A thioredoxin domain-containing protein 12 from black rockfish Sebastes schlegelii: Responses to immune challenges and protection from apoptosis against oxidative stress

Comparative Biochemistry and Physiology, Part C 185–186 (2016) 29–37

Contents lists available at ScienceDirect

Comparative Biochemistry and Physiology, Part C journal homepage: www.elsevier.com/locate/cbpc

A thioredoxin domain-containing protein 12 from black rockfish Sebastes schlegelii: Responses to immune challenges and protection from apoptosis against oxidative stress William Shanthakumar Thulasitha a,b, Navaneethaiyer Umasuthan a,b, R.G.P.T. Jayasooriya a, Jae Koo Noh c, Hae-Chul Park d,⁎, Jehee Lee a,b,⁎⁎ a

Department of Marine Life Sciences, School of Marine Biomedical Sciences, Jeju National University, Jeju Self-Governing Province 690-756, Republic of Korea Fish Vaccine Development Center, Jeju National University, Jeju Self-Governing Province 690-756, Republic of Korea c Genetics & Breeding Research Center, National Institute of Fisheries Science, Geoje 656-842, Republic of Korea d Graduate School of Medicine, Korea University, Ansan, Gyeonggido 425-707, Republic of Korea b

a r t i c l e

i n f o

Article history: Received 19 November 2015 Received in revised form 19 February 2016 Accepted 28 February 2016 Available online 2 March 2016 Keywords: Thioredoxin domain containing protein 12 Immune challenge Oxidative stress Rockfish

a b s t r a c t Thioredoxin (TXN) superfamily proteins are identified by the presence of a thioredoxin active site with a conserved CXXC active motif. TXN members are involved in a wide range of biochemical and biological functions including redox regulation, refolding of disulfide containing proteins, and regulation of transcription factors. In the present study, a thioredoxin domain-containing protein 12 was identified and characterized from black rockfish, Sebastes schlegelii (RfTXNDC12). The full length of RfTXNDC12 consists of a 522-bp coding region encoding a 173amino acid protein. It has a 29-amino acid signal peptide and a single TXN active site with a consensus atypical WCGAC active motif. Multiple sequence alignment revealed that the active site is conserved among vertebrates. RfTXNDC12 shares highest identity with its Epinephelus coioides homolog. Transcriptional analysis revealed its ubiquitous expression in a wide range of tissues with the highest expression in the ovary. Immune challenges conducted with Streptococcus iniae and poly I:C caused upregulation of RfTXNDC12 transcript levels in gills and peripheral blood cells (PBCs), while lipopolysaccharide injection caused downregulation of RfTXNDC12 in gills and upregulation in PBCs. Similar to TXN, RfTXNDC12 exhibited insulin disulfide reducing activity. Interestingly, the recombinant protein showed significant protection of LNCaP cells against apoptosis induced by H2O2-mediated oxidative stress in a concentration dependent manner. Collectively, the present data indicate that RfTXNDC12 is a TXN superfamily member, which could function as a potential antioxidant enzyme and be involved in a defense mechanism against immune challenges. © 2016 Elsevier Inc. All rights reserved.

1. Introduction Cellular reactive oxygen species (ROS) are produced as by-products during normal cellular metabolism, upon microbial infection as antimicrobial agents or in response to various stimuli including cytokines, neurotransmitters, growth factors, and hormones. Oxidative stress to a cell can be defined as by the presence of ROS or oxidants in excess of the cell's ability to mount an effective antioxidant response (Ray et al., 2012). Many antioxidant enzymes, including peroxidases, superoxide dismutase, catalase, glutathione, and thioredoxins (TXNs), protect cells through redox homeostasis against oxidative stress (Abele and Puntarulo, 2004). Among these enzymes, TXNs are known to be one

⁎ Corresponding author. ⁎⁎ Correspondence to: J. Lee, Marine Molecular Genetics Lab, Department of Marine Life Sciences, College of Ocean Science, Jeju National University, 66 Jejudaehakno, Ara-Dong, Jeju 690-756, Republic of Korea. E-mail addresses: [email protected] (H.-C. Park), [email protected] (J. Lee).

http://dx.doi.org/10.1016/j.cbpc.2016.02.005 1532-0456/© 2016 Elsevier Inc. All rights reserved.

of the main intracellular redox regulatory agents involved in a wide range of biochemical and biological functions (Matsuo et al., 2001; McEligot et al., 2005; Moriarty-Craige and Jones, 2004). TXN has been identified in both prokaryotic and eukaryotic cells and has been shown to facilitate the refolding of disulfide-containing proteins (Liu et al., 2003). The intramolecular disulfide bond in the oxidized TXN is reduced by thioredoxin reductase and NADPH. In turn, two thiol groups in the reduced TXN can catalyze disulfide bond formation in multiple substrate proteins. Hence, TXN is involved in many thiol-dependent cellular processes including gene expression, signal transduction, and proliferation (Matsuo et al., 2001). In addition, human TXN was reported to function as a growth factor and an oxidative stress indicator in different cancers (Nakamura et al., 1999; Welsh et al., 2002). The TXN superfamily is a group of enzymes characterized by the presence of TXN-fold structure and TXN or TXN-like active sites with two conserved cysteine residues (CXXC) that are separated by two amino acid residues [6,7]. Trx can be a cytosolic (Trx-1) or a mitochondrial (Trx-2) form (Holmgren, 1985). In addition, disulfide bond formation in

