Wnt signaling activation during bone regeneration and the role of Dishevelled in chondrocyte proliferation and differentiation

Bone 39 (2006) 5 – 16 www.elsevier.com/locate/bone

Wnt signaling activation during bone regeneration and the role of Dishevelled in chondrocyte proliferation and differentiation Nan Zhong, Robert P. Gersch, Michael Hadjiargyrou ⁎ Department of Biomedical Engineering, State University of New York, Stony Brook, Psychology A Building, Room 338, Stony Brook, NY 11794-2580, USA Received 10 November 2005; revised 3 December 2005; accepted 5 December 2005 Available online 3 February 2006

Abstract Wnt signaling is intrinsically involved in diverse cellular activities during cell differentiation, early embryonic development and organogenesis. Although much is known regarding the effects of Wnt signaling in the developing skeletal system, its role during regeneration remains unclear. Herein, we show transcriptional activation of specific members and target genes of the Wnt signaling pathway. Specifically, all of the Wnt signaling members and target genes analyzed were found to be upregulated during the early stages of fracture repair, with the exception of LEF1 whose expression was downregulated. In addition, spatial expression analysis of Dishevelled (Dvl) and β-catenin in the fracture callus revealed an identical pattern of expression with both proteins localizing in osteoprogenitor cells of the periosteum, osteoblasts and proliferating/prehypertrophic chondrocytes. Further, in vitro knockdown of all three Dvl isoforms in chondrocytes using small interfering RNAs (siRNA) leads to partial inhibition of cell proliferation and differentiation, decreased expression of chondrogenic markers (ColII, ColX, Sox9) and suppressed nuclear accumulation of unphosphorylated β-catenin. Taken together, these data verify our previous finding that the Wnt signaling pathway is activated during bone regeneration, by characterizing the temporal and spatial expression of a broad spectrum of Wnt-signaling molecules. Our data also suggest that all three Dvl isoforms, acting through the Wnt canonical pathway, are critical regulatory molecules for chondrocyte proliferation and differentiation. © 2006 Elsevier Inc. All rights reserved. Keywords: Wnt; Dishevelled; Fracture repair; Chondrocytes; RNAi

Introduction Our laboratory has previously reported on the transcriptional profiling of bone regeneration and has identified several members of the Wnt signaling pathway, as well as target genes being upregulated during the repair process [1]. Since it is already known that Wnt signaling is intimately involved in diverse cellular activities during early embryonic development, organogenesis and cell differentiation [2], and since fracture repair is considered essentially a recapitulation of embryonic development, it is consistent then that members of the Wnt signaling pathway are reactivated. Presently, Wnts are known to initiate three distinct intracellular signal transduction pathways, Wnt/β-catenin, Wnt/Ca++ and Wnt/Planar polarity [3]. The Wnt/β-catenin ⁎ Corresponding author. Fax: +1 631 632 8577. E-mail address: [email protected] (M. Hadjiargyrou). 8756-3282/$ - see front matter © 2006 Elsevier Inc. All rights reserved. doi:10.1016/j.bone.2005.12.008

signaling pathway, also known as canonical Wnt pathway, inhibits the phosphorylation and degradation of β-catenin, which accumulates in the cytoplasm and translocates into the nucleus, where it binds to transcription factors (ternary complex factor/lymphoid enhancer factor 1, TCF/LEF1) and regulates the expression of a number of genes. The other two pathways are commonly referred to as non-canonical and involve activation of phospholipase C (PLC) and protein kinase C (PKC) (Wnt/Ca++) and JNK and cytoskeletal rearrangements (Wnt/Planar polarity) [4]. Irrespective of pathway, distinct Wnt ligands exert their signaling actions through binding to specific Frizzled receptors [5]. With respect to the skeletal system, Wnts have been shown to be critical for chondrogenesis during limb-formation at the earliest stages of development [6,7], chondrocyte differentiation in vitro [8], maturation of chondrocytes and the onset of bone collar formation [9], and chondrogenic differentiation during long bone formation [10]. More recent studies showed that

6

N. Zhong et al. / Bone 39 (2006) 5–16

Wnt5a and Wnt5b coordinate chondrocyte proliferation and differentiation through differential regulation of cyclin D1 and p130 expression [11], whereas Wnt-14 was demonstrated to play a crucial role in initiating synovial joint formation [12]. Lastly, various Wnts were showed to effect osteoblast differentiation derived from mesenchymal stem cells [13] or in the presence of BMP-2 [14]. In addition to Wnts, other members of the signaling pathway have emerged as important regulators of skeletal development, such as the Wnt coreceptor, LRP5 (lipoprotein receptor-related protein 5), a key regulator of bone density [15,16] and β-catenin [17,18]. Aside from effects of β-catenin on osteoblasts, it was recently showed that β-catenin regulates chondrocyte differentiation [19], through its interaction with Sox9 [20] and it has been determined as “sufficient and necessary” for synovial joint formation [21]. These cellular effects of Wnts and β-catenin depend on the function of Dishevelled (Dvl), a pivotal intracellular player in the pathway [22]. Three members of the mammalian Dvl family (Dvl1, 2, 3) are ubiquitously expressed during all stages of mouse embryogenesis and in most adult tissues with significant overlapping of expression patterns, suggesting that there may be functional redundancy among these three genes [23–25]. The importance of Dvl1 and 2 was demonstrated via deficient mice and double mutant mice that exhibit developmental abnormalities in various organs and tissues, including the skeletal system [26,27]. To date, the direct role of Dvl molecules, whether signaling through the canonical or non-canonical pathway, and the relative functional contributions from each of the Dvl genes in Wnt-dependent osteogenesis or chondrogenesis have not been well addressed. In this study, we confirmed our previous results indicating activation of Wnt signaling pathway during bone regeneration (i.e. fracture repair) [1]. Moreover, we determined the temporal expression of many members of the pathway as well as the spatial localization of β-catenin and Dvl in proliferating and differentiating chondrocytes and osteoblasts within the fracture callus. To further determine the functional contribution of Wnt signaling in the chondrogenic lineage, we used RNAi to specifically knockdown the expression of Dvl1, Dvl2 and Dvl3. Results presented herein strongly suggest that all three Dvl isoforms are essential molecules for regulating the proliferation and differentiation of chondrocytes through β-catenin and the Wnt canonical pathway. Materials and methods Animal model All methods and animal procedures were reviewed and approved by the university's Institutional Animal Care and Use Committee and met or exceeded all federal guidelines for the humane use of animals in research. Controlled fixed fractures were generated in the right femurs of 28 6-month old Sprague–Dawley rats as previously described [28] and routinely performed in our laboratory [1,29–34]. A set of five animals was euthanized by CO2 inhalation at postfracture (PF) day 3, 5, 7 and 10, and a set of 4 animals at PF days 14 and 21. Both the fractured and intact contralateral (control) femurs were dissected free and processed for RNA, protein or immunohistochemistry.

Cell culture and transient transfection Rat Calvaria Joint (RCJ3.1C5) [35] cells were maintained in DMEM (Gibco) supplemented with 15% FBS (Hyclone), 1× Ampicillin and Streptomycin (Gibco) and 10−7 M dexamethasone (Sigma). Cells were subcultured once every 4–5 days and differentiation was induced upon 90– 100% confluence with ascorbic acid (50 μg/ml) and beta-glycerol phosphate (10 mM). For transfections (using the Fugene 6 reagent [Roche]), cells were plated in 6 or 12 well plates at a density of 1 × 104/cm2 and cultured overnight. The Fugene to DNA ratio used was 6 μl to 4 μg per well in 6-well plates and 3 μl to 2 μg per well in 12 well plates. Differentiation medium was changed every 2–3 days.

