Use of Bartonella adhesin A (BadA) immunoblotting in the serodiagnosis of Bartonella henselae infections

ARTICLE IN PRESS

International Journal of Medical Microbiology 298 (2008) 579–590 www.elsevier.de/ijmm

Use of Bartonella adhesin A (BadA) immunoblotting in the serodiagnosis of Bartonella henselae infections Carola L. Wagnera, Tanja Riessa, Dirk Linkeb, Christian Eberhardta, Andrea Scha¨fera, Sabine Reuttera, Ricardo G. Maggic, Volkhard A.J. Kempfa, a

Institut fu¨r Medizinische Mikrobiologie und Hygiene, University Hospital, Eberhard-Karls-Universita¨t, Elfriede-Aulhorn-Street 6, 72076 Tu¨bingen, Germany b Max-Planck-Institut fu¨r Entwicklungsbiologie, Abteilung Proteinevolution, Spemannstr. 35, 72076 Tu¨bingen, Germany c College of Veterinary Medicine, North Carolina State University, 4700 Hillsborough Street, Raleigh, NC 27606, USA Received 27 September 2007; accepted 14 January 2008

Abstract Bartonella henselae causes a variety of human diseases (e.g. cat scratch disease and the vasculoproliferative disorders, bacillary angiomatosis and peliosis hepatis). The laboratory diagnosis of B. henselae infections is usually based on the detection of anti-B. henselae antibodies by an indirect immunofluorescence assay (IFA) which, unfortunately, suffers from a significant amount of cross-reactivity and hence is prone to deliver false-positive results. In this pilot study, we evaluated the use of a potential two-step serodiagnosis of B. henselae infections by combining IFA and anti-Bartonella adhesin A (BadA) immunoblotting. Our data revealed that approximately 75% of the IFA-positive sera of patients with a suspected B. henselae infection reacted specifically with BadA but only approximately 25% of the IFA-negative sera of healthy blood donors. Although Yersinia adhesin A (YadA) is structurally closely related to BadA, no crossreactivity of sera from patients suffering from a Yersinia enterocolitica or Y. pseudotuberculosis infection with BadA was detected in immunoblotting. Unfortunately, recombinantly expressed BadA domains (head, connector, stalk fragment) were not suitable for immunoblotting. Finally, the best resolution for full-length BadA immunoblotting was obtained when whole cell lysates of B. henselae were separated using continuous 4–15% sodium dodecyl sulfate polyacrylamide gels. In summary, our results show that BadA antibodies are detectable in the sera of B. henselaeinfected patients and, therefore, this pilot study suggests to include BadA immunoblotting in the laboratory diagnosis of B. henselae infections. r 2008 Published by Elsevier GmbH. Keywords: Cat scratch disease; Bartonella henselae; Immunoblot; Two-step serology; IgG

Introduction

Corresponding author. Tel.: +49 7071 2982352; fax: +49 7071 295440. E-mail address: [email protected] (V.A.J. Kempf).

1438-4221/$ - see front matter r 2008 Published by Elsevier GmbH. doi:10.1016/j.ijmm.2008.01.013

In immunocompetent patients, infections with B. henselae usually result in cat scratch disease (CSD), a benign and self-limited but often prolonged lymphadenitis. In immunocompromised patients (e.g. AIDS patients), B. henselae infections can lead to vasculoproliferative

ARTICLE IN PRESS 580

C.L. Wagner et al. / International Journal of Medical Microbiology 298 (2008) 579–590

disorders (bacillary angiomatosis, peliosis hepatis [Anderson and Neuman, 1997]). Cats are the confirmed reservoir host of B. henselae, and the transmission to humans occurs by cat scratches or cat fleas (Dehio, 2005). Regional lymphadenopathy (axillary, head, neck, inguinal) is the predominant clinical feature of CSD (Carithers, 1985; Margileth, 1993). However, approximately 10% of CSD patients develop atypical manifestations including Parinaud’s oculoglandular syndrome, neuroretinitis, encephalitis, erythema nodosum, parotitis, arthritis, etc. (Cunningham and Koehler, 2000; Glaser et al., 2003; Kempf et al., 2001; Sarret et al., 2005; Giladi et al., 2005). Annually, 25,000 people in the United States suffer from CSD (Jackson et al., 1993). In Germany, approximately 14% of all enlarged cervicofacial lymph nodes are caused by B. henselae infections (Ridder et al., 2005). Timely and accurate diagnosis of CSD is important to prevent false diagnoses because the clinical presentation and the course of CSD may resemble lymphoma or other malignancies like parotideal or pancreatic cancer (Raasveld et al., 1997; Kempf et al., 2001). A variety of methods for the laboratory identification of B. henselae infections have been employed including histologic examination, isolation and culture, or molecular and serological approaches. Nevertheless, the detection of the causative agent of CSD by histology or PCR (e.g. via amplification of the 16S-rDNA [Dauga et al., 1996]) requires invasive procedures (e.g. biopsy, fine needle aspiration) to gain adequate material. Unfortunately, cultivation of the slowly growing and fastidious pathogens from patient specimen is normally not successful. The most widely used laboratory method is the serological testing for B. henselae antibodies (Abs). For this purpose, an indirect immunofluorescence assay (IFA) was developed using whole cell antigen from B. henselae co-cultivated with Vero cells (Regnery et al., 1992). However, this ‘gold standard’ suffers from significant cross-reactivity, proven to be higher than 50%, with many other pathogens, e.g., for sera of patients suffering from Chlamydia pneumoniae or Coxiella burnetii-infections (LaScola and Raoult, 1996; Maurin et al., 1997; McGill et al., 1998, 2004). To our knowledge, the systematic evaluation of an immunoblotting-based B. henselae serology has not been reported. A two-step serological diagnosis (step 1: IFA, step 2: western blot) would be desirable to improve the specificity of B. henselae serology as similarly shown in the serodiagnosis of Borrelia infections (CDC, 1995). Recently, the newly described Bartonella adhesin A (BadA), an outer membrane protein of B. henselae, turned out to be immunodominant in humans and rodents (Riess et al., 2004). This high-molecular-weight adhesin (monomeric approximately 328 kDa) consists of an N-terminal head region, a long, highly repetitive stalk, and a C-terminal membrane anchor. Together with, e.g., Yersinia adhesin A (YadA) of Y. enterocoli-

