Use of ribosomal promoters from Burkholderia cenocepacia and Burkholderia cepacia for improved expression of transporter protein in Escherichia coli

Protein Expression and PuriWcation 49 (2006) 219–227 www.elsevier.com/locate/yprep

Use of ribosomal promoters from Burkholderia cenocepacia and Burkholderia cepacia for improved expression of transporter protein in Escherichia coli Manda Yu, Jimmy S.H. Tsang ¤ Molecular Microbiology Laboratory, Department of Botany, The University of Hong Kong, Pokfulam Road, Hong Kong SAR, China Received 18 February 2006, and in revised form 8 April 2006 Available online 25 April 2006

Abstract Expression of heterologous protein in Escherichia coli usually based on the IPTG-inducible expression systems. The use of these systems for membrane protein production, however, usually caused cytotoxic problem that aVected the yield and functional characterization of the protein. Optimization of these systems for transporter protein production is time-consuming and is usually ineVective. Here, we described the use of the ribosomal promoters Ps12 from Burkholderia cenocepacia LMG16656 and from Burkholderia cepacia MBA4 for eYcient expression of functional transporter protein in E. coli. These promoters were used to drive the expression of a transmembrane protein, Deh4p, which help transport monohaloacetates into B. cepacia MBA4 for metabolism. Production of Deh4p in E. coli using an IPTG-inducible promoter resulted in no expression in uninduced condition and cell lysis in the presence of IPTG. Moreover, it has been reported that IPTG increased the endogenous production of other permeases such as LacZ and MelB. Cells expressing Deh4p from a Ps12 promoter grew normally in rich medium and which did not increase the expression of other permease. Uptake of 14C-monochloroacetic acid has conWrmed the production of the transporter protein in these cells. The results showed that the constitutive ribosomal protein promoters from the Burkholderia sp. could be used for eVective expression of transporter protein in E. coli without causing any detrimental and unnecessary eVect. © 2006 Elsevier Inc. All rights reserved. Keywords: Burkholderia spp.; Transporter protein; Haloacetate permease; Monochloroacetate; Ribosomal promoter

One of the most commonly used heterologous expression system is the use of the T7 promoter in Escherichia coli strain BL21(DE3). The T7 promoter is a strong bacteriophage promoter and the E. coli BL21(DE3) is a lambda lysogen producing the T7 RNA polymerase under the control of the IPTG-inducible lacUV5 promoter. This allows the T7 promoter-based vectors to be used for eYcient protein expression [1]. However, if the heterologous gene product is potentially toxic then the leaky expression would aVect the physiology of the cell and expression of the gene of interest will not be possible [2]. ModiWcations, such as incubation at lower temperature, provision of less IPTG,

*

Corresponding author. Fax: +852 2858 3477. E-mail address: [email protected] (J.S.H. Tsang).

1046-5928/$ - see front matter © 2006 Elsevier Inc. All rights reserved. doi:10.1016/j.pep.2006.04.004

could be used to minimize the toxicity eVect. An alternative is the use of tolerant host strains such as C41(DE3) and C43(DE3) [3]. These adjustments, however, are not eVective and are also limited to certain kinds of membrane protein and globular protein. The application of the T7 promoter-based expression system is also limited. As the T7 RNA polymerase is required for expression not all E. coli strains could be used. It is not applicable for alpha complementation used in bluewhite selection [4] nor is it suitable for membrane topology study [5] where the lacZM15 genotype is required. The interim solution would be co-transformation of another plasmid producing the T7 RNA polymerase using the lacUV5 promoter but this would result in plasmid incompatibility problem. In addition to the –galactosidase and lactose permease genes of the lac operon, IPTG is also

220

M. Yu, J.S.H. Tsang / Protein Expression and PuriWcation 49 (2006) 219–227

capable of inducing other operons such as the melibiose (mel)1 operon. This operon encodes for an –galactosidase and a thiomethylgalactoside permease II [6]. In general, permeases or sugar transporters also facilitated the transport of some other non-speciWc substrates with much lower aYnities. The net transport by these incidentally induced transporters would aVect the accuracy of the uptake assay for the characterization of the transporter protein. Other chemical-inducible promoters are likely to have similar behavior, which creates extra concern in experimental design. In functional protein study, production and puriWcation of large amount of protein is not necessary. A moderatestrength promoter is suYcient for heterologous expression and those that caused less interference to cellular metabolism would be preferred than those strong inducible promoters that would aVected the growth of the host. Previous study on the ribosomal protein S7 gene of Burkholderia cepacia LB400 has shown that the constitutive s7 promoter exhibited diVerent levels of expression in genotypically related species. Using enhanced green Xuorescent protein as the reporter and the expression level in E. coli as the standard the expression eYciency of the s7 promoter has been determined to ranges from 5 to 25 in diVerent Burkholderia spp. [7]. During our study on a strain of B. cepacia that utilized halogenated acetic acids as the growth substrate [8] we have identiWed a putative transporter protein gene (deh4p) that is co-expressed with the enzyme dehalogenase which is responsible for the hydrolytic degradation of the haloacids. Deh4p has been shown to exhibit domains characteristics of the sugar-transporter proteins and is likely to form a transmembrane protein. Cloning and expression of this gene in E. coli using an IPTG-inducible promoter has resulted in lysis of the cells [9]. In this paper, we describe the use of the s12 ribosomal promoters of B. cenocepacia and B. cepacia for expression of this transporter protein in E. coli. The constitutively weak expression of the transporter protein allowed us to characterize the protein functionally without aVecting the physiology of the cell and without the induction of other related permease that may interfered the interpretation of the result.