RNA and protein extraction and quantification Total RNA and protein were individually isolated from 4 fracture calluses and their contralateral intact femurs at each PF days 3, 5, 7 and 10. Calluses were isolated from the diaphysis and homogenized in TriZol reagent (Invitrogen) using a polytron (Brinkmann). Intact femurs (containing bone marrow, articular and growth plate cartilage) were crushed using a mortar and pestle in liquid nitrogen and then homogenized in TriZol. The RNA and protein were then isolated as per the manufacturer's directions. Total RNA was individually purified from 3 of the fracture calluses and their contralateral controls at PF days 14 and 21. The samples were homogenized as above and RNA-extracted using the ToTALLY RNA Kit (Ambion). Aliquots of all RNA samples were treated with DNase to remove any residual DNA contamination using the DNA Free kit (Ambion). The concentration of each of the samples was then determined using a RiboGreen (Molecular Probes) assay. Proteins were also extracted from RCJ cells by lysing in ice-cold radioimmunoprecipitation assay (RIPA) buffer (50 mM Tris–HCl, 150 mM NaCl, 1 mM EDTA, 1% Triton X-100, 0.1% SDS, 1% Sodium Deoxycholate), in the presence of a protease inhibitors Cocktail (Sigma). The concentrations of the individual protein samples (from tissue or cells) were determined using a BCA assay [Pierce]. Lastly, in experiments where nuclear proteins were investigated, we isolated nuclei and proteins from cells via a Nuclear Extract Kit (Active Motif) following manufacturer's directions.

Quantitative real-time RT-PCR (Q-PCR) Equivalent amounts of RNA from 4 animals were combined to form the intact and PF days 3, 5, 7, 10 and 14 pools, with the RNA from 3 animals combined to form the PF day 21 pool. In addition, a reference pool (used for the calibration curve) was generated by combining equivalent amounts of RNA from all samples used in the intact and PF day pools. Forward and reverse primers were designed to amplify 100–250 bp amplicons using Primer 3 software [http://www-genome.wi.mit.edu/cgi-bin/primer/primer3_www.cgi] and parameters specified in One-Step QuantiTect™ SYBR Green RT-PCR kit handbook (Qiagen). All reactions were performed using a LightCycler (Roche). Reaction conditions were optimized for each of the genes by varying the annealing temperature (55–60°C) and RNA concentration (1–10 ng/reaction). Each run consisted of intact and PF day 3, 5, 7, 10, 14 and 21 samples for both the gene of interest and Cyclophilin A, as well as 5 point calibration curves. The calculated concentration values for the intact and PF day time points for the genes of interest were normalized to their corresponding Cyclophilin A values. All Q-PCR products were checked by agarose gel electrophoresis to assess amplification, as well sequenced to verify the identity of the gene of interest. Each run was replicated 3 times and results are reported as average fold change relative to intact ± standard deviation. The same was conducted with the RNA isolated from RCJ cells. A total of 18 genes were selected for gene expression studies in the fracture healing study and summarized as three groups (Table 1): Wnts and receptor genes: (1) Frizzled-2, LRP-5, Wnt4, Wnt5A and Wnt5B; (2) Intracellular Wnt signaling molecules: Dvl-1, CK1A1, CK2A1, β-Catenin, LEF1 and TCF1; (3) Wnt signaling target genes: Engrailed1, OSF2 and PPARD, Connexin43, Fibronectin, CD44 and RARG. The primer sequences for the genes Dvl1, 2 and 3, Collagen type 2a1 (COL2a1), Collagen type X (COLX) and SOX9 studied in our cell based assays are shown in Table 2.

N. Zhong et al. / Bone 39 (2006) 5–16

7

Table 1 Primer sequences and length, generated amplicon size and melting temperature corresponding to the 18 Wnt signaling genes and Cyclophilin A (housekeeping gene) used in the analysis of RNA derived from intact bone and fracture calluses Target gene

Accession #

Forward (5′ to 3′)

Primer size (nt)

Reverse (5′ to 3′)

Primer size (nt)

Amplicon size

Tm (°C)

Wnts and receptor genes Wnt4 NM_053402 Wnt5A NM_022631 Wnt5B AF481944 Frizzled-2 NM_172035 LRP-5 XM_215187

TCTGGAGAAGTGTGGCTGTG GCTTCAACTCCCCAACCA CCGAGAGACTGCCTTCACA TGGGCACACGAACCAAG CAGGTGCTGGTGTGGAGA

20 18 19 17 18

AGCCTCGTTGTTGTGAAGGT CTCGCAGCCGTCCATC ACAGCCGCCCCACAAC AGCGTACATGGAGCACAGG GCTGGTCGGCGTAATCAA

20 16 16 19 18

184 140 151 109 193

57 57 57 57 58

Intracellular Wnt Dvl1 CK1A1 CK2A1 β-Catenin LEF1 TCF1

GCCATCACACGCACCA TGGTTCCTTCGGGGACA CTGCTGCGATACGACCAC TGCAGCGACTAAGCAGGA TCCAGGTTTTCCCATCACA TGGTGCCATTCCCAGAGT

16 17 18 18 19 18

AGCCAGTCCACCACATCC GTCTTTTCCTTGCCCATACC GAAGGGGTTGGCACTGAA TCACCAGCACGAAGGACA CTGTTCGTGCTCAGGCTTC TACCAGGCAGGCATTGTG

18 20 18 18 19 18

209 178 176 198 147 142

58 57 57 58 58 58

Wnt signaling target genes Engrailed-1 BQ782459 OSF2 BM389026 PPARD NM_013141 Connexin43 NM_012567 Fibronectin NM_019143 CD44 NM_012924 RARG BQ208359

AGCGTGCCAAGATCAAGAA TGTGGGGTAGGAACTGAAGG GGAACAGCCACAGGAGGA CGAACAGGTGGGGATAAGG GAGGGGAGTGGAAGTGTGAG GCTGGAAGAAGGCGAAGA GACCCTGAACTGAACCCAGA

19 20 18 19 20 18 20

GCATGAGCGCCGATAGA GGCTTGGCTTGCTTGTTG GGGAGGAAGGGGAGGAA GGATGGGGGCAGAGAGAG TGGGTCTGGGGTTGGTAA GGGGTCACTGGGAAGAGAG CCGTGTCATCCATCTCCA

17 18 17 18 19 19 18

161 241 155 124 100 168 104

57 57 55 57 57 57 57

Housekeeping gene Cyclophilin A NM_017101

GAGTGGCTGGATGGCAAG

18

GCCCGCAAGTCAAAGAAA

18

156

55–58

signaling genes NM_031820 NM_053615 NM_053824 NM_053357 NM_130429 NM_012669

The genes are categorized in three groups: Wnts and receptor genes, intracellular Wnt signaling genes and Wnt signaling target genes.

