Yeast Coexpression of Human Papillomavirus Types 6 and 16 Capsid Proteins

Virology 293, 335–344 (2002) doi:10.1006/viro.2001.1289, available online at http://www.idealibrary.com on

Yeast Coexpression of Human Papillomavirus Types 6 and 16 Capsid Proteins Daniela Tornese Buonamassa,* ,1 Catherine E. Greer,† ,1 Sabrina Capo,* T. S. Benedict Yen,‡ Cesira L. Galeotti,* and Giuliano Bensi* ,2 *Department of Molecular Biology, IRIS, Chiron S.p.A., Via Fiorentina 1, 53100 Siena, Italy; †Vaccine Research, Chiron Corporation, 4560 Horton Street, Emeryville, California 94608; and ‡Department of Pathology, VA Medical Center and University of California, San Francisco, California 94121 Received August 16, 2001; returned to author for revision September 12, 2001; accepted November 9, 2001 The L1 and L2 capsid proteins of animal and human papillomaviruses (HPVs) can self-assemble into virus-like particles (VLPs) that closely resemble native virions. The use of different animal models shows that VLPs can be very efficient at inducing a protective immune response. However, studies with infectious HPV virions and VLPs of different HPV types indicate that the immune response is predominantly type-specific. We have generated a diploid yeast strain that coexpresses the L1 and L2 capsid proteins of both HPV-6b and HPV-16, and we have purified fully assembled VLPs banding in a cesium chloride gradient at the expected density of 1.29–1.3 mg/ml. Experimental evidence strongly indicated that the four proteins coassembled into VLPs. Western blot analysis, using anti-HPV-6 and anti-HPV-16 L1-specific monoclonal antibodies and type-specific L2 antisera, demonstrated that all four proteins copurified. Most importantly, immunoprecipitation experiments, carried out using type-specific anti-L1 monoclonals and either total yeast cell extracts or purified VLPs, confirmed the interaction and the formation of covalent disulfide bonds between the two L1 proteins. Finally, HPV-6/16 VLPs administered to mice induced conformational antibodies against both L1 protein types. These results suggest that coexpression of different capsid proteins may provide new tools for the induction of antibodies directed against multiple HPV types. © 2002 Elsevier Science (USA)

Key Words: papillomavirus; capsid proteins; VLP assembly; yeast expression.

obtain VLPs, but its presence increases the efficiency of particle formation (Hagensee et al., 1993; Kirnbauer et al., 1993; Sasagawa et al., 1995; Zhou et al., 1993). Although capsomeric VLP subunits can induce in vitro neutralizing antibodies (Fligge et al., 2001; Rose et al., 1998), fully assembled VLPs meet most of the criteria that make them ideal surrogates of native virions. They resemble infectious particles by ultrastructural analysis (Hagensee et al., 1994), elicit high titers of virus-neutralizing antibodies, and bind to the putative receptor on the surface of mammalian cells (Muller et al., 1995; Qi et al., 1996; Roden et al., 1994; Unckell et al., 1997; Volpers et al., 1995). Most notably, the results obtained with animal models demonstrate that prophylactic immunization with VLPs can be very effective in vivo. Cottontail rabbits, calves, and dogs immunized with L1 VLPs are protected from subsequent challenge with the homologous PV (Jansen et al., 1995; Kirnbauer et al., 1996; Suzich et al., 1995), and passive transfer of immune sera confers protection to naive animals (Jansen et al., 1995; Suzich et al., 1995), indicating that an antibody-mediated response plays a major role in preventing virus infection. The efficacy of VLP-based anti-HPV vaccine candidates cannot be evaluated in animals, since these viruses exhibit a high degree of species specificity. Antibody-mediated virus neutralization has therefore been studied using either in vitro assays (Roden et al., 1996a; Smith et al.,

INTRODUCTION A promising strategy aimed at inducing an immune response capable of neutralizing papillomavirus (PV) infections is the use of virus capsid proteins as antigens. In the case of genital human papillomaviruses (HPVs), this approach is hampered by the lack of any in vivo or in vitro source of sufficient amounts of native virus. To overcome the problem, heterologous expression systems have been used extensively to obtain large quantities of capsid proteins and to allow the analysis of their structural and immunological properties. Expression of the major capsid protein late 1 (L1) from different PV types using prokaryotic (Li et al., 1997; Nardelli-Haefliger et al., 1997), baculovirus (Kirnbauer et al., 1992, 1996; Rose et al., 1993; Suzich et al., 1995; Touze et al., 1998; Volpers et al., 1994), yeast (Greer et al., 2000; Hofmann et al., 1995, 1996; Jansen et al., 1995; Neeper et al., 1996; Sasagawa et al., 1995), and mammalian expression systems (Hagensee et al., 1993, 1994; Zhou et al., 1993) demonstrates that this protein can self-assemble into virus-like particles (VLPs). Coexpression of the minor capsid protein late 2 (L2) is not strictly necessary to

1

These authors contributed equally to this work. To whom correspondence and reprint requests should be addressed. Fax: (39) 0577-243564. E-mail: [email protected]. 2

335

0042-6822/02 $35.00 © 2002 Elsevier Science (USA) All rights reserved.

336

BUONAMASSA ET AL.

1995) or xenograft systems, which allow propagation of infectious virus of specific HPV types (Bonnez et al., 1993, 1998; Christensen et al., 1990; Christensen and Kreider, 1990; Kreider et al., 1987). The primary conclusion which has been drawn from these experiments is that immunization with HPV VLPs evokes a neutralizing immune response which is predominantly type-specific (Christensen et al., 1990, 1994; Roden et al., 1996a,b; Rose et al., 1994; White et al., 1998). Therefore, an ideal anti-HPV vaccine aimed at protection from different HPV types should necessarily include VLPs able to elicit an immune response directed against all the serotypes of interest. On the basis of this background, we attempted to obtain VLPs resulting from the coassembly of capsid proteins of two different HPV types in a single Saccharomyces cerevisiae strain. Therefore, we generated a yeast diploid strain that coexpresses the HPV-6 and HPV-16 L1 and L2 genes, and we purified assembled VLPs which were used to evaluate possible interactions between the different capsid proteins. RESULTS HPV type-specific detection of capsid proteins expressed in yeast Since our experimental approach implied the coexpression of closely related capsid proteins in the same yeast cell, we initially wanted to check that the antibodies available in our laboratory could unambiguously recognize the HPV-6 and HPV-16 L1 and L2 proteins according to their type specificity. To accomplish this, the four L1 and L2 genes were cloned in the episomal pBS24.1 vector and expressed independently in the S. cerevisiae JSC310 strain. Figure 1 shows the results of a Western blot analysis of total cell extracts prepared from the recombinant strains incubated with specific anti-HPV-6 or -HPV-16 L1 monoclonal antibodies (Mabs) and with HPV-6 or HPV-16 L2 antisera. In all cases, HPV typespecific bands were detected, although a weak crossreactivity could be seen for both the L2 antisera. While the HPV-6 and HPV-16 L1 Mabs identified proteins with the expected molecular weight of about 55 kDa, the L2 proteins, as previously reported (Doorbar and Gallimor, 1987; Firzlaff et al., 1988), showed an electrophoretic mobility corresponding to approximately 72–75 kDa, instead of the 55 kDa predicted on the basis of their amino acid sequences. Expression of HPV-6 and HPV-16 L1 and L2 proteins in a single yeast strain The next experimental step consisted in obtaining two haploid strains, each expressing an L1 protein type and the heterologous L2 protein. Since the two haploids were generated using S. cerevisiae strains which had oppo-