30

W.S. Thulasitha et al. / Comparative Biochemistry and Physiology, Part C 185–186 (2016) 29–37

the endoplasmic reticulum (ER) is known to be catalyzed by several TXN superfamily enzymes including protein-disulfide isomerases (PDI) (Haugstetter et al., 2005; Noiva, 1999; Sevier and Kaiser, 2002), all of which are comprised of at least one TXN-like domain (Ellgaard and Ruddock, 2005). To date, nearly 20 human PDI or PDI-related family members have been identified (Ellgaard and Ruddock, 2005), which include ERdj5 (Cunnea et al., 2003), thioredoxin-related transmembrane protein 2 (TMX2) (Meng et al., 2003), ERp44 (Anelli et al., 2003), EndoPDI (Sullivan et al., 2003), ERp19, ERp46 (Knoblach et al., 2003), ERp28 (Ferrari et al., 1998), ERp72, PDI-related P5 (Ferrari and Soling, 1999), and thioredoxin domain-containing (TXNDC) protein 12 (previously reported as ERp16, ERp18 (Alanen et al., 2003), ERp19, or hTLP19). However, functional properties of these proteins are not fully understood (Ellgaard and Ruddock, 2005). TXNDC proteins have one or more thioredoxin active sites and have significant roles in redox regulation, defense against oxidative stress, refolding of sulfide containing proteins, and regulation of transcription factors (Jeong et al., 2008; Liu et al., 2003; Wei et al., 2012). Human TXNDC12, localized in ER (Do et al., 2004), is composed of a TXN-fold with a consensus active-site sequence (CXXC) (Liu et al., 2003). It catalyzes thiol-disulfide exchange reactions (Ellgaard and Ruddock, 2005; Jeong et al., 2008) and plays a crucial role in the cellular defense against prolonged ER stress (Do et al., 2004). At present, there are limited information regarding the structure and function of TXNDC12 in lower vertebrates, except for a study on the orange spotted grouper (Wei et al., 2012). In the present study, we describe the molecular characterization and functional properties of TXNDC12 from black rockfish, Sebastes schlegelii, by using a transcriptional profile and biological activities. 2. Material and methods 2.1. cDNA library and identification of RfTXNDC12 A cDNA library of black rockfish was constructed by 454-GS-FLX™ sequencing technique (Droege and Hill, 2008). In brief, total RNA was extracted from blood, liver, head kidney, gill, intestine, and spleen tissues of three fish (~100 g) challenged with immune stimulants, including Edwardsiella tarda (107 CFU/fish), Streptococcus iniae (107 CFU/fish), lipopolysaccharide (LPS; 1.5 mg/fish) and polyinosinic:polycytidylic acid (poly I:C; 1.5 mg/fish) using TRIzol reagent (TaKaRa, Japan) according to the manufacturer's instructions. The extracted RNA was then cleaned by an RNeasy Mini Kit (Qiagen, USA) and assessed for quality and quantified by using an Agilent 2100 Bio-analyzer (Agilent Technologies, Canada), resulting in an RNA integration score (RIN) of 7.1. Subsequently, a GS-FLX™ 454 shotgun library was constructed, and the cDNA database was established by using fragmented RNA from the aforementioned RNA samples (Macrogen, Korea). The complete sequence of RfTXNDC12 was identified form the cDNA library by the Basic Local Alignment Search Tool (BLAST) algorithm in NCBI (http://www.ncbi.nlm.nih.gov/BLAST).

of the RfTXNDC12 protein was generated by SWISS-MODEL (http:// swissmodel.expasy.org). A phylogenetic tree was constructed by the neighbor-joining method using the MEGA 5.0 package (http://www. megasoftware.net/). To deduce the confidence value for the phylogenetic analysis, bootstrap trials were replicated 5000 times.

2.3. Experimental animals and tissue collection Healthy black rockfish with an average body weight of 200 g were obtained from the Marine Science Institute of Jeju National University, Jeju Self Governing Province, Republic of Korea and were kept in 400 L flat-bottom tanks filled with aerated, sand-filtered seawater at 22 ± 1 °C. All fishes were acclimatized for one week prior to experiments. During acclimatization period fish were fed with commercial fish feed twice a day and stopped two days prior to the experiment. In order to examine the tissue-specific expression of RfTXNDC12 mRNA, peripheral blood was collected from caudal veins of five healthy fish using sterile syringes coated with 0.2% heparin sodium salt (USB, USA). Peripheral blood cells (PBCs) were immediately harvested by centrifugation at 3000 × g at 4 °C for 10 min. Other tissues, such as gills, liver, spleen, head kidney, kidney, skin, muscle, heart, brain, intestine, testes, and ovary, were also excised from five healthy individuals. These samples were immediately snap-frozen and stored at −80 °C for RNA isolation.

2.4. Immune challenge and tissue collection To determine the immune response of RfTXNDC12, acclimatized fish were divided into four groups and subjected to the following challenges: a bacterial strain S. iniae (1 × 105 CFU/μL), the immunostimulants LPS and poly I:C (1.5 μg/μL). Each of these stimulants was separately resuspended in 200 μL of phosphate-buffered saline (PBS) and intraperitonially administrated as a single dose to the respective group of fish. Meanwhile, 200 μL of PBS was injected to the control group. Then, PBCs and gill tissue samples were collected at 3, 6, 12, 24, and 48 h post-injection (p.i.) from five fish from each group (n = 5), snap-frozen in liquid nitrogen, and stored at −80 °C.

2.5. RNA extraction and cDNA synthesis Total RNA was extracted from tissues of five individual fish (40 mg/fish) using QIAzol® (Qiagen), and the RNA quality was assessed by 1.5% agarose gel electrophoresis and then quantified spectrophotometrically at 260 nm in a micro-drop plate (Thermo Scientific). The first strand cDNA synthesis was carried out using 2.5 μg of extracted total RNA by using PrimeScript™ II First-Strand cDNA Synthesis Kit (TaKaRa) and diluted 40 × in nuclease free water and stored at −20 °C until use.

