- Email: [email protected]
Ameliorative effect of atractylenolide III in the mast cell proliferation induced by TSLP
Food and Chemical Toxicology 106 (2017) 78e85
Contents lists available at ScienceDirect
Food and Chemical Toxicology journal homepage: www.elsevier.com/locate/foodchemtox
Ameliorative effect of atractylenolide III in the mast cell proliferation induced by TSLP Myoung-schook Yoou a, Sun-Young Nam a, Mu Hyun Jin b, So Young Lee b, Mi-Sun Kim b, Seok Seon Roh c, d, In Hwa Choi c, e, Nariyah Woo f, SeokWon Lim f, Dong Hyun Kim f, Jae-Bum Jang g, Hyung-Min Kim a, c, *, Hyun-Ja Jeong f, ** a
Department of Pharmacology, College of Korean Medicine, Kyung Hee University, 26, Kyungheedae-ro, Dongdaemun-gu, Seoul, 02447, Republic of Korea Skin Research Center, Research Park, LG Household & Healthcare Ltd., 175, Gajeong-ro, Yuseong-gu, Daejeon, 34114, Republic of Korea Whoo Oriental Herb & Skin Research Society, Daejeon, 34114, Republic of Korea d College of Korean Medicine, Daejeon University, Daejeon, 305-343, Republic of Korea e Department of Oriental Dermatology, College of Korean Medicine, Kyung Hee University, Seoul, 02447, Republic of Korea f Department of Food Science & Technology, Hoseo University, 20, Hoseo-ro 79beon-gil, Baebang-eup, Asan, Chungcheongnam-do 31499, Republic of Korea g Department of Pharmaceutical Engineering, Hoseo University, 20, Hoseo-ro 79beon-gil, Baebang-eup, Asan, Chungcheongnam-do 31499, Republic of Korea b c
a r t i c l e i n f o
a b s t r a c t
Article history: Received 29 March 2016 Received in revised form 10 January 2017 Accepted 20 May 2017 Available online 22 May 2017
Atractylenolide III (ATL-III) is an active compound of Atractylodes lancea, which has been widely used for the treatment of cancer. Cancer is closely connected with inflammation, and many anti-inflammatory agents are also used to treat cancer. We investigated the influence of ATL-III on thymic stromal lymphopoietin (TSLP)-induced inflammatory reactions. Pretreatment with ATL-III suppressed murine double minute 2 levels and promoted p53 levels in TSLP-treated human mast cell, HMC-1 cells. Mast cell proliferation increased by TSLP or IL-3 stimulation was significantly decreased by ATL-III pretreatment. Interleukin (IL)-13 and phosphorylated signal transducer and activator of transcription 3, 5, and 6 levels in TSLP-treated HMC-1 cells were also decreased by ATL-III pretreatment. In addition, ATL-III decreased the TSLP-induced production of proinflammatory cytokines (IL-6, IL-1b, tumor necrosis factor-a, and IL8). ATL-III decreased the levels of Bcl2 and procaspase-3 and increased caspase-3 activation and cleaved PARP levels. Furthermore, ATL-III decreased TSLP-induced mast cell proliferation and the production of inflammatory cytokine by LAD2 cells. Taken together, these findings suggest that ATL-III plays a useful role as an anti-inflammatory agent and should be viewed as a potential anti-cancer agent. © 2017 Elsevier Ltd. All rights reserved.
Keywords: Atractylenolide III Mast cell Thymic stromal lymphopoietin Murine double minute 2 Signal transducer and activator of transcription 6 Interleukin-13
1. Introduction Atopic dermatitis (AD) is a chronic inflammatory skin disease that often manifests in early childhood. AD is characterized by eczema and intense pruritus, and is associated with rhinitis, food allergies, and allergic asthma (Groneberg et al., 2005). Mast cells
* Corresponding author. Department of Pharmacology, College of Korean Medicine, Kyung Hee University, 26, Kyungheedae-ro, Dongdaemun-gu, Seoul, 02447, Republic of Korea. ** Corresponding author. Department of Food Science & Technology, Hoseo University, 20, Hoseo-ro 79beon-gil, Baebang-eup, Asan, Chungcheongnam-do 31499, Republic of Korea. E-mail addresses: [email protected] (H.-M. Kim), [email protected] (H.-J. Jeong). http://dx.doi.org/10.1016/j.fct.2017.05.042 0278-6915/© 2017 Elsevier Ltd. All rights reserved.
are activated by crosslinking of their surface receptors for IgE (FcεRI) and this leads to the secretion of vasoactive, proinflammatory, and nociceptive mediators such as histamine, interleukin (IL)-1b, IL-6, tumor necrosis factor (TNF)-a, and IL-8, which are essential for the development of AD (Singh et al., 1999; Theoharides and Cochrane., 2004). Keratinocytes also contributes to the development of AD (Esche et al., 2004). Thymic stromal lymphopoietin (TSLP) is highly expressed in the keratinocytes of AD lesions and the degree of this overexpression has been reported to correspond with disease severity (Soumelis et al., 2002). Furthermore, keratinocyte-induced TSLP acts as a powerful stimulant of Th2 cytokines and induces the activation, proliferation, and differentiation of mast cells (Mizutani et al., 2015: Takai et al., 2014). In fact, Mizutani et al. (2015) reported TSLP may serve as a master switch that triggers both the maintenance and initiation of AD.
M.-s. Yoou et al. / Food and Chemical Toxicology 106 (2017) 78e85
Murine double minute (MDM) 2 plays an important role in cancer prognosis and is a negative regulator of p53 (Manfredi, 2010). Overexpression of MDM2 is commonly observed in various cancers (Kim et al., 2011). Recently, we reported the pathological features of MDM2 are related to inflammatory disorders (Yoou et al., 2015). In mast cells, MDM2 increase by TSLP mediated mast cell development and aggravated allergic disorders by interacting with signal transducer and activator of transcription (STAT) 6 (Han et al., 2014), and Thomasova et al. reported (2012) that MDM2 blockade has anti-inflammatory and anti-mitotic effects in inflammatory and autoimmune disorders. Atractylenolide III (ATL-III) is a major active constituent of Atractylodes lancea. Its reported pharmacological properties include anti-oxidant, anti-inflammatory, anti-cancer, and neuroprotective effects (Kang et al., 2011a,b; Liu et al., 2014). Inflammation is closely linked to cancer, and many anti-cancer drugs are also used to treat inflammatory disorders (Sikdar and Khuda-Bukhsh, 2013; Rayburn et al., 2009). Li et al. (2007) explained that ATL-III inhibited lipopolysaccharide-induced tumor necrosis factor (TNF)-a and nitric oxide production in macrophages, and Kang et al. (2011b) found that ATL-III inhibited the secretion and expression of interleukin (IL)-6 in the phorbol 12-myristate 13-acetate- and calcium ionophore A23187-stimulated HMC-1 cells (a human mast cell line). However, the regulatory effect of ATL-III on TSLP-mediated inflammatory reaction has not been clarified. This study confirmed that ATL-III has an anti-inflammatory effect in TSLP-stimulated HMC-1 cells. 2. Material & methods 2.1. Reagents We purchased Isocove's modified Dulbecco's medium (IMDM), StemPro-34 SFM medium, and L-glutamine from Gibco BRL (Grand Island, NY, USA); 3-(4,5-dimethylthiazol-2-yl)-2,5diphenyltetrazolium bromide (MTT) and anti-phospho-(pSTAT) 6 from Sigma (St. Louis, MO, USA); pSTAT5 from Invitrogen (Carlsbad, CA, USA); pSTAT3 from Cell Signaling Technology (Danvers, MA, USA); bromodeoxyuridine (BrdU) from Roche Diagnostics (Mannheim, Germany); recombinant human TSLP, IL-3, and stem cell factor (SCF), caspase-3 assay kit, and IL-13, IL-6, IL-1b, TNF-a, and IL-8 antibodies were obtained from R&D Systems, Inc. (Minneapolis, MN, USA); Bcl2, procaspase-3, Poly-ADP-ribose polymerase (PARP), MDM2, and actin from Santa Cruz Biotechnology (Dallas, TX, USA). ATL-III (purity 99.0%) was obtained from Wako (Osaka, Japan), dissolved in dimethyl sulfoxide (DMSO), and subsequently diluted with IMDM. 2.2. HMC-1 and LAD2 human mast cell culture HMC-1 cells were incubated in IMDM supplemented with 100 units/ml of penicillin, 100 mg/ml of streptomycin, and 10% fetal bovine serum at 37 C in 5% CO2 atmosphere at 95% relative humidity (RH). LAD2 cells were kindly provided by A. Kirshenbaum (NIH, USA) and cultured using StemPro-34 SFM medium supplemented with 100 ng/ml recombinant SCF containing 30 ng/ml IL-3, 2 mM L-glutamine, 100 units/ml of penicillin and 100 mg/ml of streptomycin at 37 C in 5% CO2 atmosphere at 95% RH (Kirshenbaum et al., 2003).