(50 g/ml) or trimethoprim (100 g/ml) was supplemented as appropriate. Oligonucleotides and polymerase chain reaction (PCR) condition The sequences of the oligonucleotides used were as follows: primer S7pF (5⬘-GCGCA AGCTC GAGCG CTTCG GCGAC GAGAT-3⬘) was used in combination with primer S7cpR (5⬘-GGTAC CCTTG CCGGA CAGCA TCAGC ATGTT CAT-3⬘) to amplify the ribosomal promoter region of B. cenocepacia LMG16656 (Ps12c), and with primer S12pR (5⬘-GGTAC CCGGC TTCTT CGGCG TCGTC GTGTA CAC-3⬘) to amplify the promoter region from B. cepacia MBA4 (Ps12). Primers Deh4p-F (5⬘-AAAGG TACCA TGGCG ACTAT TGAAG GACGT GC-3⬘) and Deh4p-R (5⬘-AAAGA ATTCT TAGTC CGCGT CATAG GTAGA AGAAC C3⬘) were used to amplify the deh4p gene from MBA4. Primers EGFP-F (5⬘-GGTAC CATGG TGAGC AAGGG CGAGG AG-3⬘) and EGFP-R (5⬘-GGAAT TCTAG AGTCG CGGCC GCTTT-3⬘) were used to amplify egfp as control gene. Primer S12ET-F (5⬘-CACCC GCTTCG GCGAC GAGAT CAT-3⬘) was used in combination with primers S12NS-R (5⬘-ATTGG TACCC GGCTT CTTCG GC-3⬘) and 4pNS-R (5⬘-ACTAG TGTCC GCGTC ATAGG TAGAA GAACC CTT-3⬘) to amplify DNA fragments from p28tS12-4p for construction of polyhistidine-codon-carrying plasmids pES12 and pES12-4p, respectively. The ampliWcations were carried out using a PTC-200 Peltier Thermal Cycler (MJ Research). All reactions were performed with the high Wdelity thermostable Pfu DNA polymerase (Promega). The PCR conditions were as follows: denaturation at 94 °C for 30 s; annealing at 56 °C for 20 s, and extension at 72 °C for 1–2 min for 35 cycles. Taq DNA polymerase (Promega) (0.5 U) was then introduced and the reactions incubated at 72 °C for 10 min to append an A for cloning. The PCR products were separated on 1.2% (wt/vol) agarose gels and puriWed by gel extraction kit (Viogene) and subcloned into plasmid pGEM-T Easy (Promega). Expression vector construction

Materials and methods Growth conditions and genomic DNA extraction Bacteria B. cenocepacia LMG16656 and B. cepacia MBA4 were cultured in 10 ml Luria–Bertani (LB) medium without NaCl (1% tryptone and 0.5% yeast extract) at 30 °C for 16 h. Genomic DNA was extracted by phenol– chloroform method [10]. E. coli cells were grown in LB at 30 °C or 37 °C with or without antibiotics. Ampicillin 1 Abbreviations used: mel, melibiose; LB, Luria–Bertani; PCR, polymerase chain reaction; HAA, monohaloacetic acid; MCA, monochloroacetic acid.

The Ps12c and Ps12 promoter fragments were placed into a broad-host-range vector pUCP28T [11] which can replicate in E. coli, Pseudomonads, and Burkholderia spp. The plasmid carries a dhfRII gene which confers trimethoprim resistance to the host. Restriction sites HindIII and KpnI have been engineered to Xank the promoter fragments for cloning into pUCP28T. Expression vector p28tS12c (containing the Ps12c promoter from LMG16656) and p28tS12 (containing the Ps12 promoter from MBA4) were constructed. These plasmids allow the insertion of gene of interest into the unique KpnI, SacI or EcoRI site. In this study, the transporter protein gene deh4p or a control gene egfp was inserted into the KpnI/EcoRI sites of the vector p28tS12c to