2.2. In silico analysis of RfTXNDC12 In silico analysis of RfTXNDC12 was performed by using standard bioinformatic tools. The open reading frame (ORF) and amino acid sequence of RfTXNDC12 were determined by DNAssit (version 2.2). This sequence was subjected to a BLAST search to identify orthologous sequences for comparison. The amino acid sequence of RfTXNDC12 was analyzed using tools available in the ExPASy database (http:// www.expasy.org). The putative conserved domains were identified by the ScanProsite tool (http://prosite.expasy.org/cgibin/prosite). Disulfide bonds were predicted by DISULFIND, a disulfide bonding state and cysteine connectivity prediction server (http://www.disulfind.dsi.unifi. it). Sequence similarity analysis and pairwise and multiple alignments (MSA) were carried out using the ClustalW program in the BioEdit Sequence Alignment Editor package. The presumed tertiary structure

Table 1 Description of primers used in this study. Name

Primer sequence (5′ → 3′)

RfTXNDC12_FW1 AGTACTTCTACAGCACCGCAGAACA RfTXNDC12_RV1 TCTCCAGTGTGACCCTGCTTGAA RfTXNDC12_FW2 GAGA GAgaattcGCCAGCAGCAAAGGGTTTGG RfTXNDC12_RV2 GAGA GAaagcttTCACAGCTCGTCTCCAGTGTGA EF1A_FW AACCTGACCACTGAGGTGAAGTCTG EF1A_RV

TCCTTGACGGACACGTTCTTGATGTT

Description qPCR forward primer qPCR reverse primer Cloning primer with EcoRI restriction site Cloning primer with HindIII restriction site qPCR internal reference gene qPCR internal reference gene

W.S. Thulasitha et al. / Comparative Biochemistry and Physiology, Part C 185–186 (2016) 29–37

2.6. Transcriptional analysis of RfTXNDC12 by quantitative real-time PCR (qPCR) qPCR assay was performed, using gene-specific primers (Table 1), in a 10 μL mixture containing 3 μL diluted cDNA, 5 μL 2× TaKaRa Ex TaqΤμ SYBR premix, 0.4 μL of each primer (10 pmol/μL), and 1.2 μL dH2O. The mixture was subjected to the following program: one cycle at 95 °C for 30 s; 45 cycles of 95 °C for 5 s, 58 °C for 10 s, and 72 °C for 20 s, and a single final cycle at 95 °C for 15 s, 60 °C for 30 s. Relative RfTXNDC12 mRNA expression was determined by the Livak 2−ΔΔCT method (Livak and Schmittgen, 2001), using rockfish Elongation factor-1-alpha (EF1A) (GenBank accession no. KF430623) as the internal reference gene. For tissue-specific expression analysis, relative fold changes in expression were determined by comparison with heart tissue. For analysis of expression following immune challenges, relative-fold changes in expression in the PBCs or gills were determined by comparison with the PBS control at corresponding time points. All relative expression data are presented as mean ± standard deviation (S.D.). 2.7. Cloning and recombinant protein purification The ORF of the RfTXNDC12 excluding the signal sequence was amplified and the purified PCR product was digested with EcoRI and HindIII restriction enzymes. Then, the digested insert was ligated into the pMAL-c2X protein expression vector, which was also digested with the same restriction enzymes. The recombinant plasmid construct was transformed into the Escherichia coli DH5α strain for propagation. Purified plasmid DNA was sequenced (Macrogen, Korea). After confirming the sequence, the recombinant plasmid was transformed into the E. coli BL21 prokaryotic system to express and subsequently purify recombinant RfTXNDC12 (rRfTXNDC12). Briefly, E. coli BL21 cells harboring pMAL-c2X–RfTXNDC12 were grown in 500 mL LB media at 37 °C and transferred to 20 °C when the OD600 reached 0.3. Protein expression was induced by the addition of 1 mM isopropylβ-thiogalactopyranoside when the OD600 reached 0.5. Cells were harvested after 12 h of incubation by centrifugation at 2500 ×g for 30 min at 4 °C and resuspended in column buffer (Tris–HCl, pH 7.4, 200 mM NaCl). Protein purification was performed by column chromatography according to the pMAL-c2X purification protocol (New England BioLabs Inc., USA), and the purified protein was stored at − 80 °C until use. The recombinant fusion protein was subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) analysis. The recombinant maltose binding protein (rMBP) was purified and used as control in all the assays. 2.8. Turbidimetric assay for insulin disulfide reduction The insulin disulfide reductase activity of rRfTXNDC12 was measured based on the precipitation of reduced insulin as previously described (Holmgren, 1979) with slight modifications. In brief, a 250 μL reaction mixture was prepared containing 100 mM potassium phosphate buffer (pH 7.0), 2 mM EDTA, 130 mM bovine insulin (Sigma, USA), 0.6 mM dithiothreitol (DTT; Amersham Life Sciences), and purified rRfTXNDC12. The reaction was initiated by the addition of insulin to the system, and incubated for 10 min at 25 °C. The insoluble precipitate (reduced insulin) was measured spectrophotometrically at 650 nm at every 10 min interval. The experiment was conducted with same concentration of rMBP-fusion protein as control. One unit of enzyme activity was defined as the amount of enzyme that can change absorbance by 1.0 at 650 nm in a reaction as describe above. The assay was conducted in triplicate. 2.9. Protection from apoptosis against oxidative stress First, human LNCaP cells were treated with rRfTXNDC12 and then exposed to the oxidative stress. Thereafter, apoptosis percentage was