FIG. 1. Western blot analysis of cell extracts from yeast strains expressing the HPV-6 and HPV-16 capsid proteins. Equivalent amounts of total cell extracts from the parental JSC310 strain (lanes 1) and different recombinant strains (lanes 2 and 3) were separated by 10% SDS–PAGE, electrotransferred to nitrocellulose filters, and incubated with the H6.C6 (a) or the H16.H5 (c) type-specific anti-L1 Mabs and with HPV-6L2 (b) or HPV-16L2 (d) antisera. Lanes 2a and 2c, JSC310-6L1epi; lanes 3a and 3c, JSC310-16L1epi; lanes 2b and 2d, JSC310-6L2epi; lanes 3b and 3d, JSC310-16L2epi. Molecular mass standards (in kDa) are indicated. All figures have been assembled by using Adobe Photoshop 6.0 and Macromedia FreeHand 9.0 programs for Macintosh.

site mating types, their mating resulted in a diploid strain which expressed the four HPV-6 and HPV-16 L1 and L2 proteins. In order to obtain expression of the exogenous genes under identical culture conditions, each of them was cloned within the same expression cassette based on the ADH2/GAP glucose-repressible hybrid promoter and the T MF␣ transcriptional termination sequence. The HPV-6 and HPV-16 L1 proteins were expressed by means of the episomal expression vector pBS24.1. Expression of the HPV-6 and HPV-16 L2 proteins was instead obtained by cloning the expression cassette into an integrative plasmid suitable for insertion into the lys2 locus of the haploid strain genome. As a consequence of this cloning strategy, the L1 and L2 gene copy numbers in the haploid strains were different, and this resulted in higher expression levels of the L1 proteins. This was to resemble the ratio of L1 to L2 observed in native HPV virions, which has been estimated over a range of 5:1 to 30:1 (Kirnbauer et al., 1993). Table 1 lists the parental yeast strains used as well as the recombinant haploid strains obtained and the diploid strains resulting from their mating. Selection of the AB/ JS-4L diploid strain required an additional selective marker in the haploid JSC310-6L2int strain. This was obtained by inactivating the endogenous Ade2 gene by means of an integration plasmid (see Materials and Methods). Western blot analysis (Fig. 2) proved that both haploid strains AB110-6L1/16L2 and JSC310-16L1/6L2 expressed the exogenous genes and that the expression of

MOSAIC PAPILLOMAVIRUS-LIKE PARTICLES

337

TABLE 1 Parental and Recombinant Yeast Strains with Genotypes and HPV Expressed Genes Episomal HPV gene

Yeast strain

Genotype

JSC310 AB110 JSC310-6L1epi JSC310-16L1epi JSC310-6L2epi JSC310-16L2epi JSC310-6L2int AB110-16L2int JSC310-16L1/6L2 JSC310-16L1⌬C/6L2 AB110-6L1/16L2 AB110-6L1⌬C/16L2 AB/JS-4L

MATa leu2-3 ura3-52 prb1-1122 pep4-3 prc1-407 adr1::DM15 cir° MAT␣ leu2-3-112 ura3-52 pep4-3 his4-580 cir° MATa prb1-1122 pep4-3 prc1-407 adr1::DM15 cir° MATa prb1-1122 pep4-3 prc1-407 adr1::DM15 cir° MATa prb1-1122 pep4-3 prc1-407 adr1::DM15 cir° MATa prb1-1122 pep4-3 prc1-407 adr1::DM15 cir° MATa leu2-3 ura3-52 prb1-1122 lys2 pep4-3 prc1-407 adr1::DM15 cir° MAT␣ leu2-3-112 ura3-52 pep4-3 lys2 his4-580 cir° MATa prb1-1122 lys2 prc1-407 pep4-3 ade2 adr1::DM15 cir° MATa prb1-1122 lys2 prc1-407 pep4-3 ade2 adr1::DM15 cir° MAT␣ pep4-3 lys2 his4-580 cir° MAT␣ pep4-3 lys2 his4-580 cir° MATa/MAT␣ PRB1/prb1-1122 lys2/lys2 PRC1/prc1-407 pep4-3/pep4-3 HIS4/his4-580 ADR1/adr1::DM15 cir° MATa/MAT␣ PRB1/prb1-1122 lys2/lys2 PRC1/prc1-407 pep4-3/pep4-3 HIS4/his4-580 ADR1/adr1::DM15 cir°

AB/JS-4L⌬C

all four proteins was stably maintained in the resulting AB/JS-4L diploid strain. To acquire information about significant interactions between the two major L1 capsid proteins, we performed immunoprecipitation experiments using total yeast cell extracts. Since it has been shown previously that formation of disulfide-bonded trimers of L1 molecules is a prerequisite to obtain fully assembled VLPs (Sapp et al., 1998), the immunoprecipitated products were analyzed by PAGE performed under nonreducing conditions (Fig. 3). The results obtained confirmed that conformationally dependent anti-L1 type-specific Mabs could selectively immunoprecipitate HPV-6 or HPV-16 L1 trimers (Figs. 3a

FIG. 2. Western blot analysis of cell extracts from recombinant haploid and diploid yeast strains. Total cell extracts were separated by 10% SDS–PAGE, electrotransferred to nitrocellulose filters, and incubated with anti-HPV-6 L1 (a) and anti-HPV-16 L1 (c) Mabs and with HPV-6 L2 (b) and HPV-16 L2 (d) antisera. Lanes 1, AB110-6L1/16L2; lanes 2, JSC310-16L1/6L2; lanes 3, AB/JS-4L; lanes 4, JSC310-6L2epi; lanes 5, JSC310-16L2epi. Arrows in b and d indicate the bands thought to represent the L2 proteins. Molecular mass standards (in kDa) are indicated.

Integrated HPV gene

6L1 16L1 6L2 16L2

16L1 16L1⌬C 6L1 6L1⌬C 6L1-16L1

6L2 16L2 6L2 6L2 16L2 16L2 6L2-16L2

6L1⌬C-16L1⌬C

6L2-16L2

and 3b, lanes 1 and 2). As a control, cultures of the haploid clones were mixed before the cell extract was prepared, and again, under identical experimental conditions, the anti-HPV-6 and the anti-HPV-16 L1 Mabs were able to immunoprecipitate only the related protein trimer (Figs. 3a and 3b, lanes 3). However, when the cell extract of the diploid strain AB/JS-4L was used, the two Mabs could immunoprecipitate L1 trimers which reacted against both L1 type-specific Mabs (Figs. 3a and 3b, lanes 4). Identical results were observed when the L1 portion, which is not organized as trimers, was detected (Figs. 3c and 3d).