M. Yu, J.S.H. Tsang / Protein Expression and PuriWcation 49 (2006) 219–227

form p28tS12c-E and p28tS7c-4p, respectively, and to vector p28tS12 to form p28tS12-E and p28tS12-4p, respectively. DNA fragment containing Ps12 or Ps12-deh4p was also ampliWed from p28tS12-4p and cloned into polyhistidine-codon-containing plasmid pET101/D-TOPO (Invitrogen) by means of Topoisomerase activity to form pES12 and pES12-4p, respectively. The deh4p gene was also inserted into plasmid pPROEX-HT (Invitrogen) to form pPROEX-4p for expression under an IPTG-inducible promoter. Western blot analysis Escherichia coli TOP10 transformed with plasmid pES12 or pES12-4p were grown in LB with ampicillin (100 g/ml) at 37 °C until an OD600 of 0.7. The cells were harvested by centrifugation and washed twice with phosphate-buVer saline (PBS, tablet premix, Fluka). Protein concentration was determined by lysing the cells in lysis buVer (8 M urea, 4% CHAPS) and incubated at 100 °C for 5 min and the protein amount determined by Bio-Rad protein assay reagent. An equivalent of 5 g protein was mixed with sample buVer (90 mM Tris–Cl, pH 6.8, 20% glycerol, 2% SDS, 0.02% bromophenol blue, and 0.1 M DTT), boiled for 5 min, separated on 12% SDS–PAGE and electro transferred onto nitrocellulose membrane (Hybond-C, Amersham). Prestained MW marker (MultiMark, Invitrogen) was used to estimate the size of the proteins. The membrane was blocked with 5% skim milk in PBS for overnight and incubated in anti-6 £ His HRP-conjugated monoclonal antibody (Clontech) at a dilution of 1:5000 for 30 min at room temperature. The membrane was then washed three times with PBS containing 0.1% Tween 20. ECL Western blotting detection reagents (Amersham Pharmacia) were used to detect the signals with a HyperWlm (Amersham). Growth curve analysis Colonies on agar plate were inoculated into 5 ml culture medium with appropriate antibiotic and incubated at 30 °C (for pPROEX-HT based plasmids) or 37 °C (for pUCP28T based plasmids) until the cell density reached an OD600 of 1.0–1.2. The cultures were then adjusted to an OD600 of 0.5 with LB medium and subcultured into 25 ml fresh medium with antibiotic at a ratio of 1/100 with constant shaking at 250 rpm. The cell density (OD600) was then recorded hourly. Each sample was duplicated and two separate experiments were conducted. Cells carrying the pPROEX-HT-based plasmid were grown to an OD600 of 0.2 at 30 °C before isopropyl -D-thiogalactoside (IPTG, Sigma–Aldrich) was added to a Wnal concentration of 0.5 mM and the cell density recorded. Monochloroacetic acid (MCA) uptake assay Cells were cultured in LB medium with trimethoprim (100 g/ml) at 37 °C for 16 h. The cells were harvested by

221

centrifugation at 5000g for 5 min and resuspended in PBS. The cells were then washed twice with PBS and the Wnal OD600 was adjusted to 0.5. Washed cells (400 l) were mixed with 1 mM carbon-14-labeled monochloroacetic acid (MCA, second carbon labeled, Sigma–Aldrich) in PBS (100 l). Immediately the mixture was Wltered through a pre-wetted nitrocellulose membrane Wlter disc (pore-size 0.45 m, Millipore) and washed with 2 ml PBS. The membrane with the Wltered cells was placed into a scintillation vial and 2 ml of scintillation Xuid (Ready-Solv EP, Beckman) was added. The radioactive-MCA trapped in the cells was determined by a scintillation counter (Beckman LS6500 multi-purpose scintillation counter). The total protein was determined by the Bio-Rad Protein Assay. Results and discussion Expression of a putative transporter protein from B. cepacia MBA4 in E. coli using an IPTG induced system Burkholderia cepacia MBA4 is a bacterium selected from the natural environment on its ability to utilize monohaloacetic acid (HAA) [8]. A gene encoding for an enzyme responsible for the hydrolytic degradation of the HAA has been isolated in a 1.6 kb EcoRI fragment [12]. Downstream of this gene is a putative haloacid permease gene deh4p (GenBank Accession No. AF439266). The coding sequence for Deh4p was ampliWed from B. cepacia MBA4 and cloned into pPRO-EX-HT (Invitrogen) and transformed into E. coli BL21 CodonPlus (DE3)-RIL strain. This strain was initially used because it can compensate the rare E. coli arginine, isoleucine, and leucine codons used in B. cepacia. Deh4p is 552-residues long and have signatures of sugartransporter protein [Tsang and Yu, unpublished]. The production of Deh4p was under the control of a trc promoter which is induced by IPTG [13]. Growth of this strain in LB medium exhibited phenotypes such as small colony size and long lag phase. When IPTG was introduced, the cells stop growing and lysed eventually. Transformation of the deh4pcarrying plasmid into BL21, TOP10 or JM109 resulted in similar observation. Fig. 1 shows a typical growth response of E. coli cells carrying the deh4p in rich medium (LB). Fig. 1a shows that cells harboring the deh4p-carrying plasmid (pPROEX-deh4p) could grow up to an OD600 of ca. 1.5 but with an extended lag phase and lower growth rate when compared to cells harboring the vector only. This suggested that even in the absence of induced expression the basal expression of the transporter protein already caused certain physiological constraint to the cell. When IPTG was introduced into the medium (Fig. 1b) the cells producing the transporter protein failed to grow and eventually lysed at longer incubation (data not shown). This suggested that production of Deh4p aVected the integrity and physiology of the E. coli cells. It has been reported that expression of many membrane or transporter proteins will kill the cell [14–16]. Expression and functional analysis of this putative permease using a tac based promoter is thus not feasible.