31

measured using a Flow cytometer (Muse™ cell analyzer). Total cells were harvested and stained by ApopNexin-FITC kit (Invitrogen, USA). Briefly, LNCaP cells were cultured in RPMI 1640 culture medium supplemented with 10% FBS, 100 U/mL penicillin, and 100 mg/mL streptomycin in a 5% CO2 humidified incubator at 37 °C. Subsequently, cells were seeded onto a 6-well plate with the density of 1 × 105 cells/mL 24 h prior to the experiment. Treatments were as follows; (a) untreated control, (b) cells treated with 100 μg/mL rMBP, (c) cells treated with 100 μg/mL rRfTXNDC12, (d) cells treated with 500 μmol of H2O2, (e) cells treated with 100 μg/mL rMBP and 500 μmol of H2O2, (f) cells treated with 25 μg/mL RfTXNDC12 and 500 μmol of H 2 O 2, and (g) cells treated with 100 μg/mL rRfTXNDC12 and 500 μmol of H2O2. After 6 h of incubation at 25 °C, cells were harvested, washed twice with cold PBS, and resuspended in 1 × Annexin V binding buffer. Then, 1.25 μL of FITC Annexin V was added to 100 μL of cell suspension and incubated for 15 min at 4 °C. After that, 10 μL of propidium iodide solution was added and mixed gently. This mixture was kept in room temperature for 15 min in dark. Finally, 400 μL of Annexin V was added to each tube and cell viability was measured using flow cytometry.

2.10. Statistical analysis Data were tested for significance, using the SPSS 16.0 software. For statistical analysis of mRNA expression, one-way analysis of variance (ANOVA) with Duncan's multiple range post-hoc analysis was performed.

3. Results 3.1. Isolation and sequence characterization of RfTXNDC12 We identified a putative cDNA of TXNDC12 from a rockfish cDNA database based on homology with known sequences available in the NCBI database using BLASTX tool. The full-length of RfTXNDC12 cDNA (GenBank accession no. KT448553) and its deduced amino acid (aa) sequences are shown in Fig. 1. The rockfish RfTXNDC12 cDNA was comprised of 1291 bp with a 522-bp ORF (including stop codon), a 20-bp 5′-untranslated region (UTR), and a 749-bp 3′-UTR. The ORF of the RfTXNDC12 encoded a putative peptide of 173 aa residues with a calculated molecular mass of 19.103 kDa and theoretical pI of 5.34. The RfTXNDC12 protein contained a potential signal peptide of 29 aa at the N-terminal. In the amino acid sequence, a single thioredoxin family active site (59Met–Phe77) was detected by the ScanProsite program with the characteristically conserved thioredoxin active site Cys-Gly-Ala-Cys (67CGAC70). The DISULFIND program predicted a disulfide bond between 67C and C70. As shown in the predicted protein models in Fig. 2, the overall structure of RfTXNDC12 corresponded to TXNDC12 homologs of Epinephelus coioides and Homo sapiens than to the TXN1 of S. schlegelii. Multiple sequence and pairwise alignments revealed high conservation of residues among TXNDC12 homologues (Fig. 3). In particular, the thioredoxin family active site with the WCGAC motif was completely conserved in the species analyzed. Moreover, a probable motif for ER retrieval (GDEL) was detected at the C-terminal. According to pairwise alignment, RfTXNDC12 shared highest identity (93.6%) with the E. coioides homolog (Fig. 3). RfTXNDC12 shared N 70% identity with other examined fish counterparts. In order to compare the molecular phylogeny of RfTXNDC12 with that of TXNDC12 and TXN, orthologs from different taxa were subjected to phylogenetic tree construction using NJ method. TXNDC12 and TXN branches split and formed two distinct groups. RfTXNDC12 was placed within the teleostean group and was evolutionarily more closely related to TXNDC12 of E. coioides (Fig. 4).

32

W.S. Thulasitha et al. / Comparative Biochemistry and Physiology, Part C 185–186 (2016) 29–37

Fig. 1. Nucleotide (black) and amino acid (blue) sequences of rockfish TXNDC12 (RfTXNDC12). In the nucleotide sequence: UTRs are in lower case letters and the ORF are in uppercase letters. The start codon (ATG) and stop codon (TGA) are boxed and the polyadenylation sites (ATTAAA) are underlined. In the amino acid sequence: a thioredoxin family active site (59M–F77) is shaded in gray and underlined in red, respectively. The conserved thioredoxin active motif (WCGAC) is boxed. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

3.2. Transcriptional analysis of RfTXNDC12 3.2.1. Basal gene expression in different tissues of rockfish In order to determine the tissue-level mRNA expression of RfTXNDC12, quantitative real time PCR was employed in healthy unchallenged rockfish tissues. Relative expression was computed by comparing the transcript level in each tissue with that in heart tissue. The results showed that RfTXNDC12 mRNA was constitutively expressed

in all examined tissues; however, the level of expression varied among tissues. Ovarian tissue had the highest expression followed by skin, blood, brain, testes, and gills (Fig. 5). 3.2.2. Temporal gene expression of RfTXNDC12 To examine the gene expression of RfTXNDC12 upon different stimuli (mitogens: LPS and poly I:C and a live microbial pathogen: S. iniae), gill tissue and PBCs were collected from the challenged fish at different p.i.

Fig. 2. Predicted tertiary model of rockfish RfTXNDC12 (A), orange spotted grouper EcTXNDC12 (B), human TXNDC12 (C), and rockfish TXN1. The conserved cysteine residues in the TXN active motif are labeled in all models.