FIG. 3. Immunoprecipitation analysis of total yeast cell extracts. Total yeast cell extracts were immunoprecipitated by using the anti-L1 typespecific conformationally dependent Mabs H6.B10.5 and H16.V5 and subjected to Western blot analysis to detect type-specific L1 (a–d). Immunoprecipitates were fractionated under nonreducing conditions using either a 4% (a and b) or an 8% (c and d) polyacrylamide SDS gel. Cell extracts were obtained from lanes 1, AB110-6L1/16L2; lanes 2, JSC310-16L1/6L2; lanes 3, a mixture of pellets from the two haploid strains; lanes 4, AB/JS-4L. Arrows in a and b indicate bands corresponding to L1 trimers. Molecular mass standards (in kDa) are indicated.

338

BUONAMASSA ET AL.

FIG. 4. Analysis of fractions from CsCl gradient sedimentation of AB/JS-4L cell extracts. Aliquots of fractions with a density of 1.29–1.3 mg/ml (lanes 3) were subjected to SDS–PAGE, electroblotted on nitrocellulose filters, and incubated either with anti-HPV-6 L1 (a) and antiHPV-16 L1 (b) Mabs or with HPV-6 L2 (c) and HPV-16 L2 (d) antisera. As a control, total cell extracts from the JSC310-6L1epi and JSC310-16L1epi strains (lanes 1 and 2, respectively, in a and b) and the JSC310-6L2epi and JSC310-16L2epi strains (lanes 1 and 2, respectively, in c and d) were used. Molecular mass standards (in kDa) are indicated. Arrows identify bands thought to represent the L2 proteins.

HPV-6 and HPV-16 L1 proteins coassembled into VLPs. While we were able to obtain convincing results by using the anti-HPV-6 conformational Mab H6.B10.5 (Christensen et al., 1996b), we failed to get reproducible signals with both HPV-16 control and HPV-6/16 VLPs (not shown) by using the anti-HPV-16 conformational Mab H16.V5 (Christensen et al., 1996a). To overcome this problem, we performed immunoprecipitation experiments using the specific anti-HPV-6 and anti-HPV-16 L1 conformationally dependent Mabs and VLPs purified under experimental conditions (see Materials and Methods) intended to reduce the possibility of aggregation of homooligomeric capsids, if present. Western blot analysis carried out with the immunoprecipitates detected both L1 proteins when VLPs purified from the diploid strain were used (Figs. 5f and 5i). On the contrary, when HPV-6 and HPV-16 VLPs were copurified under identical experimental conditions from a yeast pellet mixture of the two haploid strains, either HPV-6 or HPV-16 L1 was detected, depending on the type specificity of the Mab used for the immunoprecipitation (Figs. 5g and 5j). To find out whether 6L1/16L1 mixed capsomeres could contribute to the formation of hybrid VLPs, immunopre-

Analysis of VLPs purified from the diploid strain The cell extract from the yeast diploid strain was subjected to CsCl gradient sedimentation, and pooled fractions with a density of 1.29–1.3 mg/ml were analyzed by Western blot, confirming the presence of HPV-6 and HPV-16 L1 and L2 proteins (Fig. 4). Electron microscopy (EM) analysis of the enriched fraction revealed the presence of VLPs which appeared to be similar to control VLPs formed by either HPV-6 or HPV-16 L1 (Figs. 5a–5c). To establish whether the two L1 proteins were assembled into the hybrid VLPs according to their expression levels in the diploid strain, defined amounts of the cell lysate and of purified VLPs were blotted and tested with anti-HPV-6 and -HPV-16 L1 Mabs. Signals below saturation obtained from each sample using the type-specific Mabs were scanned and the ratios between them were calculated. The observation that the ratios obtained from the extract and the VLPs were very similar strongly suggested that neither L1 was preferentially incorporated in the course of assembly (Figs. 5d and 5e). A similar analysis, carried out with serial dilutions of hybrid VLPs and of quantified HPV-6 and HPV-16 VLPs, revealed that the ratio between the 6 and the 16 L1s in the hybrid particles purified from the yeast clone that we had chosen was approximately 1.5, with no significant changes between the two different preparations from the same clone (data not shown). A direct detection of the two proteins by means of immuno-EM (IEM) was then attempted to prove that the

FIG. 5. Analysis of CsCl purified VLPs. HPV-6 (a), HPV-16 (b), and HPV-6/16 (c) VLPs were adsorbed onto Formvar–carbon-coated grids, stained with 4% uranyl acetate, and examined under a Zeiss EM10C microscope at a magnification of ⫻100,000. Serial dilutions of total cell extract from the diploid clone (d) and the purified VLPs (e) were blotted and analyzed with type-specific anti-L1 Mabs. Numbers between slots represent the ratios obtained by scanning signals below saturation. The 1.29 g/cm 3 CsCl gradient fractions obtained from the AB/JS-4L (f and i) clone and from the AB/JSC-4L⌬C (h and k) clone were immunoprecipitated and Western blot analysis was performed. As a control, a preparation of copurified HPV-6 and HPV-16 VLPs was used (g and j).

MOSAIC PAPILLOMAVIRUS-LIKE PARTICLES

FIG. 6. Characterization of sera derived from mice immunized with HPV-6/16 VLPs. HPV-6 and HPV-16 VLPs were dot-blotted under denaturing and reducing (D) and nondenaturing and nonreducing (N) conditions and incubated with the type-specific conformationally dependent Mabs H6.B10.5 and H16.V5 S16 and with the S16 antiserum of a mouse immunized with HPV-6/16 VLPs.

cipitation experiments were carried out using the 1.29 g/cm 3 CsCl gradient fraction obtained by processing the cell extract of the diploid strain AB/JSC-4L⌬C, in which HPV-6 and HPV-16 L1s were respectively mutagenized at cysteine residues C423 and C428, which should have allowed capsomeres but not VLP assembly. Again, both L1 proteins could be detected independently of the type specificity of the Mab used for the immunoprecipitation (Figs. 5h and 5k). HPV-6/16 VLPs induce an immune response against both HPV types To check whether HPV-6/16 VLPs were able to induce an immune response directed against both HPV types, HPV-6/16 VLPs were used to immunize mice, and the resulting immune sera were tested after the third immunization. HPV-6 and HPV-16 VLPs were blotted onto nitrocellulose filters under nondenaturing and denaturing/ reducing conditions and incubated either with type-specific conformational Mabs or with the serum from mouse 16 (S16) immunized with HPV6/16 VLPs (Fig. 6). While control Mabs recognized only the specific, nondenatured VLP type, the S16 serum reacted with both VLP types, and the observation that the signal was significantly higher without VLPs being denatured and reduced strongly suggested that antibodies directed against conformational epitopes had been elicited. DISCUSSION The availability of papillomavirus empty particles has allowed a number of researchers to investigate many immunological and biophysical facets of VLPs, including the generation of type-specific antibodies, in vitro neutralization assays, and the study of how L1 monomers interact and form the capsid-like structure. The knowledge that L1 of different PV types can coassemble may be potentially useful not only to investigate the mechanisms regulating capsid assembly, disassembly, and cellular uptake but also to develop novel prophylactic approaches. In fact, while immunization with a mixture of VLPs derived from different HPV types can induce an immune response against all of them, antibody titers and

