Vβ17 gene polymorphism in wild-derived mouse strains: Two amino acid substitutions in the Vβ17 region greatly alter T cell receptor specificity

Cell, Vol. 63, 717-728,

November

16, 1990, Copyright

0 1990 by Cell Press

VP17 Gene Polymorphism in W ild-Derived Mouse Strains: Two Amino Acid Substitutions in the VP17 Region G reatly Alter T Cell Receptor Specificity Pierre-Andre Cazenave,‘t Patrice N. Marche, Evelyne Jouvin-Marche,’ Danielle VoegtlQ Francois Bonhomme,* Antonio Bandeira,§ and Antonio Coutinho§ * Unite d’lmmunochimie Analytique §Unite d’lmmunobiologie CNRS URA 359 lnstitut Pasteur Paris France tuniversite Pierre et Marie Curie Paris France *lnstitut des Sciences de I’Evolution USTL Montpellier France

Summary Of 41 wild-derived mouse strains analyzed, 14 contained 1 cells bearing Vp17 receptors in spite of the concomitant expression of I-E antigens. Reciprocal Fl and F2 hybrids of one of these strains, PWK, with laboratory strains revealed different patterns of VP17 T cell deletions from those observed with VP17 T cells from SJL, implying that the two VP17 reglons are associated with recognition of dlstlnct superantlgens. The structures of the VP17 alleles differ by two amino acid substitutions, which lie together in an area distant from the predicted site of T cell receptor Interaction with peptide-MHC complexes but overlapping with that implicated in WM.2 recognition of Mls-1 superantigen. This demonstrates that the self-superantigen leading to VP17 T cell deletion varies wlth the allele of the receptor gene and confirms that T cell deletions by such ligands involve interactions with a region of the Vp domain that is distinct from the conventional combining site. Introduction In addition to a very extensive joining variability, a8 T cell receptor (TCR) diversity results from the combinatorial assembly of at least five distinct gene segments (for review see Davis and Bjorkman, 1988). In a number of cases, all these genetic elements were found to contribute to the fine specificity of the T lymphocytes expressing them (Kappler et al., 1987a; Fowlkes et al., 1988; Kisielow et al., 1988a; MacDonald et al., 1988a; Sha et al., 1988). Strikingly, however, there is a good correlation between the expression of Vp genes and particular patterns of antigen recognition, regardless of DJf3 and VJa (Kappler et al., 1987a, 1987b; MacDonald et al., 1988b; Marrack and Kappier, 1988; Fry and Matis, 1988; Kisielow et al., 1988a; Pullen et al., 1988; Bill et al., 1989; Lioa et al., 1989; White

et al., 1989). To date, such relationships concern several VP regions that were found to “dominate” the T cell responses to the corresponding antigens. These observations were interpreted to indicate that, in some types of TCR interaction with MHC molecules (or with complexes of MHC and superantigens), sufficient binding affinity could be achieved by V8 regions alone. It would seem that, in those cases, functional T cell recognition does not relate to the fine specificity of TCR. Reactivities imparted by VP regions alone have been particularly analyzed in relation to T cell repertoire selection by self-antigens. Thus, it has been established that mice carrying certain allelic forms at some MHC and/or other structural loci delete from their mature repertoires most T lymphocytes expressing a given Vp region (Kappler et al., 1987b, 1988; MacDonald et al., 1988~; Abe et al., 1988; Fry and Matis, 1988; Kisielow et al., 1988b; Pullen et al., 1988). This process of deletion seems to take place in the thymus, within the first 2 to 3 weeks of postnatal development, and is believed to ensure lack of pathogenic autoreactivity (Kappler et al., 1987b; Fowlkes et al., 1988; MacDonald et al., 1988~; Hodes et al., 1989). More recently, a similar association of V8 expression with reactivity to bacterial exotoxins has been established (Choi et al., 1989; White et al., 1989). Since the adverse reactions to such exotoxins seem to result from this type of T cell reactivities, the argument has been made that ontogenic deletion of T cell specificities by self-superantigens could have survival advantage upon exposure to the corresponding foreign superantigen (White et al, 1989). Negative selection of T cell repertoires would therefore correspond to some form of “negative immunity.” This speculation was later extended from the somatic deletion of TCRs to germline deletions of VP genes identified in some laboratory strains and wild mice populations (Behlke et al., 1986; Haqqi et al., 1989; Jouvin-Marche et al., 1989; Pullen et al., 1990a). For what concerns us here, studies in laboratory mouse strains have established that mature T cell repertoires are depleted of TCRs encoded by VP1 1 and Vpl7a in all individuals expressing class II I-E antigens (Kappler et al., 1987b; Bill et al., 1989). All I-E alleles thus far examined were capable of mediating clonal deletion of those T cells, although a hierarchy of efficiency among the various alleles could be established in some cases (Kappler et al., 1989). When analyzing a large number of inbred and partially inbred strains derived from populations of wild mice, we have detected the frequent coexpression of both I-E and Vf3lFencoded TCRs. Detailed studies of one such inbred strain, and of their respective Fl and F2 hybrids with selected laboratory strains, have established that this Vf317 allele is expressed in antigenic environments that delete the prototype Vpl7a allele known from laboratory strains such as SJL. Differential reactivity of those TCRs could be ascribed to two amino acid exchanges between the two allelic forms of the gene. Following the assumption that TCR

Cdl 710

Figure 1. Genomic

mxddmcn+ 2

,“hnrsEP, I

a

2.3

.

Hind III VR17

Analysis of Vf317 Alleles

DNA samples from wild mouse strains M. m. domesticus (WLA, 3SCH, WMP, DFG, DDS, and ‘JIKlg), M. m. musculus (MAI, MB& PWK, MYL, MDB, MBS, and MST), M. m. castaneus (CAS), and M. m. molossinus (MOL) were digested by Hindlll restriction endonuclease and analyzed with the Vb17 probe along with samples of laboratory strains BALBlc and SJL. The sizes in kb of Hindlll fragments of h phage are indicated at the left.