tica, BadA belongs to the class of trimeric autotransporter adhesins (TAAs) which share a similar modular architecture (Linke et al., 2006; Wollmann et al., 2006). The expression of the immunodominant BadA is lost after multiple in vitro passages of B. henselae, which is most likely due to genomic rearrangements or single base deletions (Riess et al., 2007). Only the early-passage B. henselae Marseille (Drancourt et al., 1996) is a welldefined BadA expressing strain (Riess et al., 2004). Remarkably, several other B. henselae strains do not express BadA. In many serological and experimental studies, the exact passage number of the bacteria is unfortunately not stated and, moreover, it is not clear, whether or not, these particular strains express BadA. This is problematic since a lack of BadA expression might strongly influence serological results or the outcome of infection experiments with B. henselae. Here, we evaluated the use of a two-step serological approach combining IFA and BadA immunoblotting using BadA+ B. henselae Marseille. Our pilot study suggests that the combination of these two techniques might help to differentiate between B. henselae-specific and false-positively cross-reacting Abs and should therefore improve the serodiagnosis of B. henselae infections.

Materials and methods Patient sera Clinical serum samples were collected from 34 German patients, suspected of having CSD. Sera were evaluated positive when reacting in the IFA (see below) at X1:200. Control sera were obtained from 31 healthy individuals which were evaluated negative (IFA o1:100). In every assay, technical positive and negative controls were included (purified rabbit anti-BadA IgG and pre-immunisation serum; data not shown). Moreover, IFA- and BadA-negative patient sera were included in each experiment to avoid unspecific results. For further control, the sera of 10 patients suffering from a yersiniosis were also included in the evaluation process. All of these sera contained Y. enterocolitica- or Y. pseudotuberculosisreactive Abs in ELISA and Yersinia outer-protein-D (YopD) immunoblot. Sera of 5 patients suffering from acute (n ¼ 3) or chronic (n ¼ 2) Q-fever (caused by Co. burnetii; reactive in ELISA, IFA, and complement binding reaction) were also tested for cross-reactivity (all evaluated by standard laboratory methods; data not shown).

Preparation of cell culture-derived Bartonella henselae antigen for IFA Cell culture-derived whole bacteria-containing B. henselae antigen was prepared according to CDC

ARTICLE IN PRESS C.L. Wagner et al. / International Journal of Medical Microbiology 298 (2008) 579–590

guidelines (1999). In brief, Vero cells were grown to a semiconfluent stage in RPMI 1640 cell culture medium (Biochrom, Berlin, Germany) supplemented with 10% heat-inactivated fetal calf serum (Sigma-Aldrich, Deisenhofen, Germany), 2 mM glutamin (Gibco, Karlsruhe, Germany), 1 mM Na-pyruvate and non-essential amino acids (all Biochrom) using 80 cm2 cell culture flasks (Nunc, Roskilde, Denmark) at 5% CO2 and 37 1C. B. henselae Marseille was grown on Columbia blood agar (CBA; Becton Dickinson, Heidelberg, Germany) in a humidified atmosphere at 37 1C and 5% CO2 for 5 days. BadA expression of the inoculum was evaluated by immunofluorescence using specific rabbit anti-BadA IgG as described before (Riess et al., 2004). Bacteria were used at a multiplicity of infection (MOI) of 300 and sedimented onto cultured cells by centrifugation for 5 min at 300g at room temperature. After incubation for 48 h at 37 1C and 5% CO2, infections were stopped, the resulting antigen was spotted on glass slides and fixed using phosphate-buffered (pH 7.4) paraformaldehyde (3.75%). Slides were stored at 20 1C until use.

IFA testing IFA testing was performed according to the CDC guidelines (1999) with slight modifications. In brief, sera were diluted in phosphate-buffered saline (PBS; Gibco), titrated from a 1:50 dilution up to 1:6400 and added to cell culture-derived antigen-coated glass slides (see above) for 30 min at room temperature (RT). Fluorescein isothiocyanate (FITC)-conjugated goat antihuman IgG (Fluoline G) was used for detection of specific IgG Abs (30 min, RT), Evans blue for counterstaining, and Fluoprep as a mounting medium (all bioMe´rieux, Nu¨rtingen, Germany). The slides were analysed with an epifluorescence Leica DMRBE microscope equipped with a standard filter set (Leica, Bensheim, Germany). Microscopy was carried out blinded by two independent investigators. The endpoint titer was defined as the dilution that still presented a specific fluorescence. Sera with a reactivity o1:100 were evaluated negative and sera X1:200 were evaluated positive (Hogrefe and Cullmann, 1996). Sera with a titre of 1:100 (threshold value according to the CDC guidelines [1999]) were omitted from further western blot analysis because of the unclear relevance.

Preparation of Bartonella henselae antigen for SDSPAGE and immunoblotting B. henselae was grown for 5 days on CBA (see above), collected in PBS using sterile swabs, centrifuged (1500g, 10 min, RT), resuspended in SDS sample (Laemmli-) buffer, and heated at 98 1C for 3 min. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE)

581

was performed in 12% or 4–15% gradient gels (Biorad, Munich, Germany). For immunoblotting, proteins were transferred onto nitrocellulose membranes (Schleicher and Schuell, Dassel, Germany). Blots were blocked for 1 h in 5% skim milk in 10 mM Tris, pH 7.4, 0.15 M NaCl, and 0.2% Tween 20 (Sigma-Aldrich) and incubated with patient sera (all diluted 1:100 in blocking buffer) at 4 1C overnight. Affinity chromatographypurified rabbit anti-BadA IgG (reactive in IFA at 1:1600 and in immunoblotting at 1:6400) was used as an internal control (Riess et al., 2004). Horseradish peroxidase (HRP)-conjugated secondary Abs were used for the detection of anti-B. henselae IgG, and signals were visualized either with 3,30 -diaminobenzidin tetrahydrochloride (DAB; Sigma-Aldrich) or via chemiluminescence (ECL; Amersham, Munich, Germany).