79
2.4. Western blot analysis Stimulated cells were lysed and protein separated by 12% sodium dodecyl sulfate polyacrylamide gel electrophoresis. Proteins were then transferred to nitrocellulose membranes, which were then blocked and incubated with primary (1:500 dilution) and secondary (1:3000 dilution) antibodies. Finally, protein bands were visualized using an enhanced chemiluminescence assay (Amersham Co. Newark, NJ, USA). 2.5. Cytokines assay Levels of IL-13, IL-6, IL-1b, TNF-a, and IL-8 were determined using a sandwich ELISA method according to the manufacturer's instructions (R&D Systems). 2.6. RNA isolation and quantitative real-time polymerase chain reaction (PCR) Total RNA was isolated from HMC-1 cells using an easy-BLUE™ RNA extraction kit (iNtRON Biotech, Sungnam, Korea). Concentrations of total RNA were determined by NanoDrop spectrophotometry (Thermo Scientific, Worcester, MA, USA). Total RNA (2.5 mg) was heated at 75 C for 5 min and then chilled on ice. Samples were reverse-transcribed to cDNA for 60 min at 42 C using a cDNA synthesis kit (iNtRON Biotech, Sungnam, Korea). Quantitative realTime PCR was performed using a SYBR Green master mix and mRNA was analyzed using an ABI StepOne real-time PCR System (Applied Biosystems, Foster City, CA, USA). The following primers were used: human IL-13 (50 GCCCTGGAATCCCTGATCA 3’; 50 GCTCAGCATCCTCTGGGTCTT 3’; human GAPDH (50 TCGACAGTCAGCCGCATCTTCTTT 3’; 50 ACCAAATCCGTTGACTCCGACCTT 3’). Levels of IL-13 mRNA were normalized versus GAPDH. All data were analyzed using the DDCT method. 2.7. Caspase-3 assay The enzymatic activity of caspase-3 was assayed using a colorimetric assay kit (R&D Systems). 2.8. MTT assay Cell viability was measured using a MTT assay. Briefly, 500 ml of HMC-1 cell (3 105) were pretreated with different concentrations of ATL-III for 1 h and then stimulated with TSLP for 48 h. MTT solution (5 mg/ml) then added and incubated at 37 C for 4 h. After removing the supernatant by washing, the insoluble formazan product so obtained was dissolved in DMSO. Optical densities were measured using an ELISA reader at 540 nm. 2.9. Cell apoptosis assay Apoptosis was quantified using the Alexa Fluor 488 annexin V/ Dead Cell Apoptosis Kit (Invitrogen, Carlsbad, CA, USA). Cell suspensions (100 ml) were incubated with 5 ml of annexin-V and 1 ml of propidium iodide (PI) at room temperature for 15 min, and stained cells were counted using FACScan (Becton Dickinson, Mountain View, CA, USA). 2.10. Statistics
2.3. BrdU assay Cell (1 104) proliferation was determined using a colorimetric immunoassay by measuring BrdU incorporation during DNA synthesis (Roche Diagnostics GmbH, Mannheim, Germany).
All results are representative of three independent experiments conducted in duplicate and are expressed as the mean ± standard errors of means (SEMs). The analysis was performed using an independent t-test or by ANOVA with Tukey's post hoc test using
80
M.-s. Yoou et al. / Food and Chemical Toxicology 106 (2017) 78e85
SPSS (IBM Corporation, Armonk, NY, USA). Statistical significance was accepted for P-values of <0.05. 3. Results 3.1. ATL-III attenuates the level of MDM2 and promotes the level of p53 in TSLP-stimulated HMC-1 cells In our previous study, we found that TSLP increased MDM2 levels and decreased p53 levels (Han et al., 2014). Thus, we sought to determine whether levels of MDM2 and p53 were regulated by ATL-III in TSLP-stimulated HMC-1 cells. ATL-III attenuated MDM2 levels and promoted p53 levels in TSLP-stimulated HMC-1 cells (Fig. 1AeC, P < 0.05). TSLP and IL-3 have been reported to induce
the proliferation and differentiation of mast cells (Dahlin and Hallgren, 2015; Han et al., 2014). Accordingly, we evaluated the anti-proliferative effect of ATL-III in TSLP or IL-3-stimulated HMC1 cells using a BrdU assay. As shown in Fig. 1D and E, ATL-III significantly attenuated both TSLP and IL-3-induced proliferations (P < 0.05). 3.2. ATL-III attenuates the levels of pSTAT6, pSTAT5, and pSTAT3 in TSLP-stimulated HMC-1 cells Our previous reports showed that STAT6 induces MDM2 expression and that pSTAT6 and MDM2 are associated with the proliferation of TSLP-stimulated HMC-1 cells (Yoou et al., 2015). Furthermore, TSLP has also been reported to induce the
Fig. 1. ATL-III attenuates level of MDM2 and promotes the level of p53 in TSLP-stimulated HMC-1 cells. (A) Cells were pretreated with ATL-III (1, 10, 100 mM) and then stimulated with TSLP (20 ng/ml) for 8 h. MDM2 levels were analyzed by Western blotting. (B) Cells were pretreated with ATL-III (1, 10, 100 mM), stimulated with TSLP (20 ng/ml) for 48 h, and p53 levels were analyzed by Western blotting. (C) Relative intensities of protein levels were quantified by densitometry. Cells were pretreated with ATL-III (1, 10, 100 mM) and then stimulated with (D) TSLP (20 ng/ml) or (E) IL-3 (100 ng/ml) for 48 h. BrdU incorporation assay was performed. #P < 0.05; significantly different from the unstimulated cells, *P < 0.05, significantly different from TSLP-stimulated cells. ATL-III, Atractylenolide III.
M.-s. Yoou et al. / Food and Chemical Toxicology 106 (2017) 78e85
phosphorylation of STAT5 and STAT3 (Liu et al., 2007). Thus, we tested whether ATL-III could attenuate pSTAT6, pSTAT5, and pSTAT3 levels in TSLP-stimulated HMC-1 cells. The results showed that pSTAT6, pSTAT5, and pSTAT3 level increases by TSLP were blocked by ATL-III (Fig. 2, P < 0.05).
81
TSLP-stimulated HMC-1 cells (Fig. 5D and E). Finally, we evaluated whether ATL-III could induce apoptosis using an MTT assay and a cell apoptosis assay. However, ATL-III was not found to have cytotoxic or apoptosis inducing effects (Fig. 5F and G).
3.3. ATL-III attenuates the levels of IL-13 in TSLP-stimulated HMC1 cells IL-13 levels are increased by TSLP (Han et al., 2014), and thus, we examined whether ATL-III could influence IL-13 production by TSLP. As was expected, IL-13 protein levels were significantly increased by TSLP in HMC-1 cells (Fig. 3A, P < 0.05), and ATL-III significantly decreased this increase (Fig. 3A, P < 0.05). In addition, real-time PCR was used to assess the mRNA expression of IL13. ATL-III significantly and dose-dependently decreased IL-13 mRNA expression in TSLP-stimulated HMC-1 cells (Fig. 3B, P < 0.05). 3.4. ATL-III attenuates the levels of inflammatory cytokines in TSLPstimulated HMC-1 cells Next, we evaluated the effects of ATL-III on the levels of the proinflammatory cytokines, IL-6, IL-1b, TNF-a, and IL-8 induced by TSLP. The results revealed that IL-6, IL-1b, TNF-a, and IL-8 levels were significantly increased by TSLP (Fig. 4, P < 0.05). However, pretreatment with ATL-III significantly decreased the productions of these cytokines (Fig. 4, P < 0.05). 3.5. ATL-III attenuates Bcl2 levels and promotes the activation of caspase-3 in TSLP-stimulated HMC-1 cells Anti-apoptotic factors and apoptotic factors are regulated by TSLP (Han et al., 2014; Yoou et al., 2015). Therefore, we explored whether ATL-III could regulate these factors in TSLP-stimulated HMC-1 cells. As depicted in Fig. 5A and E, ATL-III reduced Bcl2 levels in TSLP-stimulated HMC-1 cells, whereas it increased the activity of caspase-3 (Fig. 5B, P < 0.05). ATL-III also decreased procaspase-3 levels (Fig. 5C and E) and increased PARP cleavage in
Fig. 3. ATL-III attenuates levels of IL-13 in TSLP-stimulated HMC-1 cells. (A) Cells were pretreated with ATL-III (1, 10, 100 mM) and then stimulated with TSLP (20 ng/ml) for 8 h. IL-13 production in supernatant was analyzed by ELISA method. (B) IL-13 mRNA levels were analyzed by real-time PCR. #P < 0.05; significantly different from the unstimulated cells, *P < 0.05, significantly different from TSLP-stimulated cells. ATL-III, Atractylenolide III.
Fig. 2. ATL-III attenuates levels of pSTAT6, pSTAT5, and pSTAT3 in TSLP-stimulated HMC-1 cells. (A) Cells were pretreated with ATL-III (1, 10, 100 mM) and then stimulated with TSLP (20 ng/ml). Levels of pSTAT6, pSTAT5, and pSTAT3 were analyzed by Western blotting. (B) Relative intensities of protein levels were quantified by densitometry. #P < 0.05; significantly different from the unstimulated cells, *P < 0.05, significantly different from TSLP-stimulated cells. ATL-III, Atractylenolide III.
82
M.-s. Yoou et al. / Food and Chemical Toxicology 106 (2017) 78e85
Fig. 4. ATL-III attenuates levels of inflammatory cytokines in TSLP-stimulated HMC-1 cells. Cells were pretreated with ATL-III (1, 10, 100 mM) and then stimulated with TSLP (20 ng/ ml) for 8 h (AeD) Levels of cytokines in culture supernatants were measured by ELISA method. #P < 0.05; significantly different from unstimulated cells, *P < 0.05; significantly different from TSLP-stimulated cells. ATL-III, Atractylenolide III.