*t

Hind Ill VR17

chains fold in the same fashion as immunoglobulins, justified by the striking simlilarity of their primary and secondary structures (Patten et al., 1984; Barth et al., 1985; Novotny et al., 1986; Chothia et al., 1988; Davis and Bjorkman, 1988), we could predict the localization of those two critical positions. The variant residues are localized in a region distant from the predicted site of interaction between TCR V regions and peptide-MHC complexes and which overlaps with the region involved in the reactivity of Vp8.2 TCR with MIS-1 superantigen (Pullen et al., 1990b). Taken together, the genetic and structural data support the hypothesis that the two alleles of the V817 gene impart reactivities to distinct self-superantigens. Results Polymorphism of the VP17 Gene in Wild Mice Stocks To examine the polymorphism of the Vf317 gene segment, we have carried out Southern blot analyses of genomic DNA from a number of strains, derived from wild stocks of Mus musculus musculus, Mus musculus domesticus, Mus musculus molossinus, and Mus musculus castaneus, at various stages of inbreeding. Among laboratory inbred strains, after Hindlll digestion and probing with a Vf317 cDNA, a restriction fragment length polymorphism has been described that allows for the typing of the two allelic forms of the gene known to date (Kappler et al., 1987a; Wade et al., 1988). In the prototype SJL strain, the Vpl7a allele is present in a 3.9 kb Hindlll fragment, whereas the strains of mice carrying the nonfunctional Vf317b allele (prototype strain, BALE/c) contain a cross-hybridizing gene on a 6.1 kb fragment (Figure 1). As can be seen in Figure 1, all wild strains tested carry at least one gene segment that strongly hybridized with the V817 probe. The typing results summarized in Table 1 indicate that in the M. m. musculus subspecies, five strains in the eight tested display a V817 restriction fragment that is identical to that

seen in SJL, and were therefore typed as carrying the Vpl7a allele. The two other strains retain a VP17 restriction fragment of 6.1 kb, like that of BALB/c mice, and are typed as V817b. The MD6 strain carries both alleles. Among 32 M. m. domesticus strains, only five typed as V617a, while 24 were V617b in these tests. In accordance with their incipient inbreeding (see Table l), three additional strains were heterozygous at this locus and were found to carry both the a and b forms of the VP17 gene segment. Finally, one inbred strain of M. m. castaneus and another of M. m. molossinus were both found to carry the V817a allele. Coexpression of VP17 TCR and Class II I-E Antigens in Most Wild Mouse Strains Preliminary experiments established that the monoclonal antibodies KJ23a, directed against V817a regions expressed by SJL T cells (Kappler et al., 1987a), also recognize a fraction of T lymphocytes in wild strains that were genetically typed as V617a, but not in those carrying the V617b allele. We have proceeded, therefore, to quantitate the expression of VP17 TCRs in those strains, by using biotinylated KJ23a antibodies (followed by avidin-phycoerythrin) and FITC-labeled anti-CD3 antibodies, in two-color FACS analyses. The data for all strains are summarized in Table 1. While no staining above background was obtained with the KJ23a antibodies in any of the five wild strains carrying the b allelic form of the gene, only MAI and BIK/g, of the 15 strains that possess the V617a allele, failed to express a significant proportion of positive cells among CD3+ lymphocytes. It would seem, therefore, that the 3.9 kb Hindlll fragment associated with the a allelic form contains a functionally expressed gene in the vast majority of the cases. In laboratory strains, Vpl7a-expressing T cells are deleted from peripheral repertoires if the mice also express class II I-E antigens (Kappler et al., 1987b, 1989). In view of the predominance of the expression of V817a TCR in wild strains, and the fact that I-E expression in wild-de-

Polymorphism 719

of Vf317

Table 1. Polymorphism

and Expression Geographical

of the Vf317 Gene in Different Wild-Derived

Origin

Mouse Strains I-E Expression (14-4-4+ Cells in Blood)

VP1 7 Genotype

Vf317 Expression

(% Vpl7/CD3+)

SJL

a

9.5 f

BALE/c

b

0.7 + 0.5a

+

1.1s

M. m. domesticusb DDS (02)c 2481 (14) DFA (13) 24CI (06) DFC (05) DJOd (09) DJOd (09) BlW (17) BZO (14) DFS (02)

Denmark Italy France Italy France Italy Italy Israel Algeria France

a a a ab ab a ab a b b

6.2 7.3 3.7 5.7 3.2 7.8 5.9 1.5 0.1 0.5

+ + + + + + + + + +

M. m. musculus MBB (12) MBK (11) MDBd (03) MDBd (03) MBT (19) PWK (>30) MAI (>20) MYL (17) M P W (13)

Bulgaria Bulgaria Denmark Denmark Bulgaria Czechoslovakia Austria Yugoslavia Poland

a a a b b a a a b

7.6 7.9 6.2 0.9 0.2 6.6 1.0 7.6 0.4

+ + + + + + + + +

M. m. castaneus CAS (>20)

Thailand

a

7.2

+

M. m. molossinus MOL (>12)

Japan

a

6.3

a Mean + 1 SD of five animals analyzed independently. b Twenty-two additional strains were analyzed, all of which exhibited the Vf317b genotype. c The number of brother-sister mating generations is indicated in parentheses for each strain. d DJO and MDB strains are only partly inbred and both allelic forms are still present in the population

rived stocks was known to be frequent (Dembric et al., 1984; Klein, 1986) we have also studied all strains for expression of I-E molecules, as determined by reactivity with the 14-4-48 antibody, directed at epitopes on the a chain of those molecules. As can be seen in Table 1, all strains analyzed, except M. m. molossinus, express I-E molecules. It follows that, in contrast with the patterns thus far observed in laboratory strains, 14 out of 15 I-E-expressing wild-derived strains of mice do not delete V817a-bearing T ceils from their mature repertoire. Only in the MAI and BIK/g strains, typed as Vpl7a, could I-E expression be invoked to explain the absence of the corresponding T cells in the peripheral lymphocyte pool. Analysis of Vpl7a Expmssion in the PWK Strain and Respective Fl Hybrids with Laboratory Mice The deletion of Vf317a-bearing T cells in laboratory strains seems to require, in addition to I-E, the presence of a selfsuperantigen that is expressed in a tissue-specific manner (Kappler et al., 1989). The absence of deletion of such T cells in wild mouse strains could be due to the lack of the tissue-specific component, or else to structural variations in either I-E or V817a proteins. To analyze these possibilities in some detail, we have chosen the PWK strain, for it is inbred and crosses readily with laboratory strains.

analyzed.

As shown in Table 2, FACS analyses show that all seven VP genes tested are expressed, each being represented in about 5% of all T cells. Strikingly, and in spite of I-E expression, no deletions are observed in PWK mice, just like in I-E-negative C57BU8 mice, but in contrast to the I-Epositive H-2 congenic strain B6.H-2k, which deletes VP11 cells. It is not surprising, therefore, that (PWK x C57BLI 6)Fi hybrids contain V8lFexpressing T cells at about half the frequency found in the PWK strain, for simple reasons of heterozygocity (Figure 2). More interestingly, however, (PWK x B8.H-2k)F1 hybrid animals fail also to delete Vf317T cells, demonstrating that absence of deletion in the wild strain is not due to a putative I-E polymorphism (Figure 2). This observation constitutes the first indication that the PWK Vpl7a allele behaves differently from that of SJL, since it has previously been reported that T cells expressing the latter are deleted in Fl hybrids with l-E-expressing mice of the C57BU6 background (Kappler et al., 1987b, 1989). In contrast, Vj311 T cells are deleted in Fl hybrids of PWK with both C57BU6 and B6.H-2k, suggesting that PWK I-E is competent to present superantigens encoded in the C57BU6 background to VI311 T cells; that such antigens are absent in the WVK strain; and that I-E-associated ligands of V811 and V817 TCRs are distinct. Quite different results were obtained in (PWK x CBA/J)Fl hybrids (Table 3). In this case, V8lFexpressing