W.S. Thulasitha et al. / Comparative Biochemistry and Physiology, Part C 185–186 (2016) 29–37

33

Fig. 3. Multiple sequence alignment of RfTXNDC12 with some of the known vertebrate TXNDC12 counterparts. Completely and partially conserved residues among the sequences were indicated by (*) and (.) or (:) signs. The conserved TXN active motif is boxed. The percentages of identity and similarity are indicated along with GenBank accession numbers.

time points. There was no mortality after the challenge. The mRNA expression profile of RfTXNDC12 in gill tissue (A) and PBCs (B) are shown in Fig. 6. Following the LPS-challenge, the expression of RfTXNDC12

was significantly downregulated in gill tissue; however, it was upregulated at 3 h and 6 h p.i. in PBCs. Meanwhile, S. iniae administration significantly induced RfTXNDC12 expression in both tissues, with the

Fig. 4. Phylogenetic tree of RfTXNDC12 with the known vertebrate TXNDC12 and TXN. The evolutionary relationship was evaluated using the MEGA 5.0 software by following the neighbor-joining method based on ClustalW protein sequence alignment. Corresponding bootstrap values are indicated on each branch of the tree. NCBI GenBank accession numbers of each protein are also denoted in the constructed tree.

34

W.S. Thulasitha et al. / Comparative Biochemistry and Physiology, Part C 185–186 (2016) 29–37

3.3. Recombinant expression and purification of RfTXNDC12 To determine the biological functions of RfTXNDC12, the rRfTXNDC12 protein was isolated in the form of a fusion protein, and the purity and molecular weight of rRfTXNDC12 were examined by 12% SDSPAGE, visualized by Coomassie Brilliant Blue staining (Fig. 7). The specific band corresponding to the expected size of 58.479 kDa (without signal peptide) was observed in the soluble fraction and in the purified eluent, which confirmed the predicted molecular mass of the recombinant protein (15.979 kDa), since the molecular mass of the MBP-tag was 42.5 kDa. The purified rMBP-fusion protein was used as a control in all experiments. The concentration of the purified proteins was estimated by Bradford's method.

Fig. 5. Tissue-specific mRNA expression of RfTXNDC12. Expression fold-changes of mRNA was detected by qPCR and evaluated by the 2−ΔΔCT method using the rockfish elongation factor-1α gene as the internal reference. Data are presented relative to that in the heart. Error bars represent the SD (n = 3).

highest increase (~25 fold) in gill tissue at 48 h p.i. The intraperitoneal injection of viral mimic mitogen poly I:C also significantly induced the expression of RfTXNDC12 in both tissues. Marked increase in expression (~60 fold) was detected at 48 h p.i in gill tissue when challenged with poly I:C.

3.4. Biological functions of RfTXNDC12 3.4.1. Turbidimetric assay for insulin disulfide reduction An in vitro turbidimetric assay was conducted to examine whether rRfTXNDC12 has the ability to reduce insulin disulfide in the presence of DTT. Results showed that rRfTXNDC12 has TXN-like activity similar to other TXNs (Fig. 8). The rate of insulin reduction by rRfTXNDC12 increased with time and reached its optimum level at 60 min. However, in the control assay conducted with rMBP, the rate and amount of insulinprecipitation was very low compared with those of rRfTXNDC12.

Fig. 6. Temporal gene expression of RfTXNDC12 in gills (A) and PBCs (B) after in vivo challenge with lipopolysaccharides (LPS), S. iniae and poly I:C. Relative mRNA levels were determined by SYBR green qPCR. The rockfish elongation factor-1α was used as the internal reference gene. The calculation was performed using the Livak method and transcription fold changes are presented as relative to the mRNA level of the PBS-injected group at each time point. The results are reported as mean ± standard deviation (SD) of triplicates. The significance of expressional differences among different time points were analyzed by one-way analysis of variance (ANOVA) followed by Duncan's Multiple Range test, using the SPSS 16.0 program. Data indicated with different letters are significantly different (p b 0.05) from the un-injected (0 h) control.

W.S. Thulasitha et al. / Comparative Biochemistry and Physiology, Part C 185–186 (2016) 29–37

35

4. Discussion

Fig. 7. SDS-PAGE analysis of the rockfish RfTXNDC12 recombinant fusion protein. E. coli (BL21) was transformed with the pMAL-c2X/RfTXNDC12 (without signal sequence) recombinant construct and induced with isopropyl-β-thiogalactopyranoside (0.25 mM) at 20 °C for 12 h. Harvested cells were purified by amylose resin affinity chromatography. Band sizes are displayed in kDa. Lanes: M, protein marker (Enzynomics); UI, Un-induced total cellular extract; Lys, induced total cellular extract; Pel, induced insoluble pellets; and rP, induced purified rRfTXNDC12 fusion protein.

3.4.2. Protection from apoptosis against oxidative stress The rRfTXNDC12–MBP fusion protein was used to investigate the anti-apoptotic activity against H2O2 -induced oxidative stress. Cell viability of LNCaP cells upon H2 O2 treatment was determined by flow cytometry (Fig. 9A). There was no significant difference in the percentage of viable cells in untreated cells (a = 94.74%), cells treated with 500 μg/mL rMBP (b = 95.04%), or 500 μg/mL rRfTXNDC12 (c = 94.8%), or cells treated with 500 μg/mL rRfTXNDC12 and 500 μmol of H2O2 (g = 94.42%). Meanwhile, there was no significant different between cells treated with 500 μmol of H2O2 (d = 31.3%) and those treated with 500 μg/mL rMBP and 500 μmol of H2O2 (e = 30.5%) in which significant apoptosis occurred. In addition, cells treated with 125 μg/mL rRfTXNDC12 and 500 μmol of H2O2 (f) showed about 41.82% of viable cells upon oxidative stress which was higher than that of control (d). These flow cytometric data were also supported by the microscopic observation of LNCaP cells used in each experiment (Fig. 9B).

Fig. 8. Insulin disulfide reduction by rRfTXNDC12. Insulin and DTT were incubated with RfTXNDC12 or MBP and the insulin reducing activity of rRfTXNDC12 was spectrophotometrically quantified by measuring the absorbance at 650 nm at 10 min intervals.