3.6. ATL-III attenuates mast cell proliferation and inflammatory cytokine production by TSLP-stimulated LAD2 cells Finally, we evaluated the regulatory effect of ATL-III in TSLPstimulated LAD2 cells. ATL-III was found to significantly attenuate the TSLP-induced proliferation of LAD2 cells (Fig. 6A, P < 0.05), and at 100 mM ATL-III significantly decreased IL-13, IL-6, and TNF-a levels (Fig. 6BeD, P < 0.05). 4. Discussion Mast cells are distributed in various tissues, including skin, airways, and the gastrointestinal tract, and are located to enable their participation in the early recognition of environmental antigens and allergens, environmentally derived toxins or invading pathogens (Galli et al., 2005; Metcalfe et al., 1997). Ziegler et al. (2013) indicated that TSLP plays a vital role as a master switch that provokes both the initiation and maintenance of AD and the atopic march. TSLP aggravates allergic reactions by activating MDM2 (Zhang et al., 2016). In our previous study, we reported that TSLP induces mast cell proliferation and exacerbates allergic reactions by up-regulating MDM2 (Han et al., 2014). The anti-proliferative and anti-inflammatory potentials by MDM2 suppression can derive accessional effects in other various diseases, especially in autoimmune diseases (Thomasova et al., 2012). MDM2 acts as an important cellular antagonist of p53 by blocking p53 tumor suppressor functions (Moll and Petrenko, 2003). Accordingly, MDM2 and p53 may play prominent roles during inflammatory response (Ihling et al., 1998). In the present study, we show that ATL-III inhibits the TSLP-induced activation of MDM2, but increased p53 levels. It also shows ATL-III appears to inhibit mast cell responsiveness to
TSLP and IL-3, which suggests a global rather than a TSLP-specific effect. STAT6 and IL-13 are critically involved in the processes leading to allergic disease phenotypes. STAT6 is involved in the differentiation of naive T cell precursors into Th2 cells and for class switching to the IgE isotype (Stütz et al., 2003). Furthermore, interaction with IL-13 and its receptor, which is comprised of the IL-13 receptor alpha 1 (IL-13Ra1) and IL-4 receptor alpha (IL-4Ra) subunits, provokes phosphorylation of STAT6, STAT5, and STAT3 (Rolling et al., 1996; Rosen et al., 2011). STAT6 is essential for the action of cytokines and for the development of atopy and asthma (Shirakawa et al., 2000). IL-13 is a major conductor in many chronic infectious and autoimmune disorders. (Fichtner-Feigl et al., 2006). IL-13 also acts as a co-mitogen for B-cell proliferation, prolongs the survivals of T and B cells in culture, regulates vascular tissue physiology, and induces the release of chemokines, which are required for the infiltrations of cells that participate in allergic inflammatory responses (Jiang et al., 2000). In the present study, ATLIII significantly suppressed the TSLP-induced pSTAT6, pSTAT5, and pSTAT3 levels, and IL-13 levels. These results demonstrated that ATL-III might inhibit mast cell proliferation by blocking pSTAT6, pSTAT5, pSTAT3, and IL-13 signaling pathways. Bogiatzi et al. (2007) reported that pro-inflammatory and Th2 cytokines are early triggers of TSLP-induced immune responses and factors that maintain allergic inflammation in a chronic state. In previous studies, ATL-III was found to suppress TNF-a levels in LPSstimulated peritoneal macrophages (Li et al., 2007), and to modulate IL-6 secretion and expression by activated HMC-1 cells (Kang et al., 2011b). In the present study, we found that ATL-III suppressed the productions of IL-6, IL-1b, TNF-a, and IL-8 by TSLPstimulated mast cells. These results demonstrate that ATL-III was
M.-s. Yoou et al. / Food and Chemical Toxicology 106 (2017) 78e85
83
Fig. 5. ATL-III attenuates levels of Bcl2 and promotes the activation of caspase-3 in TSLP-stimulated HMC-1 cells. (A) Cells were pretreated with ATL-III (1, 10, 100 mM) and then stimulated with TSLP (20 ng/ml) for 48 h. Levels of Bcl2 were analyzed by Western blotting. (B) Caspase-3 activity was assayed using a caspase-3 colorimetric assay kit. (C) Levels of procaspase-3 were analyzed by Western blotting. (D) Levels of PARP cleavage were analyzed by Western blotting. (E) Relative intensities of protein levels were quantified by densitometry. (F) Cytotoxicity was measured by MTT assay. (G) Apoptosis was evaluated by Alexa Fluor 488 annexin V/propidium iodide-double staining. Cell apoptosis expression was determined by flow cytometry. Results are representative of three independent experiments with duplicated samples. #P < 0.05; significantly different from the unstimulated cells, *P < 0.05, significantly different from TSLP-stimulated cells. ATL-III, Atractylenolide III.
an inhibitory agent of inflammatory cytokine production. Bcl-2 is an intracellular membrane-bound protein that functions to inhibit apoptosis (Karsan et al., 1996). Caspases are a family of genes crucial for sustaining homeostasis via the regulation of apoptosis and inflammation (McIlwain et al., 2013). Furthermore, PARP can be selectively cleaved by caspase-3 during apoptosis, and thus, becomes incapable of responding to DNA damage (Salvesen and Dixit, 1997). In previous study, we found that TSLP
suppressed apoptotic factors (p53, caspase-3, and PARP) and promoted anti-apoptotic factors (MDM2, IL-13, and Bcl2) (Yoou et al., 2015). Furthermore, our data demonstrated that ATL-III suppressed Bcl2 and procaspase-3 levels, and promoted active caspase-3 and cleaved PARP levels in TSLP-stimulated HMC-1 cells. In the present study, although ATL-III induced caspase-3 activation, it did not affect apoptosis. Caspase-3 is important for apoptosis during which it acts as a negative regulator of the cell cycle (Woo
84
M.-s. Yoou et al. / Food and Chemical Toxicology 106 (2017) 78e85
Fig. 6. ATL-III attenuates mast cell proliferation and inflammatory cytokine production by TSLP-stimulated LAD2 cells. (A) LAD2 cells were pretreated with ATL-III and then stimulated with TSLP (20 ng/ml) for 48 h. BrdU incorporation assay was performed. LAD2 cells were pretreated with ATL-III (100 mM) and then stimulated with TSLP (20 ng/ml) for 8 h (B) IL-13, (C) IL-6, and (D) TNF-a production in the supernatant was analyzed by ELISA method. #P < 0.05; significantly different from the unstimulated cells, *P < 0.05, significantly different from TSLP-stimulated cells. ATL-III, Atractylenolide III.
et al., 2003). However, Racke et al. (2002) reported that caspase-3 activation was predominantly induced without any apoptotic morphological changes. Many researchers have suggested that apoptotic morphological changes might require both caspase-3 and another caspase-mediated event or other specific types of caspases (Racke et al., 2002; Zeuner et al., 1999; Zhang et al., 2000). A study carried out by Miossec et al. (1997) demonstrated that caspase-3 precursor is massively cleaved into its active form during T lymphocyte proliferation without inducing any form of cell death. Therefore, the mechanism responsible for the ATL-III effect on apoptosis remains undetermined. Further investigations are required to clarify the regulatory effect of ATL-III on apoptosis. ATL-III has some potential for anti-cancer treatment (Kang et al., 2011a). Traditionally, mast cells have been considered to be the major cell type involved in allergic reactions, but they have also been implicated in damaging responses in a large variety of diseases, including cancer (Wernersson and Pejler, 2014). Recent results support the concept that inflammation is a serious component of tumour advance. In fact, most cancers are caused at sites of infection, inflammation, or chronic irritation (Coussens and Werb, 2002). Chronic inflammation promotes the risk for several cancers, which suggests that the removal of inflammation provides a potential means of cancer prevention and treatment. In fact, several anti-inflammatory agents seem to have potential for the prevention or treatment of several human cancers (Rayburn et al., 2009). The above relations and our results support the idea that ATL-III might play a useful role as an anti-cancer and anti-inflammatory agent. However, further studies are needed to elucidate how ATL-III acts at
the molecular progression.
level
during
allergic
response
and
cancer
5. Conclusion In the present study, it was found for the first time that ATL-III suppressed TSLP-induced mast cell proliferation by downregulating MDM2 and pSTAT6. Furthermore, ATL-III reduced inflammatory cytokine levels, suppressed Bcl2 and procaspase-3, promoted caspase-3 activity, and cleaved PARP levels in TSLPstimulated mast cells. These findings indicate that ATL-III should be considered a potentially useful anti-inflammatory agent. Conflict of interest The authors state no conflict of interest. Acknowledgement This research was supported by Basic Science Research Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Education, Science and Technology (2015R1A1A3A04000922). Transparency document Transparency document related to this article can be found online at http://dx.doi.org/10.1016/j.fct.2017.05.042.