Cell 720

Table 2. Vb TCR Expression

in Fl Generations

Percentage

Derived from PWK and Laboratory

of Peripheral

CD4+ T Cells

V-93

Strains

VP3

PWK

3.4 f 0.4

(Bp6WKx B6)Fl B6.H2k (PWK x B6.H2k)Fl

Mouse Strains

V66.1

VB8.2

Vb8.3

4.9 f 0.7

4.6 f 0.7

13.6 -c 1.0

7.7 f

5.2 f 0.2 5.0 0.6

9.5 8.9 f 0.4 1.1

7.5 7.6 kf 0.6 2.3

6.3 f 0.8

11.5 f 0.5

4.5 f

1.6

8.0 f 0.8

a The events scored as positive had a fluorescence

VP11

V617

1.2

4.5 + 1.2

6.9 * 1.4

14.2 12.2 2f 0.8 0.5

7.4 5.3 rtf 0.6

0.9 5.7 2f 0.6 0.4

3.5 0.7 f+ 0.4a 0.1

3.4 f 0.1

13.6 k 0.1

9.2 f

1.8

0.9 f 0.1

1.1 + 0.1a

6.2 rt 0.7

17.0 + 0.4

6.9 f

1.4

0.8 k 0.5

4.7 72 1.9

intensity distinct from those of positive strains.

T Cells are completely deleted, together with those expressing Vf33, -6, -6.1, and -11. This can be explained by the eXpreSSiOn in CBA/J but not C57BU6 or PWK strains of non-H-2 genes that, possibly in conjunction with I-E, provide self-compiementarities to those T lymphocytes. The CBA/J strain is known to express Mis superantigens that delete T ceils expressing several Vgs and could be responsible for the deletion of V617 Tcells as well. As also shown in Table 3, however, Fl hybrids of PWK with the MIS-la strain AKR, which accordingly delete V66- and VpS.l- but not VfX3-expressing T cells, maintain expression of VP17, thus excluding reactivity of such T cells with MIS-1 products. in contrast, Fl progeny from PWK crosses with Mls-2/3a-expressing strain C3H/He, in addition to deleting V63- but not VW-and Vj36.1-expressing T cells, delete VP17 TCR as well. These data suggest the relationship between T cells expressing a receptor encoded by PWK VB17 and MIS-~/~ recognition. Differential Susceptibility to Deletion of Vpl7a TCRs from SJL and PWK Mice Given the suggestions for differential reactivity of VP17 TCRs from SJL and PWK mice, we have analyzed the respective Fl and F2 hybrid progeny. As can be seen in Table 4, both strains express Vj317 TCR in receptorbearing thymocytes and peripheral T cells, as shown by reactivity with the KJ23a monoclonai antibodies. The frequency of these T ceils is significantly higher in SJL, most likely because this strain expresses far fewer VP genes altogether. Interestingly, however, Fl hybrid mice show a frequency of V317-expressing T cells that is only about half that in the parents. This observation suggested that one of the two allelic forms of the receptor was being deleted, confronted in the Fl environment with the other parent’s antlgenic composition. This possibility was tested in F2 progeny of the same cross. These were typed for the origin of their TCRP locus, for I-E haplotype and expression, and for the numbers of Vpltexpressing T cells in the periphery. As can be seen in Table 5, among mice that were homozygous for the PWK TCRP locus, the frequency of Vpl7-expressing T cells was independent of I-E expression and similar to that scored in the PWK strain. in contrast, among mice carrying two copies of the SJL TCR6 locus, those that expressed I-E deleted VP17 T Cells, white those that did not express I-E contained a high (SJL-

type) frequency of these cells. In addition, progeny that were heterozygous at the TCRp locus behaved as Fl hybrids if I-E positive, but showed high frequencies of VP17 T cells if I-E negative. These results were obtained even when the mice were homozygous for the PWK hapiotype at the I-E locus, that is, PWK I-E is sufficient to delete the SJL form of V617 TCR, while it is not competent to delete PWK VP17 T cells, even if complemented by E6S. Finally, although the number of mice analyzed are not sufficient to reach firm conclusions, it is likely that, if a self-superantigen is necessary in conjunction with I-E to achieve deletion of SJL-type Vj317 T cells, such a putative molecule is available in both strains. Structural Differences between SJL and PWK VP17 Genes The evidence for differential reactivity of VP17 TCRs from SJL and PWK led us to compare their structures. The PWK V617 gene was amplified by PCR, and several independent clones were sequenced. As can be seen in Figure 3, where the PWK VP17 nucleotide sequence is aligned with that of the SJL and BALBlc alleles, there are eight nucleotide differences in the PWK gene compared with SJL. Four substitutions are localized in the variable coding region leading to two amino acid replacements, namely at positions 46 and 74, using the numbering of Kabat et al. (1967). The nonconservative substitution N (in SJL) to S (in PWK) at position 46 is localized in a region that corresponds to the beginning of the second hypervariable of immunogiobulins (CDR2). The replacement in position 74 of a Q (in SJL) to an R (in PWK) involves two nucleotide substitutions and is localized in a region that corresponds to a loop in the third framework of immunoglobulins (FR3). This region displays variability among VP genes (Patten et al., 1964) and has been suggested to constitute a fourth hypervariable region (HV4) (Kabat et al., 1967). Discussion The present observations describe a new polymorphism of the Vp17 gene in the mouse species and characterize the structure of an allele, tentatively designated V617a2, together with its differential reactivity to self-ligands. Furthermore, the survey of a variety of wild-derived mouse

Polymorphism 721

104

of VB17

Iti

I I

,

IWR,

I I I

, 1400,

,s, np,

,

jqop,

PWK

, I1000 00

102 ::.,‘:;‘.’ ‘1; )’ L 10’

4

--

- : -.;+g .‘.

0 r bo I

-

-

-

------

CD4 Figure 2. Vf317 T Cell Receptor Mesenteric

Expression

by Peripheral CD4+ Lymphocytes

lymph nodes were used. The values presented

are percentages

in the PWK Strain and Its Fi Progeny with Laboratory of total CD4+ cells.