Immunohistochemistry, histochemistry and immunocytochemistry Fractured femurs from each PFD were dissected free of soft tissue, fixed in 10% buffered formalin, decalcified in 5% formic acid and embedded in paraffin (Polysciences). Serial longitudinal sections (10 μm) were then cut from each sample. Immunohistochemical analysis was performed on callus sections using a rabbit anti-β-catenin polyclonal antibody (Upstate USA) and a goat antidishevelled polyclonal antibody (Chemicon). Sections were initially deparaffinized using xylene, rehydrated through an ethanol gradient and permeabilized with 0.25% Triton X-100 in PBS buffer, followed by blocking with 8% BSA in PBS buffer, and then incubated with or without (for an adjacent negative control section) primary antibodies diluted in 1% BSA (1:50 for antidishevelled and 1:200 for anti-β-catenin) at 4°C overnight. Following washings in 1× PBS, sections were then incubated with the appropriate biotinylated secondary antibodies (1:500). Antibody labeling was visualized using the ABC reagent (Vector) and DAB reagent (Vector). In addition, Safranin O/Fast green staining was performed on adjacent sections using standard histochemical staining procedures. All sections were analyzed under bright field

microscopy using a Zeiss Axiovert 200 microscope and images were captured with a CCD camera (Zeiss). For analyzing the effects of Dvl1, 2 and 3 RNAi on nuclear β-catenin (unphosphorylated) levels in RCJ cells, all RNAi plasmids were cotransfected with an EGFP plasmid (Clontech, ratio of 5:1) in order for us to be able to identify the transfected cells. These cells were initially plated on coverslips and 24 h post-transfection, they were washed with PBS buffer, and fixed and permeabilized in freshly prepared methanol and acetone solution (50%/50%, v/ v) for 3 min at room temperature. Following washing with 1× PBS and blocking with 3% goat serum, a monoclonal mouse anti-unphosphorylated β-catenin antibody [36] (1:200) was applied to cells and incubated overnight at 4°C. After PBS washings, the cells were incubated with a goat-anti-mouse secondary antibody (1:200) conjugated to TRITC for 60 min at RT. Following PBS washings, the coverslips were mounted using Vectashield mounting medium (Vector) containing DAPI for counterstaining. The same procedure but omitting primary antibody was applied to RCJ cells that served as negative control. All samples were analyzed using a Zeiss Axiovert 200 microscope under epifluorescence and images were captured with a CCD camera (Zeiss).

Table 2 Primer sequences and length, generated amplicon size and melting temperature corresponding to the six target genes and Cyclophilin A (housekeeping gene) used in the analysis of RNA from RCJ cells Target gene

Accession #

Forward (5′ to 3′)

Primer size (nt)

Reverse (5′ to 3′)

Primer size (nt)

Amplicon size

Tm (°C)

Dvl1 Dvl2 Dvl3 COL2A1 COLX Sox9 Cyclophilin A

NM_031820 XM_239254 XM_221304 NM_012929 AJ131848 AB073720 NM_017101

GCCATCACACGCACCA TGGGGTGGTGAAGGAAGA GCCTATGGCTTTCCCTTACC GACCTGAAACTCTGCCACC ACCTGGGGCAACTTAGAAAA CCGACACGGAGAACACAC GAGTGGCTGGATGGCAAG

16 18 20 19 20 18 18

AGCCAGTCCACCACATCC TGGTGGAGGTGGAGGAAC AGCTTTTGGGTCCTTCTCCT TGTGCTTCTTCTCCTTGCTC CAGTGGAATAGAAGGCACACA CAGTCATAGCCCTTCAGCAC GCCCGCAAGTCAAAGAAA

18 18 20 20 21 20 18

209 157 184 187 179 140 156

58 58 58 58 58 58 55–58

8

N. Zhong et al. / Bone 39 (2006) 5–16

Fig. 1. Transcriptional activation of Wnt signaling genes during fracture repair. (A) Temporal expression of Wnt pathway members (Wnt5A, Frizzled-2, CKIIA1 and β-catenin) and target genes (Fibronectin, OSF-2, Connexin43, RARG) as determined by microarray and Q-PCR. Both analyses were performed on pooled RNA samples (n = 4 animals/time point) from intact femurs and fracture calluses at PFD 3, 5, 7, 10, 14 and 21 (n = 3). Plotted values represent average fold changes relative to intact bone (normalized to Cyclophilin A) with error bars indicating the standard deviation among replicates (n = 3) in Q-PCR experiments. Linear regression and correlation analysis of Q-PCR versus microarray generated the indicated R2 and P values. (B, C, D) Results of Q-PCR analysis of Wnt pathway members (Wnt4, Wnt5B, CKIA1, TCF1, LEF1 and LRP5), target genes (En-1, PPARD, CD44) and all three Dishevelled genes (Dvl1, Dvl2, Dvl3). All analyses were performed on pooled RNA samples (n = 4 animals/time point) from intact femurs and fracture calluses at PFD 3, 5, 7, 10, 14 and 21 (n = 3). Results are reported as average fold changes relative to intact bone with error bars denoting the standard deviations among replicates (n = 3).

N. Zhong et al. / Bone 39 (2006) 5–16

9

RNA interference Four RNAi target sequences of 19–21 nucleotides were chosen from different regions for each of the three Dvl genes (Dvl1, Dvl2 and Dvl3). To reduce the possibility of obtaining overlapping RNAi effects on the Dvl genes, pairwise BLAST (Basic Local Alignment Search Tool, http://www.ncbi.nlm. nih.gov/BLAST/) of mRNA sequences between the three Dvl genes were performed so that sequences with significant homology could be avoided in the design. Preliminary experiments with RCJ cells were conducted in order to be able to select the RNAi candidate with the highest efficiency in knocking down the target mRNA. This was accomplished by transient transfections with empty vector (pSUPER) [37] or RNAi containing plasmids in conjunction with Western analyses. Note that since transfections were based on non-viral means (use of Fugene), ∼30–40% of the cells were actually transfected (transfection efficiency was monitored by the use of a beta-galactosidase plasmid and X-gal staining). Compared with vector controls, the RNAi plasmids reproducibly leading to the most significant reduction of the target protein were selected and used for all downstream studies. For each of the three target Dvl genes, there were 1 or 2 RNAi plasmids (out of the 4 tested) that reproducibly failed to show any reduction, indicating that effect of the RNAi is sequence-specific. Moreover, Western blotting was also used to confirm that the selected RNAi plasmids were only effective in silencing their specific target Dvl protein without affecting the other Dvl members (data not shown). The final selected (and most effective) RNAi target sequences were: Dvl1: 5′-GCGACATGTTGCTGCAGGT-3′ (sense); 5′-ACCTGCAGCAACATGTCGC-3′ (antisense); Dvl2: 5′-CAGAACTGACAGCTAGCCGTC-3′(sense); 5′-GACGGCTAGCTGTCAGTTCTG-3′ (antisense); Dvl3: 5′-AGCAGTGGCTCCAACCGAAGT-3′(sense); 5′-ACTTCGGTTGGAGCCACTGCT-3′(antisense). Lastly, differentiation was induced with Ascorbic acid (50 μg/ml) and β-Glycerolphosphate (10 μM) upon 90–100% confluence (Day 2 post-transfection). At days 4 and 6 posttransfection, all cultures were stained with alcian blue. For quantitative measurements of RCJ differentiation, Alcian blue bound to proteoglycans in the cartilage nodules of the cell cultures was eluted with 4% Guanidine hydrochloride, and quantified by measurements at OD600 in a spectrophotometer. Results are reported as the average OD from the three wells/time point ± standard deviation.

Cell proliferation RCJ proliferation was assessed as a function of metabolic activity using the Cell Titer 96AQueous One solution (MTS assay, Promega). Cells were plated in triplicate in 24-well plates at 5 × 104 cells per well. Following treatment, Cell Titer 96AQueous One solution was added to each well and the plates were then incubated for 90 min at 37°C. The absorbance of each sample was measured in a spectrophotometer (490 nm). Results are reported as the average of OD from the three wells/time point ± standard deviation. Fig. 1 (continued).