222

M. Yu, J.S.H. Tsang / Protein Expression and PuriWcation 49 (2006) 219–227

Fig. 1. Growth curves of E. coli JM109 carrying various plasmid. Cells carrying pPRO-EX-HT (triangle) or derivative containing deh4p (circle) were grown in LB (a) or LB with IPTG (b). For media with IPTG the cultures were grown to an OD600 of ca. 0.2 before IPTG was added to a Wnal concentration of 0.5 mM.

This suggested that other types of proteins were induced and which may transport MCA inadvertently. This involuntary uptake will aVect the Wnal reading of the assay and the determination of the speciWc activity of the protein under consideration. The use of IPTG-inducible promoter for heterologous expression of transporter protein was thus not acceptable. Structure of the ribosomal gene promoter in Burkholderia spp

Fig. 2. Uptake of monochloroacetic acid (MCA) into E. coli. E. coli TOP10 cells were grown in half strength LB with 1% glucose to an OD600 of 0.2. Cells were harvested and used immediately (1% glucose) or washed with one-quarter strength LB and resuspended in the same medium with 1 mM IPTG. Resuspended cultures were incubated at 37 °C for 1 hour (1hr) or 2 hours (2hr) before the MCA uptake rate was determined. The average uptake rates are shown at the top of the histograms.

Another potential problem in using the IPTG-inducible system is that some undesirable proteins may be co-induced by IPTG. The production of permeases located in the lac and mel operons have been shown to be enhanced in the presence of IPTG [6]. These transporter proteins increased the permeability of the cell and enhanced the transport of some non-speciWc substrates [17,18]. Fig. 2 shows that induction of wild-type E. coli with IPTG increased the uptake of 14C-monochloroacetic acid (MCA) into the cell.

The retardation of growth in cells expressing Deh4p in the presence or absence of IPTG was probably caused by production of excessive amount of the transporter protein [19]. To use a moderate-strength promoter for expression of transporter protein that will not cause any detrimental eVect to the cell it is crucial to look for other promoters. Previous study has shown that an 850-bp genomic fragment of the ribosomal protein gene of Burkholderia sp. LB400 was able to function as a strong constitutive promoter in various strains of the B. cepacia complex. This putative promotercontaining fragment works weakly in E. coli and contains 277 bp upstream noncoding sequence of the S12 ribosomal protein gene, the 345 bp s12 coding sequence and 227 bp downstream noncoding sequence [7]. Comparative analysis of the genomes of the Burkholderia spp. has shown that they have a common gene structure in this region (data not shown). Upstream of the ribosomal operon is a DNA helicase gene followed by the ribosomal S12 gene and then the S7 gene (Fig. 3). It was postulated that the intragenic region between the s12 and the s7 genes of the Burkholderia sp.

Fig. 3. Genetic organization of the s7 and s12 ribosomal protein genes in the Burkholderia spp. In the Burkholderia species, the ribosomal protein genes for S12 and S7 were found downstream of a DNA helicase gene.

Strain

B. ambifaria AMMD B. cenocepacia AU1054 B. cenocepacia HI2424 B. cepacia 383 B. mallei ATCC 23344 B. pseudomallei K96243 B. thailandensis E264

Neural Network Promoter Prediction

Score

(55) agccgttgacttagttggtatttccggaatatgatgttgggttccggtat (54) agccgttgacttagttggtatttccggaatatcatgctgggttccggtat (54) agccgttgacttagttggtatttccggaatatcatgctgggttccggtat (54) agccgttgacttagttggtatttccggaatatgatgctgggttccggtat (43) caagctgttgactcgcttgggattttcggaatatcatgccgggttccggt (43) agctgttgactcgcttgggattttcggaatatcatgccgggttccggttc (43) caagctgttgactcacttgggattttcggaatatcatgccgggttccggt (424) cggccgtgtgaaggacttgccgggtgtgcgttatcacatggttcgcggct (89) accgtcgacgtaaaccggccgcgcgcccggtaaatcacgcaagccgttga (49) acctgttgactcccttagtaatttcggaatattatgctaggttccggttc (598) aataagctggcaaccaattagccggtcagtagtttcaggtcgcctgcaaa

0.94 0.96 0.96 0.95 0.97 0.97 0.97 0.81 0.93 0.97 0.88

pMLS7 (PS7)

(49) acctgttgactcccttagtaatttcggaatattatgctaggttccggttc (598) aataagctggcaaccaattagccggtcagtagtttcaggtcgcctgcaaa

0.97 0.88

B. cenocepacia LMG16656 (Ps12c) B. cepacia MBA4 (Ps12)

(54) agccgttgacttagttggcatttccggaatatcatgctgggttccggtat (55) agccgttgacttagttggcatttccggaatatgatgctgggttccggtat

0.94 0.93

B.vietnamiensis G4 B. xenovorans LB400

BPROM prediction

Sourcea

¡35 box

¡10 box

(60) TTGACT (59) TTGACT (59) TTGACT (59) TTGACT (48) TTGACT (48) TTGACT (48) TTGACT

(81) GAATATGAT (80) GAATATCAT (80) GAATATCAT (80) GAATATCAT (69) GAATATCAT (69) GAATATCAT (69) GAATATCAT

JGI (ctg11) JGI (ctg223) JGI (ctg375) JGI (ctg233) NCBI (Accession No. CP000010) NCBI (Accession No. BX571965) NCBI (Accession No. CP000086)