Strains

Cell 722

Table 3. VB17 TCR Expression in Fl offspring PWK and MIS Prototype Strains Mlsa Strains

Percentage

of VP Expression

H-2 1 2/3 Vp3 3.7 f

CBAlCa

VS8.1 1.3

5.0 f

va17 1.4

10.4 f

1.3

k

bb

5.0 * 0.9 5.4 + 0.8

4.8 f 0.7 6.7 f 0.3

<0.5 4.1 + 0.7

CBA/J (PWK x CBA’J)Fl

k

aa

0.2 * 0.1 0.2 f 0.2

CO.4 0.3 f 0.3

0.1 f 0.1 0.4 f 0.1

AKR (PWK x AKR)Fl

k

ab

7.5 ct 2.3 6.8 * 0.5

1.2 f 0.8 1.2 f 1.2

<0.5 5.6 f 0.8

C3HIHe (PWK x C3HIHe)

k

ba

0.3 * 0.2 0.1 f 0.02

5.3 f 0.1 3.9 2 1.1

<0.5 0.4 + 0.1

(PWK x CBAICa)Fl

a The Mls (1988).

genotypes

are designated

not expressed in (CBA/J x PWK)Fl progeny, showing deletion by a self-superantigen. Since no deletion is observed in (AKR x PWK)Fl crosses, the Vp17a2 ligand cannot be Ml&la, while the results in (C3HIHe x PWK)Fl, where VP17a2 and Vf33 TCRs show comparable deletions, are compatible with the possibility that Mls2/3a (Pullen et al., 1988; Abe et al., 1988) could be the self-superantigen in question. As Vf317al T cells are deleted in all I-E-positive strains, irrespective of MIS-1 (Kappler et al., 1987b, 1989) and MIS-~/~ type (Marrack et al., 1988) the data indicate that the two allelic forms of VP17 impart reactivities against products of distinct loci. Alternatively, Vf317al could recognize a “public epitope” shared by MIS-~/~* and Ml~-2/3~ molecules, in which case the two amino acid exchanges in the Vp17a2 allele would have shifted its reactivity to a “private epitope” of Ml~-2/3~. This speculation would imply that the Ml~-2/3~ genes encode a product whose expression can lead to deletion of self-reactive T cells, but not to stimulation of allogeneic T lymphocytes. Incidentally, our results also allow us to conclude that superantigen responsible for deletion of VP11 TCR is distinct from that eliminating Vf317a2 T cells. Thus, Vpllexpressing T cells are absent in the periphery of all Fl hybrids from PWK crosses, irrespective of the deletion of Vp17a2 T cells. Interestingly, however, PWK mice themselves do not delete Vpll TCR. Since deletion is observed in Fl hybrids with I-E-negative strains (e.g., C57SU8), it follows that PWK I-E is competent in this respect. Hence, either the corresponding superantigen or the VP11 gene of PWK must be structurally different from those in the laboratory strains. The lack of a three-dimensional model for TCR molecules precludes the possibility of ascribing precise positions to the interactions with peptide-MHC or superantigens. Several observations, however, suggest that the TCR molecule, a member of the immunoglobulin gene superfamily, has a domain structurevery similar to that of immunoglobulins. This assumption is supported by the fact that the residues that are crucial in the folding of framework regions of immunoglobulin domains are conserved in the a and 3 chains of TCR (Patten et al., 1984; Barth et al., 1985; Novotny et al., 1986; Chothia et al., 1988; Davis and Bjorkman, 1988). On the basis of this model, the site of TCR interactions with peptide-MHC complexes

of Crosses of

according

to Abe and Hodes

strains, many of which show a similar behavior, suggests the prevalence of the same or functionally equivalent alleles in the mouse species, the prototype laboratory strains constituting the exception. Cells expressing V617al (of SJL origin) are systematically deleted whenever the individual expresses class II I-E molecules (Kappler et al., 1987b). This conclusion was reinforced here by showing deletion of Vf317ai-expressing T cells in every (SJL x FWK)F2 mouse expressing I-E of PWK origin (Table 5). It follows that Vf317al alone imparts reactivity toward either I-E molecules or I-E molecules associated with a superantigen expressed invariantly in all mouse strains analyzed, including PWK. The latter possibility is more likely, given the observation by Kappler et al. who have identified l-E-positive cells that fail to stimulate Vplhl-expressing T cell hybridomas (Kappler et al., 1987a). In contrast, T lymphocytes bearing Vp17a2 (from PWK origin) continue to be represented among thymic and peripheral repertoires in animals expressing I-E molecules. This establishes the differential reactivity of the two allelic forms of the Vf317 chain. Furthermore, V317a2 TCRS are Table 4. VP TCR Expression

by PWK, SJL. and their Fl Offspring

in Their Central and Peripheral Percentage

Surface Antigen

VP6

Vp8.2

Lymphoid

PWK

Thymocyies Lymph nodes

CD3+ CD4+ CD8+

SJL

Thymocytes

CD3+

10.5

Lymph node

CD4+ CD8+

9.5 f 0.3 16.9 f 0.9

0.3 f 0.1 0.3 f 0.1

Thymocytes

CD3+

8.4 -t 0.6

Lymph nodes

CD4+ CD8+

8.6 f 0.8 15.6 f 0.8

5.4 k 0.7 4.9 f 0.9 8.8 f 1.6

Organs

of Vp Expression

Strains

(PWK x SJL)Fl

Organ

Lymphoid

vpr 1

VB17

-

8.4 + 1.0 13.6 f 1.0 7.0 f 0.8

2.1 + 0.2 4.5 f 1.2 3.7 f 1.8


0.1 f 0.0

9.5 k 0.6

0.3 f 0.4 0.1 f 0.1

12.0 f 0.3 7.6 f 1.4

5.5 f 0.9

0.6 f 0.1

5.3 k 1.2

7.5 + 0.7 5.1 f 0.1

2.0 f 0.4 2.3 f 0.9

4.8 + 0.2 4.0 f 1.0

6.3 f 0.5 8.9 -c 1.4 5.7 f 2.5

Polymorphism 723

of VP17

-10 L GA M G A R L LCCVALCL ATGGGTGCAAGACTGCTCTGCTGTGTAGCACTTTGTCTGCTTGGGGCAG~GAG~CTGAGTC~GGG ---------------------------------------------------A----G-------------

a2 al

---------------------------------------------------A------------------

b

AAAGGACTTGTCCTCACACTCCACACTACAGTTCCCAATGTTTTTCCCTTTCAGAGTCCCTCCTTTCCTG ----------------------------------------------------------------G--------------------------------------------------------------------G-----

a2 al b

1

10

G S FVAGVTQTPRYL TTCTCATTTTCTGTTTTCCCCTCTTCC~GCTCTTTTGTTGCTGGAGT~CCCAGACTCCACGATACCTG

a2

----------------c-----------------------------------------------------

al

----------------C-----------------------------------------------------

b

20

30

V K E K G Q K A H M S CSPEKGH T A F Y W GTCAAAGAGAAAGGACAGAAAGCACACATGAGCACACATGAGCTGTAGTCCTG~GGGCACACTGCCTTTTACTGGT a2 --------------------------------T------------------------------------al --------------------------------T------------------------------------b 40

,-----2--------------------.-,

YQQNQKQELTFLISFRNEEIMEQT ATCAACAGILACCAGAAACAAGAACTTACATTTTTGATTAGCTTTCG~TG~G~TTATGG~C~C N ---------------------------------------A--------------------------------------------------------------------A-----------------------------60