Cloning, expression, and purification of BadA domains Different domains of BadA (GenBank accession number DQ665674) were expressed recombinantly in E. coli and purified for immunoblotting. All badA fragments were amplified by PCR from B. henselae Marseille (details are given in Table 1). Head domain For cloning and expression of the badA head domain, a 987-bp fragment coding for amino acids (aa) 48–376 was amplified by PCR with primers badAf8 and badAr8. Primer badAr8 includes a stop codon followed by a BamHI restriction site for ligation into the pQE30Xa vector (Qiagen, Hilden, Germany). The resulting plasmid was electroporated into E. coli XL1-Blue (Stratagene, La Jolla, USA), and protein expression was induced with 1 mM isopropyl-b-D-thiogalactopyranoside (IPTG; Fermentas, St. Leon-Rot, Germany) for 4 h. Cells were harvested, resuspended in 30 ml PBS and lysed using a French press (Thermo Spectronic; Rochester, NY, USA). After the first pass through the French pressure cell, the buffer was supplemented with 10 mg/ml of DNase, 10 mM of MgCl2 and MnCl2 each. After three passes, inclusion bodies were harvested by centrifugation (10 min, 2500g), and the resulting pellet was washed first with 2% Triton X-100 and then three times with water. The pellet was resuspended in a small volume and dissolved in 6 M guanidine–HCl supplemented with 10% glycerol, 500 mM NaCl and 50 mM Tris–HCl (pH 8). The His-tagged BadA fragment was purified under denaturing conditions using the same buffer and a linear gradient from 0 to 500 mM imidazole with a 30 ml NiNTA column on an A¨kta Purifier system (GE Healthcare, Munich, Germany). For refolding, the peak fractions from the chromatography were diluted 1:20 into a cold Tris/Arginine buffer (50 mM Tris–HCl

ARTICLE IN PRESS 582

Table 1.

C.L. Wagner et al. / International Journal of Medical Microbiology 298 (2008) 579–590

Targets, primers, and size of the expressed gene fragment.

Recombinant fragment

Size (kDa)

Nucleotide position

Primer

Head

33.0a

142–1128

Connector

17.2

1122–1608

Stalk

16.8

8257–8718

badAf8 (TCGAATCTTGCGCTTACAGGAGC) badAr8 (TGATATCATGGATCCTTATGCTTTTAGCTGTGC)b badAf6 (TGCACATATGAAAGCATTAAGGGGAATGATATCAG)c badAr6 (TTATCTCGAGTCAAGTACGCTTATCACTTTTGTTATTAGC)d badAf7 (TTCTCATATGTATTCTTTGAACGAGCAGTTATTGACC)c badAr7 (TACTCTCGAGTCAATACTTAACAGCACTATCTGC)d

a

Not including His-tag. Italic: BamHI restriction site; underlined: stop codon. c Italic: NdeI restriction site. d Italic: XhoI restriction site; underlined: stop codon. b

pH 8, 100 mM NaCl, 1 M arginine). The solution appeared clear and was dialysed against 50 mM Tris–HCl (pH 8). Precipitated protein was removed by centrifugation, and the concentration of the purified soluble protein was measured in the supernatant. Size exclusion chromatography showed that the protein solution contained mostly trimers; only a small peak was observed for the monomeric form (data not shown). Connector domain and stalk fragment The connector domain was cloned by amplifying a 486-bp fragment of badA coding for aa 375–536 with primers badAf6 and badAr6, expressed and purified as described (Riess et al., 2004). The neck/stalk fragment of badA was cloned by amplifying a 462-bp fragment coding for aa 2753–2906 using the primers badAf7 and badAr7 and ligated into pET30b. The resulting plasmid was transformed into E. coli BL21-DE3 (Stratagene), and expression was induced with 1 mM ITPG for 4 h. Protein purification was performed as described before (Riess et al., 2004). In brief, cells were lysed by passing three times a French Press in 30 mM Tris–HCl (pH 7.4), 50 mM NaCl, 5 mM dithiothreitol (DTT), 50 mg/ml DNase I and 1 mM PMSF, and the protein was purified from the high-speed centrifugation supernatant of the lysate by a combination of cation-exchange (MonoS HR, Amersham) and size-exclusion chromatography (Superdex G-75, Amersham).

Results Detection of specific anti-BadA-IgG antibodies in Bartonella henselae IFA-positive patient sera The IFA (using cell culture-derived antigen) is the best evaluated method in the serodiagnosis of B. henselae infections (CDC, 1999). However, a remarkable

cross-reactivity of IFA, greater than 50%, has been published in several independent reports (LaScola and Raoult, 1996; Maurin et al., 1997; McGill et al., 1998, 2004). We therefore evaluated, whether positive IFA results might be confirmed with a second, independent immunoblotting approach. For this purpose, sera of patients with a clinically suspected and IFA-confirmed B. henselae infection and control sera of healthy blood donors were collected and immunoblots using whole cell lysates from agar-grown BadA-expressing B. henselae were performed. To exclude unspecific Ab binding, immunoblots prepared from whole cell lysates of BadAnegative B. henselae (Riess et al., 2004) were additionally included in this study. BadA-specific rabbit Abs were also included as a further control (Fig. 1). The data clearly revealed that the IgG Abs reacting with BadA (present in the protein extract of wildtype bacteria) were not detectable when BadA-negative lysates were used as antigen. Therefore, it can be concluded that the detected IgG Abs reacting with BadA (calculated size of the protein approximately 328 kDa) are highly specific and do not show cross reactivity with other high-molecular weight antigens of B. henselae. Next, 34 IFA positive patient sera (IFA X1:200) were tested for the presence of specific anti-BadA-IgG and compared with 31 IFA-negative sera (IFA o1:100). Of the IFA-positive sera, approximately 75% (n ¼ 25) contained anti-BadA IgG, whereas these Abs were only present in approximately 25% (n ¼ 8) of the IFAnegative serum samples (Fig. 2a). Moreover, anti-BadA Abs were detectable in IFA-positive sera (X1:200) irrespective of the IFA titre (1:200–1:1600; Fig. 2b). The slightly lower incidence of anti-BadA IgG in sera with a titre of 1:3200 might be a statistic artefact due to the small sample size (n ¼ 2). Taken together, these results suggest that specific anti-BadA IgG can be detected in the majority of IFA-positive sera of patients with a suspected B. henselae infection while a much lower frequency is observed in IFA-negative serum samples of healthy donors.

