- Email: [email protected]
Characterization and functional analysis of slc7a11 gene, involved in skin color differentiation in the red tilapia
Accepted Manuscript Characterization and functional analysis of slc7a11 gene, involved in skin color differentiation in the red tilapia
Lan-mei Wang, Hong-yi Bu, Fei-biao Song, Wen-bin Zhu, Jianjun Fu, Zai-jie Dong PII: DOI: Article Number: Reference:
S1095-6433(19)30293-4 https://doi.org/10.1016/j.cbpa.2019.110529 110529 CBA 110529
To appear in:
Comparative Biochemistry and Physiology, Part A
Received date: Revised date: Accepted date:
15 January 2019 10 July 2019 10 July 2019
Please cite this article as: L.-m. Wang, H.-y. Bu, F.-b. Song, et al., Characterization and functional analysis of slc7a11 gene, involved in skin color differentiation in the red tilapia, Comparative Biochemistry and Physiology, Part A, https://doi.org/10.1016/ j.cbpa.2019.110529
This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
ACCEPTED MANUSCRIPT Characterization and functional analysis of slc7a11 gene, involved in skin color differentiation in the red tilapia
Lan-mei Wang1# , Hong-yi Bu2# , Fei-biao Song2 , Wen-bin Zhu1 , Jian-jun Fu1 & Zai-jie
IP
Freshwater Fisheries Research Centre of Chinese Academy of Fishery Sciences, Key
CR
1
T
Dong1, 2*
Laboratory of Freshwater Fisheries and Germplasm Resources Utilization, Ministry of
US
Agriculture and Rural Affairs, Wuxi 214081, China
Wuxi Fisheries College, Nanjing Agricultural University, Wuxi 214081, China
*
Correspondence: Zai-jie Dong, Freshwater Fisheries Research Centre of Chinese
M
AN
2
ED
Academy of Fishery Sciences, East Shanshui Road 9, Wuxi 214081, China. Tel.:
These authors contributed equally to this work
CE
#
PT
86-510-85558831. E-mail: [email protected]
AC
Running title: Fish slc7a11 gene involved in pigmentation differentiation
ACCEPTED MANUSCRIPT ABSTRACT Red tilapia has become more popular for aquaculture production in China in recent years. However, the pigmentation differentiation that has resulted from the process of genetic breeding and skin color variation during the overwintering period are the main
IP
T
problems limiting the development of commercial culture. The genetic basis of skin color
CR
differentiation is still not understood. Solute carrier family 7 member 11 (slc7a11) has been identified to be a critical genetic regulator of pheomelanin synthesis in the skin of
US
mammals. However, little information is available about its molecular characteristics, expression, location and function in skin color differentiation of fish. In this study, three
AN
complete cDNA sequences (2159 bp, 2190 bp and 2249 bp) of slc7a11 were successfully
M
isolated from Malaysian red tilapia, encoding polypeptides of 492, 525 and 492 amino acids respectively. Quantitative real-time PCR demonstrated that slc7a11 mRNA
ED
expression is high in the ventral skin of PR (pink with scattered red spots) fish.
PT
Immunofluorescence analysis revealed that xCT (the protein encoded by slc7a11) was concentrated mainly in the cytoplasm and nucleus of both the dorsal and ventral skin cells
CE
of fish. After RNA interference of slc7a11, slc7a11 and cbs mRNA expressions decreased,
AC
but the tyr mRNA expression increased in the skin of fish. Results suggest that slc7a11 plays an important role in skin color formation and differentiation of red tilapia through the melanogenesis pathway. Key words: slc7a11; red tilapia; expression; localization; RNA interference; skin color differentiation.
ACCEPTED MANUSCRIPT 1. Introduction Tilapia (Oreochromis genus) is currently widely accepted for consumption and as one of the most important food fish in the world. The red tilapia, a multi-cross breed between a mutant reddish-orange Mozambique tilapia (Oreochromis mossambicus) with other
T
tilapia species like Nile tilapia (O. niloticus) and blue tilapia (O. aureus), is a very
IP
attractive commercial breed in many parts of the world, such as China, Malaysia and
CR
Thailand, primarily because of its uniform red color skin and the absence of black peritoneum (Pradeep et al., 2011, 2014). However, the skin color differentiation that has
US
resulted from the process of genetic breeding and skin color variation in low temperature
AN
environments during overwintering are the main problems limiting the development of commercial red tilapia culture. Also, three coloration patterns including whole pink (WP),
M
pink with scattered black spots (PB) and pink with scattered red spots (PR) have been
ED
found in the Malaysian red tilapia breeding population (Supplementary Figure) (Zhu et al., 2016). The skin color differentiation that has resulted from the process of genetic
PT
breeding is found at birth and it is not reversible, while the skin color variation during
CE
overwintering period is reversible with an increase in environmental temperatures. Skin coloration results from diverse pigments synthesized by chromatophores or
AC
pigment cells which are either controlled or affected by a series of cellular, nutritional, physiological, genetic and environmental factors (Colihueque, 2010; Jiang et al., 2014; Zhu et al., 2016). So far, extensive studies have been conducted on molecular mechanisms of melanin biosynthesis in humans and mammals, and the melanogenesis pathways have been found to be conserved in vertebrates (Logan et al., 2006; Li et al., 2012). Recently, transcriptome and microRNA-seq analysis in different color varieties of
ACCEPTED MANUSCRIPT red tilapia (Zhu et al., 2016; Wang et al., 2018), koi carp (Cyprinus carpio L.) (Luo et al., 2018) and common carp (Jiang et al., 2014; Wang et al., 2014) have been done to understand the genetic basis of the color differentiation and confirm the conserved melanogenesis pathway in fish In the melanogenesis pathway, tyrosine is oxidized by
T
tyrosinases to form dopaquinone (DQ), which is then catalyzed to become eumelanin
IP
(brown to black pigment) through polymerization and oxidation reactions. Cysteine and
CR
dopaquine can switch off the eumelanin synthesis pathway and promote the synthesis of pheomelanin (yellow to red pigment). The production of pheomelanin depends on the
US
incorporation of cysteine, whose uptake is regulated by cysteine/glutamate exchanger
AN
(xCT), the protein encoded by the slc7a11 gene (encoding solute carrier family 7 member 11) (Hoekstra, 2006; Ito and Wakamatsu, 2011).
M
xCT, or SLC7A11, functions as an exchange system for cystine/glutamate, is an
ED
important determinant of the intracellular redox balance. xCT’s presence at the cell surface is essential for the uptake of cystine, which is required for intracellular
PT
glutathione synthesis (Kim et al., 2001; Lo et al., 2008). Although the gene slc7a11 has
CE
been shown to alter pheomelanin synthesis in the skin of mouse (Mus musculus), sheep (Ovis aries) and alpaca (Vicugna pacos) (Chintala et al., 2005; He et al., 2012; Tian et al.,
AC
2015), little information is available for fish. In our previous study, we did transcriptome and microRNA-seq analysis of different color varieties of red tilapia and found the important role of slc7a11 gene in melanin synthesis (Zhu et al., 2016; Wang et al., 2018a). We also studied the effects of dietary cysteine and tyrosine (Wang et al., 2018b) and temperature (Wang et al., 2018c) on the expression of slc7a11 and the skin color of red tilapia. In this study, we characterized mRNA sequence encoding for red tilapia slc7a11
ACCEPTED MANUSCRIPT gene for the first time and evaluated their expression profiles. In addition, we studied the effects of RNA interference (RNAi) and the location of xCT on skin tissue of red tilapia, in order to understand the role of xCT in pigmentation differentiation and variation of fish. The results will help to understand the overall role of slc7a11 in skin color
IP
T
differentiation and variation and advance our knowledge of skin color genetics in fish.
CR
2. Materials and methods 2.1 Sample preparation
US
This study was approved by the Bioethical Committee of Freshwater Fisheries
AN
Research Center (FFRC) of Chinese Academy of Fishery Sciences (CAFS) (BC 2013863, 9/2013). We carried out the methods of all experiments in accordance with the Guide for
M
the Care and Use of Experimental Animals of China.
ED
We took experimental fish of red tilapia from the Qiting Pilot Research Station (Yixing, China), which is affiliated to the FFRC, CAFS. After acclimatization, we randomly
PT
collected and then lightly anesthetized the fishes by clove oil (Zhanyun Chemical Co.,
CE
Ltd, Shanghai, China) which was added in the water. Then after, we sacrificed the sampled fish to obtain various tissues, including dorsal skin, ventral skin, muscle, heart,
AC
intestine and brain. We obtained the dorsal and ventral skins of all the three different skin colors (WP, PB and PR) of Malaysian red tilapia. We snap froze the tissue samples in liquid nitrogen and conserved at −80°C for gene mRNA expression analysis. We analyzed three biological samples (n = 3). In addition, we excised and fixed dorsal and ventral skins of fish in PFA (phosphate buffered saline: formaldehyde =9:1) at room temperature overnight. We obtained the skins with scales to ensure the integrity of the pigmentation. Tissue blocks were
ACCEPTED MANUSCRIPT dehydrated in an ascending series of ethanol, cleared in xylene, embedded in paraffin, and sectioned at 4 μm thickness for immunofluorescence analyses (IF). 2.2 Nucleic acid preparation and first-strand cDNA synthesis We extracted total RNA from various tissues of Malaysian red tilapia using EASY spin
T
tissue/cell ultra-pure RNA Rapid Extraction Kit (Yuanpinghao Biotech Co., Ltd., Tianjin,
IP
China) according to the manufacturer's protocol. We measured the concentration of total
CR
RNA with a UV-spectrophotometer 170 (NanoDrop 2000, Thermo, Wilmington, DE, USA). We examined the quantity and quality of RNA by UV-spectrophotometry
US
(OD260 /OD280 ) and agarose gel electrophoresis, respectively. We reverse transcribed total
AN
RNA (500 ng) from various tissues into first-strand cDNA using PrimeScript RT Master Mix Perfect Real Time Kit (TaKaRa, Japan) according to the manufacturer's instructions.