M.-s. Yoou et al. / Food and Chemical Toxicology 106 (2017) 78e85
References Bogiatzi, S.I., Fernandez, I., Bichet, J.C., Marloie-Provost, M.A., Volpe, E., Sastre, X., Soumelis, V., 2007. Cutting Edge: proinflammatory and Th2 cytokines synergize to induce thymic stromal lymphopoietin production by human skin keratinocytes. J. Immunol. 178, 3373e3377. Coussens, L.M., Werb, Z., 2002. Inflammation and cancer. Nature 420, 860e867. Dahlin, J.S., Hallgren, J., 2015. Mast cell progenitors: origin, development and migration to tissues. Mol. Immunol. 63, 9e17. Esche, C., de Benedetto, A., Beck, L.A., 2004. Keratinocytes in atopic dermatitis: inflammatory signals. Curr. Allergy Asthma Rep. 4, 276e284. Fichtner-Feigl, S., Strober, W., Kawakami, K., Puri, R.K., Kitani, A., 2006. IL-13 signaling through the IL-13alpha2 receptor is involved in induction of TGFbeta1 production and fibrosis. Nat. Med. 12, 99e106. Galli, S.J., Nakae, S., Tsai, M., 2005. Mast cells in the development of adaptive immune responses. Nat. Immunol. 6, 135e142. Groneberg, D.A., Serowka, F., Peckenschneider, N., Artuc, M., Grützkau, A., Fischer, A., Henz, B.M., Welke, r P., 2005. Gene expression and regulation of nerve growth factor in atopic dermatitis mast cells and the human mast cell line-1. J. Neuroimmunol. 161, 87e92. Han, N.R., Oh, H.A., Nam, S.Y., Moon, P.D., Kim, D.W., Kim, H.M., Jeong, H.J., 2014. TSLP induces mast cell development and aggravates allergic reactions through the activation of MDM2 and STAT6. J. Invest. Dermatol. 134, 2521e2530. Ihling, C., Haendeler, J., Menzel, G., Hess, R.D., Fraedrich, G., Schaefer, H.E., Zeiher, A.M., 1998. Co-expression of p53 and MDM2 in human atherosclerosis: implications for the regulation of cellularity of atherosclerotic lesions. J. Pathol. 185, 303e312. Jiang, H., Harris, M.B., Rothman, P., 2000. IL-4/IL-13 signaling beyond JAK/STAT. J.Allergy Clin. Immunol. 105, 1063e1070. Kang, T.H., Bang, J.Y., Kim, M.H., Kang, I.C., Kim, H.M., Jeong, H.J., 2011a. Atractylenolide III, a sesquiterpenoid, induces apoptosis in human lung carcinoma A549 cells via mitochondria-mediated death pathway. Food Chem. Toxicol. 49, 514e519. Kang, T.H., Han, N.R., Kim, H.M., Jeong, H.J., 2011b. Blockade of IL-6 secretion pathway by the sesquiterpenoid atractylenolide III. J. Nat. Prod. 74, 223e227. Karsan, A., Yee, E., Kaushansky, K., Harlan, J.M., 1996. Cloning of human Bcl-2 homologue: inflammatory cytokines induce human A1 in cultured endothelial cells. Blood 87, 3089e3096. Kim, K., Burghardt, R., Barhoumi, R., Lee, S.O., Liu, X., Safe, S., 2011. MDM2 regulates estrogen receptor a and estrogen responsiveness in breast cancer cells. J. Mol. Endocrinol. 46, 67e79. Kirshenbaum, A.S., Akin, C., Wu, Y., Rottem, M., Goff, J.P., Beaven, M.A., Rao, V.K., Metcalfe, D.D., 2003. Characterization of novel stem cell factor responsive human mast cell lines LAD 1 and 2 established from a patient with mast cell sarcoma/leukemia; activation following aggregation of FcepsilonRI or FcgammaRI. Leuk. Res. 27, 677e682. Li, C.Q., He, L.C., Jin, J.Q., 2007. Atractylenolide I and atractylenolide III inhibit Lipopolysaccharide-induced TNF-alpha and NO production in macrophages. Phytother. Res. 21, 347e353. Liu, C., Zhao, H., Ji, Z.H., Yu, X.Y., 2014. Neuroprotection of atractylenolide III from Atractylodis macrocephalae against glutamate-induced neuronal apoptosis via inhibiting caspase signaling pathway. Neurochem. Res. 39, 1753e1758. Liu, Y.J., Soumelis, V., Watanabe, N., Ito, T., Wang, Y.H., Malefyt, Rde, W., Omori, M., Zhou, B., Ziegler, S.F., 2007. TSLP: an epithelial cell cytokine that regulates T cell differentiation by conditioning dendritic cell maturation. Annu. Rev. Immunol. 25, 193e219. Manfredi, J.J., 2010. The Mdm2-p53 relationship evolves: Mdm2 swings both ways as an oncogene and a tumor suppressor. Genes Dev. 24, 1580e1589. McIlwain, D.R., Berger, T., Mak, T.W., 2013. Caspase functions in cell death and disease. Cold Spring Harb. Perspect. Biol. 5, a008656. Metcalfe, D.D., Baram, D., Mekori, Y.A., 1997. Mast cells. Physiol. Rev. 77, 1033e1079. Miossec, C., Dutilleul, V., Fassy, F., Diu-Hercend, A., 1997. Evidence for CPP32 activation in the absence of apoptosis during T lymphocyte stimulation. J. Biol. Chem. 272, 13459e13462. Mizutani, N., Sae-Wong, C., Kangsanant, S., Nabe, T., Yoshino, S., 2015. Thymic stromal lymphopoietin-induced interleukin-17A is involved in the
85
development of IgE-mediated atopic dermatitis-like skin lesions in mice. Immunology 146, 568e581. Moll, U.M., Petrenko, O., 2003. The MDM2-p53 interaction. Mol. Cancer Res. 1, 1001e1008. Racke, M.M., Mosior, M., Kovacevic, S., Chang, C.H., Glasebrook, A.L., Roehm, N.W., Na, S., 2002. Activation of caspase-3 alone is insufficient for apoptotic morphological changes in human neuroblastoma cells. J. Neurochem. 80, 1039e1048. Rayburn, E.R., Ezell, S.J., Zhang, R., 2009. Anti-inflammatory agents for cancer therapy. Mol. Cell. Pharmacol. 1, 29e43. Rolling, C., Treton, D., Pellegrini, S., Galanaud, P., Richard, Y., 1996. IL4 and IL13 receptors share the gamma c chain and activate STAT6, STAT3 and STAT5 proteins in normal human B cells. FEBS Lett. 393, 53e56. Rosen, M.J., Frey, M.R., Washington, M.K., Chaturvedi, R., Kuhnhein, L.A., Matta, P., Revetta, F.L., Wilson, K.T., Polk, D.B., 2011. STAT6 activation in ulcerative colitis: a new target for prevention of IL-13-induced colon epithelial cell dysfunction. Inflamm. Bowel Dis. 17, 2224e2234. Salvesen, G.S., Dixit, V.M., 1997. Caspases: intracellular signaling by proteolysis. Cell 91, 443e446. Shirakawa, I., Deichmann, K.A., Izuhara, I., Mao, I., Adra, C.N., Hopkin, J.M., 2000. Atopy and asthma: genetic variants of IL-4 and IL-13 signalling. Immunol. Today 21, 60e64. Sikdar, S., Khuda-Bukhsh, A.R., 2013. Alternative drug therapies are superior to epidermal growth factor receptor-targeted chemotherapeutic drug responses in non-small cell lung cancer. TANG 3, e10. Singh, L.K., Pang, X., Alexacos, N., Letourneau, R., Theoharides, T.C., 1999. Acute immobilization stress triggers skin mast cell degranulation via corticotropin releasing hormone, neurotensin, and substance P: a link to neurogenic skin disorders. Brain Behav. Immun. 13, 225e239. Soumelis, V., Reche, P.A., Kanzler, H., Yuan, W., Edward, G., Homey, B., Gilliet, M., Ho, S., Antonenko, S., Lauerma, A., Smith, K., Gorman, D., Zurawski, S., Abrams, J., Menon, S., McClanahan, T., de Waal-Malefyt Rd, R., Bazan, F., Kastelein, R.A., Liu, Y.J., 2002. Human epithelial cells trigger dendritic cell mediated allergic inflammation by producing TSLP. Nat. Immunol. 3, 673e680. Stütz, A.M., Pickart, L.A., Trifilieff, A., Baumruker, T., Prieschl-Strassmayr, E., €ger, M., 2003. The Th2 cell cytokines IL-4 and IL-13 regulate found Woisetschla in inflammatory zone 1/resistin-like molecule alpha gene expression by a STAT6 and CCAAT/enhancer-binding protein-dependent mechanism. J. Immunol. 170, 1789e1796. Takai, T., Chen, X., Xie, Y., Vu, A.T., Le, T.A., Kinoshita, H., Kawasaki, J., Kamijo, S., Hara, M., Ushio, H., Baba, T., Hiramatsu, K., Ikeda, S., Ogawa, H., Okumura, K., 2014. TSLP expression induced via Toll-like receptor pathways in human keratinocytes. Methods Enzymol. 535, 371e387. Theoharides, T.C., Cochrane, D.E., 2004. Critical role of mast cells in inflammatory diseases and the effect of acute stress. J. Neuroimmunol. 146, 1e12. Thomasova, D., Mulay, S.R., Bruns, H., Anders, H.J., 2012. p53-independent roles of MDM2 in NF-kB signaling: implications for cancer therapy, wound healing, and autoimmune diseases. Neoplasia 14, 1097e1101. Wernersson, S., Pejler, G., 2014. Mast cell secretory granules: armed for battle. Nat. Rev. Immunol. 14, 478e494. Woo, M., Hakem, R., Furlonger, C., Hakem, A., Duncan, G.S., Sasaki, T., Bouchard, D., Lu, L., Wu, G.E., Paige, C.J., Mak, T.W., 2003. Caspase-3 regulates cell cycle in B cells: a consequence of substrate specificity. Nat. Immunol. 4, 1016e1022. Yoou, M.S., Kim, H.M., Jeong, H.J., 2015. Acteoside attenuates TSLP-induced mast cell proliferation via down-regulating MDM2. Int. Immunopharmacol. 26, 23e29. Zeuner, A., Eramo, A., Peschle, C., De Maria, R., 1999. Caspase activation without death. Cell Death. Differ. 6, 1075e1080. Zhang, L., Luo, J., Wen, H., Zhang, T., Zuo, X., Li, X., 2016. MDM2 promotes rheumatoid arthritis via activation of MAPK and NF-kB. Int. Immunopharmacol. 30, 69e73. Zhang, Y., Goodyer, C., LeBlanc, A., 2000. Selective and protracted apoptosis in human primary neurons microinjected with active caspase-3, -6, -7 and -8. J. Neurosci. 20, 8384e8389. Ziegler, S.F., Roan, F., Bell, B.D., Stoklasek, T.A., Kitajima, M., Han, H., 2013. The biology of thymic stromal lymphopoietin (TSLP). Adv. Pharmacol. 66, 129e155.