In the present study, we identified a novel teleostean counterpart of thioredoxin domain-containing protein 12 from the rockfish, and characterized its molecular and biological features. TXNs are small, low molecular weight, ubiquitous proteins involved in several biological functions and structurally characterized by the presence of the CXXC motif (Holmgren, 1985). The nature of the residues located between the two cysteine residues determines the redox potentials of members of the TXN superfamily and hence their biological activity (Alanen et al., 2003; Bulleid, 2012). Among the TXN family members, TXN possessed the active site motif CGPC, which acts as a reductant, whereas the PDI family members possessed CGHC that act as oxidants and isomerases, and in the DsbA family, this motif consisted of CPHC, which act as oxidants (Alanen et al., 2003). In contrast, human ERp18 consisted of the CGAC motif, and thus it does not directly belong to the above group. However, it shared more similarities with PDI and TXN domain sequences than with the DsbA family (Alanen et al., 2003). MSA revealed that rockfish TXNDC12 and all the analyzed TXNDC12 sequences have a conserved CGAC motif in their TXN active sites, implying that TXNDC12 proteins might have similar structural and functional features as TXN family members. In addition, a conserved ER retrieval motif (GDEL) in the C-terminal region was also detected, where the glycine residue is replaced by glutamic acid in human ERp18 (Alanen et al., 2003) and Salmo salar TXNDC12 to an EDEL motif. At the same time, some of the resident ER proteins have a KDEL motif, which is important for their retention in the ER (Munro and Pelham, 1987). Overall, a considerable consensus was observed in the sequence, except in the extreme N-terminal signal peptide region, further suggesting overall functional similarities among vertebrates. Homology, pairwise alignment, MSA, and phylogenetic analysis clearly showed that TXNDC12 is an evolutionarily conserved protein in vertebrates. RfTXNDC12 was ubiquitously expressed in all examined tissues with significantly abundant transcripts in ovary followed by skin, PBCs, and brain. Meanwhile, human hTLP19 (TXNDC12) also showed ubiquitous expression with high levels in placenta, and it was inferred that it might be involved in development (Liu et al., 2003). Moreover, TXNDC12 of E. coioides also demonstrated a wider expression with abundant transcripts in the liver followed by the brain, the muscles, and the kidney (Wei et al., 2012). Collectively, ubiquitous expression of TXNDC12 in different tissues suggests its involvement in various physiological processes. Few studies have focused on TXNDC12 gene expression profiling in response to various pathophysiological stimulants. In this context, data from a single report is available for the fish, E. coioides, in which the expression of TXNDC12 was induced significantly by the Singapore irido virus (SGIV), and the expression pattern was comparable to that of RfTXNDC12 expression in PBCs (Kang et al., 2006). Moreover, pathogen-induced stimulation of TXN was reported against sea bream iridovirus (RSIV) in Oplegnathus fasciatus (Kim et al., 2011), against viral infection in Bombyx mori (Lee et al., 2005), and against LPS and Vibrio tapetis in Ruditapes philippinarum (Umasuthan et al., 2012). In the present study, mitogenic and live bacterial challenges upregulated the expression of RfTXNDC12 in a tissue-specific manner, except for the LPS-challenge in gill tissue. By comparison, with the injection of the viral mimic poly I:C (a synthetic viral double-stranded RNA analog), the induction of mRNA expression of RfTXNDC12 was several fold higher than with other challenges in gill tissue. This suggests that RfTXNDC12 may be involved in the viral-induced oxidative stress relieving mechanism. However, modulations of the expression pattern could be attributed to an underlying molecular mechanism for maintaining the pro-oxidant and anti-oxidant balance (Revathy et al., 2012). Metabolic changes during the elimination of microbial pathogens are correlated with the elevated production of ROS (Buggé et al., 2007; Segal, 2005), and the organism has to balance the elevated ROS level to protect cells from apoptosis. Therefore, the expression patterns of

36

W.S. Thulasitha et al. / Comparative Biochemistry and Physiology, Part C 185–186 (2016) 29–37

Fig. 9. Protection from apoptosis against H2O2-induced oxidative stress by rRfTXNDC12. Oxidative stress on LNCaP cells was induced by 500 μmol of H2O2. (A) Flowcytometric analysis of each experiment and their apoptosis profiles: (a) control cells, (b) cells treated with 100 μg/mL rMBP, (c) cells treated with 100 μg/mL rRfTXNDC12, (d) cells treated only with 500 μmol of H2O2, (e) cells treated with 100 μg/mL rMBP and 500 μmol of H2O2, (f) cells treated with 25 μg/mL rRfTXNDC12 and 500 μmol of H2O2, (g) cells treated with 100 μg/mL rRfTXNDC12 and 500 μmol of H2O2. The percentages of viable and apoptotic cells are indicated in the graphical representation. (B) Morphological examination of cells from each experiment (a–g) by light microscopy (400×).