M
2.3. Rapid amplification of cDNA ends (RACE)
ED
We extended the red tilapia slc7a11 cDNA sequence using the SMARTer™ RACE cDNA Amplification Kit (Clontech, USA) according to the manufacturer's protocol. We
PT
designed the gene-specific primers (Table 1) based on the original expressed sequence tag
CE
(EST) from the Malaysian red tilapia transcriptome library (National Center for Biotechnology Information NCBI SRA database SRP076062). The 5’ sequence of the
AC
slc7a11 EST is complete by 5’ RACE verification and blast in NCBI. The PCR program was Nest PCR performed for 33 cycles of 95°C for 3 min, 94°C for 30 s, 58°C for 30 s, 72°C for 60 s and 72°C for 7 min. We separated PCR products on 1.5% agarose gel and purified PCR products with an E.Z.N.A® Gel Extraction Kit (Omiga BioTek, USA). We cloned the purified PCR products into a pMD18-T vector (TaKaRa, Japan) overnight. We transformed the recombinant plasmids into competent Escherichia coli cells and
ACCEPTED MANUSCRIPT sequenced positive clones at Shanghai Biosune Bio Co. Ltd., China. Then we verified and analyzed the retrieved sequences for similarity with other known slc7a11 sequences using the BLASTX program at the NCBI (http://www.ncbi.nlm.nih.gov/blast). Finally we chose ten fish from each color variants (WP, PB and PR) to make a total of thirty fish, to
different phenotypes of red tilapia.
CR
2.4. Multiple sequence alignment and phylogenetic analysis
IP
T
perform the end to end RT-PCR for confirmation of the existence and distribution in three
We retrieved the deduced protein sequences of slc7a11 of various species from
multiple
alignments
using
ClustalW2.
We
constructed
a
bootstrapped
AN
out
US
GenBank and compared phylogenetically with those of Malaysian red tilapia. We carried
neighbor-joining (NJ) phylogenetic tree using MEGA software version 5.0. We tested the
M
reliability of the branching using bootstrap re-sampling with 1000 pseudo replicates.
ED
2.5. qRT-PCR analysis
We conducted the tissue-dependent and fish dorsal and ventral skin of different color
PT
variants (WP, PB and PR) mRNA expression analysis via qRT-PCR. We designed the
CE
gene-specific qRT-PCR primers (Table1) based on the cloned slc7a11 cDNA to produce an amplicon of 224 bp. We performed qRT-PCR with a CFX96 Real- Time PCR Detection
AC
System (Bio-Rad, Hercules, CA, USA) using SYBR Premix Ex TaqII (Takara) according to the manufacturer's protocol. The final volume of each qRT-PCR reaction was 25 μL, which contained 12.5 μL 2 × SYBR Premix ExTaq, 1.0 μL of diluted cDNA template(100ng RNA), 9.5 μL of PCR-grade water, and 1.0 μL of each 10 μM primer. The PCR conditions were as follows: 95°C for 30 s, followed by 40 cycles of 95°C for 5 s and 60°C for 30s. We run each sample in triplicates and normalized to the selected
ACCEPTED MANUSCRIPT control gene β-actin of Malaysian red tilapia (NCBI SRA database SRP076062). We calculated the slc7a11 mRNA expression levels by the comparative CT (2−ΔΔCt ) method (Livak and Schmittgen, 2001). We calculated the means and standard deviations from triplicate experiments and presented as n- fold differences in expression relative to
T
β-actin mRNA. We reported data as the mean ± standard error of mean (SEM). We
IP
confirmed the homogeneity of variance and performed comparison between means with a
CR
one-way ANOVA. We used Turkey B and Duncan’s test for multiple comparisons
US
between groups. We determined statistical significance at P < 0.05. We performed all statistical analyses by SPSS 17 (Chicago, IL, USA).
AN
2.6. Immunofluorescence
M
To locate xCT, we generated the antibody against Malaysian red tilapia xCT rabbit polyclonal antibody from a 15-residue polypeptide (NGHKVSSNGTEQKDC). The
ED
antibody was found to recognize xCT in Malaysian red tilapia in preliminary tests.
PT
We used paraffin sections for IF. The paraffin sections were deparaffinized and hydrated, followed by xylene I for 10 min, xylene II for 10 min, absolute ethyl alcohol
CE
for 5 min, absolute ethyl alcohol II for 5 min, 95% alcohol for 5 min, 90% alcohol for 5
AC
min, 80% alcohol for 5 min, 70% alcohol for 5 min, and washed with distilled water. We placed the sections in a repair box filled with boiling Tris-EDTA buffer (pH 9.0), and maintained at 95-100℃ for 20min on low heat in the microwave oven. We cooled the sections at room temperature for 10 min, and washed with 0.01PBS (pH 7.4) 3 times at 3 min per wash. Then we treated the sections in blocking solution, incubated with slc7a11 monoclonal antibody (1:1000 1%BSA dilution) overnight at 4℃, and rinsed with 0.01PBS (pH 7.4) 3 times at 3 min per wash. Subsequently, we incubated the tissue sections with a
ACCEPTED MANUSCRIPT second antibody (goat anti-rabbit IgG) with 4’,6-Diamidine-2’-phenylindole (DAPI) (Roche) at 1:500 for 3 h (room temperature), and then rinsed with PBS three times for 3 min per wash. Finally we sealed sections with anti-quenching water-soluble sealant and observed with fluorescence microscope. In the negative control, we replaced the primary
T
antibody with 10% goat anti-rabbit serum.
IP
2.7. RNA interference (RNAi)
CR
The description of RNA interference is taken from the protocol described by Qiao et al., (2015). We synthesized the dsRNA of slc7a11 in vitro using TranscriptAid T7 High
US
Yield Transcription Kit (Thermo Scientific, USA) according to the manufacturer's
AN
instructions. We prepared the template for slc7a11-dsRNA synthesis by amplifying skin cDNA of Malaysian red tilapia with the primers slc7a11 iF and slc7a11 iR (Table 1). We
M
designed the primers based on the identical ORF areas of the three slc7a11 transcript
ED
variant to produce an amplicon of 593 bp. We measured the concentration of dsRNA at 260 nm with a BioPhotometer (Eppendorf, Hamburg, Germany). We examined the purity
PT
and integrity of dsRNA by 1% agarose gel electrophoresis, and then stored at -20°C until
CE
used.
Preliminary experiment showed that the optimum interfering effect was observed after
AC
the caudal vein injection of slc7a11-dsRNA with the dose of 5 μg g-1 body weight. In this study, we divided the juvenile red tilapia (initial weight: 19.86±0.80 g) randomly into two groups with 33 WP fishes per group when we injected the caudal vein with slc7a11-dsRNA at a dose of 5 μg g-1 body weight. We injected H2 O into control group at the same volume. We obtained the dorsal and ventral skin samples at the 1st , 2nd, 3rd, 4th ， 5th ，6th , 7th ，9th , 11th ,13th and 15th day after injection, and obtained 3 fish samples per
ACCEPTED MANUSCRIPT group every time. We snap- froze the skin samples in liquid nitrogen and stored at −80°C until used. We tested the mRNA expression levels of slc7a11, tyrosinase (tyr) and cystathionine beta synthase (cbs) gene by qRT-PCR, primers used as shown in Table 1.
T
3. Results
IP
3.1 slc7a11 cDNA cloning and sequence analysis
CR
In this study we successfully isolated three complete cDNA sequences of slc7a11 from Malaysian red tilapia by RACE-PCR, identified as slc7a11 transcript variant 1
US
(slc7a11-tv1 GenBank accession number: MH450056), slc7a11-tv2 (MH450057) and
AN
slc7a11-tv3 (MH450058), respectively. As shown in Fig. 1, slc7a11-tv1 was 2159 bp in length containing an open reading frame (ORF) of 1478 bp, corresponding to 492 amino
M
acid (AA) (SLC7A11-1 or xCT-1), slc7a11-tv2 spanned 2190 nucleotides with a 1565 bp
ED
ORF, and encodes 525 AA (SLC7A11-2 or xCT-2), and slc7a11-tv3 spanned 2249 nucleotides with a 1478 bp ORF, and encodes 492 AA, which was the same as xCT-1. All
PT
the three slc7a11 transcript variants were found in the skin of all ten WP fishes by
CE
RT-PCR confirmation. We only observed the expression bands of the three slc7a11 transcript variants in some of the ten PR and PB fishes. Analysis using TMHMM
regions.
AC
available online showed that xCT protein of red tilapia contains 12 transmembrane
The homology between Malaysian red tilapia xCT and deduced amino acid sequences of other species was explored via multiple sequence alignment using DNAMAN (Fig 2). Alignment of the red tilapia xCT with those reported for other organisms revealed a high similarity. The red tilapia xCT shared 100% similarity with Oreochromis niloticus
ACCEPTED MANUSCRIPT predicted xCT (GenBank accession number: XP_005466062.1), 81% with Oncorhynchus mykiss (XP_021439621.1) and 78% with Danio rerio (XP_009289503.1). The red tilapia xCT-1 shared similarity of 81% with Salmo salar predicted xCT-1 (XP_014055067.1), 80% with Salmo salar predicted xCT-2 (XP_014055068.1), 66% with Homo sapiens
T
(NP_055146.1) and Mus musculus (NP_036120.1). The red tilapia xCT-2 shared
3.2 phylogenetic analysis of slc7a11
CR
xCT-2, 61% with Homo sapiens and Mus musculus.
IP
similarity of 79% with Salmo salar predicted xCT-1, 81% with Salmo salar predicted
US
Phylogenetic analysis of xCT from representative fishes and mammals produced an
AN
NJ-phylogenetic tree clustered into four distinct branches (Fig. 3). The red tilapia xCT-1 and xCT-2 sequences clustered first with that of Oreochromis niloticus and then with
M
those of Fundulus heteroclitus and other teleost fishes, and finally clustered with
ED
mammals. 3.3 Expression pattern of slc7a11
PT
The mRNA expression of the Malaysian red tilapia slc7a11 gene was significantly
CE
higher in the ventral skin than in other tissues, including the dorsal skin (P < 0.05; Fig. 4), with the exception of the heart (P > 0.05).