Contents lists available at ScienceDirect
Food and Chemical Toxicology journal homepage: www.elsevier.com/locate/foodchemtox
Ameliorative effect of atractylenolide III in the mast cell proliferation induced by TSLP Myoung-schook Yoou a, Sun-Young Nam a, Mu Hyun Jin b, So Young Lee b, Mi-Sun Kim b, Seok Seon Roh c, d, In Hwa Choi c, e, Nariyah Woo f, SeokWon Lim f, Dong Hyun Kim f, Jae-Bum Jang g, Hyung-Min Kim a, c, *, Hyun-Ja Jeong f, ** a
Department of Pharmacology, College of Korean Medicine, Kyung Hee University, 26, Kyungheedae-ro, Dongdaemun-gu, Seoul, 02447, Republic of Korea Skin Research Center, Research Park, LG Household & Healthcare Ltd., 175, Gajeong-ro, Yuseong-gu, Daejeon, 34114, Republic of Korea Whoo Oriental Herb & Skin Research Society, Daejeon, 34114, Republic of Korea d College of Korean Medicine, Daejeon University, Daejeon, 305-343, Republic of Korea e Department of Oriental Dermatology, College of Korean Medicine, Kyung Hee University, Seoul, 02447, Republic of Korea f Department of Food Science & Technology, Hoseo University, 20, Hoseo-ro 79beon-gil, Baebang-eup, Asan, Chungcheongnam-do 31499, Republic of Korea g Department of Pharmaceutical Engineering, Hoseo University, 20, Hoseo-ro 79beon-gil, Baebang-eup, Asan, Chungcheongnam-do 31499, Republic of Korea b c
a r t i c l e i n f o
a b s t r a c t
Article history: Received 29 March 2016 Received in revised form 10 January 2017 Accepted 20 May 2017 Available online 22 May 2017
Atractylenolide III (ATL-III) is an active compound of Atractylodes lancea, which has been widely used for the treatment of cancer. Cancer is closely connected with inflammation, and many anti-inflammatory agents are also used to treat cancer. We investigated the influence of ATL-III on thymic stromal lymphopoietin (TSLP)-induced inflammatory reactions. Pretreatment with ATL-III suppressed murine double minute 2 levels and promoted p53 levels in TSLP-treated human mast cell, HMC-1 cells. Mast cell proliferation increased by TSLP or IL-3 stimulation was significantly decreased by ATL-III pretreatment. Interleukin (IL)-13 and phosphorylated signal transducer and activator of transcription 3, 5, and 6 levels in TSLP-treated HMC-1 cells were also decreased by ATL-III pretreatment. In addition, ATL-III decreased the TSLP-induced production of proinflammatory cytokines (IL-6, IL-1b, tumor necrosis factor-a, and IL8). ATL-III decreased the levels of Bcl2 and procaspase-3 and increased caspase-3 activation and cleaved PARP levels. Furthermore, ATL-III decreased TSLP-induced mast cell proliferation and the production of inflammatory cytokine by LAD2 cells. Taken together, these findings suggest that ATL-III plays a useful role as an anti-inflammatory agent and should be viewed as a potential anti-cancer agent. © 2017 Elsevier Ltd. All rights reserved.
Keywords: Atractylenolide III Mast cell Thymic stromal lymphopoietin Murine double minute 2 Signal transducer and activator of transcription 6 Interleukin-13
1. Introduction Atopic dermatitis (AD) is a chronic inflammatory skin disease that often manifests in early childhood. AD is characterized by eczema and intense pruritus, and is associated with rhinitis, food allergies, and allergic asthma (Groneberg et al., 2005). Mast cells
* Corresponding author. Department of Pharmacology, College of Korean Medicine, Kyung Hee University, 26, Kyungheedae-ro, Dongdaemun-gu, Seoul, 02447, Republic of Korea. ** Corresponding author. Department of Food Science & Technology, Hoseo University, 20, Hoseo-ro 79beon-gil, Baebang-eup, Asan, Chungcheongnam-do 31499, Republic of Korea. E-mail addresses: [email protected] (H.-M. Kim), [email protected] (H.-J. Jeong). http://dx.doi.org/10.1016/j.fct.2017.05.042 0278-6915/© 2017 Elsevier Ltd. All rights reserved.
are activated by crosslinking of their surface receptors for IgE (FcεRI) and this leads to the secretion of vasoactive, proinflammatory, and nociceptive mediators such as histamine, interleukin (IL)-1b, IL-6, tumor necrosis factor (TNF)-a, and IL-8, which are essential for the development of AD (Singh et al., 1999; Theoharides and Cochrane., 2004). Keratinocytes also contributes to the development of AD (Esche et al., 2004). Thymic stromal lymphopoietin (TSLP) is highly expressed in the keratinocytes of AD lesions and the degree of this overexpression has been reported to correspond with disease severity (Soumelis et al., 2002). Furthermore, keratinocyte-induced TSLP acts as a powerful stimulant of Th2 cytokines and induces the activation, proliferation, and differentiation of mast cells (Mizutani et al., 2015: Takai et al., 2014). In fact, Mizutani et al. (2015) reported TSLP may serve as a master switch that triggers both the maintenance and initiation of AD.
M.-s. Yoou et al. / Food and Chemical Toxicology 106 (2017) 78e85
Murine double minute (MDM) 2 plays an important role in cancer prognosis and is a negative regulator of p53 (Manfredi, 2010). Overexpression of MDM2 is commonly observed in various cancers (Kim et al., 2011). Recently, we reported the pathological features of MDM2 are related to inflammatory disorders (Yoou et al., 2015). In mast cells, MDM2 increase by TSLP mediated mast cell development and aggravated allergic disorders by interacting with signal transducer and activator of transcription (STAT) 6 (Han et al., 2014), and Thomasova et al. reported (2012) that MDM2 blockade has anti-inflammatory and anti-mitotic effects in inflammatory and autoimmune disorders. Atractylenolide III (ATL-III) is a major active constituent of Atractylodes lancea. Its reported pharmacological properties include anti-oxidant, anti-inflammatory, anti-cancer, and neuroprotective effects (Kang et al., 2011a,b; Liu et al., 2014). Inflammation is closely linked to cancer, and many anti-cancer drugs are also used to treat inflammatory disorders (Sikdar and Khuda-Bukhsh, 2013; Rayburn et al., 2009). Li et al. (2007) explained that ATL-III inhibited lipopolysaccharide-induced tumor necrosis factor (TNF)-a and nitric oxide production in macrophages, and Kang et al. (2011b) found that ATL-III inhibited the secretion and expression of interleukin (IL)-6 in the phorbol 12-myristate 13-acetate- and calcium ionophore A23187-stimulated HMC-1 cells (a human mast cell line). However, the regulatory effect of ATL-III on TSLP-mediated inflammatory reaction has not been clarified. This study confirmed that ATL-III has an anti-inflammatory effect in TSLP-stimulated HMC-1 cells. 2. Material & methods 2.1. Reagents We purchased Isocove's modified Dulbecco's medium (IMDM), StemPro-34 SFM medium, and L-glutamine from Gibco BRL (Grand Island, NY, USA); 3-(4,5-dimethylthiazol-2-yl)-2,5diphenyltetrazolium bromide (MTT) and anti-phospho-(pSTAT) 6 from Sigma (St. Louis, MO, USA); pSTAT5 from Invitrogen (Carlsbad, CA, USA); pSTAT3 from Cell Signaling Technology (Danvers, MA, USA); bromodeoxyuridine (BrdU) from Roche Diagnostics (Mannheim, Germany); recombinant human TSLP, IL-3, and stem cell factor (SCF), caspase-3 assay kit, and IL-13, IL-6, IL-1b, TNF-a, and IL-8 antibodies were obtained from R&D Systems, Inc. (Minneapolis, MN, USA); Bcl2, procaspase-3, Poly-ADP-ribose polymerase (PARP), MDM2, and actin from Santa Cruz Biotechnology (Dallas, TX, USA). ATL-III (purity 99.0%) was obtained from Wako (Osaka, Japan), dissolved in dimethyl sulfoxide (DMSO), and subsequently diluted with IMDM. 2.2. HMC-1 and LAD2 human mast cell culture HMC-1 cells were incubated in IMDM supplemented with 100 units/ml of penicillin, 100 mg/ml of streptomycin, and 10% fetal bovine serum at 37 C in 5% CO2 atmosphere at 95% relative humidity (RH). LAD2 cells were kindly provided by A. Kirshenbaum (NIH, USA) and cultured using StemPro-34 SFM medium supplemented with 100 ng/ml recombinant SCF containing 30 ng/ml IL-3, 2 mM L-glutamine, 100 units/ml of penicillin and 100 mg/ml of streptomycin at 37 C in 5% CO2 atmosphere at 95% RH (Kirshenbaum et al., 2003).