(135) TTGACT (54) TTGACT (412) TTTCTT (737) TTAGTT (54) TTGACT (412) TTTCTT (737) TTAGTT (59) TTGACT (60) TTGACT

(156) GAATATGAT (78) TATTATGCT (432) GGCCACAAT (754) GGCTAAAAG (78) TATTATGCT (432) GGCCACAAT (754) GGCTAAAAG (80) GAATATCAT (81) GAATATGAT

JGI (2004Nov4_fasta.Cont99) JGI (ctg482)

NCBI (Accession No. AY112734)

This study (GenBank Accession No. DQ359148) This study (GenBank Accession No. DQ359147)

Underlined sequences indicated an overlap with the s12 ORF. a JGI stands for the Joint Genome Institute (http://genome.jgi-psf.org/mic_home.html), NCBI stands for National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov/).

M. Yu, J.S.H. Tsang / Protein Expression and PuriWcation 49 (2006) 219–227

Table 1 Prediction of promoter sequence in various Burkholderia spp

223

224

M. Yu, J.S.H. Tsang / Protein Expression and PuriWcation 49 (2006) 219–227

LB400 provided a promoter function and thus the 850 bpfragment was indicated as s7 promoter-containing (GenBank Accession No. AY112734). This 850 bp-fragment was able to provide constitutive expression in both Burkholderia spp. and E. coli; however, it is questionable on the necessity to include the structural gene for S12. To utilize a promoter sequence for weak expression in E. coli we strived to compare the sequences of the ribosomal promoter regions in various Burkholderia spp. PCR primers S7pF/S7cpR were used to amplify the region after the termination codon of the DNA helicase gene to the beginning of the s7 gene of B. cenocepacia LMG16656 (GenBank Accession No. DQ359148). Sequences of similar regions from B. ambifaria AMMD, B. cenocepacia AU1054 and HI2424, B. cepacia 383, B. mallei ATCC 23344, B. pseudomallei K96242, B. thailandenesis E264, B. vietnamiensis G4, and B. xenovorans LB400 were obtained from the databases in Joint Genome Institute (http://genome.jgi-psf.org/mic_home.html) and from the National Center for Biotechnology Information (http:// www.ncbi.nlm.nih.gov/). These sequences were then predicted for promoter activity by Softberry’s BPROM (http:// www.softberry.com/) and the Neural Network Promoter Prediction (NNPP) program [20] (http://www.fruitXy.org/ seq_tools/promoter.html). Table 1 shows the results of the analyses. The NNPP program predicted that all species tested possess a conserved promoter region at position 43–89 downstream of the helicase gene. B. thailandensis E264 and B. xenovorans LB400 were predicted to have a second site started at 424 and 598, respectively. These second sites, how-

ever, overlapped the structural gene for S12. Analysis of the same sequences with BPROM gave similar results that a putative ¡35 box having the sequence TTGACT were found 48–135 bp downstream of the helicase gene. Putative ¡10 box GAATAT(G/C)AT were also found in all species tested except B. xenovorans LB400 where the sequence is TATTATGCT. The second predicted site for B. thailandensis was not detected in this analysis. Moreover, the second predicted site for LB400 and pMLS7 which overlaps the structural gene of s12 was detected but was found at position 412 instead of 598. It is likely that this one is not a genuine promoter site. A unique third site was also predicted at position 737 of LB400 and pMLS7 and is located at the intergenic region between s12 and s7. The discrepancy in the prediction results reXected the limitation of the analysis software and indicated that the interpretation should be taken cautiously. The above predictions revealed that the S12 and the S7 ribosomal protein genes may be organized as an operon where the two ORFs were transcribed as a single mRNA driven by the s12 promoter. Similar gene organization were found in the str operon of E. coli [21], corynebacteria [22] and in many other species [23]. The analysis of the s12-s7 gene regions among the Burkholderia spp. showed that sequences upstream of the s12 gene may be suYcient for promoter activity. The region spanning the helicase gene and s7gene from B. cenocepacia LMG16656 (GenBank Accession No. DQ359148) was cloned into pUCP28T to form p28tS12c and the region spanning the helicase gene and the s12 gene of B. cepacia

Fig. 4. Genealogy of the constructs used in this study.