RfTXNDC12 in response to immune challenges may be attributed to a molecular mechanism to maintain redox homeostasis. Biological properties of RfTXNDC12 were evaluated by in vitro assays using rRfTXNDC12 expressed in a bacterial system. According to our results, RfTXNDC12 is characterized as a member of the TXN superfamily. In order to address the TXN-enzymatic activity of rRfTXNDC12, the classical insulin disulfide-reduction assay was first performed in the presence of DTT. The results suggested that rRfTXNDC12 possesses TXN activity, which is comparable to that of other TXN family members. This result was compatible with the results for TXNDC12 (Wei et al., 2012) and thioredoxin related protein14 (TRP14) (Wei et al., 2013) from E. coioides. Human sperm specific TXNDC2 and TXNDC3 are involved in protection against age-related oxidative stress (Smith et al., 2013). In addition, E. coioides TXNDC12 (Wei et al., 2012) and TRP14 (Wei et al., 2013) offered significant protection against oxidative stress caused by viral infection in GS cells. Likewise, TXN-1 from O. fasciatus also showed significant protection against oxidative stress and enhanced the viability of kidney leukocytes (Kim et al., 2011). In order to confirm the protective activity of rRfTXNDC12 against oxidative stress induced apoptosis, we performed the cell viability assay using LNCaP cells, which undergo apoptosis when treated with H2O2. Flow cytometry was employed to estimate cell viability; our results indicated that incubating the cells with rRfTXNDC12, which were pre-treated with H2O2, significantly recovered them from undergoing apoptosis in a rRfTXNDC12-dose dependent manner. Evidently, our microscopic data for morphological variations in the examined cells were in accordance with the corresponding apoptosis profiles (Fig. 9). Experiments with MBP had no significant impact on either cell viability or cell morphology and clearly suggested that the protective effect is a result of rRfTXNDC12. The results from the present study clearly confirmed that rRfTXNDC12 was able to protect the cells from ROS-induced apoptosis in a concentration-dependent manner. 5. Conclusions In summary, a TXNDC12 homolog was identified and cloned from the rockfish S. schlegelii. It was constitutively expressed in all the tissues tested and upregulated upon injection with live bacterial and mitogenic stimuli in gills and blood. The recombinant fusion protein showed significant TXN-activity, and provided protection from apoptosis against

oxidative stress in vitro. Collectively, the transcriptional and biological assay data from the present study suggests that, like TXN, RfTXNDC12 could function as a potential antioxidant enzyme involved in the defense against immune challenges. Acknowledgment This research was a part of the project titled ‘Fish Vaccine Research Center’, funded by the Ministry of Oceans and Fisheries, Korea and by a grant from the National Institute of Fisheries Science (R2015001). References Abele, D., Puntarulo, S., 2004. Formation of reactive species and induction of antioxidant defence systems in polar and temperate marine invertebrates and fish. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 138, 405–415. Alanen, H.I., Williamson, R.A., Howard, M.J., Lappi, A.-K., Jäntti, H.P., Rautio, S.M., Kellokumpu, S., Ruddock, L.W., 2003. Functional characterization of ERp18, a new endoplasmic reticulum-located thioredoxin superfamily member. J. Biol. Chem. 278, 28912–28920. Anelli, T., Alessio, M., Bachi, A., Bergamelli, L., Bertoli, G., Camerini, S., Mezghrani, A., Ruffato, E., Simmen, T., Sitia, R., 2003. Thiol-mediated protein retention in the endoplasmic reticulum: the role of ERp44. EMBO J. 22, 5015–5022. Buggé, D.M., Hégaret, H., Wikfors, G.H., Allam, B., 2007. Oxidative burst in hard clam (Mercenaria mercenaria) haemocytes. Fish Shellfish Immunol. 23, 188–196. Bulleid, N.J., 2012. Disulfide bond formation in the mammalian endoplasmic reticulum. Cold Spring Harb. Perspect. Biol. 4. Cunnea, P.M., Miranda-Vizuete, A., Bertoli, G., Simmen, T., Damdimopoulos, A.E., Hermann, S., Leinonen, S., Huikko, M.P., Gustafsson, J.A., Sitia, R., Spyrou, G., 2003. ERdj5, an endoplasmic reticulum (ER)-resident protein containing DnaJ and thioredoxin domains, is expressed in secretory cells or following ER stress. J. Biol. Chem. 278, 1059–1066. Do, J.W., Moon, C.H., Kim, H.J., Ko, M.S., Kim, S.B., Son, J.H., Kim, J.S., An, E.J., Kim, M.K., Lee, S.K., Han, M.S., Cha, S.J., Park, M.S., Park, M.A., Kim, Y.C., Kim, J.W., Park, J.W., 2004. Complete genomic DNA sequence of rock bream iridovirus. Virology 325, 351–363. Droege, M., Hill, B., 2008. The Genome Sequencer FLX System—longer reads, more applications, straight forward bioinformatics and more complete data sets. J. Biotechnol. 136, 3–10. Ellgaard, L., Ruddock, L.W., 2005. The human protein disulphide isomerase family: substrate interactions and functional properties. EMBO Rep. 6, 28–32. Ferrari, D.M., Soling, H.D., 1999. The protein disulphide-isomerase family: unravelling a string of folds. Biochem. J. 339, 1–10. Ferrari, D.M., Nguyen Van, P., Kratzin, H.D., Soling, H.D., 1998. ERp28, a human endoplasmic-reticulum-lumenal protein, is a member of the protein disulfide isomerase family but lacks a CXXC thioredoxin-box motif. Eur. J. Biochem. 255, 570–579. Haugstetter, J., Blicher, T., Ellgaard, L., 2005. Identification and characterization of a novel thioredoxin-related transmembrane protein of the endoplasmic reticulum. J. Biol. Chem. 280, 8371–8380. Holmgren, A., 1979. Thioredoxin catalyzes the reduction of insulin disulfides by dithiothreitol and dihydrolipoamide. J. Biol. Chem. 254, 9627–9632.