AC
We further investigated the expression profiles of slc7a11 in the ventral skin of three different color variants of Malaysian red tilapia. The expression of slc7a11 mRNA in PR group was significantly higher than that in WP and PB groups (Fig 5). 3.4 Localization of SLC7A11 in skin In this study, the SLC7A11 rabbit polyclonal antibody was found to recognize SLC7A11 in Malaysian red tilapia by ELISA test and immunohistochemistry and
ACCEPTED MANUSCRIPT immunofluorescence pretest. Localization of the SLC7A11 protein in PR dorsal and ventral skin of fishes was studied by IF. The immunoreactive positive signals (green) for SLC7A11 were concentrated mainly in cytoplasm and nucleus of both the dorsal and ventral skin (Fig. 6
T
C, D, E, F). The nuclei fluoresced blue. We found a weaker SLC7A11 protein signal
IP
(green) in the nuclei than in the cytoplasm of red tilapia skin (Fig. 6 C, D, E, F).
CR
Meanwhile, the fluorescent signals of ventral skin were stronger than that of dorsal skin. No positive signal was found in the negative control (Fig 6 A and B).
US
3.5 RNAi
AN
The mRNA expression level of slc7a11 was examined by qRT-PCR after RNAi with the caudal vein injection of slc7a11-dsRNA at 5 μg g-1 . As shown in Fig. 7, injection of
M
slc7a11-dsRNA resulted in significant down-regulation of slc7a11 mRNA expression
ED
compared with the control group (P < 0.05) except for the 15th day in dorsal skin. The expression of slc7a11 mRNA increased again from the 7th day after injection (P < 0.05
PT
Fig 7). The expression profiles of red tilapia cbs and tyr genes were further investigated
CE
at the 1st , 2nd, 3rd, 5th and 7th day after the slc7a11 mRNA expression decreased. The cbs mRNA expression in dorsal and ventral skin of the fish injected slc7a11-dsRNA was
AC
significantly lower than that in control group from the 1st to the 7th day (P < 0.05 Fig 8). The expression of cbs mRNA increased again on the 7th day after injection (P < 0.05 Fig 8). The tyr mRNA expression in dorsal and ventral skin of red tilapia after RNAi was significantly higher compared with the control group (P < 0.05 Fig 9) except the 1st day in ventral skin.
ACCEPTED MANUSCRIPT 4. Discussion The Slc7a11 gene has been shown to alter pheomelanin synthesis in the skin of mouse, sheep and alpaca (Chintala et al., 2005; He et al., 2012; Tian et al., 2015). And the protein (xCT) that the slc7a11 gene encodes has 12 putative transmembrane domains, which are
T
highly conserved within mammals (Sato et al., 2000; Gasol et al., 2004; He et al., 2012;
IP
Tian et al., 2015). However little is known about the function of slc7a11 gene with regard
CR
to melanogenesis in fish. In this study, we characterized the full length cDNA of the slc7a11 gene in Malaysian red tilapia for the first time. Three slc7a11 transcript variants,
US
encoding two xCT proteins, were found and the nucleotide sequences from 1 to 1880bp
AN
of three transcript variants were identical. This may imply the important functional roles of the 3’ nucleotide and amino acid sequences of this gene. Further studies will be
M
required to find the differences among the three slc7a11 transcript variants, especially
ED
between tv1 and tv3.
In our study, the qRT-PCR result showed that the levels of slc7a11 mRNA were
PT
elevated in the skin of Malaysian red tilapia. And more remarkably, the slc7a11 mRNA
CE
transcripts were more abundantly expressed in ventral skin compared to the dorsal skin. Correspondingly, there was stronger xCT protein fluorescence in the ventral skin
AC
compared to the dorsal skin (Fig 6). Up to now there has been no report showing the mRNA expression and cellular localization of the SLC7A11 in other fish. The level of slc7a11 mRNA was consistently high in the skin of red tilapia as in mammals (Sato et al., 2000; He et al., 2012; Li et al., 2012; Tian et al., 2015), indicating that slc7a11 may also play an important role in skin color formation and differentiation of fish. The significant expression of slc7a11 in ventral skin of Malaysian red tilapia might be related to the
ACCEPTED MANUSCRIPT ventral skin first getting dark during the overwintering period (Wang et al., 2018c). In our study the expression level of slc7a11 mRNA was higher in the skin of PR fish compared to that in WP and PB. The result is consistent with work on mammals. In Kazakh sheep, the highest level of xCT was found in the skin of brown sheep, followed by the black and
T
white (Li et al., 2012). Also the gene was highly expressed in the skin of brown alpacas
IP
compared to white (Tian et al., 2015). The reason might be that functional SLC7A11
CR
directly affects pheomelanin synthesis by increasing intracellular cystine level (Chintala et al., 2005; Tian et al., 2015). The activity of pheomelanogenesis in PR red tilapia skin
US
might be stronger than in WP and PB. In order to maintain high levels of
AN
pheomelanogenesis, xCT could function continuously to supply enough cystine, correlating with higher mRNA expression level of slc7a11 in PR red tilapia skin (Zhu et
M
al., 2016). Ito and Wakamatsu (2008) suggested that the pheomelanin would continue to
ED
be produced until the cystine and Cysteinyl-DOPA were depleted. We further investigated the localization of xCT in the dorsal and ventral skin of PR red
PT
tilapia to explore its functions in skin color regulation. Immunofluorescence analysis
CE
revealed that the xCT is found in the cytoplasm and nucleus of skin cells, and the signals is stronger in the cytoplasm than in the nucleus. No information on the cellular
AC
localization of xCT is available in other fish. Again the xCT is known as a multi-pass membrane protein, the presence of xCT in the cytoplasm may be related to the membranous elements such as endoplasmic reticulum and golgi apparatus (Gasol et al., 2004). In brown alpaca skin, the xCT were concentrated mainly in the hair matrix (Tian et al., 2015), and in other mammals, it has been shown that melanocytes are located in the hair matrix, and they are the primary melanin producing cells contributing to color
ACCEPTED MANUSCRIPT formation (Slominski et al., 2004; Nishimura et al., 2005; Tobin, 2011). The consistency of xCT localization in cytoplasm or matrix of skin cells suggests that xCT plays an important role for skin color formation or differentiation in fish. For further understanding the mechanisms underlying expression and localization of
T
the slc7a11 in red tilapia skin, we investigated the RNA interference of slc7a11. Injection
IP
of slc7a11-dsRNA resulted in significant down-regulation of slc7a11 mRNA expression
CR
in the dorsal and ventral skin of fish. In addition, the expression of cbs mRNA in the skin of fish decreased, while that of tyr mRNA increased. The cbs is the downstream gene of
US
slc7a11 in the conserved pheomelanin synthesis pathway and the tyr gene is the starting
AN
point of the eumelanin synthesis pathway (Hoekstra, 2006; Ito and Wakamatsu, 2011; Zhu et al., 2016). Kottler et al., (2015) indicated that studies attempting to measure
M
eumelanin and pheomelanin in the skin of red seabream (Pagrus major) using
ED
high-performance liquid chromatography (HPLC) method could not identify any pheomelanin (Adachi et al., 2005; 2010). But in our previous study, we identified the
PT
melanogenesis pathway and candidate genes involved in skin pigmentation by
CE
transcriptome analysis from the three color skins of WP, PB and PR Malaysian red tilapia. The slc7a11 and cbs genes involved in the pheomelanin synthesis pathway were
AC
up-regulated in the PR skin (Zhu et al., 2016). In this study, the expression level of slc7a11 mRNA was also higher in the skin of PR fish than that in WP and PB groups. A decrease in expression of cbs after RNAi of slc7a11 would probably result in reduced amounts of pheomelanins, but higher amounts of eumelanins through elevated expression of tyr. Emaresi et al. (2013) suggested that the tyr gene typically involved in eumelanin synthesis was strongly correlated and negatively associated with the slc7a11 and cbs
ACCEPTED MANUSCRIPT genes typically involved in pheomelanin synthesis in the tawny owl (Strix aluco). These results suggested that the slc7a11 gene functions through the melanogenesis pathway. In conclusion, we successfully cloned and characterized full- length cDNAs of the slc7a11 gene in Malaysian red tilapia in this study. The slc7a11 mRNA is mainly
T
expressed in the ventral skin of PR fish. Immunofluorescence analysis revealed that xCT
IP
was concentrated mainly in the cytoplasm of fish skin cells. The cbs mRNA expression in
CR
the skin of fish decreased and the tyr mRNA expression increased after slc7a11 RNAi. These data sets suggest that slc7a11 plays an important role in skin color formation and
AN
US
differentiation in the red tilapia through the melanogenesis pathway.
M
Acknowledgments
This study was financially supported by the Jiangsu Natural Science Foundation for
ED
Young Scholars (BK20160203) ， Central Public- interest Scientific Institution Basal
PT
Research Fund, CAFS (NO. 2019ZY21) and National Natural Science Foundation Younth
CE
Fund of China (Grant No. 31802290).
AC
Conflict of interest: The authors declare no conflict of interests.
References
Adachi, K., Kato, K., Wakamatsu, K., Ito, S., Ishimaru, K., Hirata, T., Murata, O., Kumai, H. 2005. The histological analysis, colorimetric evaluation, and chemical quantification of melanin content in 'suntanned' fish. Pigm Cell Ees. 18, 465-468. Adachi, K., Wakamatsu, K., Ito, S., Matsubara, H., Nomura, K., Tanaka, H., Kato, K.
ACCEPTED MANUSCRIPT 2010. A close relationship between androgen levels and eumelanogenesis in the teleost red seabream (Pagrus major): Quantitative analysis of its seasonal variation and effects of oral treatment with methyl- testosterone. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 156, 184-189.
T
Chintala, S., Li, W., Lamoreux, M. L., Ito, S., Wakamatsu, K., Sviderskaya, E. V., Bennett,
IP
D. C., Park, Y. M., Gahl, W. A., Huizing, M., 2005. Slc7a11 gene controls production
CR
of pheomelanin pigment and proliferation of cultured cells. Proc. Natl. Acad. Sci. U. S. A. 102, 10964-10969.
US
Colihueque, N., 2010. Genetics of salmonid skin pigme ntation: clues and prospects for
AN
improving the external appearance of farmed salmonids. Rev Fish Biol Fisheries 20, 71-86.
M
Emaresi, G., Ducrest, A. L., Bize, P., Richter, H., Simon, C., Roulin, A., 2013. Pleiotropy
ED
in the melanocortin system: expression levels of this system are associated with
4915-4930.