339

cytokine profiles in immunized chimpanzees were shown to be affected by the manufacturing and purification processes used for individuals VLP types (Palker et al., 2001). Multiple antigen delivery by using a single biological source may therefore represent the basis for an accessible and suitable vaccine formulation, from both economic and regulatory viewpoints. Although the immune response to genital HPVs is predominantly type-specific, cross-neutralization has been reported between HPV-6 and HPV-11 (92% amino acid sequence identity) (Christensen et al., 1996b) and between HPV-16 and HPV-33 (80% amino acid sequence identity) (White et al., 1998). This may indicate the existence of some correlation between protein sequences and structural similarities that could possibly be relevant for the mechanism of capsid assembly. On the basis of these considerations, the concept that HPV-6 and HPV-16 L1 proteins can coassemble is not obvious, since the two viruses belong to phylogenetically more distant groups (Chan et al., 1992; Van Rast et al., 1992) and exhibit a lower (67%) L1 amino acid sequence identity. In this study we have reported the purification of VLPs from a yeast strain that has been genetically engineered to coexpress the HPV-6 and HPV-16 L1 and L2 capsid proteins. Although we could not unequivocally detect the two L1 proteins on individual VLPs by IEM, the results of the immunoprecipitation experiments strongly indicate that the purified VLPs represent the result of specific interactions between HPV-6 and 16 L1s, rather than the simple coexistence and aggregation of different VLP types (even though the formation of some homooligomeric capsids cannot be entirely ruled out). The fact that the L2 proteins were present in the same CsCl fractions favors the hypothesis that they are incorporated into the VLPs as well, since the L2 protein expressed alone bands at a different density in CsCl gradients (Volpers et al., 1994) and is highly sensitive to degradation (Kirnbauer et al., 1993). In turn, incorporation of L2 into VLPs suggests that some stable association between the major and the homologous minor capsid proteins deriving from the opposite haploid contributor occurred in the diploid strain. This would be in agreement with the fact that an L1/L2 interaction has been suggested to be type-specific (Roden et al., 1996a), as well as with our observation that L2 detection in haploid strains was far more difficult when the protein was coexpressed with the heterologous L1 counterpart than when the homologous L1 was present (not shown). Several reports have discussed the importance of disulfide bonds for the integrity of native bovine papillomavirus type 1 virions (Li et al., 1998) and VLP structures (Li et al., 1997; Sapp et al., 1995, 1998). Li et al. (1998) have also shown that the cysteine 424 mutant (C424) of HPV-11 L1 in the carboxyl-terminal domain, which has been identified as critical for capsid formation (Li et al.,

340

BUONAMASSA ET AL.

1997), is still able to form capsomeres but not VLPs, indicating that this residue may be involved in interpentamer bonding. The essential role of disulfide bonds has been confirmed by a single point mutation of either C176 or C427 in HPV-33 L1 (C428 in HPV-18 L1), which converts all VLP trimers into monomers, allowing capsomere formation but not VLP assembly (Sapp et al., 1998), while the recent data published by Fligge et al. (2001) confirmed that the only product of the HPV-33 L1 C427 mutation was represented by capsomers which could be purified from a CsCl gradient at the usual 1.29 g/cm 3 density. In this context, the fact that corresponding cysteine residues are conserved in the HPV-6 (C423) and HPV-16 (C428) L1s suggested that, in our diploid strain, formation of trimers by means of covalent disulfide bonds could result from interaction among type-specific or “mosaic” capsomeres or both. The immunoprecipitation experiments using the 1.29 g/cm 3 CsCl gradient fraction from the diploid strain coexpressing the HPV-6 and HPV-16 L1 proteins in which the critical cystein residues were mutated showed that interaction of the two L1 proteins still occurred. This result strongly suggests the existence of hybrid capsomers, with the interaction of HPV-6 and HPV-16 L1 being independent of the formation of trimers, which in fact we could hardly detect in cell extracts of the mutated haploid and derived diploid strains (not shown), in agreement with what reports for the corresponding L1 mutants have described (Li et al., 1998; Sapp et al., 1998). Of course, contribution of homospecific pentamers to VLP assembly cannot be excluded. Further investigations will be required to define more clearly the structural relationships among the two L1 proteins and the contribution of L2 to the formation of HPV-6/16 capsids. However, irrespective of a complete knowledge of capsid protein organization, we could also show that immunization of mice with HPV6/16 VLPs induced conformational antibodies directed against both type-specific L1s. The recent immunological analysis of several HPV VLPs, confirming the dominant role of antibodies directed against nonlinear epitopes and the entirely genotype-specific nature of the antibody response induced, reinforces the concept that protection from different HPVs will require vaccines including VLPs of all the serotypes of interest (Giroglou et al., 2001). Therefore, although we will need to perform a more detailed immunogenic and antigenic characterization of the HPV-6/16 VLPs and to confirm, by using in vitro neutralization assays, that the immune response which we have elicited using these particles can actually neutralize the two viruses, the data that we have reported open up the possibility of testing mosaic VLPs as a new tool for inducing an immune response against a broader spectrum of HPV types.