ARTICLE IN PRESS C.L. Wagner et al. / International Journal of Medical Microbiology 298 (2008) 579–590

IFA titer

10

20

30

50

80

220

10

20

30

80

50

220

B. henselae BadA-

1

+

-

800

2

+

-

400

3

+

-

800

4

+

-

200

5

+

-

400

6

+

-

3,200

7

+

-

1,600

8

(+)

-

400

9

+

-

1,600

10

-

-

200

11

-

-

<100

12

-

-

<100

13

-

-

<100

14

-

-

<100

15

-

-

<100

16

-

-

<100

17

+

-

<100

18

+

-

<100

19

-

-

<100

+

-

<100

+

-

1,600

BadA

antiBadA

20

BadA

donors

patients

kDa

B. henselae BadA+

583

Fig. 1. Representative IgG immunoblots of patient and control sera. Whole cell lysates of B. henselae strain Marseille BadA+ (left) or BadA (right) were separated by 12% SDS-PAGE and blotted on nitrocellulose membranes. Sera were obtained from 10 patients (reactive in IFA analysis at 1:200 or higher), control sera from 10 healthy individuals (not reactive in IFA analysis, o1:100). For internal control, purified rabbit anti-BadA IgG (reactive in IFA analysis at 1:1600) was used.

Evaluation of the reliability, sensitivity and specificity of human anti-BadA IgG antibodies To detect reliably B. henselae reactive antibodies, all detectable bands in immunoblotting (using total cell lysates from B. henselae) were investigated for their reactivity with IFA-positive and IFA-negative sera. For this purpose, the sizes of the reacting bands were estimated. In total, approximately 12 bands from B. henselae whole cell lysates ranging from approximately 15 up to 4220 kDa (Fig. 3) were reactive in immunoblotting using IFA-positive patient sera. Two reactive

bands could be identified (data not shown): the band appearing at approximately 30 kDa is caused by Pap31reactive IgGs (identified by the use of the specific monoclonal Ab VKS29 [Zimmermann et al., 2003], data not shown), and the band appearing at 4220 kDa represents BadA-specific IgGs (identified by the use of BadA specific rabbit Abs [Riess et al., 2004] and by using a BadA-negative mutant [Fig. 1]). In total, 34 IFA-positive (X1:200) sera suspicious for CSD and 31 IFA-negative (o1:100) sera of healthy blood donors were analysed. The data revealed that the bands appearing at 100, 90, 70, and 60 kDa did not allow to

ARTICLE IN PRESS 584

C.L. Wagner et al. / International Journal of Medical Microbiology 298 (2008) 579–590

IFA pos.

IFA neg.

immunoblot positive

25

8

Σn = 33

immunoblot negative

9

23

Σn = 32

Σn = 34

Σn = 31

anti-BadA-IgG pos. sera (%)

100 80 60 40 20

patients Σn=34

1:200 n=8

1:400 n=13

1:800 n=8

1:1,600 1:3,200 donors n=3 n=2 Σn=31

IFA titer

prevalence of IgG antibodies

Fig. 2. Evaluation of anti-BadA IgG as a diagnostic marker for B. henselae infections. (A) Four-fold table analysis of BadA immunoblot serology compared with conventional IFA testing. In total, 34 IFA positive (X1:200) and 31 IFA negative (o1:100) patient sera were analysed. (B) Prevalence of anti-BadA IgG (determined by immunoblotting) in patients with different anti-B. henselae titres (determined by IFA). Prevalence of anti-BadA IgG in all patients was approximately 75%, in IFA negative sera approximately 25%. Note that anti-BadA IgG was detectable in low- and high-titre patient sera.

100%

patients

80%

donors

60% 40% 20%

>220 ~160

~100

~90

~60 ~50 ~70 ~45 molecular weight (kDa)

~40

~30

~20

~15

Fig. 3. Reactivity of different proteins from B. henselae Marseille whole cell lysates with sera of patients and healthy blood donors. The molecular weight of the reactive bands was estimated according to the protein standard. Note that the highest differences in reactivity were observed for BadA (4220 kDa), for the 45-, 30-, 20-, and for the 15-kDa band. In total, 34 IFA positive (X1:200) and 31 IFA negative (o1:100) sera were analysed.

differentiate between IFA-positive and IFA-negative sera. The bands of 160, 50, 40, and 31 kDa reacted more frequently with IFA-positive sera than with the IFAnegative controls. However, the bands of 4220, 45, 20, and 15 kDa showed the highest discrimination rates between IFA-positive and IFA-negative sera. From these bands, only the 4220 kDa band represents an identified B. henselae protein (BadA, Fig. 1 and [Riess et al., 2004]). Therefore, the presence of anti-BadA IgG

predicts a B. henselae-infection in immunoblotting with a sensitivity of 74% and a specificity of 74% (positive predictive value: 0.76; negative predictive value: 0.72). It has been reported that Y. enterocolitica expresses Yersinia adhesin A (YadA) on its surface (Bolin et al., 1982), which is homologous to BadA on the sequence and structural level (Riess et al., 2004; Linke et al., 2006). We therefore investigated, whether sera containing Y. enterocolitica or Y. pseudotuberculosis Abs might

ARTICLE IN PRESS C.L. Wagner et al. / International Journal of Medical Microbiology 298 (2008) 579–590

10

20

30

50

100

200

B. henselae BadA10

20

30

50

100

200

kDa

B. henselae BadA+

585

anti-BadA control

Coxiella infection

A acute

B C

chronic

D E

Fig. 4. IgG immunoblots of patients suffering from clinically suspected and serologically confirmed acute and chronic Q-fever caused by Coxiella burnetii. Whole cell lysates of B. henselae strain Marseille BadA+ (left) or BadA (right) were separated by 12% SDS-PAGE and blotted on nitrocellulose membranes. For internal control, purified rabbit anti-BadA IgG (reactive in IFA analysis at 1:1600) and a negative control serum (healthy blood donor) were used. Note the missing cross-reactivity in BadA immunoblotting (B. henselae IFA results: patient A: o1:50, B: 1:100, C: 1:100, D: 1:100, E: o1:50).

cross-react in BadA immunoblots to exclude falsepositive results. Remarkably, none of these 10 sera reacted with BadA in western blotting (data not shown) underlining that BadA represents a promising target in the serodiagnosis of B. henselae infections. Moreover, sera of patients suffering from acute or chronic Q-fever (caused by Coxiella burnetii) did also not show crossreactivity in BadA immunoblots (Fig. 4).