70

,_------_-_, D L V K K R F S A KC S SNSRCILEILS AGACTTGGTCAAGAAGAGATTCTCAGCTAAGTGTGTTCGTCCTATCC Q -----------------------------------------------AG-------------------------------------------------------------------AG---------------------

a2 al ), 80 a2 al b

90

S E E D D S A L Y LCASSL TCTGAAGAAGACGACTCAGCACTGTACCTCTGTGCCAGCAGTCTGTACACAGCGCTG~TGTACGTTG -_-_-_-----_-_-----------------------------* --------------------------G-----------------------------------------Figure 3. Comparison

a2 al b

of Vf317 Alleles

The nucleotide sequences of Vp17 alleles are presented aligned a2 for V317a2 from PWK, al for Vpl7al from SJL (Kappler et al., 1997a), and b for Vb17b from SALE/c (Wade et al., 1988; D. Y. Loh, personal communication). Splicing and recombination heptamer signals are overlined. The translation of Vpl7a2 is shown above the nucleotide sequence and only amino acid differences are indicated for the other alleles. Amino acids involved in the formation of loops discussed in the text are overlined by broken lines. The amino acid positions were determined according to Kabat et al. (1997). The asterisk stands for the termination codon in the Vf317b allele.

is predicted to be localized in regions corresponding to the CDR of immunoglobulins, which constitute the antigencombining site of antibodies. The distance separating CDRl and -2 of Vu from the

corresponding VP CDRs is the same as that separating the two a helices of the MHC molecule (Bjorkman et al., 1987a), suggesting that CDRl and -2 equivalent regions on Va and Vf3 will contact side chains of the MHC a

Cell 724

Table 5. Differential

Modulation

of SJL and PWK V817a Frequencies

in I-E+ or I-E- (SJL x PWK)FP Progeny

I-EMice

CD Genotype

8 Genotype

Expression

Percentage vpi 7iw3+

SJL PWK Fl(SJL x PWK) FP(SJL x PWK) A5 A6 Al2 D3 Fl

.9 Pa SIP ‘*

S P SIP

+ +

11.0 f 1.1 6.2 f 0.3 2.1 + 0.5

S S S S S

Bl C6 c9 Cl0 D4 E3

SIP SIP SIP SIP SIP SIP

A7 E2

S S

S S

A6 A9 All Al3

SIP SIP SIP SIP

P P P P

A2 82 84 B6 c3 c5 c7 C6 D2

SIP SIP SIP SIP SIP SIP SIP SIP SIP

SIP SIP SIP SIP SIP SIP SIP SIP SIP

Al D6

SIP S/P

S S

+ + + +

0.5 83 87 c2 c4 A3 A10 Cl Dl

SIP SIP SIP SIP

B6 D5

S S

a S for SJL origin: P for PWK origin. b Mean f 1 SD for all mice in each segregating

+ + + +

of

0.7 0.1 0.6 0.9 0.8

0.6 f 0.3b

1.7 0.9 1.8 1.3 0.7 1.0

1.2 2 0.5

10.1 9.9

10.0 * 0.1

4.1 6.9 4.2 4.2

4.9 + 1.4

2.6 5.2 4.8 4.8 5.2 4.0 3.9 5.0 4.6

4.5 f 0.8

10.8 9.1

10.0 f

1.2

6.8 8.4 6.9 4.3 6.6

6.6 f

1.5

5.9 9.4 7.4 7.4

7.5 f

1.4

5.9 6.6

6.3 f 0.5

group.

helices, while the central CDR3 equivalents contact the peptide presented in the MHC groove (Bjorkman et al., 1987b). The fact that CDR3 regions of TCR determine peptide specificity (Hedrick et al., 1988; Danska et al., 1990) as well as the conservation of the predicted TCR contact residues in the a helices in various MHC class II alleles (Cam et al., 1990) is in accordance with that model. T cell reactivities with superantigens, however, cannot be accommodated in this model. Thus, they do not show MHC

restriction and are independent of Vp junctional diversity and of the pairing Va (reviewed in Moller 1989). To account for these characteristics, Janeway et al. (1989) proposed a model in which superantigens, such as MIS-1 or enterotoxins, after intimate association with class II molecules, bind to specific VP regions of TCR outside the combining site for peptide-MHC complexes. Recent studies on VW.2 residues involved in reactivity toward MIS-1 superantigen do support the existance of an interaction re-

Polymorphism 725

of VP17

Figure 4. Predicted

Localization

of the VP17 Variant Residues

Diagrams of the a carbon skeleton of a Fab fragment were generated from X-ray crystallographic analysis of the D1.3 monoclonal antibody (Bentley et al., 1999) using the FRODO program (Jones, 1979). The atoms corresponding to the variant residues among Vf3 alleles are represented using standard van der Walls radii. (A) Side view of the Fab fragment with the antigen-combining site oriented to the bottom. The a carbon skeletons of VH, VL, CH, and CL domains are drawn in blue, magenta, brown, and green, respectively. The predicted positions of V917 variant residues 49 and 74 are indicated in yellow. In red are represented the predicted positions 24 and 73, which, with residue 74, were shown to be involved in MIS-~ reactivity (Pullen et al., 1990b) and correspond to amino acids 21, 70, and 71 in the Vf39.2 chain (Pullen et al., 199Oa). Thick lines indicate the tips of the Fab CDR loops and of the hypefvariable region 4 of VP (HV4). (6) Upper view of the VW and VL domains, with the CDR loops oriented toward the viewer. The same color code is used.

gion outside the predicted TCR combining site (Pullen et al., 1990b). To predict the putative positions of the variant residues in the VP17 domain, its amino acid sequence was aligned with the variable segments of immunoglobulins for which three-dimensional structures are available. We selected the Fab model of the anti-lysozyme antibody D1.3 because the corresponding CDRZ and HV4 loops of the VH domain have the same sizes as those predicted for the VP17 domain (Bentley et al., 1989). The a carbon skeleton of the Fab is depicted in Figure 4A with the CDR regions oriented to the bottom. The residues corresponding to positions 48 and 74 of V817 are indicated using the standard representation of the van der Walls radii. Residue 48 is localized at one extremity of the CDRP loop, and residue 74 lies in a hairpin loop linking two 8 sheets of the third framework equivalent, corresponding to the fourth hypervariable region of Vf3 (HV4). Along with the Vp17 variant residues, the predicted positions of the residues involved in MIS-1 reactivity (Pullen et al., 1990b) are also indicated. As can be seen, the three residues implicated in MIS-1 reactivity and residue 74 of V817 are located in a compact area at the surface of the Vp domain. Although this region does not contribute to the

formation of the antigen-combining site in immunoglobulins, it is known to interact with solvent in some VK domains and was shown to contain contact residues in idotype-anti-idiotype interactions (Bentley et al., 1989). Position 48, although located at the beginning of the CDRP loop, is actually closer to the variant residues of the HV4 region than to the tip of the CDR loops. It is interesting to note that the distance between residues 48 and 74 depends on the angle formed by the axis of the CDRP and HV4 loops. There are models of immunoglobulin Fabs where this angle is smaller than that shown in Figure 4, leading to a closer positioning of those residues. Taken together, the data suggest that the regions of interaction between TCR and superantigen are largely overlapping for Vf38.2 (Pullen et al., 1990b) and VP17 Marrack et al. (1988) have previously proposed two hypotheses to explain the reactivity of V817 T cells with I-Eexpressing B lymphocytes. The first, which considers a B cell-specific peptide capable of associating with all alleles of I-E, is difficult to accommodate with current results from peptide-class II interactions and is not supported by our data. Thus, the putative peptide presented in the I-E groove would presumably interact with regions of the Vf317 TCR far removed from the critical positions identified here.