PT
melanogenesis and pigmentation in the tawny owl (strix aluco). Mol Ecol. 22(19),
CE
Gasol, E., Jiménez-Vidal, M., Chillarón, J., Zorzano, A., Palacín, M., 2004. Membrane topology of system Xc− light subunit reveals a re-entrant loop with substrate restricted
AC
accessibility. J. Biol. Chem. 279, 31228-31236. He, X., Li, H., Zhou, Z., Zhao, Z., Li,W., 2012. Production of brown/yellow coat color in the SLC7A11 transgenic sheep via testicular injection of transgene. J. Genet. Genomics 39, 281-285. Hoekstra, H. E., 2006. Genetics, development and evolution of adaptive pigmentation in vertebrates. Heredity 97, 222-234.
ACCEPTED MANUSCRIPT Ito, S., Wakamatsu, K., 2008. Chemistry of mixed melanogenesis-pivotal roles of dopaquinone. Photochem. Photobiol. 84, 582-592. Ito, S., Wakamatsu, K., 2011. Human hair melanins: what we have learned and have not learned from mouse coat color pigmentation. Pigment Cell Melanoma Res. 24(1),
T
63-74.
IP
Jiang, Y., Zhang, S., Xu, J., Feng, J., Mahboob, S., Al-Ghanim, K. A., Sun, X., Xu, P.,
variation in common carp. PLoS One 9, e108200.
CR
2014. Comparative transcriptome analysis reveals the genetic basis of skin color
AN
Pigmentation doi: 10.1111/pcmr.12359.
US
Kottler, V. A., Künstner, A., Schartl, M., Pheomelanin in fish?. Melanin Chemistry &
Kim, J. Y., Kanai, Y., Chairoungdua, A., Cha, S. H., Matsuo, H., Kim, D. K., Inatomi, J.,
M
Sawa, H., Ida, Y., Endou, H., 2001. Human cystine/glutamate transporter: cDNA
1512(1), 335-344.
ED
cloning and upregulation by oxidative stress in glioma cells. Biochim Biophys Acta.
PT
Li, H. S., He, X., Zhou, Z. Y., Diao, S. H., Zhang, W. X., Liu, G., Diao, Z. Q., Gu, B.,
CE
2012. Expression levels of Slc7a11 in skin of kazakh sheep with different coat color. Hereditas 34, 1314-1319.
AC
Li, S., Wang, C., Yu, W., Zhao, S., Gong, Y., 2012. Identification of genes related to white and black plumage formation by RNA-Seq from white and black feather bulbs in ducks. PLoS One 7, e36592. Lo, M., Wang, Y. Z., Gout, P. W., 2008. The x(C)- cystine/glutamate antiporter: a potential target for therapy of cancer and other diseases. J Cell Physiol. 215, 593-602. Logan, D. W., Burn, S. F., Jackson, I. J., 2006. Regulation of pigmentation in zebrafish
ACCEPTED MANUSCRIPT melanophores. Pigment Cell Res. 19, 206-213. Luo, M. K., Wang, L. M., Zhu, W. B., Fu, J. J., Song, F. B., Fang, M., Dong, J. J., Dong, Z. J., et al. 2018. Identification and characterization of skin color microRNAs in Koi carp (Cyprinus carpio L.) by Illumina sequencing. BMC Genomics 19, 779.
T
Nishimura, E. K., Granter, S. R., Fisher, D. E., 2005. Mechanisms of hair graying:
IP
incomplete melanocyte stem cell maintenance in the niche. Science 307, 720-724.
CR
Pradeep, P. J., Srijaya, T. C., Jose, D., Papini, A., Hassan, A., Chatterji, A. K., 2011. Identification of diploid and triploid Red Tilapia by using erythrocyte indices.
US
Caryologia 64, 485-492.
AN
Pradeep, P. J., Srijaya, T. C., Hassan, A., Chatterji, A. K., Withyachumnarnkul, B., Jeffs,
Aquacult Int. 22: 1163-1174.
M
A., 2014. Optimal conditions for cold-shock induction of triploidy in red tilapia.
ED
Qiao, H., Xiong, Y., Zhang, W., Fu, H., Jiang, S., Sun, S., Bai, H., Jin, S., Gong, Y., 2015. Characterization, expression, and function analysis of gonad- inhibiting hormone in
PT
Oriental River prawn, Macrobrachium nipponense, and its induced expression by
CE
temperature. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 185, 1-8. Sato, H., Tamba, M., Kuriyama-Matsumura, K., Okuno, S., Bannai, S., 2000. Molecular
AC
cloning and expression of human xCT, the light chain of amino acid transport system XC-. Antioxid Redox Signal. 2, 665-671. Slominski, A., Wortsman, J.,
Plonka, P. M., Schallreuter, K. U., Paus, R., Tobin, D. J.,
2004. Hair follicle pigmentation. J. Invest. Dermatol. 124, 13-21. Tian, X., Meng, X. L., Wang, L. Y., Song, Y. F., Zhang, D. L., Ji, Y. K., Li, X. J., Dong, C. S., 2015. Molecular cloning, mRNA expression and tissue distribution analysis of
ACCEPTED MANUSCRIPT Slc7a11 gene in alpaca (Lama paco) skins associated with different coat colors. Gene 555, 88-94. Tobin, D. J., 2011. The cell biology of human hair follicle pigmentation. Pigment Cell Melanoma Res. 24, 75-88.
T
Wang, C., Wachholtz, M., Wang, J., Liao, X., Lu, G., 2014. Analysis of the skin
IP
transcriptome in two oujiang color varieties of common carp. PLoS One 9, e90074.
CR
Wang, L. M., Zhu, W. B., Dong, Z. J., Song, F. B., Dong, J. J., Fu, J. J., 2018a. Comparative microRNA-seq analysis depicts candidate miRNAs involved in skin
US
color differentiation in red tilapia. Int. J. Mol. Sci. 19, 1209.
AN
Wang, L. M., Zhu, W. B., Yang, J., Miao, L. H., Dong, J. J., Song, F. B., Dong, Z. J., 2018b. Effects of dietary cystine and tyrosine on melanogenesis pathways involved in
M
skin color differentiation of Malaysian red tilapia. Aquaculture 490, 149-155.
ED
Wang, L. M., Song, F. B., Zhu, W. B., Dong, J. J., Fu, J. J., Dong, Z. J., 2018c. Effects of temperature on body color of Malaysian red tilapia during overwintering period. J.
PT
Fish. China. 42 (1), 72-79.
CE
Zhu, W. B., Wang, L. M., Dong, Z. J., Chen, X. T., Song, F. B., Liu, N., Yang, H., Fu, J. J., 2016. Comparative transcriptome analysis identifies candidate genes related to skin
AC
color differentiation in red tilapia. Scientific Reports 6, 31347.
ACCEPTED MANUSCRIPT Table 1. Primer sequences. Primers
Sequences (5’-3’)
Slc7a11 RACE F1 (first)
CTTCCTGTCTCTGTACTCGGACCCTGTT
Joint primer
GCTGTCAACGATACGCTACGTAAC
Slc7a11 RACE F2 (nested) Joint primer
CACTGGCATCCCTGCGTACTACATCTTT
Slc7a11 Forward
GAAGAAGCGTGGTAGGCACT
Slc7a11 Reverse
TGCTTCAGGATTCCCTTCGG
β-actin Forward
GTACCACCATGTACCCTGGC
β-actin Reverse
TGAAGTTGTTGGGCGTTTGG
slc7a11 iF
TAATACGACTCACTATAGGGTGCAAAGACTG TTCCACTCG
slc7a11 iR
TAATACGACTCACTATAGGGCAGTGAGGGA AATGGCAAAT
cbs Forward
GGATTGATCCTGGGCATGGT
Primers for
cbs Reverse
TGCTGTGAGAGCCATCAGTC
RNA interference
tyr Forward
CCATGGACCGATTTGCCAAC
tyr Reverse
TATGCAAGGCGTTGTGCAAG
Primers for qRT-PCR
ED
M
AN
US
CR
IP
T
GCTACGTAACGGCATGACAGTG
PT CE AC
Primers for 3’ RACE PCR
ACCEPTED MANUSCRIPT Figure Legends Fig. 1. Schematic representation of Malaysian red tilapia cDNA sequences for slc7a11. The region from 1 to 1880bp of three transcript variant of slc7a11 is identical (broken line). The translation initiation codon (462bp) and the stop codon are shown as
T
black arrows and white arrows, respectively. AAA represents poly(A)+ .
IP
Fig. 2. Multiple alignment of xCT amino acid sequences in different species. Dark
CR
shaded areas indicate examples of species with the same amino acid sites; light shaded areas indicate that more than half of the listed species have the same amino acid sites.
US
Fig. 3. Neighbor-joining phylogenetic tree of the xCT protein using the deduced
Oreochromis
(JAR78910.1);
niloticus
Oncorhynchus
(XP_005466062.1);
mykiss
M
database:
AN
amino acids sequences of Malaysian red tilapia and other species from GenBank Fundulus
(XP_021439621.1);
heteroclitus
Salmo
salar-1
ED
(XP_014055067.1); Salmo salar-2 (XP_014055068.1); Danio rerio (XP_009289503.1); Ovis aries (NP_001239111.1); Homo
sapiens (NP_055146.1); Mus musculus
PT
(NP_036120.1); Oryctolagus cuniculus (ATO93739.1). The numbers in the phylogram
CE
nodes indicate the bootstrap value (%). The bar at the bottom indicates 5% amino acid divergence in the sequences.
AC
Fig. 4. Tissue-dependent slc7a11 mRNA expression in Malaysian red tilapia. Values with different letters mean significant differences (P<0.05). Fig. 5. Relative expression of slc7a11 mRNA in the ventral skin of three different color patterns of Malaysian red tilapia. WP: whole pink, PB: pink with scattered black spots, PR: pink with scattered red spots. Values with different letters mean significant differences (P<0.05).
ACCEPTED MANUSCRIPT Fig. 6. Immunofluorescence localization of SLC7A11 proteins in the dorsal skin (DS) and ventral skin (VS) of Malaysian red tilapia. Positive signals of anti-SLC7A11 immunolabeling are shown in green (C, D, E, F). The blue fluorescence is nucleus (N). A negative control for DS (A) and VS (B). C, cytoplasm; M, melanin.