MATERIALS AND METHODS Yeast strains The S. cerevisiae parental haploid strains used were JSC310 (MATa, leu2-3, ura3-52, prb1-1122, pep4-3, prc1407, adr1::DM15, cir°) (Hines et al., 1994) and AB110 (MAT␣, leu2-3-112, ura3-52, pep4-3, his4-580, cir°) (Travis et al., 1985), provided by Vicky Hines (Chiron Corp., Emeryville, CA). Site-directed mutagenesis of L1 protein genes Both HPV-6 and HPV-16 L1 genes were mutagenized by using the Chameleon double-stranded site-directed mutagenesis kit (Stratagene, La Jolla, CA) and were completely sequenced. The oligonucleotides 6C.3 (ACAGGCCATTACCAGTCAAAAGCCCACTC) and 16C.3 (CCAGGCAATTGCTAGTCAAAAACATACAC) were used to change the TGT codons (Cys) into AGT codons (Ser) in HPV-6 (Cys423) and HPV-16 (Cys428) L1s, respectively. Construction of recombinant plasmids DNA fragments encoding the HPV proteins were obtained from available recombinant plasmids, either by restriction enzyme digestion or by PCR amplification (Expand High Fidelity PCR System, Boehringer Mannheim, Mannheim, Germany), and they were completely sequenced using an Applied Biosystems (Norwalk, CT) Model 373 DNA sequencer. The episomal yeast expression vector pBS24.1, containing the leucine 2 (Leu2) and uracil 3 (Ura3) selectable genes, and the derived pBS6L1 plasmid, expressing the HPV-6b L1 protein under the control of the alcohol-dehydrogenase-2-glyceraldehyde3-phosphate-dehydrogenase (ADH2/GAP) glucose repressible promoter, have been previously reported (Greer et al., 2000). To construct the YIpAde integrative plasmid, a 1059-bp XbaI genomic DNA fragment of the S. cerevisiae adenine 2 (Ade2) gene was amplified by using the PCR oligonucleotide primers 5⬘AdeE (5⬘-GCGGCGAATTCTAGAACAGTTGGTATATTAG-3⬘, inserting an EcoRI site) and 3⬘AdeP (5⬘-GCGGCCTGCAGGGTCTAGACTCTTTTCCATATA-3⬘, inserting a PstI site). The amplified DNA fragment was cloned into plasmid pUC8 digested with EcoRI and PstI, and the XbaI sites, included in the amplified DNA fragment, were used to excise the insert for yeast transformation. To obtain the integrative YIpLys-L2 expression plasmids, a 1318-bp genomic DNA fragment of the S. cerevisiae lysine 2 (Lys2) gene was amplified by using the PCR oligonucleotide primers 5⬘LysE (5⬘-GCGGAATTCCACTAGTAATTACA-3⬘, inserting an EcoRI site) and 3⬘LysH (5⬘-GATGTAAGCTTCTACTAGTTGA-3⬘, inserting a HindIII site). The amplified DNA fragment was then inserted into pUC8 digested with EcoRI and HindIII, generating a plasmid named YIpLys. A BamHI DNA fragment from the pSI3 vector (Isabel Zaror, Chiron), including the ADH2/GAP promoter, the human superoxide dismutase (SOD) gene, and the mating

MOSAIC PAPILLOMAVIRUS-LIKE PARTICLES

type ␣-factor gene transcriptional termination sequence (T MF␣), was cloned into the single BglII restriction site in the Lys2 gene sequence of YIpLys, obtaining a plasmid named YIpLys-SOD. The YIpLys-6L2 plasmid was derived from YIpLys-SOD, replacing the NcoI-SalI DNA fragment encoding the SOD gene with the NcoI-SalI DNA fragment from pGM3Z-6L2 (Kent Thudium, Chiron) encoding the HPV-6b L2 open reading frame (ORF). To construct the YIpLys-16L2 plasmid, the L2 gene was amplified from a cloned HPV-16 genomic DNA (kindly provided by Dennis J. McCance, University of Rochester, Rochester, NY) by using the PCR oligonucleotide primers DT-5⬘L2 (5⬘-CGACACAAACGTTCTGCAA-3⬘) and DT-3⬘L2 (5⬘-ATTAGTCGACCTAGGCAGCCAAGAGACATC-3⬘), including the translation termination codon and a SalI site. The DNA fragment obtained was digested with SalI and cloned into a YIpLys-SOD from which the SOD coding sequence had been removed by digestion with NcoI, filling in with Klenow enzyme and digestion with SalI. The pBS-6L2 and pBS-16L2 episomal expression plasmids were obtained by replacing a SacI-SalI DNA fragment from pBS-6L1, including part of the ADH2/GAP promoter and the entire HPV-6b L1 ORF, with SacI-SalI DNA fragments derived from either YIpLys-6L2 or YIpLys-16L2, including the corresponding promoter region and the L2 ORF. To construct the pBS-16L1 episomal expression plasmid, the L1 gene was amplified from the cloned HPV-16 genomic DNA by using the PCR oligonucleotide primers DT-5⬘L1 (5⬘TCTCTTTGGCTGCCTAGTGAGGCCA) and DT-3⬘L1 (5⬘CTAGTAATGTCGACTTACAGCTTACGTTTTTTGCG-3⬘), comprising the translational termination codon and a SalI site. The amplified DNA fragment, encoding an L1 protein identical to the one derived from clone 114/K and described by Kirnbauer et al. (1993), was cloned into a blunt-ended pSI3 vector from which the SOD gene had been previously removed by digestion with NcoI and SalI restriction enzymes and filling in with the Klenow enzyme. From this intermediate construct, a SacI-SalI DNA fragment, including part of the ADH2/GAP promoter and the HPV-16L1 ORF, replaced the corresponding SacI-SalI DNA fragment in pBS-6L1. To construct pBS-6L1⌬C and pBS-16L1⌬C, the same SacI-SalI DNA fragment, mutagenized in the L1 gene, was used to replace the corresponding fragment in the L1 episomal expression plasmids. Generation of recombinant yeast strains The strains JSC310-6L1epi (Greer et al., 2000), JSC31016L1epi, JSC310-6L2epi, and JSC310-16L2epi, expressing the four capsid proteins by means of episomal vectors, were obtained by transformation of the parental JSC310 strain with the expression plasmids pBS-6L1 (Greer et al., 2000), pBS-16L1, pBS-6L2, and pBS-16L2. The JSC3106L2int and the AB110-16L2int strains were obtained by transforming competent yeast cells with 5 ␮g of the EcoRI-HindIII-digested YIpLys-6L2 or YIpLys-16L2 integrative plasmid and 1 ␮g of the pBS24.1 episomal vector

341

to allow the selection of transformants. Different clones were tested for growth onto plates of minimal medium (MM) supplemented with ␣-adipate to select mutants with an inactivated Lys2 gene (Zaret and Sherman, 1985). Correct integration into the lys2 locus was verified by PCR analysis by using pairs of oligonucleotide primers complementary to sequences within the expression cassette and the genomic portion of the Lys2 gene. Among the colonies expressing the L2 protein, one was chosen, cured of the pBS24.1 plasmid, and tested for the inability to grow in the absence of uracil and leucine. Introduction of the episomal L1 expressing vectors into these strains was carried out following two different strategies. AB11016L2int was transformed with either the pBS-6L1 or the pBS-6L1⌬C expression plasmid, and selection of transformants on MM plates without leucine and uracil allowed the isolation of the haploid strains AB110-6L1/ 16L2 and AB110-6L1⌬C/16L2. The JSC310-6L2int strain was instead cotransformed with the pBS-16L1 expression vector and with the XbaI-digested YIpAde integrative plasmid. Transformants grown on selective plates were plated on complete yeast extract–peptone medium (YEP) and allowed to grow at 30°C for 3–4 days until colonies (1–2%) developed a red color due to disruption of the ade2 locus. One of the clones, which showed correct integration into the ade2 locus by PCR and L1 and L2 expression by Western blot analysis, was designated JSC310-16L1/6L2. Curing of this strain of the episomal plasmid, followed by transformation with pBS16L1⌬C, allowed isolation of the JSC310-16L1⌬C/6L2 strain. Generation of the AB/JSC-4L and AB/JSC-4L⌬C diploid strains was obtained by mixing cultures, in YEP medium containing 5% glucose, of the haploid strains AB110-6L1/16L2 and AB110-6L1⌬C/16L2 with JSC31016L1/6L2 and JSC310-16L1⌬C/6L2, respectively. Diploid cells were selected onto MM plates lacking histidine and adenine. Growth of yeast cultures and preparation of total cell extracts Parental yeast strains were grown in complete YEP medium. Strains transformed with episomal vectors were first cultured in leucine-deficient MM medium with 4% glucose until they reached mid-log phase. Diluting these cultures 1:50 into YEP complete medium and culturing the cells at 30°C for 2–3 days induced expression of the genes under the control of the ADH2/GAP glucose-repressible promoter. Total cell extracts were prepared by incubating yeast cells for 10 min on ice in 0.24 N NaOH and 0.96% ␤-mercaptoethanol, followed by trichloroacetic acid precipitation, ice-cold acetone washing, and final suspension of the protein pellet in 100 ␮l of protein loading buffer. Total cell extracts to be used for immunoprecipitations were prepared in PBS/0.5 M NaCl and incubated overnight at 4°C in the presence of Complete