Cell 726

The second hypothesis considered a 6 cell-specific accessory molecule capable of increasing the efficiency of interactions between VP17 TCRs and I-E molecules (Marrack et al., 1988). If such a molecule directly binds to VP, this model is similar to that of Janeway et al. (1989), which proposes VP TCR interactions with unprocessed superantigens bound to class II molecules. Our results are compatible with such a model, by showing that the critical residues that determine VP17 TCR specificity toward a self-superantigen are located away from the predicted combining site for processed peptide-MHC complexes. It is striking that essentially the same region on the VP domain of a different TCR is also crucial in determining specificity toward a distinct self-superantigen (Pullen et al., 1990b), raising the possibility that this particular region is generally involved in interactions with unprocessed superantigens, enterotoxins in particular. The analysis reported here suggests that VP clonal deletions in wild mice populations are relatively exceptional. Thus, 14 out of 18 strains, representing a very wide geographic origin, do not delete Vf317a TCR, even if I-E positive. Furthermore, the detailed analysis of the PWK strain shows no evidence for deletion of any of the VP regions that are eliminated in I-E-positive laboratory strains, such as Vp3, -5, -8, -8.1, -11, and -17a. Ongoing studies of M. musculus stocks from Asia, which reveal a similar pattern of expression together with a marked polymorphism in Southern blot analyses, will allow us to test the generality of the present observations. It is clear that minor alterations of TCR structure may drastically alter reactivity with self-superantigens, such that variants of the same Vf3 regions recognize different ligands. This finding has implications for speculations on the evolutionary pressures behind Vp polymorphisms, whether these are taken as advantageous by escape from deletion or by escape from reactivity with pathogenic microbial ligands. Thus, the probability that a variant VP region will find new superantigens depends on their number and polymorphism. The finding that deletion is rare in wild mouse stocks could suggest either a marked polymorphism of self-superantigens, or that their number is low and Vf3 genes have been selected against such reactivities. Certain combinations of alleles at each locus may indeed ensure reactivity dependent on VP regions alone, but this would seem exceptional. It follows that such polymorphisms must exist and evolve “at equilibrium” in mouse populations and that it is difficult to single out specific evolutionary pressures behind the balanced evolution of polymorphisms in the species. These discussions, however, should await a better analysis of these polymorphisms. It is interesting to note that studies of wild mouse populations, in addition to addressing this type of question, also provide information concerning the molecular basis of the interactions of TCRs with ligands and may have implications for the therapeutic use of the anti-VP family in humans. Experimental Pmcedures Mice All mice studied here belong to the M. musculus species (Bonhomme et al., 1984). A series of lines at different stages of inbreeding was de-

rived from animals trapped in the wild, in various sites of Europe and North Africa (as specified in Table I), and maintained at either the Institut des Sciences de I’Evolution (Universite de Montpellier) or at our animal facilities. The laboratory strains BALB/c, SJUJ, C57BU6, CBA/J, AKR, C3HIHe, CBA/Ca, and B6.H-2k are also maintained at the lnstitut Pasteur.

Monoclonal Antibodles The following monoclonal antibodies were used: KJ25, anti-V63 (Pullen et al, 1988); 44.22.1, anti-V!36 (Payne et al., 1988); F23.1, anti-!/f38 (Staerz et al., 1985); F23.2, antiV88.2 (Kappler et al., 1987b); KJ16, antiV88.1 + 8.2 (Haskins et al., 1984); RR3-15, anti-V611 (Sill et al., 1989); KJ23a, anti-V617a (Kappler et al., 1987b); 1452Cl1, anti-CD3 (Leo et al., 1987); GKl-5, anti-CD4 (Dialynas et al., 1983); 53.6.72, anti-CD8 (Ledbetter and Herzenberg, 1979) 14.4.4.S anti-l-E (Ozato et al., 1980). All monoclonal antibodies were purified from ascitic fluids or culture supernatants by affinity chromatography on protein A-Sepharose CL48 (Pharmacia, Uppsala, Sweden) or on DEAE-cellulose chromatography (Servacell, Serva Heidelberg, FRG).

Immunofluorescence

and Cytofluoranrlyslo

Mesenteric lymph nodes, spleen, or thymus was directly teased in fluorescence medium (balanced salt solution without red phenol, sup plemented with 3% fetal calf serum and containing azide). Single or double stainings were performed as extensively described before (Forni, 1979). In short, 1-2 million cells were incubated in the cold for a period of 20 min with biotinylated monoclonal antibodies, in round bottom microtiter plates; after three washes, a second 20 min incubation with FITC-labeled monoclonal antibodies and R-streptavidinphycoerythrine (Becton and Dickinson) was performed, and cells were washed again three times. Propidium iodide was added in every staining. Cytofluoranalysis was performed with a FACScan analyzer (Becton and Dickinson). For every staining, single or double, dead cells were eliminated prior to acquisition. Six to eight thousand events were acquired per sample.

Southern Blot Samples of 10 Kg of high molecular weight DNA were prepared from tails and digested to completion by restriction endonuclease enzyme. Then the fragments were separated in 0.8% agarose gel, transferred onto a nylon membrane, and hybridized as previously detailed (JouvinMarche et al., 1989). For V617 typing, genomic DNAs were digested by Hindlll, and a 580 bp Hindlll-Seal fragment derived from a V617 cDNA clone was used as probe (Kappler et al., 1987a). The genotypes of the constant region 5 were determined as previously described (Cazenave et al., 1986) and the genotypes of the H-21-E 8 gene were analyzed in BamHl digestions using a probe corresponding to the exon II of the I-E 6 gene (Saito et al., 1983).

Polymerase Cheln Reactions The reactions were performed using the cloned T. aquiticus polymerase (Cetus) and a Hybaid thermal reactor. The primers possess a Xhol cloning site and were derived from the begining of the leader coding sequence for MLB17X (S-GACTCGAGATGGGTGCAAGACTGCTCTGCT-3’) and from the complementary sequence spanning between the 7-mer and 9-mer recombination signals for MVBl7FX (5’-GCCTCGAGAGGGCAACGTACAAAAGTC-3’). Genomic DNA (5 ng) was amplified in the presence of 50 pmol of each primer, 0.2 mM each dNTP, 50 mM KCI, IO mM Tris-WI (pH 8.3) 1.5 mM MgCls, 0.01% (wIv) gelatin, and 2.5 Li of Taq polymerase in a final volume of 100 ~1. The reactions were first heated 10 min at 94% and then cycles of 2 min at 94% 2 min at 55%, and 3 min at 72% were repeated 25 times except for the last elongation, which was prolonged for 10 min at 72%.