T
Fig. 7. Relative expression of slc7a11 mRNA in the dorsal and ventral skin of
IP
Malaysian red tilapia after slc7a11-dsRNA injection. Values with different letters mean
CR
significant differences (P<0.05).
Fig. 8. Relative expression of cbs mRNA in the dorsal and ventral skin of Malaysian
US
red tilapia after slc7a11-dsRNA injection. Values with different letters mean significant
AN
differences (P<0.05).
Fig. 9. Relative expression of tyr mRNA in the dorsal and ventral skin of Malaysian
M
red tilapia after slc7a11-dsRNA injection. Values with different letters mean significant
ED
differences (P<0.05).
Suppleme ntary Fig. Three skin color types of Malaysian red tilapia. (WP: whole pink,
PT
PR: pink with scattered red spots and PB: pink with scattered black spots from left to right
AC
CE
respectively).
ACCEPTED MANUSCRIPT Research Highlights
Three
slc7a11 mRNA expressions were high in the ventral skin of PR fish.
SLC7A11 was concentrated mainly in the cytoplasm and nucleu of fish skin.
The cbs mRNA expression decreased and tyr expression increased after slc7a11
IP
T
full-length cDNA of slc7a11 were identified from Malaysia red tilapia.
RNAi.
CR
slc7a11 plays important role in skin color differentiation through the
CE
PT
ED
M
AN
US
melanogenesis pathways.
AC
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5
Figure 6
Figure 7
Figure 8
Figure 9
Figure 10
Lan-mei Wang, Hong-yi Bu, Fei-biao Song, Wen-bin Zhu, Jianjun Fu, Zai-jie Dong PII: DOI: Article Number: Reference:
S1095-6433(19)30293-4 https://doi.org/10.1016/j.cbpa.2019.110529 110529 CBA 110529
To appear in:
Comparative Biochemistry and Physiology, Part A
Received date: Revised date: Accepted date:
15 January 2019 10 July 2019 10 July 2019
Please cite this article as: L.-m. Wang, H.-y. Bu, F.-b. Song, et al., Characterization and functional analysis of slc7a11 gene, involved in skin color differentiation in the red tilapia, Comparative Biochemistry and Physiology, Part A, https://doi.org/10.1016/ j.cbpa.2019.110529
This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
ACCEPTED MANUSCRIPT Characterization and functional analysis of slc7a11 gene, involved in skin color differentiation in the red tilapia
Lan-mei Wang1# , Hong-yi Bu2# , Fei-biao Song2 , Wen-bin Zhu1 , Jian-jun Fu1 & Zai-jie
IP
Freshwater Fisheries Research Centre of Chinese Academy of Fishery Sciences, Key
CR
1
T
Dong1, 2*
Laboratory of Freshwater Fisheries and Germplasm Resources Utilization, Ministry of
US
Agriculture and Rural Affairs, Wuxi 214081, China
Wuxi Fisheries College, Nanjing Agricultural University, Wuxi 214081, China
*
Correspondence: Zai-jie Dong, Freshwater Fisheries Research Centre of Chinese
M
AN
2
ED
Academy of Fishery Sciences, East Shanshui Road 9, Wuxi 214081, China. Tel.:
These authors contributed equally to this work
CE
#
PT
86-510-85558831. E-mail: [email protected]
AC
Running title: Fish slc7a11 gene involved in pigmentation differentiation
ACCEPTED MANUSCRIPT ABSTRACT Red tilapia has become more popular for aquaculture production in China in recent years. However, the pigmentation differentiation that has resulted from the process of genetic breeding and skin color variation during the overwintering period are the main
IP
T
problems limiting the development of commercial culture. The genetic basis of skin color
CR
differentiation is still not understood. Solute carrier family 7 member 11 (slc7a11) has been identified to be a critical genetic regulator of pheomelanin synthesis in the skin of
US
mammals. However, little information is available about its molecular characteristics, expression, location and function in skin color differentiation of fish. In this study, three
AN
complete cDNA sequences (2159 bp, 2190 bp and 2249 bp) of slc7a11 were successfully
M
isolated from Malaysian red tilapia, encoding polypeptides of 492, 525 and 492 amino acids respectively. Quantitative real-time PCR demonstrated that slc7a11 mRNA
ED
expression is high in the ventral skin of PR (pink with scattered red spots) fish.
PT
Immunofluorescence analysis revealed that xCT (the protein encoded by slc7a11) was concentrated mainly in the cytoplasm and nucleus of both the dorsal and ventral skin cells
CE
of fish. After RNA interference of slc7a11, slc7a11 and cbs mRNA expressions decreased,
AC
but the tyr mRNA expression increased in the skin of fish. Results suggest that slc7a11 plays an important role in skin color formation and differentiation of red tilapia through the melanogenesis pathway. Key words: slc7a11; red tilapia; expression; localization; RNA interference; skin color differentiation.
ACCEPTED MANUSCRIPT 1. Introduction Tilapia (Oreochromis genus) is currently widely accepted for consumption and as one of the most important food fish in the world. The red tilapia, a multi-cross breed between a mutant reddish-orange Mozambique tilapia (Oreochromis mossambicus) with other
T
tilapia species like Nile tilapia (O. niloticus) and blue tilapia (O. aureus), is a very
IP
attractive commercial breed in many parts of the world, such as China, Malaysia and
CR
Thailand, primarily because of its uniform red color skin and the absence of black peritoneum (Pradeep et al., 2011, 2014). However, the skin color differentiation that has
US
resulted from the process of genetic breeding and skin color variation in low temperature
AN
environments during overwintering are the main problems limiting the development of commercial red tilapia culture. Also, three coloration patterns including whole pink (WP),
M
pink with scattered black spots (PB) and pink with scattered red spots (PR) have been
ED
found in the Malaysian red tilapia breeding population (Supplementary Figure) (Zhu et al., 2016). The skin color differentiation that has resulted from the process of genetic
PT
breeding is found at birth and it is not reversible, while the skin color variation during
CE
overwintering period is reversible with an increase in environmental temperatures. Skin coloration results from diverse pigments synthesized by chromatophores or
AC
pigment cells which are either controlled or affected by a series of cellular, nutritional, physiological, genetic and environmental factors (Colihueque, 2010; Jiang et al., 2014; Zhu et al., 2016). So far, extensive studies have been conducted on molecular mechanisms of melanin biosynthesis in humans and mammals, and the melanogenesis pathways have been found to be conserved in vertebrates (Logan et al., 2006; Li et al., 2012). Recently, transcriptome and microRNA-seq analysis in different color varieties of
ACCEPTED MANUSCRIPT red tilapia (Zhu et al., 2016; Wang et al., 2018), koi carp (Cyprinus carpio L.) (Luo et al., 2018) and common carp (Jiang et al., 2014; Wang et al., 2014) have been done to understand the genetic basis of the color differentiation and confirm the conserved melanogenesis pathway in fish In the melanogenesis pathway, tyrosine is oxidized by
T
tyrosinases to form dopaquinone (DQ), which is then catalyzed to become eumelanin
IP
(brown to black pigment) through polymerization and oxidation reactions. Cysteine and
CR
dopaquine can switch off the eumelanin synthesis pathway and promote the synthesis of pheomelanin (yellow to red pigment). The production of pheomelanin depends on the
US
incorporation of cysteine, whose uptake is regulated by cysteine/glutamate exchanger
AN
(xCT), the protein encoded by the slc7a11 gene (encoding solute carrier family 7 member 11) (Hoekstra, 2006; Ito and Wakamatsu, 2011).
M
xCT, or SLC7A11, functions as an exchange system for cystine/glutamate, is an
ED
important determinant of the intracellular redox balance. xCT’s presence at the cell surface is essential for the uptake of cystine, which is required for intracellular
PT
glutathione synthesis (Kim et al., 2001; Lo et al., 2008). Although the gene slc7a11 has
CE
been shown to alter pheomelanin synthesis in the skin of mouse (Mus musculus), sheep (Ovis aries) and alpaca (Vicugna pacos) (Chintala et al., 2005; He et al., 2012; Tian et al.,
AC
2015), little information is available for fish. In our previous study, we did transcriptome and microRNA-seq analysis of different color varieties of red tilapia and found the important role of slc7a11 gene in melanin synthesis (Zhu et al., 2016; Wang et al., 2018a). We also studied the effects of dietary cysteine and tyrosine (Wang et al., 2018b) and temperature (Wang et al., 2018c) on the expression of slc7a11 and the skin color of red tilapia. In this study, we characterized mRNA sequence encoding for red tilapia slc7a11
ACCEPTED MANUSCRIPT gene for the first time and evaluated their expression profiles. In addition, we studied the effects of RNA interference (RNAi) and the location of xCT on skin tissue of red tilapia, in order to understand the role of xCT in pigmentation differentiation and variation of fish. The results will help to understand the overall role of slc7a11 in skin color
IP
T
differentiation and variation and advance our knowledge of skin color genetics in fish.
CR
2. Materials and methods 2.1 Sample preparation
US
This study was approved by the Bioethical Committee of Freshwater Fisheries
AN
Research Center (FFRC) of Chinese Academy of Fishery Sciences (CAFS) (BC 2013863, 9/2013). We carried out the methods of all experiments in accordance with the Guide for
M
the Care and Use of Experimental Animals of China.
ED
We took experimental fish of red tilapia from the Qiting Pilot Research Station (Yixing, China), which is affiliated to the FFRC, CAFS. After acclimatization, we randomly
PT
collected and then lightly anesthetized the fishes by clove oil (Zhanyun Chemical Co.,
CE
Ltd, Shanghai, China) which was added in the water. Then after, we sacrificed the sampled fish to obtain various tissues, including dorsal skin, ventral skin, muscle, heart,
AC
intestine and brain. We obtained the dorsal and ventral skins of all the three different skin colors (WP, PB and PR) of Malaysian red tilapia. We snap froze the tissue samples in liquid nitrogen and conserved at −80°C for gene mRNA expression analysis. We analyzed three biological samples (n = 3). In addition, we excised and fixed dorsal and ventral skins of fish in PFA (phosphate buffered saline: formaldehyde =9:1) at room temperature overnight. We obtained the skins with scales to ensure the integrity of the pigmentation. Tissue blocks were
ACCEPTED MANUSCRIPT dehydrated in an ascending series of ethanol, cleared in xylene, embedded in paraffin, and sectioned at 4 μm thickness for immunofluorescence analyses (IF). 2.2 Nucleic acid preparation and first-strand cDNA synthesis We extracted total RNA from various tissues of Malaysian red tilapia using EASY spin
T
tissue/cell ultra-pure RNA Rapid Extraction Kit (Yuanpinghao Biotech Co., Ltd., Tianjin,
IP
China) according to the manufacturer's protocol. We measured the concentration of total
CR
RNA with a UV-spectrophotometer 170 (NanoDrop 2000, Thermo, Wilmington, DE, USA). We examined the quantity and quality of RNA by UV-spectrophotometry
US
(OD260 /OD280 ) and agarose gel electrophoresis, respectively. We reverse transcribed total
AN
RNA (500 ng) from various tissues into first-strand cDNA using PrimeScript RT Master Mix Perfect Real Time Kit (TaKaRa, Japan) according to the manufacturer's instructions.