79
2.4. Western blot analysis Stimulated cells were lysed and protein separated by 12% sodium dodecyl sulfate polyacrylamide gel electrophoresis. Proteins were then transferred to nitrocellulose membranes, which were then blocked and incubated with primary (1:500 dilution) and secondary (1:3000 dilution) antibodies. Finally, protein bands were visualized using an enhanced chemiluminescence assay (Amersham Co. Newark, NJ, USA). 2.5. Cytokines assay Levels of IL-13, IL-6, IL-1b, TNF-a, and IL-8 were determined using a sandwich ELISA method according to the manufacturer's instructions (R&D Systems). 2.6. RNA isolation and quantitative real-time polymerase chain reaction (PCR) Total RNA was isolated from HMC-1 cells using an easy-BLUE™ RNA extraction kit (iNtRON Biotech, Sungnam, Korea). Concentrations of total RNA were determined by NanoDrop spectrophotometry (Thermo Scientific, Worcester, MA, USA). Total RNA (2.5 mg) was heated at 75 C for 5 min and then chilled on ice. Samples were reverse-transcribed to cDNA for 60 min at 42 C using a cDNA synthesis kit (iNtRON Biotech, Sungnam, Korea). Quantitative realTime PCR was performed using a SYBR Green master mix and mRNA was analyzed using an ABI StepOne real-time PCR System (Applied Biosystems, Foster City, CA, USA). The following primers were used: human IL-13 (50 GCCCTGGAATCCCTGATCA 3’; 50 GCTCAGCATCCTCTGGGTCTT 3’; human GAPDH (50 TCGACAGTCAGCCGCATCTTCTTT 3’; 50 ACCAAATCCGTTGACTCCGACCTT 3’). Levels of IL-13 mRNA were normalized versus GAPDH. All data were analyzed using the DDCT method. 2.7. Caspase-3 assay The enzymatic activity of caspase-3 was assayed using a colorimetric assay kit (R&D Systems). 2.8. MTT assay Cell viability was measured using a MTT assay. Briefly, 500 ml of HMC-1 cell (3 105) were pretreated with different concentrations of ATL-III for 1 h and then stimulated with TSLP for 48 h. MTT solution (5 mg/ml) then added and incubated at 37 C for 4 h. After removing the supernatant by washing, the insoluble formazan product so obtained was dissolved in DMSO. Optical densities were measured using an ELISA reader at 540 nm. 2.9. Cell apoptosis assay Apoptosis was quantified using the Alexa Fluor 488 annexin V/ Dead Cell Apoptosis Kit (Invitrogen, Carlsbad, CA, USA). Cell suspensions (100 ml) were incubated with 5 ml of annexin-V and 1 ml of propidium iodide (PI) at room temperature for 15 min, and stained cells were counted using FACScan (Becton Dickinson, Mountain View, CA, USA). 2.10. Statistics
2.3. BrdU assay Cell (1 104) proliferation was determined using a colorimetric immunoassay by measuring BrdU incorporation during DNA synthesis (Roche Diagnostics GmbH, Mannheim, Germany).
All results are representative of three independent experiments conducted in duplicate and are expressed as the mean ± standard errors of means (SEMs). The analysis was performed using an independent t-test or by ANOVA with Tukey's post hoc test using
80
M.-s. Yoou et al. / Food and Chemical Toxicology 106 (2017) 78e85
SPSS (IBM Corporation, Armonk, NY, USA). Statistical significance was accepted for P-values of <0.05. 3. Results 3.1. ATL-III attenuates the level of MDM2 and promotes the level of p53 in TSLP-stimulated HMC-1 cells In our previous study, we found that TSLP increased MDM2 levels and decreased p53 levels (Han et al., 2014). Thus, we sought to determine whether levels of MDM2 and p53 were regulated by ATL-III in TSLP-stimulated HMC-1 cells. ATL-III attenuated MDM2 levels and promoted p53 levels in TSLP-stimulated HMC-1 cells (Fig. 1AeC, P < 0.05). TSLP and IL-3 have been reported to induce
the proliferation and differentiation of mast cells (Dahlin and Hallgren, 2015; Han et al., 2014). Accordingly, we evaluated the anti-proliferative effect of ATL-III in TSLP or IL-3-stimulated HMC1 cells using a BrdU assay. As shown in Fig. 1D and E, ATL-III significantly attenuated both TSLP and IL-3-induced proliferations (P < 0.05). 3.2. ATL-III attenuates the levels of pSTAT6, pSTAT5, and pSTAT3 in TSLP-stimulated HMC-1 cells Our previous reports showed that STAT6 induces MDM2 expression and that pSTAT6 and MDM2 are associated with the proliferation of TSLP-stimulated HMC-1 cells (Yoou et al., 2015). Furthermore, TSLP has also been reported to induce the
Fig. 1. ATL-III attenuates level of MDM2 and promotes the level of p53 in TSLP-stimulated HMC-1 cells. (A) Cells were pretreated with ATL-III (1, 10, 100 mM) and then stimulated with TSLP (20 ng/ml) for 8 h. MDM2 levels were analyzed by Western blotting. (B) Cells were pretreated with ATL-III (1, 10, 100 mM), stimulated with TSLP (20 ng/ml) for 48 h, and p53 levels were analyzed by Western blotting. (C) Relative intensities of protein levels were quantified by densitometry. Cells were pretreated with ATL-III (1, 10, 100 mM) and then stimulated with (D) TSLP (20 ng/ml) or (E) IL-3 (100 ng/ml) for 48 h. BrdU incorporation assay was performed. #P < 0.05; significantly different from the unstimulated cells, *P < 0.05, significantly different from TSLP-stimulated cells. ATL-III, Atractylenolide III.
M.-s. Yoou et al. / Food and Chemical Toxicology 106 (2017) 78e85
phosphorylation of STAT5 and STAT3 (Liu et al., 2007). Thus, we tested whether ATL-III could attenuate pSTAT6, pSTAT5, and pSTAT3 levels in TSLP-stimulated HMC-1 cells. The results showed that pSTAT6, pSTAT5, and pSTAT3 level increases by TSLP were blocked by ATL-III (Fig. 2, P < 0.05).
81
TSLP-stimulated HMC-1 cells (Fig. 5D and E). Finally, we evaluated whether ATL-III could induce apoptosis using an MTT assay and a cell apoptosis assay. However, ATL-III was not found to have cytotoxic or apoptosis inducing effects (Fig. 5F and G).
3.3. ATL-III attenuates the levels of IL-13 in TSLP-stimulated HMC1 cells IL-13 levels are increased by TSLP (Han et al., 2014), and thus, we examined whether ATL-III could influence IL-13 production by TSLP. As was expected, IL-13 protein levels were significantly increased by TSLP in HMC-1 cells (Fig. 3A, P < 0.05), and ATL-III significantly decreased this increase (Fig. 3A, P < 0.05). In addition, real-time PCR was used to assess the mRNA expression of IL13. ATL-III significantly and dose-dependently decreased IL-13 mRNA expression in TSLP-stimulated HMC-1 cells (Fig. 3B, P < 0.05). 3.4. ATL-III attenuates the levels of inflammatory cytokines in TSLPstimulated HMC-1 cells Next, we evaluated the effects of ATL-III on the levels of the proinflammatory cytokines, IL-6, IL-1b, TNF-a, and IL-8 induced by TSLP. The results revealed that IL-6, IL-1b, TNF-a, and IL-8 levels were significantly increased by TSLP (Fig. 4, P < 0.05). However, pretreatment with ATL-III significantly decreased the productions of these cytokines (Fig. 4, P < 0.05). 3.5. ATL-III attenuates Bcl2 levels and promotes the activation of caspase-3 in TSLP-stimulated HMC-1 cells Anti-apoptotic factors and apoptotic factors are regulated by TSLP (Han et al., 2014; Yoou et al., 2015). Therefore, we explored whether ATL-III could regulate these factors in TSLP-stimulated HMC-1 cells. As depicted in Fig. 5A and E, ATL-III reduced Bcl2 levels in TSLP-stimulated HMC-1 cells, whereas it increased the activity of caspase-3 (Fig. 5B, P < 0.05). ATL-III also decreased procaspase-3 levels (Fig. 5C and E) and increased PARP cleavage in
Fig. 3. ATL-III attenuates levels of IL-13 in TSLP-stimulated HMC-1 cells. (A) Cells were pretreated with ATL-III (1, 10, 100 mM) and then stimulated with TSLP (20 ng/ml) for 8 h. IL-13 production in supernatant was analyzed by ELISA method. (B) IL-13 mRNA levels were analyzed by real-time PCR. #P < 0.05; significantly different from the unstimulated cells, *P < 0.05, significantly different from TSLP-stimulated cells. ATL-III, Atractylenolide III.
Fig. 2. ATL-III attenuates levels of pSTAT6, pSTAT5, and pSTAT3 in TSLP-stimulated HMC-1 cells. (A) Cells were pretreated with ATL-III (1, 10, 100 mM) and then stimulated with TSLP (20 ng/ml). Levels of pSTAT6, pSTAT5, and pSTAT3 were analyzed by Western blotting. (B) Relative intensities of protein levels were quantified by densitometry. #P < 0.05; significantly different from the unstimulated cells, *P < 0.05, significantly different from TSLP-stimulated cells. ATL-III, Atractylenolide III.
82
M.-s. Yoou et al. / Food and Chemical Toxicology 106 (2017) 78e85
Fig. 4. ATL-III attenuates levels of inflammatory cytokines in TSLP-stimulated HMC-1 cells. Cells were pretreated with ATL-III (1, 10, 100 mM) and then stimulated with TSLP (20 ng/ ml) for 8 h (AeD) Levels of cytokines in culture supernatants were measured by ELISA method. #P < 0.05; significantly different from unstimulated cells, *P < 0.05; significantly different from TSLP-stimulated cells. ATL-III, Atractylenolide III.