DNA Sequencing The PCR products were either restricted by Xhol or phosphorylated by T4 nucleotide kinase and then cloned in M13mp21 cleaved by Xhol or Smal, respectively. The inserts were sequenced using the dideoxynucleotide chain termination method (Sanger et al., 1977) with a Sequenase kit (US Biochemical Corp.) using universal, MLBl‘IX, MVB17FX primers and a primer corresponding to base 40 to 64 of the variable region exon. The nucleotide sequence determination was carried out on three independent PCR products.

Polymorphism 727

of Vfl17

Acknowledgments The authors wish to acknowledge their gratitude to J. Kappler and I? Marrack for providing the VP17 probe and several anti-V6 hybridomas, to D. Loh for making available the nucleotide sequence of the germline V817b allele, to T. Fishman for providing the amino acid coordinates of the DA13 Fab, and to F! Alzari for expert advice and helpful discussion in the analysis of Fab models. We are indebted to A. Orth and A. Tomas-Apparici for their expert assistance in animal breeding. We thank A. Demond and M. Person for their help in preparing the manuscript, S. Amzazi, 0. Burlen-Defranoux, S. Degermann, C. Gris-Liebe, and N. S. Trede for helpful technical assistance, and D. Rueff-Juy for valuable discussion and comments. We thank Pablo Pereira and Andrei Augustin for helpful discussion. This work was supported by institutional grants from lnstitut Pasteur, CNRS, and Univenitb Pierre et Marie Curie and specific grants from INSERM (No. 883011), Association pour la Recherche sur le Cancer, Ligue Nationale contre le Cancer, European Economic Community, and Fondation pour la Recherthe MBdicale. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 USC Section 1734 solely to indicate this fact. Received June 7, 1990; revised August 10. 1990

References Abe, R., and Hodes, R. J. (1989). Properties of the MIS system: a revised formulation of MIS genetics and an analysis of T cell recognition of MIS determinants. Immunol. Rev. 7OZ 5-28. Abe, R., Vacchio. S., Fox, B., and Hodes, R. J. (1988). Preferential expression of the VP gene by MlsC reactive T cells. Nature 335, 827-830. Barth, R. K., Kim, B. S., Lan, N. C., Hunkapiller, T., Sobieck, N., Winoto, A., Gershenfeld, H., Okada, C., Hansburg, D.. Weissman, I. L., and Hood, L. (1985). The murine T-cell receptor uses a limited repertoire of expressed V beta segments. Nature 376, 517-523. Behlke, M., Chou, H., Huppi, K., and Loh, D. Y. (1986). Murine T cell receptor mutants with deletions of beta-chain variable region genes. Proc. Natl. Acad. Sci. USA 83, 767-771. Bentley, G. A., Bhat, T. N., Boulot, G., Fishman, T., Navaza, J., Poljak, R. J., Riottot, M. M., and Tello, D. (1989). lmmunochemical and crystallographic studies of antibody D1.3 in its free, antigen-liganded, and idiotope-bound states. Cold Spring Harbor Symp. Quant. Biol. 54, 239-245. Bill, J., Kanagawa, O., Woodland, D. L., and Palmer, E. D. (1989). The MHC molecule I-E is necessary but not sufficient for the clonal deletion of Vpll-bearing T cells. J. Exp. Med. 769, 1405-1419. Bjorkman, P J., Saper, M. A., Samraoui, B., Bennett, W. S., Strominger, J. L., and Wiley, D. C. (1987a). Structure of the human class I histocompatibility antigen, HLA-A2. Nature 329, 506-512. Bjorkman, P. J., Saper, M. A., Samraoui, B.. Bennett, W. S., Strominger, J. L., and Wiley, D. C. (1987b). The foreign antigen binding site and T cell recognition regions of class I histocompatibility antigens, Nature 329, 512-518. Bonhomme, F., Catalan, J., Brinon-Davidian, J., Chapman, V. M., Moriwaki, K., and Thaler, L. ( 1984). Biochemical diversity and evolution in the genus Mus. Biochem. Genet. 22, 275-301. Cam, P., Jouvin-Marche, E., LeGuern, C., and Marche, I? N. (1990). Structure of class II genes in wild mouse Mus sexicola: functional and evolutionary implication. Eur. J. Immunol. 20, 1337-043. Cazenave, P A., Bonhomme. F., G&net, J. L., and Kindt, T. J. (1986). Correlation of CTP phenotype with origins of laboratory mouse strains. Curr. Topics Microbial. Immunol. 727; 300-308.

Danska, J. S., Livingstone, A. M., Paragas, V., Ishihara, T., and Fathman, C. G. (1990). The presumptive CDR3 regions of both T cell receplor a and p chains determine T cell specificity for myoglobin peptides. J. Exp. Med. 772, 27-33. Davis, M. M., and Bjorkman, P J. (1988). T-cell antigen receptor genes and T-cell recognition. Nature 334, 395402. Dembric, Z., Singer, P. A., and Klein, J. (1984). EO: a history of a mutation. EMBO J. 3, 1647-1654. Dialynas, D., Quan, Z., Wall, K., Pierres, A., Quintans, J., Loken, M., Pierre% M., and Fitch, F (1983). Characterization of the murine T cell surface molecule, designated L3T4, identified by monoclonal antibody GK-1.5: similarity of L3T4 to the human Leu 31T4 molecule and the possible involvement of L3T4 in class II MHC antigen reactivity. J. Immunol. 731, 2445-2451. Forni, L. (1979). Reagents for immunofluorescence and their use for studying lymphoid cell products. Immunol. Meth. 7, 151. Fowlkes, B. J., Schwartz, R. H., and Pardoll, D. M. (1988). Deletion of self-reactive thymocyies occurs at a CD4+8+ precursor stage. Nature 334, 620-623. Fry, A., and Matis, L. M. (1988). Self tolerance alters T-cell receptor axpression in an antigen-specific MHC restricted immune response, Nature 335, 830-833. Haqqi, T M., Banerjee, S., Anderson, G. D., and David, C. S. (1989). Rlll SNI(H-2r). An inbred mouse strain with a massive deletion of T cell receptor Vp genes. J. Exp. Med. 769, 1903-1909. Haskins. K., Kubo, R., White, J., Pigeon, M., Kappler, J., and Marrack, I? (1984). The major histocompatibility complex-restricted antigen receptor on T cells. I. Isolation with a monoclonal antibody. J. Exp. Med. 757, 1149-1169. Hedrick, S. M.. Engel, I., McElligott, D. L., Fink, F? J., Hsu, M. L., Hansburg, D., and Matis, L. A. (1988). Selection of amino acid sequences in the beta chain of the T cell antigen receptor. Science 239,1541-1644. Hades, R. J., Sharrow, S. O., and Solomon, A. (1989). Failure of T cell receptor VP negative selection in an athymic environment. Science 246, 1041-1044. Janeway, C. A., Yagi, J., Conrad, P. J., Katz, M. E., Jones, B., Vroegop, E., and Buxser, S. (1989). T-cell responses to MIS and to bacterial proteins that mimic its behavior. Immunol. Rev. 707, 81-88. Jones, T. A.. (1978). A graphic model building and refinement system for macromolecules. J. Appl. Crystallogr. 77, 614-617, Jouvin-Marche, E., Trede, N. S., Bandeira. A., Tomas, A., Loh, D. Y., and Cazenave, P. A. (1989). Different large deletions of T cell receptor VP genes in natural populations of mice. Eur. J. Immunol. 79, 192% 1926. Kabat, E. A., Wu, T. T., Reid-Miller, M., Perry, H. M , and Gottesman, K. S. (1987). Sequences of Proteins of Immunological Interest, Fourth Edition (Bethesda, Maryland: US Department of Health and Human Services, Public Health Service, National Institutes of Health). Kappler, J. W., Wade, T, White, J., Kushnir, E., Blackman, M., Bill, J., Roehm, N., and Marrack, i? (1987a). AT cell receptor Vb segment that imparts reactivity to a class II major histocompatibility complex product. Cell 49, 263-271. Kappler, J. W., Roehm, N., and Marrack. P (1987b). ‘T cell tolerance by dOnal elimination in the thymus. Cell 49, 273-280. Kappler. J. W., Staerz, U., White, J., and Marrack, I? C. (1988). Selftolerance eliminates T CellS specific for MIS-modified products of the major histocompatibility complex. Nature 332, 35-40. Kappler. J. W., Kushnir, E., and Marrack. F? (1989). Analysis of Vpt7a in new mouse strains bearing the VW haplotype. J. Exp. Med. 769, 1533-1541.