Western blotting For Western analyses, protein samples were pooled from 4 animals each for the intact and PF days 3, 5 and 7 time points, with 3 animals pooled for PF day 10. Monoclonal antibodies for Dvl1, 2 and 3 (Santa Cruz) and β-Actin (Sigma) were used in conjunction with HRP-conjugated secondary antibodies and the Chemiluminecent ECL Detection Kit (Chemicon). Protein samples from tissue or RCJ cells or isolated nuclei were quantified by BCA assay and for each of the blots, equal amount (20–40 μg) of each protein pool was fractionated by SDSPAGE and transferred to Protran nitrocellulose membrane (Schleicher and Schuell). The transferred proteins were visualized by Ponceau S staining prior to blocking. Blots were then incubated in blocking buffer (TBST with 5% non-fat dry milk) for 1 h at room temperature (RT) with agitation, followed by the addition of the primary antibody (in blocking buffer) overnight at 4°C with agitation. Next, blots were washed in TBST (1 × 15 min, 2 × 10 min, RT) and incubated with secondary antibodies for 1 h at RT with agitation. Blots were again washed in TBST (1 × 15 min, 2 × 10 min, RT) and incubated in ECL solution for 3 min, followed by exposure to film (Kodak Biomax MR).

Statistical analysis The quantitative data shown throughout this report were the average results of three or more independent experiments with standard deviation indicated by error bars. For Fig. 1, linear regression and correlation analysis of Q-PCR versus microarray generated the indicated R2 and P values. For Fig. 3A, statistical significance was determined using ANOVA on ranks with a Holm–Sidak post hoc normalized to Day 1 (SigmaStat 3.1). For Fig. 4, statistical significance was determined by using a one-way ANOVA with Holm–Sidak post hoc on the raw data normalized to day 1 average values (SigmaStat 3.1). Lastly, for Figs. 5B and 6A–C, statistical significance was determined using ANOVA on ranks with a Holm–Sidak post hoc normalized to empty vector control (SigmaStat 3.1).

Results Temporal mRNA expression analyses Our previous combination of suppressive subtractive hybridization ([SSH) and microarray experiments revealed

10

N. Zhong et al. / Bone 39 (2006) 5–16

activation of Wnt signaling during bone regeneration [1]. Specifically, we detected mRNA upregulation of both signaling members of the pathway (Wnt5A, Frizzled2, CK2A1 and βcatenin), as well as various pathway target genes (fibronectin, connexin43, OSF-2 and RARG) over the first 21 days PF. Since it is well known that microarray is a high throughput method resulting to fluctuations in expression levels, these data were verified using quantitative measurements of mRNA expression with Q-PCR. Results from these experiments are shown in Fig. 1A. In all cases, there was a similar pattern of upregulated expression between data obtained with microarray and Q-PCR. In fact, linear regression and correlation analysis of the two data sets yielded a range of R2 value between 0.49 and 0.94 verifying the similarity in expression patterns as revealed by the two techniques (Fig. 1A). The exception was the analysis of Wnt5A that showed a poor correlation, R2 = 0.6. Regardless, the expression levels of all genes was upregulated with the highest fold changes over intact (unfractured) bone that ranged between ∼3-, 18-, 1.5-, 2.5-, 6-, 20-, 4.5- and 2.5-fold (at a specific time point) for Wnt5A, Frizzled2, CKIIA1, β-catenin, fibronectin, connexin43, OSF-2 and RARG, respectively (Fig. 1A). In addition to these genes, we wanted to investigate whether the expression of other Wnt signaling molecules and target genes is also upregulated during bone regeneration and thus more conclusively determine the extent of the activation of the signaling pathway. Therefore, we chose to examine Wnt pathway genes, Wnt-4, Wnt5-A, CKIA1, TCF1, LEF1, LRP5, target genes, En-1, PPARD and CD44, and the three Dvl members (Dvl1–3). Once again, Q-PCR was utilized in these analyses and results are shown in Figs. 1B, C and D. As expected, all of the genes assayed were found to be upregulated with fold changes that ranged from ∼1.5- to 11-fold higher (at a specific time point) than the control intact bone, except, LEF1 which was found to be downregulated (Fig. 1B). Temporal and spatial Dvl and β-catenin expression analyses Since we decided to focus on β-catenin and Dvl for further studies (see Discussion), we sought to investigate their temporal and spatial protein expression during bone regeneration. We therefore performed Western analysis using protein isolated from PF days 3–10 calluses (Fig. 2) and immunohistochemistry using adjacent PF day 10 callus sections (Fig. 2). Quantitative results from Western analyses revealed that all three Dvl members are expressed during the early phases of fracture repair with peaks (∼1.5–5.6-fold increase) in protein expression at PF days 3–7, as compared to intact bone. Similarly, β-catenin protein expression also peaked (∼1.4–2-fold increase) at PF days 3–10 (Fig. 2). These results are in agreement with the elevated mRNA levels detected with Q-PCR for all three Dvl genes, as well as β-catenin (Figs. 1A and C). More specifically, with both mRNA and protein analyses, Dvl2 consistently displayed lower expression in comparison to Dvl1 and 3 (Figs. 1C and 2). Not surprising, Dvl and β-catenin expression was also detected in intact bone (Fig. 2). In conjunction with Western analysis, we also performed immunohistochemical studies in order to localize the cellular

source of Dvl and β-catenin within the fracture callus. We chose to analyze PF day 10 sections because this time point best represents the various biological processes (i.e. intramembranous ossification, chondrogenesis, endochondral ossification) ongoing simultaneously within the fracture callus. In addition, we stained adjacent sections with Safranin O/Fast green in order to clearly identify and define regions of cartilage (red) and bone (blue) (Figs. 2A and B). Both Dvl and β-catenin displayed the same pattern of protein expression, that is, both proteins were expressed by cells within areas of fibrocartilage, cartilage (Figs. 2C and D), woven bone and periosteum (Figs. 2F and G). More specifically, within areas of cartilage, both Dvl and β-catenin are localized within proliferating and pre-hypertrophic chondrocytes (white arrows) while hypertrophic chondrocytes (black arrows) were devoid of labeling (Figs. 2C and D). Further, in areas of intramembranous ossification, osteoblasts lining the regions of newly formed woven bone and those becoming trapped in new bone (destined to differentiate into osteocytes) stained strongly for both Dvl and β-catenin (Black arrowheads in Figs. 2F and G). In addition, strong staining was detected in osteoprogenitor cells found in the various layers of the periosteum (Figs. 2F and G). Sections immunostained with secondary antibodies alone served as negative controls and resulted in no staining (Fig. 2E). Dvl1, 2 and 3 knockdown in RCJ cells In order to assess the involvement of Dvl1, 2 and 3 in RCJ chondrocyte proliferation and differentiation (we chose this cell line because it is a well established in vitro model for chondrogenic differentiation [35]), we initially sought to establish the temporal mRNA expression of Dvl1, 2 and 3, during normal RCJ proliferation and differentiation. Results from these experiments reveal that Dvl2 and 3 mRNAs increase during RCJ proliferation and differentiation (Fig. 3A). In contrast, Dvl1 expression is not changed during the same time points (Fig. 3A). Based on these data, we proceeded to knockdown the protein production of all three Dvl genes using RNAi targeting each specific member. The specificity of each Dvl RNAi was established by monitoring Dvl proteins using Western analysis. We observed an overall 22%, 22% and 58.5% inhibition of Dvl1, Dvl2 and Dvl3 protein levels, respectively, as compared to empty vector transfected cells (Fig. 3B). Percent inhibition is derived from the ratio of the mean intensity value (Kodak ID 3.6 program) of each of the vector and Dvl bands divided by that of the corresponding actin band, and by setting the value for Vector at 100%. It is noteworthy to mention that since transfections were based on non-viral means (use of Fugene), only ∼30–40% of the cells were actually transfected (transfection efficiency was monitor by the use of a beta-galactosidase plasmid and X-gal staining, data not shown). Thus, we only expected a fraction of each of the total target protein to be eliminated. In addition, Western blotting was also used to confirm that the selected RNAi plasmids were only effective in silencing their specific target Dvl protein without affecting the other Dvl members (data not shown). Lastly, no changes in β-actin protein levels were