342

BUONAMASSA ET AL.

Protease Inhibitors (Boehringer Mannheim) and Benzonase (Merck & Co., Rahway, NJ). Purification of VLPs Frozen yeast cell pellets were thawed in buffer containing 0.1 M Tris–HCl (pH 7.5), 0.15 M NaCl, 2 mM MgCl 2, 1 mM EGTA, Complete Protease Inhibitors (No. 1-697498, Boehringer Mannheim), and 100 units/ml Benzonase Purity Grade II (Merck). Cells were disrupted by vortexing twice for 10 min with a 5-min interval on ice, in the presence of glass beads [G-8772 (Sigma Chemical Co., St. Louis, MO), 0.5 ml beads per milliliter of cell suspension] using a VWR Scientific Product (South Plainfield, NJ) multitube vortexer. Following overnight incubation at 4°C with gentle shaking, cellular debris was removed by a 20-min centrifugation at 2000 g, and the supernatants were centrifuged through a 40% (w/w) sucrose cushion (2-h centrifugation at 100,000 g). The resulting pellets were suspended in PBS, applied to a preformed CsCl gradient (1.17–1.57 g/ml), and centrifuged for 24 h at 285,000 g. The gradients were fractionated, and aliquots from each fraction were subjected to measurement of the refractive index and Western blot analysis with type-specific anti-L1. Fractions of interest were dialyzed against PBS. For immunoprecipitation experiments, yeast supernatants were adjusted to 0.5 m NaCl and centrifuged for 2 h at 100,000 g through a twocomponent step gradient composed of 40 and 63% (wt/ wt) sucrose in PBS/0.5 M NaCl, 0.01% Triton X-100. The material banded at the interface between the two sucrose solutions was collected, extensively dialyzed against PBS/0.5 M NaCl, 0.01% Triton X-100, adjusted to 30% CsCl, and centrifuged for 48 h at 285,000 g. Fractions with a density of 1.29–1.3 mg/ml were dialyzed against PBS/0.5 M NaCl. Western and dot/slot-blot analysis Proteins were analyzed by sodium dodecyl sulfate– polyacrylamide gel electrophoresis (SDS–PAGE) and Western blotting according to standard protocols. Dot / slot-blot analysis of denatured and reduced VLPs and cell extracts was carried out by boiling the samples for 5 min in the presence of dithiothreitol (DTT). When the native VLP structure had to be maintained, VLPs in PBS were blotted without boiling and in the absence of DTT. Reaction with HPV-specific antibodies was detected using an enhanced chemiluminescence Western blotting reagent (Amersham, Arlington Heights, IL). Monoclonal and polyclonal antibodies The H6.C6 and H16.H5 monoclonal antibodies, which bind to denatured HPV-6 and HPV-16 L1 proteins, respectively, in addition to the H6.B10.5 and H16.V5 Mabs, specific for HPV-6 and HPV-16 intact VLPs, have been described by Christensen et al. (1996a,b). HPV-16 L2

rabbit antiserum was a gift of Lutz Gissmann (DKFZ, Heidelberg, Germany), while HPV-6 L2 rabbit antisera were kindly provided by Denise Galloway (Fred Hutchinson Cancer Research Center, Seattle, WA) and Robert C. Rose (University of Rochester). Anti-rabbit and antimouse peroxidase-conjugated antibodies were from Biosource International (Camarillo, CA). Immunoprecipitations Aliquots of either total cell extracts or CsCl-derived gradient fractions, both in PBS/0.5 M NaCl, were immunoprecipitated overnight at 4°C with either of the two type-specific conformationally dependent Mabs H6.B10.5 (anti-HPV-6 L1) and H16.V5 (anti-HPV-16 L1). Immune complexes were collected with Protein G Sepharose CL-4B (Pharmacia Biotech, Piscataway, NJ), washed 5 times with 1 ml PBS/0.5M NaCl, suspended in 40 ␮l sample buffer without DTT, boiled for 5 min, and subjected to SDS–PAGE and Western blot analysis using type-specific anti-L1 Mabs. Mouse immunization with VLPs Six-week-old female Balb/c mice were injected subcutaneously with 20 ␮g of HPV-6/16 purified VLPs administered with an equal volume of MF59 adjuvant (Ott et al., 1995). A group of control mice was injected with MF59 only. The mice were boosted with 15 ␮g of the antigen at week 3 and 10 ␮g at week 5. Serum samples were collected on day 12 after the final booster and assayed for capsid protein-specific antibodies. Nucleotide sequence accession numbers The HPV-6b L1 and L2 sequences used were identical to those derived from the HPV-6b genome deposited in the GenBank/EMBL database under Accession No. X00203. The HPV-16 L2 protein sequence corresponded to that derived from the HPV-16 genome deposited in the GenBank/EMBL database under Accession No. K02718. ACKNOWLEDGMENTS We thank Neil D. Christensen for the HPV-6- and HPV-16-specific anti-L1 Mabs and Denise Galloway, Lutz Gissmann, Robert C. Rose, and Martin Mu¨ller for the gift of different reagents. We also thank Vicky Heines for the yeast strains, Isabel Zaror, Dennis McCance, and Kent Thudium for plasmids, and Ivy Hsieh for preparing the negative stains. We are also indebted to Massimo Tommasino, Mara Rossini, and Vincenzo Scarlato for critically reading the manuscript, to the IRIS technical staff for their help, and to Giorgio Corsi for graphic work.