Technical improvement of anti-BadA IgG western blotting serodiagnosis Because of its high molecular weight (calculated mass of monomeric BadA: 328 kDa [Riess et al., 2004]), the resolution of BadA from other B. henselae proteins is unsatisfying when standard 12% SDS-PAGE are used. Therefore, we tried to improve the technical prerequisites to detect anti-BadA Abs on a feasible technical basis, allowing a reproducible evaluation of BadA immunoblotting in routine serological diagnostics. First, we tried to establish BadA immunoblots with recombinantly expressed BadA fragments. For this purpose, the head domain, the connector domain, and a stalk fragment (Fig. 5a and Table 1) were cloned and expressed in E. coli, the expressed fragments were purified, and immunoblotting was performed as described in Materials and methods. Surprisingly, none of these recombinantly expressed fragments exhibited a satisfactory specificity to discriminate between patient and control sera (head: 10 positive and 10 negative sera tested; connector/stalk fragment: 10 positive and 5 negative sera tested each; Fig. 5b). Therefore, immunoblot serology with recombinantly expressed BadA

fragments does not meet the claim of a satisfying approach in the serodiagnosis of B. henselae infections. Next, we tried to improve the resolution of our whole cell lysates of B. henselae immunoblots using all 25 sera evaluated to be positive by standard 12% SDS-PAGE immunoblotting. For this purpose, whole cell lysates were separated via 4–15% SDS-PAGE gradient gels. Data revealed that the resolution of BadA and its presumptive fragments was significantly better when compared to standard 12% SDS-PAGE (Fig. 6). Therefore, we conclude that the use of B. henselae whole cell lysates separated in 4–15% gradient gels is a reasonable and convenient method of performing an immunoblot-based serodiagnosis of B. henselae infections.

Discussion In this study, we evaluated the use of a combined serodiagnosis of B. henselae infections (screening test: B. henselae IFA with cell culture-derived antigen, confirmation test: BadA immunoblotting). As the widely used IFA is known to be cross-reactive, such a two-step serodiagnosis of B. henselae Abs would be beneficial for improving the specificity of B. henselae serodiagnosis and would, therefore, be a significant step forward in the serodiagnosis of B. henselae infections like CSD or BA. IFA is the most thoroughly studied and frequently applied method in the serological testing of B. henselae infections. Generally, IFA has been used for many years in diagnostic laboratories and provides a relatively simple method to detect Abs against a wide variety of

ARTICLE IN PRESS 586

C.L. Wagner et al. / International Journal of Medical Microbiology 298 (2008) 579–590

neck-stalk repeats

signal peptide

head

connector

anchor

stalk fragment connector

stalk fragment

donors

patients

head

Fig. 5. Reactivity of patient and donor sera with recombinantly expressed BadA fragments. (A) For reasons of clarity, BadA is schematically depicted with the signal peptide (light blue), the head sequence (red), the connector sequence (purple), 22 neck-stalk repeats (brown and green, respectively), and the membrane anchor (orange). (B) The head, the connector, and a stalk fragment were recombinantly expressed in E. coli, purified, blotted on nitrocellulose membranes, and incubated with selected patient or donor sera. Note that there is no clear discrimination between patient and donor sera when recombinant BadA fragments were used for immunoblotting.

50

100

200

4-15% SDS PAGE whole cell lysate

50

200 100

kDa

12% SDS PAGE whole cell lysate

rabbit anti-B. henselae rabbit anti-BadA patient

BadA

BadA

donor

Fig. 6. Optimisation of BadA Western blot serology. To improve the resolution of the high-molecular weight bands of anti-BadA reactive IgG, conventional immunoblots performed with 12% SDS polyacrylamide gels (left) were compared with those by 4–15% gradient gels (right). A patient serum (IFA 1:400), a serum of a healthy blood donor (o1:100), a serum of a B. henselae-infected rabbit (1:6400), and purified rabbit anti-BadA IgG (1:1600) are shown. Note the significantly improved resolution of the BadAreactive bands in the immunoblots of the gradient gel electrophoresis.

pathogens. As only a small amount of antigen is needed for each test, IFA also meets the demands of an economical assay. In case of Bartonella infections, an IFA with cell culture-derived antigen was developed at the CDC (1999) based on earlier published results (Regnery et al., 1992). B. henselae-infected Vero cells turned out to be a more feasible antigen when compared to agar-grown bacteria. Not less than 88% of the sera from patients suspected of having a B. henselae infection

(n ¼ 41) reacted with this antigen, whereas only 6% of blood donors were reactive (n ¼ 107) (Regnery et al., 1992). However, more recent data suggest a significantly higher percentage of anti-B. henselae seropositive individuals in healthy blood donors (M. Kosoy, CDC, Fort Collins, Colorado, USA, pers. communication). Currently, serological results are rated positive when reacting at dilutions higher than 1:200. Sera with no reaction at a dilution of 1:50 are rated negative. Sera

ARTICLE IN PRESS C.L. Wagner et al. / International Journal of Medical Microbiology 298 (2008) 579–590

with an antibody titre of 1:50 to 1:100 are at the threshold level for considering Bartonella-seropositive, and these patients are recommended to be reevaluated 3 weeks after taking the initial serum sample (CDC, 1999). Unfortunately, results of the B. henselae IFA can suffer from a high percentage of cross-reactivity (up to 450%, depending on the particular diagnostic laboratory) with many other intracellular pathogens like B. quintana, Coxiella burnetii (LaScola and Raoult, 1996), Chlamydia pneumoniae (Maurin et al., 1997), Ehrlichia chaffeensis, Mycoplasma pneumoniae, E. coli, Rickettsia spp., Treponema pallidum (McGill et al., 1998), and also with Bordetella pertussis and Borrelia spp. (McGill et al., 2004) leading to false-positive results in serodiagnosis. This fact is an important issue because other diseases might be misdiagnosed. For instance, a Treponema pallidum infection might also cause lymphadenitis similar to B. henselae but aetiology and treatment of this sexually transmitted disease differ completely from CSD. Therefore, establishing a more specific serology is important to improve serodiagnosis of B. henselae infections. In this study, analysis of serum samples from patients suspected of having a B. henselae infection revealed that 25 of 34 sera with an IFA titre of 1:200 or higher reacted specifically with BadA in western blotting (approximately 75%). In contrast, only 8 out of 31 sera of healthy blood donors showed BadA reactivity (approximately 25%). These data are consistent with previously published data (Zangwill et al., 1993). Obviously, the reactivity of anti-BadA IgG is highly specific, as immunoblotting with a BadA-negative B. henselae mutant always appeared negative when tested in parallel (Fig. 1). BadA reactivity seems to be independent of the IFA-titre, as immunoblot-positive sera were reactive in IFA from 1:200 up to 1:3200 (Fig. 2b). From these data, it can be suggested that specific anti-BadA IgG Abs might be a useful marker of B. henselae infection. The observed BadA reactivity of approximately 25% in healthy blood donors might be due to earlier contact(s) of these individuals with B. henselae, e.g. due to an asymptomatic infection. In fact, recent results suggest higher contact rates (M. Kosoy, pers. communication) in humans than previously described (Regnery et al., 1992). Surprisingly, 26 serum samples from 27 patients suffering from a chronic Bartonella infection (Breitschwerdt et al., 2007) did not react in IFA testing at 41:100 (confirmed by the CDC, Atlanta, USA; data not shown). From this, it has to be concluded that in chronic Bartonella infections laboratory diagnosis exclusively performed via IFA might cause false-negative and therefore misleading serological results. Why sera of patients suffering from a chronic B. henselae infection do not react in IFA-testing remains unclear. This phenomenon might be explained by an impaired ability