W.S. Thulasitha et al. / Comparative Biochemistry and Physiology, Part C 185–186 (2016) 29–37 Holmgren, A., 1985. Thioredoxin. Annu. Rev. Biochem. 54, 237–271. Jeong, W., Lee, D.-Y., Park, S., Rhee, S.G., 2008. ERp16, an endoplasmic reticulum-resident thiol-disulfide oxidoreductase biochemical properties and role in apoptosis induced by endoplasmic reticulum stress. J. Biol. Chem. 283, 25557–25566. Kang, Y.-S., Kim, Y.-M., Park, K.-I., Kim Cho, S., Choi, K.-S., Cho, M., 2006. Analysis of EST and lectin expressions in hemocytes of Manila clams (Ruditapes philippinarum) (Bivalvia: Mollusca) infected with Perkinsus olseni. Dev. Comp. Immunol. 30, 1119–1131. Kim, D.-H., Kim, J.-W., Jeong, J.-M., Park, H.-J., Park, C.-I., 2011. Molecular cloning and expression analysis of a thioredoxin from rock bream, Oplegnathus fasciatus, and biological activity of the recombinant protein. Fish Shellfish Immunol. 31, 22–28. Knoblach, B., Keller, B.O., Groenendyk, J., Aldred, S., Zheng, J., Lemire, B.D., Li, L., Michalak, M., 2003. ERp19 and ERp46, new members of the thioredoxin family of endoplasmic reticulum proteins. Mol. Cell. Proteomics 2, 1104–1119. Lee, K.S., Kim, S.R., Park, N.S., Kim, I., Kang, P.D., Sohn, B.H., Choi, K.H., Kang, S.W., Je, Y.H., Lee, S.M., 2005. Characterization of a silkworm thioredoxin peroxidase that is induced by external temperature stimulus and viral infection. Insect Biochem. Mol. Biol. 35, 73–84. Liu, F., Rong, Y.-P., Zeng, L.-C., Zhang, X., Han, Z.-G., 2003. Isolation and characterization of a novel human thioredoxin-like gene hTLP19 encoding a secretory protein. Gene 315, 71–78. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(−Delta Delta C(T)) Method. Methods 25, 402–408. Matsuo, Y., Akiyama, N., Nakamura, H., Yodoi, J., Noda, M., Kizaka-Kondoh, S., 2001. Identification of a novel thioredoxin-related transmembrane protein. J. Biol. Chem. 276, 10032–10038. McEligot, A.J., Yang, S., Meyskens Jr., F.L., 2005. Redox regulation by intrinsic species and extrinsic nutrients in normal and cancer cells. Annu. Rev. Nutr. 25, 261–295. Meng, X., Zhang, C., Chen, J., Peng, S., Cao, Y., Ying, K., Xie, Y., Mao, Y., 2003. Cloning and identification of a novel cDNA coding thioredoxin-related transmembrane protein 2. Biochem. Genet. 41, 99–106. Moriarty-Craige, S.E., Jones, D.P., 2004. Extracellular thiols and thiol/disulfide redox in metabolism. Annu. Rev. Nutr. 24, 481–509. Munro, S., Pelham, H.R., 1987. A C-terminal signal prevents secretion of luminal ER proteins. Cell 48, 899–907.

37

Nakamura, H., Bai, J., Nishinaka, Y., Ueda, S., Sasada, T., Ohshio, G., Imamura, M., Takabayashi, A., Yamaoka, Y., Yodoi, J., 1999. Expression of thioredoxin and glutaredoxin, redox-regulating proteins, in pancreatic cancer. Cancer Detect. Prev. 24, 53–60. Noiva, R., 1999. Protein disulfide isomerase: the multifunctional redox chaperone of the endoplasmic reticulum. Semin. Cell Dev. Biol. 10, 481–493. Ray, P.D., Huang, B.-W., Tsuji, Y., 2012. Reactive oxygen species (ROS) homeostasis and redox regulation in cellular signaling. Cell. Signal. 24, 981–990. Revathy, K.S., Umasuthan, N., Lee, Y., Whang, I., Kim, H.C., Lee, J., 2012. Cytosolic thioredoxin from Ruditapes philippinarum: molecular cloning, characterization, expression and DNA protection activity of the recombinant protein. Dev. Comp. Immunol. 36, 85–92. Segal, A.W., 2005. How neutrophils kill microbes. Annu. Rev. Immunol. 23, 197. Sevier, C.S., Kaiser, C.A., 2002. Formation and transfer of disulphide bonds in living cells. Nat. Rev. Mol. Cell Biol. 3, 836–847. Smith, T.B., Baker, M.A., Connaughton, H.S., Habenicht, U., Aitken, R.J., 2013. Functional deletion of Txndc2 and Txndc3 increases the susceptibility of spermatozoa to age-related oxidative stress. Free Radic. Biol. Med. 65, 872–881. Sullivan, D.C., Huminiecki, L., Moore, J.W., Boyle, J.J., Poulsom, R., Creamer, D., Barker, J., Bicknell, R., 2003. EndoPDI, a novel protein-disulfide isomerase-like protein that is preferentially expressed in endothelial cells acts as a stress survival factor. J. Biol. Chem. 278, 47079–47088. Umasuthan, N., Revathy, K.S., Lee, Y., Whang, I., Lee, J., 2012. Mitochondrial thioredoxin-2 from Manila clam (Ruditapes philippinarum) is a potent antioxidant enzyme involved in antibacterial response. Fish Shellfish Immunol. 32, 513–523. Wei, J., Ji, H., Guo, M., Qin, Q., 2012. Isolation and characterization of a thioredoxin domain-containing protein 12 from orange-spotted grouper, Epinephelus coioides. Fish Shellfish Immunol. 33, 667–673. Wei, J., Ji, H., Guo, M., Yan, Y., Qin, Q., 2013. Identification and characterization of TRP14, a thioredoxin-related protein of 14 kDa from orange-spotted grouper, Epinephelus coioides. Fish Shellfish Immunol. 35, 1670–1676. Welsh, S.J., Bellamy, W.T., Briehl, M.M., Powis, G., 2002. The redox protein thioredoxin-1 (Trx-1) increases hypoxia-inducible factor 1alpha protein expression: Trx-1 overexpression results in increased vascular endothelial growth factor production and enhanced tumor angiogenesis. Cancer Res. 62, 5089–5095.