N. Zhong et al. / Bone 39 (2006) 5–16

11

Fig. 2. Protein analysis of Dvl and β-catenin during fracture repair. Western analysis of Dvl1, 2 and 3 and β-catenin during fracture repair. Protein samples were pooled (n = 4 animals/time point) from intact bone and PF days 3, 5, 7 and 10 fracture calluses and used in SDS-PAGE and Western analysis as described in Materials and methods. Digitally scanned images of detected bands of Dvl1, 2 and 3 and β-catenin are shown to illustrate protein expression. β-actin expression used as a control indicates that the amount of proteins loaded per lane was the same. Graph shows the temporal expression patterns as determined by integrated optical density. Plotted values represent fold changes relative to intact bone after background subtraction and normalization to β-actin. Immunohistochemical analysis of Dvl and β-catenin on PF day 10 callus sections. (A) Safranin O/Fast green staining of PF day 10 callus section showing the fracture callus and illustrating regions of fibrocartilage (Fca), cartilage (Ca), periosteum (Pe) and newly formed woven bone (Wb). (B) Higher magnification view of the cartilaginous zone from panel A (white box). (C and D) Adjacent sections from that shown in panels A and B, showing Dvl and β-catenin immunolocalization in proliferating chondrocytes (white arrows) and little to no staining in hypertrophic chondrocytes (black arrows), respectively. (E) Adjacent section to those seen in panels F and G but stained only with secondary antibodies indicating no staining (negative control). (F and G) View of woven bone regions (indicated by black box in panel A) illustrating immunoreactivity of Dvl and β-catenin in both newly trapped osteoblasts/osteocytes (black arrowheads) and osteoblasts that line surfaces of newly formed bone (white arrowheads) as well as periosteal osteoprogenitor cells (Pe). Scale bars for panel A = 1 mm, panels B–D = 20 μm, and panels E–G = 10 μm.

detected between vector or Dvl RNAi transfected RCJ cells, as expected (Fig. 3B). Next, we investigated the proliferation rates of RCJ cells over 5 days in the presence of empty vector control or Dvl1, 2 or 3 RNAi following transient transfections. At day 5, we observed a 33, 20 and 29% inhibition of cell proliferation in the presence of Dvl1, 2 or 3 RNAi, respectively, as compared to empty vector control (Fig. 4). Similarly, we observed a robust suppression of RCJ differentiation using Dvl1, 2 or 3 RNAi using Alcian blue staining (Fig. 5). It is clearly evident, especially by the high magnification photographs, that the number and size of nodule formation were decreased substantially in the presence of the Dvl1, 2 or 3 RNAi (Fig.

5A). In order to quantitate the inhibition of differentiation, we eluted the Alcian blue dye from the cultures and measured its optical density. Results indicated a 21, 67 and 63% (for posttransfection day 4) and a 29, 59 and 67% (for post-transfection day 6) inhibition as compared to empty vector control with Dvl1, 2 or 3 RNAi, respectively (Fig. 5B). To confirm the inhibitory effects of Dvl RNAi at the molecular level, we examined the mRNA expression levels of three well established markers of chondrocyte differentiation, the extracellular molecules, collagen II (early marker) and collagen X (late marker) and the transcription factor, SOX9 (early marker). Similar to our differentiation experiments, we examined their expression at post-transfection day 4 and 6 and

12

N. Zhong et al. / Bone 39 (2006) 5–16

was used to clearly delineate the nucleus (Figs. 7A, C, E and G). Results from these experiments reveal a reduction of unphosphorylated β-catenin in the presence of Dvl1, 2 and 3 RNAi (Figs. 7D, F and H, respectively), as compared to an empty vector control (Fig. 7B). These results are congruent with results from isolated nuclear extracts that show that Dvl2 and Dvl3 had a stronger inhibitory effect (26 and 20%, respectively) than Dvl1 RNAi [16%] in reducing the amount of nuclear unphosphorylated β-catenin, as compared to vector treatment (Fig. 7, bottom). Percent inhibition is derived from the ratio of the mean intensity value (Kodak ID 3.6 program) of the unphosphorylated β-catenin band divided by that of the arbitrary band, and by setting the value for Vector at 100%. Discussion

Fig. 3. Dvl expression during RCJ cell differentiation and RNAi silencing. (A) Dvl1, 2 and 3 mRNA expression during RCJ differentiation (days 1–6) as determined by Q-PCR analysis. Top panel shows alcian blue-stained cultures at the same time points to indicate the normal process of chondrocyte differentiation in RCJ cells. (B) RCJ cells were transfected with pcDNA/ SUPER vector control or Dvl1, 2 and 3 RNAi and analyzed as described in Materials and methods. Immunoblotting analysis verified that Dvl1, 2 and 3 RNAi inhibited expression of their respective target proteins. Dvl-1 and Dvl-3 RNAi were more effective in silencing than Dvl2. Statistical significance was determined using ANOVA on ranks with a Holm–Sidak post hoc normalized to Day 1. *P b 0.001, **P b 0.01, ***P b 0.05.

found that the mRNA levels for all three gene markers were robustly suppressed by the presence of the Dvl1, 2 or 3 RNAi (Fig. 6). Specifically, the suppression was more evident at posttransfection day 4 than 6, where the fold change in expression was ∼6- (COLII), 2- (COLX) and 1.5- (SOX9) fold lower with all three Dvl RNAi plasmids (Fig. 6). Since Dvl is known to induce the dissociation of the GSK3/ Axin/β-catenin complex which normally leads to phosphorylation of β-catenin followed by its polyubiquitination and proteosomal degradation, we reasoned that suppression of Dvl by RNAi will correlate with a subsequent decrease in unphosphorylated β-catenin within the nucleus. To test this, we transiently cotransfected RCJ cells with Dvl1, 2 or 3 RNAi and EGFP and 24 h later used a monoclonal antibody raised specifically against unphospohrylated β-catenin [36] to examine its nuclear presence. Cells were cotransfected with EGFP (marker) in order for us to be able to identify cells that were indeed transfected (Figs. 7A, C, E and G). In addition, DAPI

The data presented herein verify our previous data reporting on the activation of Wnt signaling during bone regeneration [1]. Specifically, we used Q-PCR to confirm the upregulation of the initial members (Wnt5A, Frizzled2, CK2A1 and β-catenin) and target genes (fibronectin, connexin43, OSF-2 and RARG) of the pathway as identified by SSH and microarray analysis. In addition, we also examined the expression of a number of other pathway members (Wnt4A, Wnt5B, Dvl1-3, CK1A1, TCF1, LEF1 and LRP5), as well as target genes (En-1, PPARD and CD44). With the exception of LEF1, all genes assayed displayed increased levels of mRNA expression, especially during PF days 5 and 14 (time of active bone and cartilage formation). These data confirm that Wnt signaling activation (as identified by increased expression of Wnt signaling genes, Fig. 1), as well as that of its target genes (fibronectin, connexin43, OSF-2, RARG, En-1, PPARD, CD44), is required for osteoblast and chondrocyte differentiation leading to osteogenesis and chondrogenesis, processes critical to fracture repair. The downregulation of LEF1 occurred during the early phases of the repair process (PF days 3–14), coinciding with the

Fig. 4. Knockdown of endogenous Dvl1, 2 and 3 by RNAi inhibits RCJ cell proliferation. RCJ cell proliferation in the presence of pcDNA/SUPER vector control or Dvl1, 2 and 3 RNAi was monitored for 5 days as described in Materials and methods. The number of cells was determined spectrophotometrically by the MTS assay at 1, 2, 3, 4 and 5 days of growth. Results are reported as average OD measurements with error bars denoting the standard deviations among replicates (n = 3). Statistical significance between empty vector and each of the Dvl RNAi-treated cells was determined by using a one-way ANOVA with Holm–Sidak post hoc on the raw data normalized to day 1 average values. *P b 0.001.