587

of these patients to produce significant levels of antiBartonella IgG detectable by IFA testing also precluding the clearance of the infection (in contrast to, e.g., IFApositive CSD patients). Remarkably, 38% of these sera reacted with BadA (data not shown) suggesting that BadA immunoblotting might be even superior to IFA in the serological diagnosis of chronic B. henselae infections. It has to be mentioned that, besides BadA, other protein bands might also be of interest for performing immunoblot serodiagnosis. In particular, the bands appearing at 15, 20, and 45 kDa discriminate IFApositive from negative sera; however, theses bands are unfortunately not identified yet. Therefore, of all the bands analysed, BadA is a first promising candidate for establishing a Western blot-based serodiagnosis of B. henselae infections. Other defined B. henselae proteins, in particular substrates of the virB type IV secretion system (Bartonella-translocated effector proteins [Beps] known to modulate host cell function and to inhibit apoptosis [Schmid et al., 2006]) turned out to represent further good seromarkers for the diagnosis of B. henselae infections (Christoph Dehio, pers. communication). It is most likely that the specificity of the serodiagnosis of B. henselae infections could be significantly increased if a second defined immunodominant antigen (e.g. BepG) would be included in an immunoblot-based approach. Accordingly, Abs reacting with two defined and independent antigens of Borrelia spp. are decisive for the serodiagnosis of Borrelia infections (CDC, 1995). Further evaluation of possible antigen combinations in B. henselae immunoblotting might therefore greatly improve the specificity of serodiagnosis. It is important to note that BadA shares great structural and protein sequence homologies with YadA, the prototypical and best characterised bacterial TAA (Hoiczyk et al., 2000; Linke et al., 2006). Enteropathogenic Yersinia species (Y. enterocolitica and Y. pseudotuberculosis) cause a variety of diseases in humans ranging from diarrhea to septicaemia, mesenteric lymphadenitis, and reactive arthritis (Cover and Aber, 1989). In yersiniosis, Yersinia-specific Abs are found regularly (by Widal reaction, ELISA, and YopD immunoblotting) returning to normal within 3–6 months post-infection. However, these Abs may remain detectable for several years (Campbell and Dennis, 2001). Therefore, one could assume that Yersiniapositive sera might cross-react with B. henselae on the base of the homologies of YadA with BadA. Convincingly, none of 10 tested sera of patients with a clinically suspected and serologically confirmed Y. enterocolitica or Y. pseudotuberculosis infection reacted in BadA immunoblotting (data not shown). Due to these findings, it seems unlikely that Yersinia-specific Abs interfere with BadA immunoblotting. Moreover, in silico

ARTICLE IN PRESS 588

C.L. Wagner et al. / International Journal of Medical Microbiology 298 (2008) 579–590

analysis of the currently known genomes of Coxiella burnetii, Chlamydia pneumoniae, Ehrlichia chaffeensis, Mycoplasma pneumoniae, Rickettsia spp., Treponema pallidum, Bordetella pertussis, and Borrelia spp. (which are all cross-reactive with B. henselae IFA) revealed that these bacteria do not harbour genes encoding for TAAs (Szczesny, P., Linke, D., Lupas, A.; unpublished). Therefore, BadA would represent an excellent serological discrimination target for B. henselae infections, as potential cross-reactivities on the base of TAAs with the above-listed pathogens are unlikely. Of the known cross reactive pathogens, only B. quintana harbours BadAhomologous TAAs (variably expressed outer-membrane proteins; Vomps) (Zhang et al., 2004; Linke et al., 2006) which could be responsible for cross-reactivity of B. quintana Abs with B. henselae in IFA (LaScola and Raoult, 1996). Notably, the homology of the Vomps with BadA is much higher when compared to that of YadA with BadA (Linke et al., 2006). Whether sera reacting with BadA of B. henselae might also react with Vomps of B. quintana needs to be clarified. The molecular reason for the appearance of a multiple band pattern in BadA immunoblots is not clear. ‘High molecular weight ladders’ of BadA were detectable in immunoblots of patient sera or of sera from rabbits immunised either with a purified fragment of BadA or with viable B. henselae (Riess et al., 2004). Remarkably, Gilmore Jr. et al. (2005) found similar ‘ladders’ in immunoblots of whole-cell lysates from B. henselae and B. vinsonii when using an antiserum raised against Bartonella repeat protein A (BrpA), a further TAA homologous to BadA. It was suggested that these bands might be ‘polymeric, cleaved, or semi-degraded forms of the proteins and/or several epitope-containing repeated regions’ of BrpA (Gilmore Jr. et al., 2005). Moreover, it can be assumed that the high molecular weight bands in sera of IFA-positive patients observed by Litwin et al. (1997) might also represent Abs reactive with BadA fragments. It can be suggested that this ladder (regularly observed in BadA immunoblots) is represented by degraded BadA fragments or is the result of recombination events within the badA gene culminating in BadA proteins of different length (Riess et al., 2007). Nevertheless, the appearance of this typical high molecular weight ‘BadA ladder’ is a reliable and easy-to-detect serological marker in 4–15% SDS-PAGE (Fig. 6). Remarkably, evaluation of Bartonella serology was often performed using B. henselae not tested for BadA expression, and this information is not given in the application sheets of the commercially available B. henselae IFAs. As demonstrated recently, several B. henselae (sub-)strains do not express BadA (Riess et al., 2007). We therefore strongly emphasize that BadA expression in the antigen preparations should be evaluated when interpreting serological results obtained with B. henselae antigen (CDC, 1999).