M
2.3. Rapid amplification of cDNA ends (RACE)
ED
We extended the red tilapia slc7a11 cDNA sequence using the SMARTer™ RACE cDNA Amplification Kit (Clontech, USA) according to the manufacturer's protocol. We
PT
designed the gene-specific primers (Table 1) based on the original expressed sequence tag
CE
(EST) from the Malaysian red tilapia transcriptome library (National Center for Biotechnology Information NCBI SRA database SRP076062). The 5’ sequence of the
AC
slc7a11 EST is complete by 5’ RACE verification and blast in NCBI. The PCR program was Nest PCR performed for 33 cycles of 95°C for 3 min, 94°C for 30 s, 58°C for 30 s, 72°C for 60 s and 72°C for 7 min. We separated PCR products on 1.5% agarose gel and purified PCR products with an E.Z.N.A® Gel Extraction Kit (Omiga BioTek, USA). We cloned the purified PCR products into a pMD18-T vector (TaKaRa, Japan) overnight. We transformed the recombinant plasmids into competent Escherichia coli cells and
ACCEPTED MANUSCRIPT sequenced positive clones at Shanghai Biosune Bio Co. Ltd., China. Then we verified and analyzed the retrieved sequences for similarity with other known slc7a11 sequences using the BLASTX program at the NCBI (http://www.ncbi.nlm.nih.gov/blast). Finally we chose ten fish from each color variants (WP, PB and PR) to make a total of thirty fish, to
different phenotypes of red tilapia.
CR
2.4. Multiple sequence alignment and phylogenetic analysis
IP
T
perform the end to end RT-PCR for confirmation of the existence and distribution in three
We retrieved the deduced protein sequences of slc7a11 of various species from
multiple
alignments
using
ClustalW2.
We
constructed
a
bootstrapped
AN
out
US
GenBank and compared phylogenetically with those of Malaysian red tilapia. We carried
neighbor-joining (NJ) phylogenetic tree using MEGA software version 5.0. We tested the
M
reliability of the branching using bootstrap re-sampling with 1000 pseudo replicates.
ED
2.5. qRT-PCR analysis
We conducted the tissue-dependent and fish dorsal and ventral skin of different color
PT
variants (WP, PB and PR) mRNA expression analysis via qRT-PCR. We designed the
CE
gene-specific qRT-PCR primers (Table1) based on the cloned slc7a11 cDNA to produce an amplicon of 224 bp. We performed qRT-PCR with a CFX96 Real- Time PCR Detection
AC
System (Bio-Rad, Hercules, CA, USA) using SYBR Premix Ex TaqII (Takara) according to the manufacturer's protocol. The final volume of each qRT-PCR reaction was 25 μL, which contained 12.5 μL 2 × SYBR Premix ExTaq, 1.0 μL of diluted cDNA template(100ng RNA), 9.5 μL of PCR-grade water, and 1.0 μL of each 10 μM primer. The PCR conditions were as follows: 95°C for 30 s, followed by 40 cycles of 95°C for 5 s and 60°C for 30s. We run each sample in triplicates and normalized to the selected
ACCEPTED MANUSCRIPT control gene β-actin of Malaysian red tilapia (NCBI SRA database SRP076062). We calculated the slc7a11 mRNA expression levels by the comparative CT (2−ΔΔCt ) method (Livak and Schmittgen, 2001). We calculated the means and standard deviations from triplicate experiments and presented as n- fold differences in expression relative to
T
β-actin mRNA. We reported data as the mean ± standard error of mean (SEM). We
IP
confirmed the homogeneity of variance and performed comparison between means with a
CR
one-way ANOVA. We used Turkey B and Duncan’s test for multiple comparisons
US
between groups. We determined statistical significance at P < 0.05. We performed all statistical analyses by SPSS 17 (Chicago, IL, USA).
AN
2.6. Immunofluorescence
M
To locate xCT, we generated the antibody against Malaysian red tilapia xCT rabbit polyclonal antibody from a 15-residue polypeptide (NGHKVSSNGTEQKDC). The
ED
antibody was found to recognize xCT in Malaysian red tilapia in preliminary tests.
PT
We used paraffin sections for IF. The paraffin sections were deparaffinized and hydrated, followed by xylene I for 10 min, xylene II for 10 min, absolute ethyl alcohol
CE
for 5 min, absolute ethyl alcohol II for 5 min, 95% alcohol for 5 min, 90% alcohol for 5
AC
min, 80% alcohol for 5 min, 70% alcohol for 5 min, and washed with distilled water. We placed the sections in a repair box filled with boiling Tris-EDTA buffer (pH 9.0), and maintained at 95-100℃ for 20min on low heat in the microwave oven. We cooled the sections at room temperature for 10 min, and washed with 0.01PBS (pH 7.4) 3 times at 3 min per wash. Then we treated the sections in blocking solution, incubated with slc7a11 monoclonal antibody (1:1000 1%BSA dilution) overnight at 4℃, and rinsed with 0.01PBS (pH 7.4) 3 times at 3 min per wash. Subsequently, we incubated the tissue sections with a
ACCEPTED MANUSCRIPT second antibody (goat anti-rabbit IgG) with 4’,6-Diamidine-2’-phenylindole (DAPI) (Roche) at 1:500 for 3 h (room temperature), and then rinsed with PBS three times for 3 min per wash. Finally we sealed sections with anti-quenching water-soluble sealant and observed with fluorescence microscope. In the negative control, we replaced the primary
T
antibody with 10% goat anti-rabbit serum.
IP
2.7. RNA interference (RNAi)
CR
The description of RNA interference is taken from the protocol described by Qiao et al., (2015). We synthesized the dsRNA of slc7a11 in vitro using TranscriptAid T7 High
US
Yield Transcription Kit (Thermo Scientific, USA) according to the manufacturer's
AN
instructions. We prepared the template for slc7a11-dsRNA synthesis by amplifying skin cDNA of Malaysian red tilapia with the primers slc7a11 iF and slc7a11 iR (Table 1). We
M
designed the primers based on the identical ORF areas of the three slc7a11 transcript
ED
variant to produce an amplicon of 593 bp. We measured the concentration of dsRNA at 260 nm with a BioPhotometer (Eppendorf, Hamburg, Germany). We examined the purity
PT
and integrity of dsRNA by 1% agarose gel electrophoresis, and then stored at -20°C until
CE
used.
Preliminary experiment showed that the optimum interfering effect was observed after
AC
the caudal vein injection of slc7a11-dsRNA with the dose of 5 μg g-1 body weight. In this study, we divided the juvenile red tilapia (initial weight: 19.86±0.80 g) randomly into two groups with 33 WP fishes per group when we injected the caudal vein with slc7a11-dsRNA at a dose of 5 μg g-1 body weight. We injected H2 O into control group at the same volume. We obtained the dorsal and ventral skin samples at the 1st , 2nd, 3rd, 4th ， 5th ，6th , 7th ，9th , 11th ,13th and 15th day after injection, and obtained 3 fish samples per
ACCEPTED MANUSCRIPT group every time. We snap- froze the skin samples in liquid nitrogen and stored at −80°C until used. We tested the mRNA expression levels of slc7a11, tyrosinase (tyr) and cystathionine beta synthase (cbs) gene by qRT-PCR, primers used as shown in Table 1.
T
3. Results
IP
3.1 slc7a11 cDNA cloning and sequence analysis
CR
In this study we successfully isolated three complete cDNA sequences of slc7a11 from Malaysian red tilapia by RACE-PCR, identified as slc7a11 transcript variant 1
US
(slc7a11-tv1 GenBank accession number: MH450056), slc7a11-tv2 (MH450057) and
AN
slc7a11-tv3 (MH450058), respectively. As shown in Fig. 1, slc7a11-tv1 was 2159 bp in length containing an open reading frame (ORF) of 1478 bp, corresponding to 492 amino
M
acid (AA) (SLC7A11-1 or xCT-1), slc7a11-tv2 spanned 2190 nucleotides with a 1565 bp
ED
ORF, and encodes 525 AA (SLC7A11-2 or xCT-2), and slc7a11-tv3 spanned 2249 nucleotides with a 1478 bp ORF, and encodes 492 AA, which was the same as xCT-1. All
PT
the three slc7a11 transcript variants were found in the skin of all ten WP fishes by
CE
RT-PCR confirmation. We only observed the expression bands of the three slc7a11 transcript variants in some of the ten PR and PB fishes. Analysis using TMHMM
regions.
AC
available online showed that xCT protein of red tilapia contains 12 transmembrane
The homology between Malaysian red tilapia xCT and deduced amino acid sequences of other species was explored via multiple sequence alignment using DNAMAN (Fig 2). Alignment of the red tilapia xCT with those reported for other organisms revealed a high similarity. The red tilapia xCT shared 100% similarity with Oreochromis niloticus
ACCEPTED MANUSCRIPT predicted xCT (GenBank accession number: XP_005466062.1), 81% with Oncorhynchus mykiss (XP_021439621.1) and 78% with Danio rerio (XP_009289503.1). The red tilapia xCT-1 shared similarity of 81% with Salmo salar predicted xCT-1 (XP_014055067.1), 80% with Salmo salar predicted xCT-2 (XP_014055068.1), 66% with Homo sapiens
T
(NP_055146.1) and Mus musculus (NP_036120.1). The red tilapia xCT-2 shared
3.2 phylogenetic analysis of slc7a11
CR
xCT-2, 61% with Homo sapiens and Mus musculus.