N. Zhong et al. / Bone 39 (2006) 5–16

13

expression occurs during the time period coinciding with peak osteoblast differentiation and overall intramembranous ossification (PF days 3–14), as our data indicate. Although, the involvement and importance of Wnt signaling have been clearly established in the mammalian skeletal system [40], the exact mechanism of Dvl action is not well known. In fact, only one study deals with the direct functional contribution of Dvl in the skeletal system and reports that genetic inactivation of Dvl2 results in vertebral and rib malformations

Fig. 5. Knockdown of endogenous Dvl1, 2 and 3 by RNAi inhibits RCJ cell differentiation. (A) RCJ cell proliferation in the presence of pcDNA/SUPER vector control or Dvl1, 2 and 3 RNAi was monitored using alcian blue staining at 4 and 6 days post-transfection as described in Materials and methods. Left panels for both days show actual alcian-stained cell cultures while right panels show a micrograph of a random region from the respective dish and indicate nodule formation and size. (B) Quantitative measurement of eluted alcian blue from pcDNA/SUPER vector control or Dvl1, 2 and 3 RNAi-treated cultures shown in panel A. Results are reported as average OD measurements with error bars denoting the standard deviations among replicates (n = 3). Statistical significance between empty vector and each of the Dvl RNAi-treated cells was determined using ANOVA on ranks with a Holm–Sidak post hoc (normalized to empty vector control). *P b 0.001.

peak of osteoblast differentiation and subsequent intramembranous ossification. However, as healing progresses and the process of intramembranous ossification slows down (represented by PF day 21), LEF1 mRNA levels are restored to those observed for intact bone. Since, it is known that LEF1 represses Runx2-dependent activation of the osteocalcin promoter in osteoblasts [38], it is then not surprising that LEF1 is downregulated during fracture repair. This is consistent with knowledge that Runx2, a transcription factor, is required for osteoblast development [39], and that this process is necessary for callus development and maturation, as well as successful bone regeneration. In this aspect, LEF1, would appear to be an inhibitor of osteoblast differentiation and thus if its expression levels did not decrease during bone regeneration (as observed in this study), then intramembranous ossification would be retarded, leading to impaired or delayed fracture healing. So it is consistent then that LEF1 is downregulated during fracture repair, and that the maximum suppression of LEF1 mRNA

Fig. 6. Knockdown of endogenous Dvl1, 2 and 3 by RNAi suppresses chondrogenic differentiation marker expression. Results of Q-PCR analysis of (A) Collagen type II (COLII), (B) Collagen type X (COLX) and (C) SOX9 in the presence of pcDNA/SUPER vector control or Dvl1, 2 and 3 RNAi indicate suppression of all three chondrogenic markers at post-transfection days 4 and 6. Results are reported as average fold changes with error bars denoting the standard deviations among replicates (n = 3). Statistical significance between empty vector and each of the Dvl RNAi-treated cells was determined using ANOVA on ranks with a Holm–Sidak post hoc (normalized to empty vector control). *P b 0.001, **P b 0.01, ***P b 0.05.

14

N. Zhong et al. / Bone 39 (2006) 5–16

Fig. 7. Knockdown of endogenous Dvl1, 2 and 3 by RNAi suppresses accumulation of unphosphorylated β-catenin in the nucleus. (Top) Immunocytochemical analysis of RCJ cells with an unphosphorylated β-catenin specific mAb as described in Materials and methods. Left panel photographs (A, C, E, G) indicate DAPI (blue) and EGFP staining (green). GFP was used to cotransfect cells with pcDNA/SUPER vector control (A) or Dvl1 (C), 2 (E) and 3 (G) RNAi. Right panel photographs (B, D, F, H) show images of the identical cells from the left panel and indicate the presence of unphosphorylated β-catenin in the nucleus of pcDNA/SUPER vector control (B) or Dvl1 (D), 2 (F) and 3 (H) RNAi. Scale bar = 10 μm. (Bottom) Western analysis on nuclear extracts isolated from vector (V), Dvl1, Dvl2 and Dvl3 RNAi transfected cells (Dvl1i, Dvl2i, Dvl3i, respectively). Arbitrary band represents a random band from the ponceau-stained blot that serves as an indicator of the amounts loaded on the gel.

which are even more pronounced in mice deficient for both Dvl1 and Dvl2 [26]. Rather, the majority of published manuscripts focus mainly on the effects of Wnts, frizzled, LRP5 and β-catenin [40]. For these reasons, as well as the fact that Dvl plays a central role by being the first intracellular molecule in the Wnt pathway to transduce the signal from the receptor complex leading to the activation of β-catenin [41], we decided to focus on Dvl. In detail, Dvl induces the dissociation of the GSK3/Axin/β-catenin complex which normally leads to phosphorylation of β-catenin followed by its polyubiquitination and proteosomal degradation. In the absence of this inhibitory complex, unphosphorylated β-catenin enters the nucleus where it binds to members of the LEF/TCF family of transcription factors and alters the activity of Wnt target genes [3]. Aside from the role of Dvl in the Wnt canonical pathway, Dvl also plays a crucial role in the Wnt/Ca++ pathway that activates CamKII and PKC [42,43], and in Wnt/Planar polarity pathway that involves JNK and cytoskeletal rearrangements [4]. As such, Dvl represents a pivotal molecule in these three Wnt signaling pathways. Utilizing Western analysis and subsequent quantitative measurements, we have determined that all three Dvl members (1, 2, 3) are upregulated during bone regeneration, especially during PF days 5–14 coinciding with active osteogenesis, chondrogenesis and subsequent endochondral ossification. Consistent with these data, we have localized the spatial expression of Dvl in periosteal osteoprogenitor cells, young active osteoblasts in areas of newly woven bone (through intramembranous ossification) and proliferating/pre-hypertrophic chondrocytes within the cartilagenous soft callus. Because expression of Dvl was so robust in chondrocytes and since there is a wealth of data on the involvement of Wnt signaling during limb development [8–10,44,45], a process similar to bone regeneration, we decided to focus on the functional contribution of Dvl in the chondrogenic lineage using the RCJ cells as a model. Having determined the basal level of Dvl1, 2 and 3 expression during normal RCJ cell differentiation, we used a knockdown (siRNA) approach to silence all three Dvl isoforms individually. Another recent study utilized siRNA to silence Dvl1, 2 and 3 in CHO cells and found that only the specific knockdown of Dvl2 expression reduced Wnt3a-dependent changes in cell shape and movement suggesting that Dvl2 is the specific isoform with a predominant role in mediating Wnt-3adependent motility in CHO cells [46]. Similarly, knockdown of Dvl2 in endothelial cells implicated its role in cell migration via rearrangements of the actin cytoskeleton [47]. Furthermore, two other studies probed the functional aspects of mammalian Dvl. For example, it was reported that by deleting a large portion of the Dvl C-terminal (includes the PDZ and DEP domains, essential for Dvl-induced JNK activation), it caused Dvl to become a more potent activator of the canonical pathway. This study also reported that the activity of Dvl is modulated by casein kinase Iε (CKIε); stimulated in the canonical pathway and inhibited in the JNK pathway [48]. Based on these results, the authors concluded that CKIε functions as a switch to direct Dvl from the planar polarity to the canonical Wnt pathway.