It remains unclear why recombinantly expressed BadA domains (head, connector, stalk fragment) are unsuitable for performing immunoblot serodiagnosis of B. henselae infections. One possible explanation may be that the heterologously expressed fragments do not represent the particular, specific, immunodominant epitopes of BadA. Another possibility might be that BadA is modified post-transcriptionally in B. henselae. This is not too unlikely as it has been shown that the proper glycosylation of outer-membrane proteins (e.g. Ag43 of E. coli) is essential for its biological function (Sherlock et al., 2006). Such glycosylation might account for the specific reactivity of anti-BadA Abs. However, there is unfortunately no current knowledge about the glycosylation of B. henselae-expressed proteins. Moreover, BadA fragments were re-folded from inclusion bodies (see Materials and methods). Therefore, these fragments were not surface-expressed and might not be modified when expressed in E. coli. Our pilot study suggesting a two-step B. henselae serology combining IFA (first step) and BadA immunoblotting (second step) might represent an improvement of the serodiagnosis of B. henselae infections since the introduction of IFA. From our data, IFA testing is clearly recommended for patients suspected of having an acute B. henselae infection. When IFA-negative results (o1:100) are found, no subsequent Western blot analysis might be necessary as the serological data provide no evidence of a B. henselae infection. If the IFA test is positive (X1:200), BadA immunoblotting should be performed. If anti-BadA IgG Abs are detectable, the IFA result is suggested to be rated ‘confirmed’, and the serodiagnosis could corroborate a clinically suspected B. henselae infection. If anti-BadA IgG Abs are absent in immunoblotting but the IFA result is positive, we suggest this constellation to be rated as an ‘unclear result’; a second serological examination after, e.g., 3–4 weeks might be recommended in accordance with the recommendations given by the CDC for IFA (CDC, 1999). Sera with IFA titres of 1:100 to 1:200 were not included in our study because of the unclear relevance of these findings. According to the CDC recommendations, we suggest a repeat serodiagnosis after 3–4 weeks (CDC, 1999). Whether BadA is a reasonable seromarker for such thresholdtitre sera, remains to be investigated. Preliminary, it must be stated here that patients suffering from a chronic B. henselae infection will not be detected by IFA (false-negative) although BadA antibodies were detectable via immunoblotting in 38% (see above). This observation might suggest that BadA immunoblotting of patients clinically suspicious for a chronic B. henselae infection should be performed despite of negative IFA results. In summary, our data provide the first pilot study towards a more defined two-step algorithm for an IFA

ARTICLE IN PRESS C.L. Wagner et al. / International Journal of Medical Microbiology 298 (2008) 579–590

and immunoblotting serodiagnosis of B. henselae infections. Clearly, further work is needed to improve the serodiagnosis of B. henselae infections (e.g. by including further defined immunodominant B. henselae antigens) and, moreover, to understand the immune response in chronic Bartonella infections.

Acknowledgements We thank Ingo B. Autenrieth (Tu¨bingen, Germany) and Volker Fingerle (Munich, Germany) for discussion, Anna Sander (Freiburg, Germany) for providing several patient sera, and Diana Neumann for excellent technical assistance. This work was supported by grants from the Deutsche Forschungsgemeinschaft (DFG) and from the University of Tu¨bingen (Center for Interdisciplinary Clinical Research, junior group program) to V.K.

References Anderson, B.E., Neuman, M.A., 1997. Bartonella spp. as emerging human pathogens. Clin. Microbiol. Rev. 10, 203–219. Bolin, I., Norlander, L., Wolf-Watz, H., 1982. Temperatureinducible outer membrane protein of Yersinia pseudotuberculosis and Yersinia enterocolitica is associated with the virulence plasmid. Infect. Immun. 37, 506–512. Breitschwerdt, E.B., Maggi, R.G., Duncan, A.W., Nicholson, W.L., Hegarty, B.C., Woods, C.W., 2007. Bartonella species in blood of immunocompetent persons with animal and arthropod contact. Emerg. Infect. Dis. 13, 938–941. Campbell, E., Dennis, D.T., 2001. Plague and other Yersinia infections. In: Braunwald, E., Fauci, A.S., Kasper, D.L., Hauser, S.L., Longo, D.L., Jameson, J.L. (Eds.), Harrison’s Principles of Internal Medicine. McGraw-Hill, New York, NY, pp. 993–1001. Carithers, H.A., 1985. Cat-scratch disease. An overview based on a study of 1,200 patients. Am. J. Dis. Child 139, 1124–1133. Centers of Disease Control and Prevention (CDC), 1995. Recommendations for test performance and interpretation from the Second National Conference on Serologic Diagnosis of Lyme Disease. MMWR Morb. Mortal. Wkly. Rep. 44, 590–591. Centers of Disease Control and Prevention (CDC), 1999. Serodiagnosis of Emerging Infectious Diseases: Bartonella and Ehrlichia Infections (course manual). Cover, T.L., Aber, R.C., 1989. Yersinia enterocolitica. N. Engl. J. Med. 321, 16–24. Cunningham, E.T., Koehler, J.E., 2000. Ocular bartonellosis. Am. J. Ophthalmol. 130, 340–349. Dauga, C., Miras, I., Grimont, P.A., 1996. Identification of Bartonella henselae and B. quintana 16s rDNA sequences by branch-, genus- and species-specific amplification. J. Med. Microbiol. 45, 192–199. Dehio, C., 2005. Bartonella–host-cell interactions and vascular tumour formation. Nat. Rev. Microbiol. 3, 621–631.

