotropic and chronotropic actions. Hypertension 2003;42:373–9.