N. Zhong et al. / Bone 39 (2006) 5–16

Consistent with these results, it was also established that Wntinduced phosphorylation of Dvl can activate both canonical and non-canonical signaling pathways [49]. Although, we did not directly address the structural significance of the three conserved domains of Dvl, nor the biochemical mechanism(s) of how downregulation of Dvl isoforms inhibits chondrocyte proliferation and differentiation, others have described these in different model organisms (Xenopus, Caenorhabditis, Drosophila), as well as cell lines. It is now well established that there are at least 18 Dvl associated proteins that positively or negatively regulate Dvl and thus it is believed that Dvl functions in a multimeric protein complex that enables correct transmission of Wnt signals [22]. More importantly, some of these Dvl associated proteins are protein kinases (CK1, CK2, Par-1, MuSK) and phosphatases (PP2Cα), β-catenin pathway-specific proteins (Axin, NkD, GFP/Frat, Idax, Fodo/Dpr), planar cell polarity pathway-specific proteins (Vang/Stbm, Prickle, Daam1), as well as others (Notch, βarrestin, Eps8). There is a plethora of data on the function of these proteins implicating them in diverse functions including proliferation, differentiation, cell fate decisions, morphogenesis, segment polarity, body axis formation, etc. [22]. Undoubtedly, Dvl interactions with some of these proteins occur in RCJ cells and probably have effects on cellular behavior as observed in our studies. Clearly, having demonstrated a biological contribution of the various Dvl isoforms in vitro, it will be interesting to further examine the biochemical mechanism(s), but more importantly, the in vivo effects of Dvl deficiency, especially in the skeletal system. In this regard, both Dvl1- and Dvl2-deficient mice have been previously generated and did reveal specific phenotypes. In the case of Dvl1, deficient mice display abnormalities in social interaction and sensorimotor gating, without any apparent problems in their skeletal system [27]. In contrast, Dvl2-deficient mice exhibit defects in the cardiovascular outflow track, somite segmentation, neural tube closure, as well as in vertebrae (disorganized and abnormal vertebral bodies) and ribs (forked and fused) [26]. Interestingly, these skeletal malformations were more prominent in Dvl1 and Dvl2 double knockouts, with numerous collapsed vertebrae and extensive fusion of the ribs along the vertebral column [26]. Taken together, these results indicate that there is a functional redundancy in the skeletal system between Dvl1 and 2. It would be highly informative to generate a Dvl3-deficient mouse in order to compare its phenotype to those of Dvl1 and 2 knockout mice. In line with this work, our Dvl functional data also revealed differences in the effects of specific Dvl deficiency on cellular behavior. For example, Dvl2 and Dvl3 RNAi inhibited RCJ proliferation and differentiation, downregulated the expression of chondrogenic-specific markers (ColII, ColX, Sox9) and decreased the entry of unphosphorylated β-catenin into the nucleus much more robustly than did Dvl1 RNAi. Specifically, the downregulation of ColII, ColX and Sox9 coupled to the observed decrease of unphosphorylated β-catenin in the nucleus in the presence of Dvl RNAi implicates the involvement of the Wnt/β-catenin canonical pathway rather than the non-canonical

15

pathways in chondrogenic proliferation and differentiation. This is consistent with previous data showing that interactions between Sox9 and β-catenin control chondrocyte differentiation [20], as well as the observation that the Wnt/β-catenin canonical pathway stimulates maturation and hypertrophy of chondrocytes and ectopic endochondrial ossification [44–50]. Collectively, the greater inhibitory effects of Dvl2 and Dvl3 RNAi is consistent with our finding that Dvl1 expression does not change during the proliferation and differentiation of RCJ cells, unlike that of Dvl2 and Dvl3 (indicated by our data). In this context, each different Dvl isoform or their combinations may have specific effects depending upon the cell/tissue type. Regardless, the data presented here show the involvement of Wnt signaling in bone regeneration and implicate Dvl in chondrogenic proliferation and differentiation via the Wnt/βcatenin canonical signaling pathway. Acknowledgments We are grateful to Drs. Jane Aubin and William Horton for supplying the RCJ cells, Dr. Michael Frohman for providing the pcDNA/SUPER vector and Dr. Jen-Chih Hsieh for giving us the unphosphorylated β-catenin-specific antibody. In addition, we thank Frank Lombardo for help with the microarray data and David Komatsu for critically reading the manuscript as well as for helpful discussions. Lastly, we thank Rosemary Gaynor for secretarial support. This study was supported by a generous grant from NASA (MH). References [1] Hadjiargyrou M, Lombardo F, Zhao S, Ahrens W, Joo J, Ahn H, et al. Transcriptional profiling of bone regeneration. Insight into the molecular complexity of wound repair. J Biol Chem 2002;277: 30177–30182. [2] Moon RT, Bowerman B, Boutros M, Perrimon N. The promise and perils of Wnt signaling through beta-catenin. Science 2002;296:1644–6. [3] Strutt D. Frizzled signalling and cell polarisation in Drosophila and vertebrates. Development 2003;130:4501–13. [4] Huelsken J, Birchmeier W. New aspects of Wnt signaling pathways in higher vertebrates. Curr Opin Genet Dev 2001;11:547–53. [5] Huang HC, Klein PS. The Frizzled family: receptors for multiple signal transduction pathways. Genome Biol 2004;5:234. [6] Church V, Nohno T, Linker C, Marcelle C, Francis-West P. Wnt regulation of chondrocyte differentiation. J Cell Sci 2002;115:4809–18. [7] Tuan RS. Cellular signaling in developmental chondrogenesis: N-cadherin, Wnts, and BMP-2. J Bone Joint Surg Am 2003;85-A(Suppl 2):137–41. [8] Daumer KM, Tufan AC, Tuan RS. Long-term in vitro analysis of limb cartilage development: involvement of Wnt signaling. J Cell Biochem 2004;93:526–41. [9] Hartmann C, Tabin CJ. Dual roles of Wnt signaling during chondrogenesis in the chicken limb. Development 2000;127:3141–59. [10] Kawakami Y, Wada N, Nishimatsu SI, Ishikawa T, Noji S, Nohno T. Involvement of Wnt-5a in chondrogenic pattern formation in the chick limb bud. Dev Growth Differ 1999;41:29–40. [11] Yang Y, Topol L, Lee H, Wu J. Wnt5a and Wnt5b exhibit distinct activities in coordinating chondrocyte proliferation and differentiation. Development 2003;130:1003–15. [12] Hartmann C, Tabin CJ. Wnt-14 plays a pivotal role in inducing synovial joint formation in the developing appendicular skeleton. Cell 2001; 104:341–51. [13] Boland GM, Perkins G, Hall DJ, Tuan RS. Wnt 3a promotes proliferation

16

[14]

[15]

[16]

[17]

[18] [19]

[20]

[21]

[22] [23]

[24]

[25]

[26]

[27]

[28] [29]

[30]

[31]