3.6. ATL-III attenuates mast cell proliferation and inflammatory cytokine production by TSLP-stimulated LAD2 cells Finally, we evaluated the regulatory effect of ATL-III in TSLPstimulated LAD2 cells. ATL-III was found to significantly attenuate the TSLP-induced proliferation of LAD2 cells (Fig. 6A, P < 0.05), and at 100 mM ATL-III significantly decreased IL-13, IL-6, and TNF-a levels (Fig. 6BeD, P < 0.05). 4. Discussion Mast cells are distributed in various tissues, including skin, airways, and the gastrointestinal tract, and are located to enable their participation in the early recognition of environmental antigens and allergens, environmentally derived toxins or invading pathogens (Galli et al., 2005; Metcalfe et al., 1997). Ziegler et al. (2013) indicated that TSLP plays a vital role as a master switch that provokes both the initiation and maintenance of AD and the atopic march. TSLP aggravates allergic reactions by activating MDM2 (Zhang et al., 2016). In our previous study, we reported that TSLP induces mast cell proliferation and exacerbates allergic reactions by up-regulating MDM2 (Han et al., 2014). The anti-proliferative and anti-inflammatory potentials by MDM2 suppression can derive accessional effects in other various diseases, especially in autoimmune diseases (Thomasova et al., 2012). MDM2 acts as an important cellular antagonist of p53 by blocking p53 tumor suppressor functions (Moll and Petrenko, 2003). Accordingly, MDM2 and p53 may play prominent roles during inflammatory response (Ihling et al., 1998). In the present study, we show that ATL-III inhibits the TSLP-induced activation of MDM2, but increased p53 levels. It also shows ATL-III appears to inhibit mast cell responsiveness to
TSLP and IL-3, which suggests a global rather than a TSLP-specific effect. STAT6 and IL-13 are critically involved in the processes leading to allergic disease phenotypes. STAT6 is involved in the differentiation of naive T cell precursors into Th2 cells and for class switching to the IgE isotype (Stütz et al., 2003). Furthermore, interaction with IL-13 and its receptor, which is comprised of the IL-13 receptor alpha 1 (IL-13Ra1) and IL-4 receptor alpha (IL-4Ra) subunits, provokes phosphorylation of STAT6, STAT5, and STAT3 (Rolling et al., 1996; Rosen et al., 2011). STAT6 is essential for the action of cytokines and for the development of atopy and asthma (Shirakawa et al., 2000). IL-13 is a major conductor in many chronic infectious and autoimmune disorders. (Fichtner-Feigl et al., 2006). IL-13 also acts as a co-mitogen for B-cell proliferation, prolongs the survivals of T and B cells in culture, regulates vascular tissue physiology, and induces the release of chemokines, which are required for the infiltrations of cells that participate in allergic inflammatory responses (Jiang et al., 2000). In the present study, ATLIII significantly suppressed the TSLP-induced pSTAT6, pSTAT5, and pSTAT3 levels, and IL-13 levels. These results demonstrated that ATL-III might inhibit mast cell proliferation by blocking pSTAT6, pSTAT5, pSTAT3, and IL-13 signaling pathways. Bogiatzi et al. (2007) reported that pro-inflammatory and Th2 cytokines are early triggers of TSLP-induced immune responses and factors that maintain allergic inflammation in a chronic state. In previous studies, ATL-III was found to suppress TNF-a levels in LPSstimulated peritoneal macrophages (Li et al., 2007), and to modulate IL-6 secretion and expression by activated HMC-1 cells (Kang et al., 2011b). In the present study, we found that ATL-III suppressed the productions of IL-6, IL-1b, TNF-a, and IL-8 by TSLPstimulated mast cells. These results demonstrate that ATL-III was
M.-s. Yoou et al. / Food and Chemical Toxicology 106 (2017) 78e85
83
Fig. 5. ATL-III attenuates levels of Bcl2 and promotes the activation of caspase-3 in TSLP-stimulated HMC-1 cells. (A) Cells were pretreated with ATL-III (1, 10, 100 mM) and then stimulated with TSLP (20 ng/ml) for 48 h. Levels of Bcl2 were analyzed by Western blotting. (B) Caspase-3 activity was assayed using a caspase-3 colorimetric assay kit. (C) Levels of procaspase-3 were analyzed by Western blotting. (D) Levels of PARP cleavage were analyzed by Western blotting. (E) Relative intensities of protein levels were quantified by densitometry. (F) Cytotoxicity was measured by MTT assay. (G) Apoptosis was evaluated by Alexa Fluor 488 annexin V/propidium iodide-double staining. Cell apoptosis expression was determined by flow cytometry. Results are representative of three independent experiments with duplicated samples. #P < 0.05; significantly different from the unstimulated cells, *P < 0.05, significantly different from TSLP-stimulated cells. ATL-III, Atractylenolide III.
an inhibitory agent of inflammatory cytokine production. Bcl-2 is an intracellular membrane-bound protein that functions to inhibit apoptosis (Karsan et al., 1996). Caspases are a family of genes crucial for sustaining homeostasis via the regulation of apoptosis and inflammation (McIlwain et al., 2013). Furthermore, PARP can be selectively cleaved by caspase-3 during apoptosis, and thus, becomes incapable of responding to DNA damage (Salvesen and Dixit, 1997). In previous study, we found that TSLP
suppressed apoptotic factors (p53, caspase-3, and PARP) and promoted anti-apoptotic factors (MDM2, IL-13, and Bcl2) (Yoou et al., 2015). Furthermore, our data demonstrated that ATL-III suppressed Bcl2 and procaspase-3 levels, and promoted active caspase-3 and cleaved PARP levels in TSLP-stimulated HMC-1 cells. In the present study, although ATL-III induced caspase-3 activation, it did not affect apoptosis. Caspase-3 is important for apoptosis during which it acts as a negative regulator of the cell cycle (Woo
84
M.-s. Yoou et al. / Food and Chemical Toxicology 106 (2017) 78e85
Fig. 6. ATL-III attenuates mast cell proliferation and inflammatory cytokine production by TSLP-stimulated LAD2 cells. (A) LAD2 cells were pretreated with ATL-III and then stimulated with TSLP (20 ng/ml) for 48 h. BrdU incorporation assay was performed. LAD2 cells were pretreated with ATL-III (100 mM) and then stimulated with TSLP (20 ng/ml) for 8 h (B) IL-13, (C) IL-6, and (D) TNF-a production in the supernatant was analyzed by ELISA method. #P < 0.05; significantly different from the unstimulated cells, *P < 0.05, significantly different from TSLP-stimulated cells. ATL-III, Atractylenolide III.
et al., 2003). However, Racke et al. (2002) reported that caspase-3 activation was predominantly induced without any apoptotic morphological changes. Many researchers have suggested that apoptotic morphological changes might require both caspase-3 and another caspase-mediated event or other specific types of caspases (Racke et al., 2002; Zeuner et al., 1999; Zhang et al., 2000). A study carried out by Miossec et al. (1997) demonstrated that caspase-3 precursor is massively cleaved into its active form during T lymphocyte proliferation without inducing any form of cell death. Therefore, the mechanism responsible for the ATL-III effect on apoptosis remains undetermined. Further investigations are required to clarify the regulatory effect of ATL-III on apoptosis. ATL-III has some potential for anti-cancer treatment (Kang et al., 2011a). Traditionally, mast cells have been considered to be the major cell type involved in allergic reactions, but they have also been implicated in damaging responses in a large variety of diseases, including cancer (Wernersson and Pejler, 2014). Recent results support the concept that inflammation is a serious component of tumour advance. In fact, most cancers are caused at sites of infection, inflammation, or chronic irritation (Coussens and Werb, 2002). Chronic inflammation promotes the risk for several cancers, which suggests that the removal of inflammation provides a potential means of cancer prevention and treatment. In fact, several anti-inflammatory agents seem to have potential for the prevention or treatment of several human cancers (Rayburn et al., 2009). The above relations and our results support the idea that ATL-III might play a useful role as an anti-cancer and anti-inflammatory agent. However, further studies are needed to elucidate how ATL-III acts at
the molecular progression.
level
during
allergic
response
and
cancer
5. Conclusion In the present study, it was found for the first time that ATL-III suppressed TSLP-induced mast cell proliferation by downregulating MDM2 and pSTAT6. Furthermore, ATL-III reduced inflammatory cytokine levels, suppressed Bcl2 and procaspase-3, promoted caspase-3 activity, and cleaved PARP levels in TSLPstimulated mast cells. These findings indicate that ATL-III should be considered a potentially useful anti-inflammatory agent. Conflict of interest The authors state no conflict of interest. Acknowledgement This research was supported by Basic Science Research Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Education, Science and Technology (2015R1A1A3A04000922). Transparency document Transparency document related to this article can be found online at http://dx.doi.org/10.1016/j.fct.2017.05.042.