M. Yu, J.S.H. Tsang / Protein Expression and PuriWcation 49 (2006) 219–227

225

MBA4 (GenBank Accession No. DQ359147) was cloned into pUCP28T to form p28tS12 (Fig. 4). Expression of Deh4p with Ps12c and Ps12 promoters in E. coli To assay the functional property of the putative Ps12c and Ps12 promoters the deh4p gene [9] of B. cepacia MBA4 was cloned into p28tS12c and p28tS12 to form p28tS12c-4p and p28tS12-4p, respectively. The egfp gene [24] encoding a green Xuorescent protein was also cloned into similar vectors to form p28tS12c-E and p28tS12-E for comparative purpose (Fig. 4). These constructs were transformed to E. coli TOP10 and their growth determined in LB containing trimethoprim. Fig. 5 shows that cells expressing deh4p or egfp have similar growth pattern. Those expressing Deh4p from the Ps12c promoter grew even better than the others. Prolonged incubation of these cultures did not result in lysis of the cells. This suggested that the use of Ps12c and Ps12 promoters in the production of the transporter protein Deh4p has no detrimental eVect to the cell. To conWrm that the promoters were indeed functional and producing Deh4p, activity assay for Deh4p was carried out. Cells were grown in LB, washed and assayed for uptake of 14C-MCA. Fig. 6 shows that cells producing Deh4p from either p28tS12c-4p or p28tS12-4p showed higher uptake rate of MCA than cells producing eGFP (from p28tS12c-E or p28tS12-E). This revealed that Deh4p was produced and which facilitated the inXux of MCA into the cell. The uptake was more prominent at the beginning of the assay. Cells containing p28tS12-4p have the highest uptake rate (44.0 nmol/mg protein/min), followed by cells carrying p28tS12c-4p (34.1 nmol/mg protein/min). Cells producing eGFP from p28tS12c-E and p28tS12-E have rates of 15.1 and 13.9 nmol/mg protein/min, respectively. This showed that the Ps12 promoter (2.9-fold) has higher expression eYciency than the Ps12c promoter (2.5-fold).

Fig. 5. Growth of E. coli producing eGFP or Deh4p from a constitutive promoter. E. coli TOP10 containing p28tS12c-E (square), p28tS12-E (circle) p28tS12c-4p (open square), or p28tS12-4p (open circle) were grown at 37 °C in LB containing trimethoprim. The results are average of at least two independent experiments.

Fig. 6. Uptake of MCA in various E. coli strains. E. coli TOP10 containing p28tS12c-E (square), p28tS12-E (circle), p28tS12c-4p (open square) or p28tS12-4p (open circle) were grown at 37 °C in LB containing trimethoprim. The cells were harvested, washed, and resuspended in PBS and uptake of 14C-MCA was determined by a scintillation counter.

The better growth of cells containing the p28tS12c-4p plasmid cannot be explained. It is unlikely for the eGFP to form toxic aggregate that aVected the survival of the cell [25]. It is also unlikely for the Deh4p produced from Ps12 promoter to form toxic insoluble aggregate because the uptake assay showed that this strain has the best MCA uptake rate. It could be argued that a lower expression level of Deh4p from the Ps12c promoter provided the best environment for the uptake of nutrients into the cell and thus enhanced cell growth. On the other hand, the moderate expression level of Deh4p in p28tS12-4p carrying cells still aVected growth slightly. Further work is necessary to Wnd out the reason for this phenomenon. The expression eYciencies of Ps12c and Ps12 promoters are similar which suggested that the region upstream of the s12 gene was suYcient for eYcient expression in E. coli. Ps12c promoter has a slightly weaker eYciency which may due to the longer distance from the promoter. The inter-cistronic region between s12 and s7 is unlikely to be critical for expression. The function of the s12-s7 inter-cistronic region has been shown to be important for auto-regulation of the S7 protein synthesis although it was not regarded as a single promoter [26,27]. To conWrm that the Ps12 promoter sequence is suYcient for production of gene product in E. coli DNA fragment containing Ps12-deh4p was ampliWed from p28tS12-4p and cloned into pET101/D-TOPO (Invitrogen) to form pES124p. This construct produced a Deh4p tagged with six histidine residues at the carboxyl-terminus, and was driven by the Ps12 promoter. A T7 promoter, originally resided in the pET101/D-TOPO plasmid, was disrupted and was nonfunctional in E. coli strain TOP10. Western blot analysis (Fig. 7) using anti-histidine-tag antibody showed that a protein of about 60 kDa was found in cells carrying the pES12-4p plasmid (lane 5). The molecular size of this band is similar to the expected size (68.6 kDa) of recombinant

226

M. Yu, J.S.H. Tsang / Protein Expression and PuriWcation 49 (2006) 219–227

Fig. 7. Western blot analysis of E. coli cells. E. coli TOP10 containing pES12 (lanes 2 and 4) or pES12-4p (lanes 3 and 5) were grown at 37 °C in LB containing ampicillin. The cells were harvested, washed and an equivalent of 5 g protein was loaded and resolved in a 12% SDS–PAGE gel. The proteins were stained with Coomassie blue (lanes 1–3) and a replica was blotted onto nitrocellulose membrane and recombinant histidinetagged proteins were detected by monoclonal anti-His-tag antibody (lanes 4 and 5). The sizes of the MW markers are illustrated. The location of the recombinant Deh4p is indicated by an arrow.