589

Drancourt, M., Birtles, R., Chaumentin, G., Vandenesch, F., Etienne, J., Raoult, D., 1996. New serotype of Bartonella henselae in endocarditis and cat-scratch disease. Lancet 347, 441–443. Giladi, M., Maman, E., Paran, D., Bickels, J., Comaneshter, D., Avidor, B., Varon-Graidy, M., Ephros, M., Wientroub, S., 2005. Cat-scratch disease-associated arthropathy. Arthritis Rheum. 52, 3611–3617. Gilmore Jr., R.D., Bellville, T.M., Sviat, S.L., Frace, M., 2005. The Bartonella vinsonii subsp. arupensis immunodominant surface antigen BrpA gene, encoding a 382-kilodalton protein composed of repetitive sequences, is a member of a multigene family conserved among Bartonella species. Infect. Immun. 73, 3128–3136. Glaser, C.A., Gilliam, S., Schnurr, D., Forghani, B., Honarmand, S., Khetsuriani, N., Fischer, M., Cossen, C.K., Anderson, L.J., 2003. In search of encephalitis etiologies: diagnostic challenges in the California Encephalitis Project, 1998–2000. Clin. Infect. Dis. 36, 731–742. Hogrefe, W.R., Cullmann, L.C., 1996. Specificity and sensitivity of Vero cell substrate slides versus blood agar substrate slides for cat scratch disease serologies. Presented at the 96th ASM General Meeting, New Orleans, LA, May 10–23. Hoiczyk, E., Roggenkamp, A., Reichenbecher, M., Lupas, A., Heesemann, J., 2000. Structure and sequence analysis of Yersinia YadA and Moraxella UspAs reveal a novel class of adhesins. EMBO J. 19, 5989–5999. Jackson, L.A., Perkins, B.A., Wenger, J.D., 1993. Cat scratch disease in the United States: an analysis of three national databases. Am. J. Public Health 83, 1707–1711. Kempf, V.A., Petzold, H., Autenrieth, I.B., 2001. Cat scratch disease due to Bartonella henselae infection mimicking parotid malignancy. Eur. J. Clin. Microbiol. Infect. Dis. 20, 732–733. LaScola, B., Raoult, D., 1996. Serological cross-reactions between Bartonella quintana, Bartonella henselae, and Coxiella burnetii. J. Clin. Microbiol. 34, 2270–2274. Linke, D., Riess, T., Autenrieth, I.B., Lupas, A., Kempf, V.A., 2006. Trimeric autotransporter adhesins: variable structure, common function. Trends Microbiol. 14, 264–270. Litwin, C.M., Martins, T.B., Hill, H.R., 1997. Immunologic response to Bartonella henselae as determined by enzyme immunoassay and Western blot analysis. Am. J. Clin. Pathol. 108, 202–209. Margileth, A.M., 1993. Cat scratch disease. Adv. Pediatr. Infect. Dis. 8, 1–21. Maurin, M., Eb, F., Etienne, J., Raoult, D., 1997. Serological cross-reactions between Bartonella and Chlamydia species: implications for diagnosis. J. Clin. Microbiol. 35, 2283–2287. McGill, S.L., Regnery, R.L., Karem, K.L., 1998. Characterization of human immunoglobulin (Ig) isotype and IgG subclass response to Bartonella henselae infection. Infect. Immun. 66, 5915–5920. McGill, S.l., Friman, G., Wesslen, L., Hjelm, E., 2004. Broad spectrum analysis of bartonella intra- and inter-genus cross reactivity by immunoblot and immunofluorescence assay. Presented at the Fourth International Conference on Bartonella as Emerging Pathogens, Uppsala, Sweden.

ARTICLE IN PRESS 590

C.L. Wagner et al. / International Journal of Medical Microbiology 298 (2008) 579–590

Raasveld, M.H., Weel, J.F., Braat, M.C., Bakker, P.J., 1997. Cat-scratch disease mimicking pancreatic malignancy: case report. Clin. Infect. Dis. 24, 77–78. Regnery, R.L., Olson, J.G., Perkins, B.A., Bibb, W., 1992. Serological response to ‘‘Rochalimaea henselae’’ antigen in suspected cat-scratch disease. Lancet 339, 1443–1445. Ridder, G.J., Boedeker, C.C., Technau-Ihling, K., Sander, A., 2005. Cat-scratch disease: otolaryngologic manifestations and management. Otolaryngol. Head Neck Surg. 132, 353–358. Riess, T., Andersson, S.G., Lupas, A., Schaller, M., Scha¨fer, A., Kyme, P., Martin, J., Walzlein, J.H., Ehehalt, U., Lindroos, H., Schirle, M., Nordheim, A., Autenrieth, I.B., Kempf, V.A., 2004. Bartonella adhesin A mediates a proangiogenic host cell response. J. Exp. Med. 200, 1267–1278. Riess, T., Raddatz, G., Linke, D., Scha¨fer, A., Kempf, V.A., 2007. Analysis of Bartonella adhesin A expression reveals differences between various B. henselae strains. Infect. Immun. 75, 35–43. Sarret, C., Barbier, C., Faucher, R., Lacombe, P., Meyer, M., Labbe, A., 2005. Erythema nodosum and adenopathy in a 15-year-old boy: uncommon signs of cat scratch disease. Arch. Pediatr. 12, 295–297. Schmid, M.C., Scheidegger, F., Dehio, M., Balmelle-Devaux, N., Schu¨lein, R., Guye, P., Chennakesava, C.S., Bieder-

mann, B., Dehio, C., 2006. A translocated bacterial protein protects vascular endothelial cells from apoptosis. PLoS Pathog. 2, e115. Sherlock, O., Dobrindt, U., Jensen, J.B., Munk, V.R., Klemm, P., 2006. Glycosylation of the self-recognizing Escherichia coli Ag43 autotransporter protein. J. Bacteriol. 188, 1798–1807. Wollmann, P., Zeth, K., Lupas, A.N., Linke, D., 2006. Purification of the YadA membrane anchor for secondary structure analysis and crystallization. Int. J. Biol. Macromol. 39, 3–9. Zangwill, K.M., Hamilton, D.H., Perkins, B.A., Regnery, R.L., Plikaytis, B.D., Hadler, J.L., Cartter, M.L., Wenger, J.D., 1993. Cat scratch disease in Connecticut. Epidemiology, risk factors, and evaluation of a new diagnostic test. N. Engl. J. Med. 329, 8–13. Zhang, P., Chomel, B.B., Schau, M.K., Goo, J.S., Droz, S., Kelminson, K.L., George, S.S., Lerche, N.W., Koehler, J.E., 2004. A family of variably expressed outer-membrane proteins (Vomp) mediates adhesion and autoaggregation in Bartonella quintana. Proc. Natl. Acad. Sci. USA 101, 13630–13635. Zimmermann, R., Kempf, V.A., Schiltz, E., Oberle, K., Sander, A., 2003. Hemin binding, functional expression, and complementation analysis of Pap 31 from Bartonella henselae. J. Bacteriol. 185, 1739–1744.