REFERENCES Bonnez, W., Da Rin, C., Borkhuis, C., de Mesy Jensen, K., Reichman, R. C., and Rose, R. C. (1998). Isolation and propagation of human papillomavirus type 16 in human xenografts implanted in the severe combined immunodeficiency mouse. J. Virol. 72, 5256–5261. Bonnez, W., Rose, R. C., Da Rin, C., Borkhuis, C., de Mesy Jensen, K., and Reichman, R. C. (1993). Propagation of human papillomavirus

MOSAIC PAPILLOMAVIRUS-LIKE PARTICLES type 11 in human xenografts using the severe combined immunodeficiency (SCID) mouse and comparison to the nude mouse model. Virology 197, 455–458. Chan, S. Y., Bernard, H. U., Hong, C. H., Chan, S. P., Hoffmann, B., and Delius, H. (1992). Phylogenetic analysis of 48 papillomavirus types and 28 subtypes and variants: A showcase for the molecular evolution of DNA viruses. J. Virol. 66, 5714–5725. Christensen, N. D., Dillner, J., Eklund, C., Carter, J. J., Wipf, G. C., Reed, C. A., Cladel, N. M., and Galloway, D. A. (1996a). Surface conformational and linear epitopes on HPV-16 and HPV-18 L1 virus-like particles as defined by monoclonal antibodies. Virology 223, 174–184. Christensen, N. D., Kirnbauer, R., Schiller, J. T., Ghim, S. J., Schlegel, R., Jenson, A. B., and Kreider, J. W. (1994). Human papillomavirus types 6 and 11 have antigenically distinct strongly immunogenic conformationally dependent neutralizing epitopes. Virology 205, 329–335. Christensen, N. D., and Kreider, J. W. (1990). Antibody-mediated neutralization in vivo of infectious papillomavirus. J. Virol. 64, 3151–3156. Christensen, N. D., Kreider, J. W., Cladel, N. M., Patrick, S. D., and Welsh, P. A. (1990). Monoclonal antibody-mediated neutralization of infectious human papillomavirus type 11. J. Virol. 64, 5678–5681. Christensen, N. D., Reed, C. A., Cladel, N. M., Hall, K., and Leiserowitz, G. S. (1996b). Monoclonal antibodies to HPV-6 L1 virus-like particles identify conformational and linear neutralizing epitopes on HPV-11 in addition to type-specific epitopes on HPV-6. Virology 224, 477–486. Doorbar, J., and Gallimor, P. H. (1987). Identification of proteins encoded by the L1 and L2 open reading frames of human papillomavirus 1a. J. Virol. 61, 1131–1142. Firzlaff, J. M., Kiviat, N. B., Beckmann, A. M., Jenison, S. A., and Galloway, D. A. (1988). Detection of human papillomavirus capsid antigens in various squamous epithelial lesions using antibodies directed against the L1 and L2 open reading frames. Virology 164, 467–477. Fligge, G., Giroglou, T., Streeck, R. E., and Sapp, M. (2001). Induction of type-specific neutralizing antibodies by capsomeres of human papillomavirus type 33. Virology 283, 353–357. Giroglou, T., Sapp, M., Lane, C., Fligge, C., Christensen, N. D., Streeck, R. E., and Rose, R. C. (2001). Immunological analyses of human papillomavirus capsids. Vaccine 19, 1783–1793. Greer, C. E., Petracca, R., Buonamassa, D. T., Di Tommaso, A., Gervase, B., Reeve, R. L., Ugozzoli, M., Van Nest, G., De Magistris, M. T., and Bensi, G. (2000). The comparison of the effect of LTR72 and MF59 adjuvants on mouse humoral response to intranasal immunisation with human papillomavirus type 6b (HPV-6b) virus-like particles. Vaccine 19, 1008–1012. Hagensee, M. E., Olson, N. H., Baker, T. S., and Galloway, D. A. (1994). Three-dimensional structure of vaccinia virus-produced human papillomavirus type 1 capsids. J. Virol. 68, 4503–4505. Hagensee, M. E., Yaegashi, N., and Galloway, D. A. (1993). Self-assembly of human papillomavirus type 1 capsids by expression of the L1 protein alone or by coexpression of the L1 and L2 capsid proteins. J. Virol. 67, 315–322. Hines, V., Zhang, W., Ramakrishna, N., Styles, J., Mehta, P., Kim, K. S., Innis, M., and Miller, D. L. (1994). The expression and processing of human beta-amyloid peptide precursors in Saccharomyces cerevisiae: Evidence for a novel endopeptidase in the yeast secretory system. Cell. Mol. Biol. Res. 40, 273–284. Hofmann, K. J., Cook, J. C., Joyce, J. G., Brown, D. R., Schultz, L. D., George, H. A., Rosolowsky, M., Fife, K. H., and Jansen, K. U. (1995). Sequence determination of human papillomavirus type 6a and assembly of virus-like particles in Saccharomyces cerevisiae. Virology 209, 506–518. Hofmann, K. J., Neeper, M. P., Markus, H. Z., Brown, D. R., Muller, M., and Jansen, K. U. (1996). Sequence conservation within the major capsid protein of human papillomavirus (HPV) type 18 and formation of HPV-18 virus-like particles in Saccharomyces cerevisiae. J. Gen. Virol. 77, 465–468. Jansen, K. U., Rosolowsky, M., Schultz, L. D., Markus, H. Z., Cook, J. C., Donnelly, J. J., Martinez, D., Ellis, R. W., and Shaw, A. R. (1995).