Deh4p carrying six histidine residues. Such protein band was not detected in cells harboring pES12 (lane 4). This protein band was not readily identiWed in total protein (compare lanes 2 and 3) which revealed that the Ps12 was not a strong promoter in E. coli. Uptake of 14C-MCA in cells carrying pES12-4p has an uptake rate of 2-fold higher than cells carrying the vector pES12. Moreover, the uptake of 14C-MCA was also inhibited by unlabeled MCA and not by succinate (data not shown). This showed that the facilitated uptake of MCA was speciWc and was mediated by the Deh4p protein. The uptake rate is slightly lower than cells carrying p28tS12-4p which produced Deh4p from a

pUCP28T plasmid. This could be explained by the lower copy number of pET101/D-TOPO which is a pBR322 derivative. This also suggested that the expression level can be further optimized by using vectors having diVerent copy numbers. Although Ps12c and Ps12 promoters are moderate promoters that allow membrane protein expression and functional assay in E. coli, they are strong promoters in the Burkholderia species. B. cepacia MBA4 harboring plasmid p28tS12c-4p or p28tS12-4p showed very slow growth, small colony size, and long lag phase. This suggested that the production of additional transporter proteins from these promoters aVected the physiology of the cells. Therefore we do not recommend the use of the Ps12c or Ps12 promoter for expression of membrane or potential toxic protein in Burkholderia species. These promoters, however, could be an alternative choice to express large amount of non-toxic protein in Burkholderia SPP. Previous study showed that expression eYciency of ribosomal promoter varies among the Burkholderia species [7]. The introduction of the Ps12c and the Ps12 promoters increased the chance of Wnding an optimized promoter for protein expression in diVerent species or strains. We have compared the genomic region between the DNA helicase gene and the ribosomal S12 protein gene of various strains (Fig. 8). Although they are very similar, variations were still observed. The Ps12 promoter is most similar to that ofBurkholderia sp. 383 and the Ps12c clustered with that of B. cenocepacia HI2424 and AU105. Ps7 promoter identiWed in B. xenovorans LB400 is more related to B. thailandensis E264, B. pseudomallei K96243 and B. mallei ATCC 23344. The remaining B. vietnamiensis G4 and B. ambifaria AMMD are in between these two groups. This analysis showed that the Ps12c and Ps12 promoters may be a better choice to use in B. cepacia and B. cenocepacia, while for B.mallei, B. pseudomallei, and B. thailandensis the Ps7 promoter will be preferred.

Fig. 8. A phylogenetic tree comparing the genomic regions between the DNA helicase gene and the ribosomal S12 protein gene in various Burkholderia strains. Ralstonia solanacearum GMI1000 was used as the out group. The tree was constructed using MEGA version 3.1 [16] using neighbor-joining method and a bootstrap value of 1000. The scale bar represents the genetic distance.

M. Yu, J.S.H. Tsang / Protein Expression and PuriWcation 49 (2006) 219–227

The limitation for the current study is that information on transcription and regulation of these promoters was limited; the expression eYciency across diVerent species is unknown, which restricted the use of these promoters in protein expression. Nevertheless, we have provided alternative choices for transporter protein expression that are simple and convenient, especially for researchers requiring preliminary functional assay for uncharacterized protein. In conclusion we have used the Ps12c promoter from B. cenocepacia and the Ps12 promoter from B. cepacia for improved expression of a B. cepacia transporter protein Deh4p in E. coli. The use of these constitutive promoters allowed us to perform functional assay for this protein without causing too much interference to the cell physiology. Acknowledgments We thank H. Schweizer for plasmid pUCP28T. This work has been partially supported by Seed Funding for Basic Research of the University Research Committee. References [1] F.W. Studier, B.A. MoVatt, Use of bacteriophage T7 RNA polymerase to direct selective high-level expression of cloned genes, J. Mol. Biol. 189 (1986) 113–130. [2] N. Mertens, E. Remaut, W. Fiers, Tight transcriptional control mechanism ensures stable high-level expression from T7 promoter-based expression plasmids, Biotechnology (NY) 13 (1995) 175–179. [3] B. Miroux, J.E. Walker, Over-production of proteins in Escherichia coli: mutant hosts that allow synthesis of some membrane proteins and globular proteins at high levels, J. Mol. Biol. 260 (1996) 289–298. [4] K.E. Langley, M.R. Villarejo, A.V. Fowler, P.J. Zamenhof, I. Zabin, Molecular basis of beta-galactosidase alpha-complementation, Proc. Natl. Acad. Sci. USA 72 (1975) 1254–1257. [5] M.F. Alexeyev, H.H. Winkler, Membrane topology of the Rickettsia prowazekii ATP/ADP translocase revealed by novel dual pho-lac reporters, J. Mol. Biol. 285 (1999) 1503–1513. [6] S.E. Chuang, D.L. Daniels, F.R. Blattner, Global regulation of gene expression in Escherichia coli, J. Bacteriol. 175 (1993) 2026–2036. [7] M.D. Lefebre, M.A. Valvano, Construction and evaluation of plasmid vectors optimized for constitutive and regulated gene expression in Burkholderia cepacia complex isolates, Appl. Environ. Microbiol. 68 (2002) 5956–5964. [8] J.S.H. Tsang, P.J. Sallis, A.T. Bull, D.J. Hardman, A monobromoacetate dehalogenase from Pseudomonas cepacia MBA4, Arch Microbiol. 150 (1988) 441–446. [9] W.Y.K. Chung, H.P.S. Wong, J.S.H. Tsang, Cloning and characterisation of a 2-haloacid permease gene from Burkholderia cepacia MBA4., 1st FEMS Congress of European Microbiologists, Ljubljana, Slovenia, 2003, p. 371. [10] K. Wilson, Preparation of genomic DNA from bacteria, in: F.M. Ausubel, R. Brent, R.E. Kingston, D.D. Moore, J.G. Seidman, J.A. Smith, K. Struhl (Eds.), Current protocols in molecular biology, John Wiley & Sons Inc., New York, 2003, pp. v. (loose-leaf).