IP
similarity of 79% with Salmo salar predicted xCT-1, 81% with Salmo salar predicted
US
Phylogenetic analysis of xCT from representative fishes and mammals produced an
AN
NJ-phylogenetic tree clustered into four distinct branches (Fig. 3). The red tilapia xCT-1 and xCT-2 sequences clustered first with that of Oreochromis niloticus and then with
M
those of Fundulus heteroclitus and other teleost fishes, and finally clustered with
ED
mammals. 3.3 Expression pattern of slc7a11
PT
The mRNA expression of the Malaysian red tilapia slc7a11 gene was significantly
CE
higher in the ventral skin than in other tissues, including the dorsal skin (P < 0.05; Fig. 4), with the exception of the heart (P > 0.05).
AC
We further investigated the expression profiles of slc7a11 in the ventral skin of three different color variants of Malaysian red tilapia. The expression of slc7a11 mRNA in PR group was significantly higher than that in WP and PB groups (Fig 5). 3.4 Localization of SLC7A11 in skin In this study, the SLC7A11 rabbit polyclonal antibody was found to recognize SLC7A11 in Malaysian red tilapia by ELISA test and immunohistochemistry and
ACCEPTED MANUSCRIPT immunofluorescence pretest. Localization of the SLC7A11 protein in PR dorsal and ventral skin of fishes was studied by IF. The immunoreactive positive signals (green) for SLC7A11 were concentrated mainly in cytoplasm and nucleus of both the dorsal and ventral skin (Fig. 6
T
C, D, E, F). The nuclei fluoresced blue. We found a weaker SLC7A11 protein signal
IP
(green) in the nuclei than in the cytoplasm of red tilapia skin (Fig. 6 C, D, E, F).
CR
Meanwhile, the fluorescent signals of ventral skin were stronger than that of dorsal skin. No positive signal was found in the negative control (Fig 6 A and B).
US
3.5 RNAi
AN
The mRNA expression level of slc7a11 was examined by qRT-PCR after RNAi with the caudal vein injection of slc7a11-dsRNA at 5 μg g-1 . As shown in Fig. 7, injection of
M
slc7a11-dsRNA resulted in significant down-regulation of slc7a11 mRNA expression
ED
compared with the control group (P < 0.05) except for the 15th day in dorsal skin. The expression of slc7a11 mRNA increased again from the 7th day after injection (P < 0.05
PT
Fig 7). The expression profiles of red tilapia cbs and tyr genes were further investigated
CE
at the 1st , 2nd, 3rd, 5th and 7th day after the slc7a11 mRNA expression decreased. The cbs mRNA expression in dorsal and ventral skin of the fish injected slc7a11-dsRNA was
AC
significantly lower than that in control group from the 1st to the 7th day (P < 0.05 Fig 8). The expression of cbs mRNA increased again on the 7th day after injection (P < 0.05 Fig 8). The tyr mRNA expression in dorsal and ventral skin of red tilapia after RNAi was significantly higher compared with the control group (P < 0.05 Fig 9) except the 1st day in ventral skin.
ACCEPTED MANUSCRIPT 4. Discussion The Slc7a11 gene has been shown to alter pheomelanin synthesis in the skin of mouse, sheep and alpaca (Chintala et al., 2005; He et al., 2012; Tian et al., 2015). And the protein (xCT) that the slc7a11 gene encodes has 12 putative transmembrane domains, which are
T
highly conserved within mammals (Sato et al., 2000; Gasol et al., 2004; He et al., 2012;
IP
Tian et al., 2015). However little is known about the function of slc7a11 gene with regard
CR
to melanogenesis in fish. In this study, we characterized the full length cDNA of the slc7a11 gene in Malaysian red tilapia for the first time. Three slc7a11 transcript variants,
US
encoding two xCT proteins, were found and the nucleotide sequences from 1 to 1880bp
AN
of three transcript variants were identical. This may imply the important functional roles of the 3’ nucleotide and amino acid sequences of this gene. Further studies will be
M
required to find the differences among the three slc7a11 transcript variants, especially
ED
between tv1 and tv3.
In our study, the qRT-PCR result showed that the levels of slc7a11 mRNA were
PT
elevated in the skin of Malaysian red tilapia. And more remarkably, the slc7a11 mRNA
CE
transcripts were more abundantly expressed in ventral skin compared to the dorsal skin. Correspondingly, there was stronger xCT protein fluorescence in the ventral skin
AC
compared to the dorsal skin (Fig 6). Up to now there has been no report showing the mRNA expression and cellular localization of the SLC7A11 in other fish. The level of slc7a11 mRNA was consistently high in the skin of red tilapia as in mammals (Sato et al., 2000; He et al., 2012; Li et al., 2012; Tian et al., 2015), indicating that slc7a11 may also play an important role in skin color formation and differentiation of fish. The significant expression of slc7a11 in ventral skin of Malaysian red tilapia might be related to the
ACCEPTED MANUSCRIPT ventral skin first getting dark during the overwintering period (Wang et al., 2018c). In our study the expression level of slc7a11 mRNA was higher in the skin of PR fish compared to that in WP and PB. The result is consistent with work on mammals. In Kazakh sheep, the highest level of xCT was found in the skin of brown sheep, followed by the black and
T
white (Li et al., 2012). Also the gene was highly expressed in the skin of brown alpacas
IP
compared to white (Tian et al., 2015). The reason might be that functional SLC7A11
CR
directly affects pheomelanin synthesis by increasing intracellular cystine level (Chintala et al., 2005; Tian et al., 2015). The activity of pheomelanogenesis in PR red tilapia skin
US
might be stronger than in WP and PB. In order to maintain high levels of
AN
pheomelanogenesis, xCT could function continuously to supply enough cystine, correlating with higher mRNA expression level of slc7a11 in PR red tilapia skin (Zhu et
M
al., 2016). Ito and Wakamatsu (2008) suggested that the pheomelanin would continue to
ED
be produced until the cystine and Cysteinyl-DOPA were depleted. We further investigated the localization of xCT in the dorsal and ventral skin of PR red
PT
tilapia to explore its functions in skin color regulation. Immunofluorescence analysis
CE
revealed that the xCT is found in the cytoplasm and nucleus of skin cells, and the signals is stronger in the cytoplasm than in the nucleus. No information on the cellular
AC
localization of xCT is available in other fish. Again the xCT is known as a multi-pass membrane protein, the presence of xCT in the cytoplasm may be related to the membranous elements such as endoplasmic reticulum and golgi apparatus (Gasol et al., 2004). In brown alpaca skin, the xCT were concentrated mainly in the hair matrix (Tian et al., 2015), and in other mammals, it has been shown that melanocytes are located in the hair matrix, and they are the primary melanin producing cells contributing to color
ACCEPTED MANUSCRIPT formation (Slominski et al., 2004; Nishimura et al., 2005; Tobin, 2011). The consistency of xCT localization in cytoplasm or matrix of skin cells suggests that xCT plays an important role for skin color formation or differentiation in fish. For further understanding the mechanisms underlying expression and localization of
T
the slc7a11 in red tilapia skin, we investigated the RNA interference of slc7a11. Injection
IP
of slc7a11-dsRNA resulted in significant down-regulation of slc7a11 mRNA expression
CR
in the dorsal and ventral skin of fish. In addition, the expression of cbs mRNA in the skin of fish decreased, while that of tyr mRNA increased. The cbs is the downstream gene of
US
slc7a11 in the conserved pheomelanin synthesis pathway and the tyr gene is the starting
AN
point of the eumelanin synthesis pathway (Hoekstra, 2006; Ito and Wakamatsu, 2011; Zhu et al., 2016). Kottler et al., (2015) indicated that studies attempting to measure
M
eumelanin and pheomelanin in the skin of red seabream (Pagrus major) using
ED
high-performance liquid chromatography (HPLC) method could not identify any pheomelanin (Adachi et al., 2005; 2010). But in our previous study, we identified the
PT
melanogenesis pathway and candidate genes involved in skin pigmentation by
CE
transcriptome analysis from the three color skins of WP, PB and PR Malaysian red tilapia. The slc7a11 and cbs genes involved in the pheomelanin synthesis pathway were
AC
up-regulated in the PR skin (Zhu et al., 2016). In this study, the expression level of slc7a11 mRNA was also higher in the skin of PR fish than that in WP and PB groups. A decrease in expression of cbs after RNAi of slc7a11 would probably result in reduced amounts of pheomelanins, but higher amounts of eumelanins through elevated expression of tyr. Emaresi et al. (2013) suggested that the tyr gene typically involved in eumelanin synthesis was strongly correlated and negatively associated with the slc7a11 and cbs
ACCEPTED MANUSCRIPT genes typically involved in pheomelanin synthesis in the tawny owl (Strix aluco). These results suggested that the slc7a11 gene functions through the melanogenesis pathway. In conclusion, we successfully cloned and characterized full- length cDNAs of the slc7a11 gene in Malaysian red tilapia in this study. The slc7a11 mRNA is mainly
T
expressed in the ventral skin of PR fish. Immunofluorescence analysis revealed that xCT
IP
was concentrated mainly in the cytoplasm of fish skin cells. The cbs mRNA expression in
CR
the skin of fish decreased and the tyr mRNA expression increased after slc7a11 RNAi. These data sets suggest that slc7a11 plays an important role in skin color formation and
AN
US
differentiation in the red tilapia through the melanogenesis pathway.
M
Acknowledgments
This study was financially supported by the Jiangsu Natural Science Foundation for
ED
Young Scholars (BK20160203) ， Central Public- interest Scientific Institution Basal
PT
Research Fund, CAFS (NO. 2019ZY21) and National Natural Science Foundation Younth
CE
Fund of China (Grant No. 31802290).
AC
Conflict of interest: The authors declare no conflict of interests.
References
Adachi, K., Kato, K., Wakamatsu, K., Ito, S., Ishimaru, K., Hirata, T., Murata, O., Kumai, H. 2005. The histological analysis, colorimetric evaluation, and chemical quantification of melanin content in 'suntanned' fish. Pigm Cell Ees. 18, 465-468. Adachi, K., Wakamatsu, K., Ito, S., Matsubara, H., Nomura, K., Tanaka, H., Kato, K.