M.-s. Yoou et al. / Food and Chemical Toxicology 106 (2017) 78e85
References Bogiatzi, S.I., Fernandez, I., Bichet, J.C., Marloie-Provost, M.A., Volpe, E., Sastre, X., Soumelis, V., 2007. Cutting Edge: proinflammatory and Th2 cytokines synergize to induce thymic stromal lymphopoietin production by human skin keratinocytes. J. Immunol. 178, 3373e3377. Coussens, L.M., Werb, Z., 2002. Inflammation and cancer. Nature 420, 860e867. Dahlin, J.S., Hallgren, J., 2015. Mast cell progenitors: origin, development and migration to tissues. Mol. Immunol. 63, 9e17. Esche, C., de Benedetto, A., Beck, L.A., 2004. Keratinocytes in atopic dermatitis: inflammatory signals. Curr. Allergy Asthma Rep. 4, 276e284. Fichtner-Feigl, S., Strober, W., Kawakami, K., Puri, R.K., Kitani, A., 2006. IL-13 signaling through the IL-13alpha2 receptor is involved in induction of TGFbeta1 production and fibrosis. Nat. Med. 12, 99e106. Galli, S.J., Nakae, S., Tsai, M., 2005. Mast cells in the development of adaptive immune responses. Nat. Immunol. 6, 135e142. Groneberg, D.A., Serowka, F., Peckenschneider, N., Artuc, M., Grützkau, A., Fischer, A., Henz, B.M., Welke, r P., 2005. Gene expression and regulation of nerve growth factor in atopic dermatitis mast cells and the human mast cell line-1. J. Neuroimmunol. 161, 87e92. Han, N.R., Oh, H.A., Nam, S.Y., Moon, P.D., Kim, D.W., Kim, H.M., Jeong, H.J., 2014. TSLP induces mast cell development and aggravates allergic reactions through the activation of MDM2 and STAT6. J. Invest. Dermatol. 134, 2521e2530. Ihling, C., Haendeler, J., Menzel, G., Hess, R.D., Fraedrich, G., Schaefer, H.E., Zeiher, A.M., 1998. Co-expression of p53 and MDM2 in human atherosclerosis: implications for the regulation of cellularity of atherosclerotic lesions. J. Pathol. 185, 303e312. Jiang, H., Harris, M.B., Rothman, P., 2000. IL-4/IL-13 signaling beyond JAK/STAT. J.Allergy Clin. Immunol. 105, 1063e1070. Kang, T.H., Bang, J.Y., Kim, M.H., Kang, I.C., Kim, H.M., Jeong, H.J., 2011a. Atractylenolide III, a sesquiterpenoid, induces apoptosis in human lung carcinoma A549 cells via mitochondria-mediated death pathway. Food Chem. Toxicol. 49, 514e519. Kang, T.H., Han, N.R., Kim, H.M., Jeong, H.J., 2011b. Blockade of IL-6 secretion pathway by the sesquiterpenoid atractylenolide III. J. Nat. Prod. 74, 223e227. Karsan, A., Yee, E., Kaushansky, K., Harlan, J.M., 1996. Cloning of human Bcl-2 homologue: inflammatory cytokines induce human A1 in cultured endothelial cells. Blood 87, 3089e3096. Kim, K., Burghardt, R., Barhoumi, R., Lee, S.O., Liu, X., Safe, S., 2011. MDM2 regulates estrogen receptor a and estrogen responsiveness in breast cancer cells. J. Mol. Endocrinol. 46, 67e79. Kirshenbaum, A.S., Akin, C., Wu, Y., Rottem, M., Goff, J.P., Beaven, M.A., Rao, V.K., Metcalfe, D.D., 2003. Characterization of novel stem cell factor responsive human mast cell lines LAD 1 and 2 established from a patient with mast cell sarcoma/leukemia; activation following aggregation of FcepsilonRI or FcgammaRI. Leuk. Res. 27, 677e682. Li, C.Q., He, L.C., Jin, J.Q., 2007. Atractylenolide I and atractylenolide III inhibit Lipopolysaccharide-induced TNF-alpha and NO production in macrophages. Phytother. Res. 21, 347e353. Liu, C., Zhao, H., Ji, Z.H., Yu, X.Y., 2014. Neuroprotection of atractylenolide III from Atractylodis macrocephalae against glutamate-induced neuronal apoptosis via inhibiting caspase signaling pathway. Neurochem. Res. 39, 1753e1758. Liu, Y.J., Soumelis, V., Watanabe, N., Ito, T., Wang, Y.H., Malefyt, Rde, W., Omori, M., Zhou, B., Ziegler, S.F., 2007. TSLP: an epithelial cell cytokine that regulates T cell differentiation by conditioning dendritic cell maturation. Annu. Rev. Immunol. 25, 193e219. Manfredi, J.J., 2010. The Mdm2-p53 relationship evolves: Mdm2 swings both ways as an oncogene and a tumor suppressor. Genes Dev. 24, 1580e1589. McIlwain, D.R., Berger, T., Mak, T.W., 2013. Caspase functions in cell death and disease. Cold Spring Harb. Perspect. Biol. 5, a008656. Metcalfe, D.D., Baram, D., Mekori, Y.A., 1997. Mast cells. Physiol. Rev. 77, 1033e1079. Miossec, C., Dutilleul, V., Fassy, F., Diu-Hercend, A., 1997. Evidence for CPP32 activation in the absence of apoptosis during T lymphocyte stimulation. J. Biol. Chem. 272, 13459e13462. Mizutani, N., Sae-Wong, C., Kangsanant, S., Nabe, T., Yoshino, S., 2015. Thymic stromal lymphopoietin-induced interleukin-17A is involved in the
85
development of IgE-mediated atopic dermatitis-like skin lesions in mice. Immunology 146, 568e581. Moll, U.M., Petrenko, O., 2003. The MDM2-p53 interaction. Mol. Cancer Res. 1, 1001e1008. Racke, M.M., Mosior, M., Kovacevic, S., Chang, C.H., Glasebrook, A.L., Roehm, N.W., Na, S., 2002. Activation of caspase-3 alone is insufficient for apoptotic morphological changes in human neuroblastoma cells. J. Neurochem. 80, 1039e1048. Rayburn, E.R., Ezell, S.J., Zhang, R., 2009. Anti-inflammatory agents for cancer therapy. Mol. Cell. Pharmacol. 1, 29e43. Rolling, C., Treton, D., Pellegrini, S., Galanaud, P., Richard, Y., 1996. IL4 and IL13 receptors share the gamma c chain and activate STAT6, STAT3 and STAT5 proteins in normal human B cells. FEBS Lett. 393, 53e56. Rosen, M.J., Frey, M.R., Washington, M.K., Chaturvedi, R., Kuhnhein, L.A., Matta, P., Revetta, F.L., Wilson, K.T., Polk, D.B., 2011. STAT6 activation in ulcerative colitis: a new target for prevention of IL-13-induced colon epithelial cell dysfunction. Inflamm. Bowel Dis. 17, 2224e2234. Salvesen, G.S., Dixit, V.M., 1997. Caspases: intracellular signaling by proteolysis. Cell 91, 443e446. Shirakawa, I., Deichmann, K.A., Izuhara, I., Mao, I., Adra, C.N., Hopkin, J.M., 2000. Atopy and asthma: genetic variants of IL-4 and IL-13 signalling. Immunol. Today 21, 60e64. Sikdar, S., Khuda-Bukhsh, A.R., 2013. Alternative drug therapies are superior to epidermal growth factor receptor-targeted chemotherapeutic drug responses in non-small cell lung cancer. TANG 3, e10. Singh, L.K., Pang, X., Alexacos, N., Letourneau, R., Theoharides, T.C., 1999. Acute immobilization stress triggers skin mast cell degranulation via corticotropin releasing hormone, neurotensin, and substance P: a link to neurogenic skin disorders. Brain Behav. Immun. 13, 225e239. Soumelis, V., Reche, P.A., Kanzler, H., Yuan, W., Edward, G., Homey, B., Gilliet, M., Ho, S., Antonenko, S., Lauerma, A., Smith, K., Gorman, D., Zurawski, S., Abrams, J., Menon, S., McClanahan, T., de Waal-Malefyt Rd, R., Bazan, F., Kastelein, R.A., Liu, Y.J., 2002. Human epithelial cells trigger dendritic cell mediated allergic inflammation by producing TSLP. Nat. Immunol. 3, 673e680. Stütz, A.M., Pickart, L.A., Trifilieff, A., Baumruker, T., Prieschl-Strassmayr, E., €ger, M., 2003. The Th2 cell cytokines IL-4 and IL-13 regulate found Woisetschla in inflammatory zone 1/resistin-like molecule alpha gene expression by a STAT6 and CCAAT/enhancer-binding protein-dependent mechanism. J. Immunol. 170, 1789e1796. Takai, T., Chen, X., Xie, Y., Vu, A.T., Le, T.A., Kinoshita, H., Kawasaki, J., Kamijo, S., Hara, M., Ushio, H., Baba, T., Hiramatsu, K., Ikeda, S., Ogawa, H., Okumura, K., 2014. TSLP expression induced via Toll-like receptor pathways in human keratinocytes. Methods Enzymol. 535, 371e387. Theoharides, T.C., Cochrane, D.E., 2004. Critical role of mast cells in inflammatory diseases and the effect of acute stress. J. Neuroimmunol. 146, 1e12. Thomasova, D., Mulay, S.R., Bruns, H., Anders, H.J., 2012. p53-independent roles of MDM2 in NF-kB signaling: implications for cancer therapy, wound healing, and autoimmune diseases. Neoplasia 14, 1097e1101. Wernersson, S., Pejler, G., 2014. Mast cell secretory granules: armed for battle. Nat. Rev. Immunol. 14, 478e494. Woo, M., Hakem, R., Furlonger, C., Hakem, A., Duncan, G.S., Sasaki, T., Bouchard, D., Lu, L., Wu, G.E., Paige, C.J., Mak, T.W., 2003. Caspase-3 regulates cell cycle in B cells: a consequence of substrate specificity. Nat. Immunol. 4, 1016e1022. Yoou, M.S., Kim, H.M., Jeong, H.J., 2015. Acteoside attenuates TSLP-induced mast cell proliferation via down-regulating MDM2. Int. Immunopharmacol. 26, 23e29. Zeuner, A., Eramo, A., Peschle, C., De Maria, R., 1999. Caspase activation without death. Cell Death. Differ. 6, 1075e1080. Zhang, L., Luo, J., Wen, H., Zhang, T., Zuo, X., Li, X., 2016. MDM2 promotes rheumatoid arthritis via activation of MAPK and NF-kB. Int. Immunopharmacol. 30, 69e73. Zhang, Y., Goodyer, C., LeBlanc, A., 2000. Selective and protracted apoptosis in human primary neurons microinjected with active caspase-3, -6, -7 and -8. J. Neurosci. 20, 8384e8389. Ziegler, S.F., Roan, F., Bell, B.D., Stoklasek, T.A., Kitajima, M., Han, H., 2013. The biology of thymic stromal lymphopoietin (TSLP). Adv. Pharmacol. 66, 129e155.