N. Zhong et al. / Bone 39 (2006) 5–16 and suppresses osteogenic differentiation of adult human mesenchymal stem cells. J Cell Biochem 2004;93:1210–30. Rawadi G, Vayssiere B, Dunn F, Baron R, Roman-Roman S. BMP-2 controls alkaline phosphatase expression and osteoblast mineralization by a Wnt autocrine loop. J Bone Miner Res 2003;18:1842–53. Gong Y, Slee RB, Fukai N, Rawadi G, Roman-Roman S, Reginato AM, et al. LDL receptor-related protein 5 [LRP5] affects bone accrual and eye development. Cell 2001;107:513–23. Kato M, Patel MS, Levasseur R, Lobov I, Chang BH, Glass II DA. Cbfa1independent decrease in osteoblast proliferation, osteopenia, and persistent embryonic eye vascularization in mice deficient in Lrp5, a Wnt coreceptor. J Cell Biol 2002;157:303–14. Brault V, Moore R, Kutsch S, Ishibashi M, Rowitch DH, McMahon AP, et al. Inactivation of the beta-catenin gene by Wnt1-Cre-mediated deletion results in dramatic brain malformation and failure of craniofacial development. Development 2001;128:1253–64. Glass D, Patel M, Long F, Taketo M, McMahon A, Karsenty G. Regulation of bone formation by Wnt signaling. JBMR 2003;18:S14 [Abstract]. Ryu JH, Kim SJ, Kim SH, Oh CD, Hwang SG, Chun CH, et al. Regulation of the chondrocyte phenotype by beta-catenin. Development 2002;129: 5541–50. Akiyama H, Lyons JP, Mori-Akiyama Y, Yang X, Zhang R, Zhang Z, et al. Interactions between Sox9 and beta-catenin control chondrocyte differentiation. Genes Dev 2004;18:1072–87. Guo X, Day TF, Jiang X, Garrett-Beal L, Topol L, Yang Y. Wnt/betacatenin signaling is sufficient and necessary for synovial joint formation. Genes Dev 2004;18:2404–17. Wharton Jr KA. Runnin' with the Dvl: proteins that associate with Dsh/Dvl and their significance to Wnt signal transduction. Dev Biol 2003;253:1–17. Sussman DJ, Klingensmith J, Salinas P, Adams PS, Nusse R, Perrimon N. Isolation and characterization of a mouse homolog of the Drosophila segment polarity gene dishevelled. Dev Biol 1994;166:73–86. Klingensmith J, Yang Y, Axelrod JD, Beier DR, Perrimon N, Sussman DJ. Conservation of dishevelled structure and function between flies and mice: isolation and characterization of Dvl2. Mech Dev 1996;58:15–26. Tsang M, Lijam N, Yang Y, Beier DR, Wynshaw-Boris A, Sussman DJ. Isolation and characterization of mouse dishevelled-3. Dev Dyn 1996;207:253–62. Hamblet NS, Lijam N, Ruiz-Lozano P, Wang J, Yang Y, Luo Z, et al. Dishevelled 2 is essential for cardiac outflow tract development, somite segmentation and neural tube closure. Development 2002;129:5827–38. Lijam N, Paylor R, McDonald M, Crawley J, Deng C, Herrup K, et al. Social interaction and sensorimotor gating abnormalities in mice lacking Dvl1. Cell 1997;90:895–905. Bonnarens F, Einhorn TA. Production of a standard closed fracture in laboratory animal bone. J Orthop Res 1984;2:97–101. Hadjiargyrou M, Halsey MF, Ahrens W, Rightmire EP, McLeod KJ, Rubin CT. Cloning of a novel cDNA expressed during the early stages of fracture healing. Biochem Biophys Res Commun 1998;249:879–84. Hadjiargyrou M, Ahrens W, Rubin C. Temporal expression of the chondrogenic and angiogenic growth factor CYR61 during fracture repair. J Bone Miner Res 2000;15:1014–23. Hadjiargyrou M, Rightmire E, Ando T, Lombardo F. The E11 osteoblastic lineage marker is differentially expressed during fracture healing. Bone 2001;29:149–54.

[32] Lombardo F, Komatsu D, Hadjiargyrou M. Molecular cloning and characterization of Mustang, a novel nuclear protein expressed during skeletal development and regeneration. FASEB J 2004;18:52–61. [33] Komatsu DE, Hadjiargyrou M. Activation of the transcription factor HIF-1 and its target genes, VEGF, HO-1, iNOS, during fracture repair. Bone 2004;34:680–8. [34] Gersch R, Lombardo F, McGovern S, Hadjiargyrou M. Re-activation of Hox gene expression during bone regeneration. J Orthop Res 2005; 23:882–90. [35] Grigoriadis AE, Heersche JN, Aubin JE. Continuously growing bipotential and monopotential myogenic, adipogenic, and chondrogenic subclones isolated from the multipotential RCJ 3.1 clonal cell line. Dev Biol 1990;142:313–8. [36] van Noort M, Meeldijk J, van der Zee R, Destree O, Clevers H. Wnt signaling controls the phosphorylation status of beta-catenin. J Biol Chem 2002;277:17901–5. [37] Brummelkamp TR, Bernards R, Agami R. A system for stable expression of short interfering RNAs in mammalian cells. Science 2002;296:550–3. [38] Kahler RA, Westendorf JJ. Lymphoid enhancer factor-1 and beta-catenin inhibit Runx2-dependent transcriptional activation of the osteocalcin promoter. J Biol Chem 2003;278:11937–44. [39] Ducy P, Zhang R, Geoffroy V, Ridall AL, Karsenty G. Osf2/Cbfa1: a transcriptional activator of osteoblast differentiation. Cell 1997;89: 747–54. [40] Westendorf JJ, Kahler RA, Schroeder TM. Wnt signaling in osteoblasts and bone diseases. Gene 2004;341:19–39. [41] Seto ES, Bellen HJ. The ins and outs of Wingless signaling. Trends Cell Biol 2004;14:45–53. [42] Kuhl M, Sheldahl LC, Park M, Miller JR, Moon RT. The Wnt/Ca2+ pathway: a new vertebrate Wnt signaling pathway takes shape. Trends Genet 2000;16:279–83. [43] Sheldahl LC, Slusarski DC, Pandur P, Miller JR, Kuhl M, Moon RT. Dishevelled activates Ca2+ flux, PKC, and CamKII in vertebrate embryos. J Cell Biol 2003;161:769–77. [44] Enomoto-Iwamoto M, Kitagaki J, Koyama E, Tamamura Y, Wu C, Kanatani N, et al. The Wnt antagonist Frzb-1 regulates chondrocyte maturation and long bone development during limb skeletogenesis. Dev Biol 2002;251:142–56. [45] Church VL, Francis-West P. Wnt signalling during limb development. Int J Dev Biol 2002;46:927–36. [46] Endo Y, Wolf V, Muraiso K, Kamijo K, Soon L, Uren A, et al. Wnt-3adependent cell motility involves RhoA activation and is specifically regulated by dishevelled-2. J Biol Chem 2005;280:777–86. [47] Wechezak AR, Coan DE. Dvl2 silencing in postdevelopmental cells results in aberrant cell membrane activity and actin disorganization. J Cell Physiol 2005;202:867–73. [48] Cong F, Schweizer L, Varmus H. Casein kinase I epsilon modulates the signaling specificities of dishevelled. Mol Cell Biol 2004;24:2000–11. [49] Gonzalez-Sancho JM, Brennan KR, Castelo-Soccio LA, Brown AM, Gonzalez-Sancho JM, Brennan KR, et al. Mol Cell Biol 2004;24: 4468–757. [50] Kitagaki J, Iwamoto M, Liu JG, Tamamura Y, Pacifci M, EnomotoIwamoto M. Activation of beta-catenin-LEF/TCF signal pathway in chondrocytes stimulates ectopic endochondral ossification. Osteoarthr Cartil 2003;11:36–43.