343

Vaccination with yeast-expressed cottontail rabbit papillomavirus (CRPV) virus-like particles protects rabbits from CRPV-induced papilloma formation. Vaccine 13, 1509–1514. Kirnbauer, R., Booy, G., Cheng, N., Lowy, D. R., and Schiller, J. T. (1992). Papillomavirus L1 major capsid protein self-assembles into virus-like particles that are highly immunogenic. Proc. Natl. Acad. Sci. USA 89, 12180–12184. Kirnbauer, R., Chandrachud, L. M., O’Neil, B. W., Wagner, E. R., Grindlay, G. J., Armstrong, A., McGarvie, G. M., Schiller, J. T., Lowy, D. R., and Campo, M. S. (1996). Virus-like particles of bovine papillomavirus type 4 in prophylactic and therapeutic immunization. Virology 219, 37–44. Kirnbauer, R., Taub, J., Greenstone, H., Roden, R., Durst, M., Gissmann, L., Lowy, D. R., and Schiller, J. T. (1993). Efficient self-assembly of human papillomavirus type 16 L1 and L1–L2 into virus-like particles. J. Virol. 67, 6929–6936. Kreider, J. W., Howett, M. K., Leure-Dupree, A. E., Zaino, R. J., and Weber, J. A. (1987). Laboratory production in vivo of infectious human papillomavirus type 11. J. Virol. 61, 590–593. Li, M., Beard, P., Estes, P. A., Lyon, M. K., and Garcea, R. L. (1998). Intercapsomeric disulfide bonds in papillomavirus assembly and disassembly. J. Virol. 72, 2160–2167. Li, M., Cripe, T. P., Estes, P. A., Lyon, M. K., Rose, R. C., and Garcea, R. L. (1997). Expression of the human papillomavirus type 11 capsid protein in Escherichia coli: characterization of protein domains involved in DNA binding and capsid assembly. J. Virol. 71, 2988–2995. Muller, M., Gissmann, L., Cristiano, R. J., Sun, X. Y., Frazer, I. H., Jenson, A. B., Alonso, A., Zentgraf, H., and Zhou, J. (1995). Papillomavirus capsid binding and uptake by cells from different tissues and species. J. Virol. 69, 948–954. Nardelli-Haefliger, D., Roden, R. B., Benyacoub, J., Sahli, R., Kraehenbuhl, J. P., Schiller, J. T., Lachat, P., Potts, A., and De Grandi, P. (1997). Human papillomavirus type 16 virus-like particles expressed in attenuated Salmonella typhimurium elicit mucosal and systemic neutralizing antibodies in mice. Infect. Immun. 65, 3328–3336. Neeper, M. P., Hofmann, K. J., and Jansen, K. U. (1996). Expression of the major capsid protein of human papillomavirus type 11 in Saccharomyces cerevisae. Gene 180, 1–6. Ott, G., Barchfeld, G. L., Chernoff, D., Radakrishnan, R., van Hoogevest, P., and Van Nest, G. (1995). MF59: Design and evaluation of a safe and potent adjuvant for human vaccines. In “Vaccine Design: The Subunit and Adjuvant Approach,” (M. F., Powell, and M. J., Newman, Eds.), pp. 277–296. Plenum Press, New York. Palker, T. J., Monteiro, J. M., Martin, M. M., Kakareka, C., Smith, J. F., Cook, J. C., Joyce, J. G., and Jansen, K. U. (2001). Antibody, cytokine and cytotoxic T lymphocyte responses in chimpanzees immunized with human papillomavirus virus-like particles. Vaccine 19, 3733– 3743. Qi, Y. M., Peng, S. W., Hengst, K., Evander, M., Park, D. S., Zhou, J., and Frazer, I. H. (1996). Epithelial cells display separate receptors for papillomavirus VLPs and for soluble L1 capsid protein. Virology 216, 35–45. Roden, R. B., Greenstone, H. L., Kirnbauer, R., Booy, F. P., Jessie, J., Lowy, D. R., and Schiller, J. T. (1996a). In vitro generation and type-specific neutralization of human papillomavirus type 16 virion pseudotype. J. Virol. 70, 5875–5883. Roden, R. B., Hubbert, N. L., Kirnbauer, R., Christensen, N. D., Lowy, D. R., and Schiller, J. T. (1996b). Assessment of the serological relatedness of genital human papillomaviruses by hemagglutination inhibition. J. Virol. 70, 3298–3301. Roden, R. B., Kirnbauer, R., Jenson, A. B., Lowy, D. R., and Schiller, J. T. (1994). Interaction of papillomaviruses with the cell surface. J. Virol. 68, 7260–7266. Rose, R. C., Bonnez, W., Da Rin, C., McCance, D. J., and Reichman, R. C. (1994). Serological differentiation of human papillomavirus types 11, 16 and 18 using recombinant virus-like particles. J. Gen. Virol. 75, 2445–2449.

344

BUONAMASSA ET AL.

Rose, R. C., Bonnez, W., Reichman, R. C., and Garcea, R. L. (1993). Expression of human papillomavirus type 11 L1 protein in insect cells: In vivo and in vitro assembly of viruslike particles. J. Virol. 67, 1936–1944. Rose, R. C., White, W. I., Li, M., Suzich, J. A., Lane, C., and Garcea, R. L. (1998). Human papillomavirus type 11 recombinant L1 capsomeres induce virus-neutralizing antibodies. J. Virol. 72, 6151–6154. Sapp, M., Fligge, C., Petzak, I., Harris, J. R., and Streeck, R. E. (1998). Papillomavirus assembly requires trimerization of the major capsid protein by disulfides between two highly conserved cysteines. J. Virol. 72, 6186–6189. Sapp, M., Volpers, C., Muller, M., and Streeck, R. E. (1995). Organization of the major and minor capsid proteins in human papillomavirus type 33 virus-like particles. J. Gen. Virol. 76, 2407–2412. Sasagawa, T., Pushko, P., Steers, G., Gschmeissner, S. E., Hajibagheri, M. A., Finch, J., Crawford, L., and Tommasino, M. (1995). Synthesis and assembly of virus-like particles of human papillomaviruses type 6 and type 16 in fission yeast Schizosaccharomyces pombe. Virology 206, 126–135. Smith, L. H., Foster, C., Hitchcock, M. E., Leiserowitz, G. S., Hall, K., Iseroff, R., Christensen, N. D., and Kreider, J. W. (1995). Titration of HPV 11 infectivity and antibody neutralization can be measured in vitro. J. Invest. Dermatol. 105, 1–7. Suzich, J. A., Ghim, S., Palmer-Hill, F. J., White, W. I., Tamura, J. K., Bell, J. A., Newsome, J. A., Bennet Jenson, A., and Schlegel, R. (1995). Systemic immunization with papillomavirus L1 protein completely prevents the development of viral mucosal papillomas. Proc. Natl. Acad. Sci. USA 92, 11553–11557. Touze, A., El Mehdaoui, S., Sizaret, P. Y., Mougin, C., Munoz, N., and Coursaget, P. (1998). The L1 major capsid protein of human papillo-

mavirus type 16 variants affects yield of virus-like particles produced in an insect cell expression system. J. Clin. Microbiol. 36, 2046–2051. Travis, J., Owen, M., George, P., Carrel, R., Rosemberg, S., Hallewell, R. A., and Barr, P. J. (1985). Isolation and properties of recombinant DNA produced variants of human ␣1-proteinase inhibitor. J. Biol. Chem. 260, 4384–4389. Unckell, F., Streeck, R. E., and Sapp, M. (1997). Generation and neutralization of pseudovirions of human papillomavirus type 33. J. Virol. 71, 2934–2939. Van Rast, M., Kaplan, J. B., and Burk, R. D. (1992). Phylogenetic classification of human papillomaviruses: Correlation with clinical manifestations. J. Gen. Virol. 73, 2653–2660. Volpers, C., Schirmacher, P., Streeck, R. E., and Sapp, M. (1994). Assembly of the major and the minor capsid protein of human papillomavirus type 33 into virus-like particles and tubular structures in insect cells. Virology 200, 504–512. Volpers, C., Unckell, F., Schirmacher, P., Streeck, R. E., and Sapp, M. (1995). Binding and internalization of human papillomavirus type 33 virus-like particles by eukaryotic cells. J. Virol. 69, 3258–3264. White, W. I., Wilson, S. D., Bonnez, W., Rose, R. C., Koenig, S., and Suzich, J. A. (1998). In vitro infection of type-restricted antibodymediated neutralization of authentic human papillomavirus type 16. J. Virol. 72, 959–964. Zaret, K. S., and Sherman, F. (1985). ␣-Aminoadipate as a primary nitrogen source for Saccharomyces cerevisiae mutants. J. Bacteriol. 162, 579–583. Zhou, J., Stenzel, D. J., Sun, X. Y., and Frazer, I. H. (1993). Synthesis and assembly of infectious bovine papillomavirus particles in vitro. J. Gen. Virol. 74, 763–768.