227

[11] H.P. Schweizer, T. Klassen, T. Hoang, Improved methods for gene analysis and expression in Pseudomonas spp., in: T. Nakazawa, K. Fukukawa, D. Hass, S. Silver (Eds.), Molecular Biology of Pseudomonads, ASM Press, Washington DC, 1996, pp. 229–237. [12] J.S.H. Tsang, D.J. Hardman, A.T. Bull, Cloning and expression of 2haloalkanoic acid dehalogenase of Pseudomonas cepacia MBA4 in Escherichia coli and in Pseudomonas putida, in: S.-T. Chang, K.-Y. Chan, N.Y.S. Woo (Eds.), Recent Advances in Biotechnology and Applied Biology, The Chinese University of Hong Kong Press, Hong Kong, 1988, pp. 231–239. [13] J. Brosius, M. ErXe, J. Storella, Spacing of the ¡10 and ¡35 regions in the tac promoter. EVect on its in vivo activity, J. Biol. Chem. 260 (1985) 3539–3541. [14] D. Dykhuizen, D. Hartl, Transport by the lactose permease of Escherichia coli as the basis of lactose killing, J. Bacteriol. 135 (1978) 876–882. [15] R.J. Kadner, G.P. Murphy, C.M. Stephens, Two mechanisms for growth inhibition by elevated transport of sugar phosphates in Escherichia coli, J. Gen. Microbiol. 138 (1992) 2007–2014. [16] C.R. Timblin, M.L. Kahn, Lactose inhibits the growth of Rhizobium meliloti cells that contain an actively expressed Escherichia coli lactose operon, J. Bacteriol. 158 (1984) 1204–1207. [17] H. Sandermann Jr., Beta-D-galactoside transport in Escherichia coli: substrate recognition, Eur. J. Biochem. 80 (1977) 507–515. [18] D.I. Kreimer, H. Malak, J.R. Lakowicz, S. Trakhanov, E. Villar, V.L. Shnyrov, Thermodynamics and dynamics of histidine-binding protein, the water-soluble receptor of histidine permease. Implications for the transport of high and low aYnity ligands, Eur. J. Biochem. 267 (2000) 4242–4252. [19] J. Brosius, Toxicity of an overproduced foreign gene product in Escherichia coli and its use in plasmid vectors for the selection of transcription terminators, Gene 27 (1984) 161–172. [20] M.G. Reese, Application of a time-delay neural network to promoter annotation in the Drosophila melanogaster genome, Comput. Chem. 26 (2001) 51–56. [21] V.A. Spiridonova, T.S. Rozhdestvensky, A.M. Kopylov, A study of the thermophilic ribosomal protein S7 binding to the truncated S12S7 intercistronic region provides more insight into the mechanism of regulation of the str operon of E. coli(1), FEBS Lett. 460 (1999) 353–356. [22] J.F. Martin, C. Barreiro, E. Gonzalez-Lavado, M. Barriuso, Ribosomal RNA and ribosomal proteins in corynebacteria, J. Biotechnol. 104 (2003) 41–53. [23] S. Hansmann, W. Martin, Phylogeny of 33 ribosomal and six other proteins encoded in an ancient gene cluster that is conserved across prokaryotic genomes: inXuence of excluding poorly alignable sites from analysis, Int. J. Syst. Evol. Microbiol. 50 (2000) 1655–1663. [24] B.P. Cormack, R.H. Valdivia, S. Falkow, FACS-optimized mutants of the green Xuorescent protein (GFP), Gene 173 (1996) 33–38. [25] C.D. Link, V. Fonte, B. Hiester, J. Yerg, J. Ferguson, S. Csontos, M.A. Silverman, G.H. Stein, Conversion of green Xuorescent protein into a toxic, aggregation-prone protein by C-terminal addition of a short peptide, J. Biol. Chem. 281 (2006) 1808–1816. [26] S. Iwanaga, N. Ohara, T. Kariu, M. Kimura, N. Yamasaki, T. Yamada, Cloning and nucleotide sequence of the gene cluster encoding ribosomal proteins S12 and S7 from Mycobacterium bovis BCG, Biochem. Mol. Biol. Int. 36 (1995) 209–218. [27] K. Saito, L.C. Mattheakis, M. Nomura, Post-transcriptional regulation of the str operon in Escherichia coli. Ribosomal protein S7 inhibits coupled translation of S7 but not its independent translation, J. Mol. Biol. 235 (1994) 111–124.