eXpreSSiOn

Kisielow, P, Teh, H. S., Bluthmann, l-f., and von Boehmer, H. (1988a). Positive selection Of antigen-specific T cells in thymus by restricting MHC molecules. Nature 335, 730-733.

Choi, Y, Kotzin, B., Herron, L., Marrack, P, and Kappler, J. (1989). Interaction of Sra@Jy/ococcus auraus toxin ‘superantigens” with human T cells. Proc. Natl. Acad. Sci. USA 86, 8941-8945.

Kisielow, P., Bluthmann, H., Staerz, U. D., Steinmetz, M., and von Boehmer, H. (1988b). Tolerance in T-cell-receptor transgenic mice involves deletion of nonmature CD4+8+ thymocytes. Nature 333, 742-746.

Chothia, C., Boswell, D. R., and Lesk. A. M. (1988). The outline structure of the T-cell alpha-beta receptor. EMBO J. 7; 3745-3755.

Klein, J. (1986). Natural History of the Major Histocompatibility plex (New York: John Wiley and Sons).

Com-

Cell 728

Ledbetter, J. A., and Herzenberg, L. A. (1979). Xenogeneic monoclonal antibodies to mouse lymphoid differentiation antigens. Immunol. Rev. 47, 63. Leo, O., Fw, M., Sachs, D. H., Samelson, L. E., and Bluestone, J. A. (1967). Identification of a monoclonal antibody specific for murine T3. Proc. Nab. Acad. Sci. USA 84, 1374-1378. Lioa, N. S., Maltzman, J., and Raulet, D. H. (1969). Positive selection determines T cell receptor VP14 gene usage by CD8+ T cells. J. Exp. Med. 170, 135-143. Marrack, P., and Kappler, J. W. (1988). T cells can distinguish between allogenic major histocompatibility complex products on different cell types. Nature 332, 640-843. MacDonald, H. R., Lees, R. K., Schneider, R., Zinkernagel, R. M., and Hengartner, H. (1988a). Positive selection of CD4+ thymocytes controlled by MHC class II gene products. Nature 328, 47l-473. MacDonald, H. R., Schneider, R., Lees, R. K., Howe, R. C., AchaOrbea, H., Festenstein, H., Zinkernagel, R. M., and Hengartner, H. (1988b). T-cell receptor V5 use predicts reactivity and tolerance to MlsKencoded antigens. Nature 332, 40-45. MacDonald, H. R., Hengartner, R., and Pedrazzini, T. (1988c). Intrathymic deletion of self-reactive cells prevented by neonatal anti-CD4 antibody treatment. Nature 335, 174-176. Moller, G. (1989). T-cell tolerance, Rev. 1OZ

MIS and MHC antigen.

Immunol.

Novotny, J., Tonegawa, S., Saito, H., Kranz, D. M., and Eisen. H. N. (1966). Secondary, tertiary, and quaternary structure of T-cell-specific immunoglobulin-like polypeptide chains. Proc. Natl. Acad. Sci. USA 83. 742-746. Ozato, K., Mayer, N., and Sachs, D. (1980). Hybridoma cell lines secreting monoclonal antibodies to mouse H-2 and la antigens. J. Immunol. 124, 533-540. Patten, P, Yokota, T., Rothbard, J., Chien, Y. H., Arai, K. I., and Davis, M. M. (1984). Structure, expression and divergence of T-cell receptor beta-chain variable regions. Nature 372, 40-46. Payne, J., Huver, B. T., Cannon, N. A., Schneider, R., Schilham, M. W., Acha-Orbea, H., MacDonald, H. R., and Hengartner, H. (1988). Two monoclonal rat antibodies with specificity for the B-chain variable region VpS of the murine T-cell receptor. Proc. Natl. Acad. Sci. USA 85, 7695-7698. Pullen, A., Marrack, I?, and Kappler, J. (1988). The T cell repertoire is heavily influenced by tolerance to polymorphic self antigens. Nature 335, 796-801. Pullen, A. M., Potts, W., Wakeland, E. K., Kappler, J., and Marrack, P (199Oa). Surprisingly uneven distribution of the T cell receptor Vf3 repertoire in wild mice. J. Exp. Med. In, 49-62. Pullen, A. M., Wade, T., Marrack, P., and Kappler, J. (199Ob). Identification of the region of T cell receptor 6 chain that interacts with the selfsuperantigen MIS-la. Cell 81, 1365-1374. Saito, H., Maki, R. A., Clayton, L. K., and Tonegawa, S. (1983). Complete primary structures of the Ep chain and gene of the mouse major histocompatibility complex. Proc. Natl. Acad. Sci. USA 80,5520-5524. Sanger, F., Nicklen, S., and Coulson, A. R. (1977). DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74, 5463-5467. Sha, W. C.. Nelson, C. A., Newberry, R. D., Kranz, D. M., Russel, J. H., and Loh, D. Y. (1968). Positive and negative selection of an antigen receptor on cells in transgenic mice. Nature 336, 73-76. Staerz, U. D., Rammensee, H. G., Senedetto, J., and Bevan, M. (1985). Characterization of a murine monoclonal antibody specific far an altotypic determinant on T cell antigen receptor. J. Immunol. 134. 39944000. Wade, T., Bill, J., Marrack, P C., Palmer, E., and Kappler, J. W. (1988). Molecular basis for the nonexpression of V beta 17 in some strains of mice. J. Immunol. 141, 2165-2167. White, J., Herman, A., Pullen, A. M., Kubo, R., Kappler, J. W., and Marrack, f? (1989). The VfQpecific superantigen staphylococcal enterotoxin 0: stimulation of mature T cells and clonal deletion in neonatal mice. Cell 56, 27-35.