ACCEPTED MANUSCRIPT 2010. A close relationship between androgen levels and eumelanogenesis in the teleost red seabream (Pagrus major): Quantitative analysis of its seasonal variation and effects of oral treatment with methyl- testosterone. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 156, 184-189.
T
Chintala, S., Li, W., Lamoreux, M. L., Ito, S., Wakamatsu, K., Sviderskaya, E. V., Bennett,
IP
D. C., Park, Y. M., Gahl, W. A., Huizing, M., 2005. Slc7a11 gene controls production
CR
of pheomelanin pigment and proliferation of cultured cells. Proc. Natl. Acad. Sci. U. S. A. 102, 10964-10969.
US
Colihueque, N., 2010. Genetics of salmonid skin pigme ntation: clues and prospects for
AN
improving the external appearance of farmed salmonids. Rev Fish Biol Fisheries 20, 71-86.
M
Emaresi, G., Ducrest, A. L., Bize, P., Richter, H., Simon, C., Roulin, A., 2013. Pleiotropy
ED
in the melanocortin system: expression levels of this system are associated with
4915-4930.
PT
melanogenesis and pigmentation in the tawny owl (strix aluco). Mol Ecol. 22(19),
CE
Gasol, E., Jiménez-Vidal, M., Chillarón, J., Zorzano, A., Palacín, M., 2004. Membrane topology of system Xc− light subunit reveals a re-entrant loop with substrate restricted
AC
accessibility. J. Biol. Chem. 279, 31228-31236. He, X., Li, H., Zhou, Z., Zhao, Z., Li,W., 2012. Production of brown/yellow coat color in the SLC7A11 transgenic sheep via testicular injection of transgene. J. Genet. Genomics 39, 281-285. Hoekstra, H. E., 2006. Genetics, development and evolution of adaptive pigmentation in vertebrates. Heredity 97, 222-234.
ACCEPTED MANUSCRIPT Ito, S., Wakamatsu, K., 2008. Chemistry of mixed melanogenesis-pivotal roles of dopaquinone. Photochem. Photobiol. 84, 582-592. Ito, S., Wakamatsu, K., 2011. Human hair melanins: what we have learned and have not learned from mouse coat color pigmentation. Pigment Cell Melanoma Res. 24(1),
T
63-74.
IP
Jiang, Y., Zhang, S., Xu, J., Feng, J., Mahboob, S., Al-Ghanim, K. A., Sun, X., Xu, P.,
variation in common carp. PLoS One 9, e108200.
CR
2014. Comparative transcriptome analysis reveals the genetic basis of skin color
AN
Pigmentation doi: 10.1111/pcmr.12359.
US
Kottler, V. A., Künstner, A., Schartl, M., Pheomelanin in fish?. Melanin Chemistry &
Kim, J. Y., Kanai, Y., Chairoungdua, A., Cha, S. H., Matsuo, H., Kim, D. K., Inatomi, J.,
M
Sawa, H., Ida, Y., Endou, H., 2001. Human cystine/glutamate transporter: cDNA
1512(1), 335-344.
ED
cloning and upregulation by oxidative stress in glioma cells. Biochim Biophys Acta.
PT
Li, H. S., He, X., Zhou, Z. Y., Diao, S. H., Zhang, W. X., Liu, G., Diao, Z. Q., Gu, B.,
CE
2012. Expression levels of Slc7a11 in skin of kazakh sheep with different coat color. Hereditas 34, 1314-1319.
AC
Li, S., Wang, C., Yu, W., Zhao, S., Gong, Y., 2012. Identification of genes related to white and black plumage formation by RNA-Seq from white and black feather bulbs in ducks. PLoS One 7, e36592. Lo, M., Wang, Y. Z., Gout, P. W., 2008. The x(C)- cystine/glutamate antiporter: a potential target for therapy of cancer and other diseases. J Cell Physiol. 215, 593-602. Logan, D. W., Burn, S. F., Jackson, I. J., 2006. Regulation of pigmentation in zebrafish
ACCEPTED MANUSCRIPT melanophores. Pigment Cell Res. 19, 206-213. Luo, M. K., Wang, L. M., Zhu, W. B., Fu, J. J., Song, F. B., Fang, M., Dong, J. J., Dong, Z. J., et al. 2018. Identification and characterization of skin color microRNAs in Koi carp (Cyprinus carpio L.) by Illumina sequencing. BMC Genomics 19, 779.
T
Nishimura, E. K., Granter, S. R., Fisher, D. E., 2005. Mechanisms of hair graying:
IP
incomplete melanocyte stem cell maintenance in the niche. Science 307, 720-724.
CR
Pradeep, P. J., Srijaya, T. C., Jose, D., Papini, A., Hassan, A., Chatterji, A. K., 2011. Identification of diploid and triploid Red Tilapia by using erythrocyte indices.
US
Caryologia 64, 485-492.
AN
Pradeep, P. J., Srijaya, T. C., Hassan, A., Chatterji, A. K., Withyachumnarnkul, B., Jeffs,
Aquacult Int. 22: 1163-1174.
M
A., 2014. Optimal conditions for cold-shock induction of triploidy in red tilapia.
ED
Qiao, H., Xiong, Y., Zhang, W., Fu, H., Jiang, S., Sun, S., Bai, H., Jin, S., Gong, Y., 2015. Characterization, expression, and function analysis of gonad- inhibiting hormone in
PT
Oriental River prawn, Macrobrachium nipponense, and its induced expression by
CE
temperature. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 185, 1-8. Sato, H., Tamba, M., Kuriyama-Matsumura, K., Okuno, S., Bannai, S., 2000. Molecular
AC
cloning and expression of human xCT, the light chain of amino acid transport system XC-. Antioxid Redox Signal. 2, 665-671. Slominski, A., Wortsman, J.,
Plonka, P. M., Schallreuter, K. U., Paus, R., Tobin, D. J.,
2004. Hair follicle pigmentation. J. Invest. Dermatol. 124, 13-21. Tian, X., Meng, X. L., Wang, L. Y., Song, Y. F., Zhang, D. L., Ji, Y. K., Li, X. J., Dong, C. S., 2015. Molecular cloning, mRNA expression and tissue distribution analysis of
ACCEPTED MANUSCRIPT Slc7a11 gene in alpaca (Lama paco) skins associated with different coat colors. Gene 555, 88-94. Tobin, D. J., 2011. The cell biology of human hair follicle pigmentation. Pigment Cell Melanoma Res. 24, 75-88.
T
Wang, C., Wachholtz, M., Wang, J., Liao, X., Lu, G., 2014. Analysis of the skin
IP
transcriptome in two oujiang color varieties of common carp. PLoS One 9, e90074.
CR
Wang, L. M., Zhu, W. B., Dong, Z. J., Song, F. B., Dong, J. J., Fu, J. J., 2018a. Comparative microRNA-seq analysis depicts candidate miRNAs involved in skin
US
color differentiation in red tilapia. Int. J. Mol. Sci. 19, 1209.
AN
Wang, L. M., Zhu, W. B., Yang, J., Miao, L. H., Dong, J. J., Song, F. B., Dong, Z. J., 2018b. Effects of dietary cystine and tyrosine on melanogenesis pathways involved in
M
skin color differentiation of Malaysian red tilapia. Aquaculture 490, 149-155.
ED
Wang, L. M., Song, F. B., Zhu, W. B., Dong, J. J., Fu, J. J., Dong, Z. J., 2018c. Effects of temperature on body color of Malaysian red tilapia during overwintering period. J.
PT
Fish. China. 42 (1), 72-79.
CE
Zhu, W. B., Wang, L. M., Dong, Z. J., Chen, X. T., Song, F. B., Liu, N., Yang, H., Fu, J. J., 2016. Comparative transcriptome analysis identifies candidate genes related to skin
AC
color differentiation in red tilapia. Scientific Reports 6, 31347.
ACCEPTED MANUSCRIPT Table 1. Primer sequences. Primers
Sequences (5’-3’)
Slc7a11 RACE F1 (first)
CTTCCTGTCTCTGTACTCGGACCCTGTT
Joint primer
GCTGTCAACGATACGCTACGTAAC
Slc7a11 RACE F2 (nested) Joint primer
CACTGGCATCCCTGCGTACTACATCTTT
Slc7a11 Forward
GAAGAAGCGTGGTAGGCACT
Slc7a11 Reverse
TGCTTCAGGATTCCCTTCGG
β-actin Forward
GTACCACCATGTACCCTGGC
β-actin Reverse
TGAAGTTGTTGGGCGTTTGG
slc7a11 iF
TAATACGACTCACTATAGGGTGCAAAGACTG TTCCACTCG
slc7a11 iR
TAATACGACTCACTATAGGGCAGTGAGGGA AATGGCAAAT
cbs Forward
GGATTGATCCTGGGCATGGT
Primers for
cbs Reverse
TGCTGTGAGAGCCATCAGTC
RNA interference
tyr Forward
CCATGGACCGATTTGCCAAC
tyr Reverse
TATGCAAGGCGTTGTGCAAG
Primers for qRT-PCR
ED
M
AN
US
CR
IP
T
GCTACGTAACGGCATGACAGTG
PT CE AC
Primers for 3’ RACE PCR
ACCEPTED MANUSCRIPT Figure Legends Fig. 1. Schematic representation of Malaysian red tilapia cDNA sequences for slc7a11. The region from 1 to 1880bp of three transcript variant of slc7a11 is identical (broken line). The translation initiation codon (462bp) and the stop codon are shown as
T
black arrows and white arrows, respectively. AAA represents poly(A)+ .
IP
Fig. 2. Multiple alignment of xCT amino acid sequences in different species. Dark
CR
shaded areas indicate examples of species with the same amino acid sites; light shaded areas indicate that more than half of the listed species have the same amino acid sites.
US
Fig. 3. Neighbor-joining phylogenetic tree of the xCT protein using the deduced
Oreochromis
(JAR78910.1);
niloticus
Oncorhynchus
(XP_005466062.1);
mykiss
M
database:
AN
amino acids sequences of Malaysian red tilapia and other species from GenBank Fundulus
(XP_021439621.1);
heteroclitus
Salmo
salar-1
ED
(XP_014055067.1); Salmo salar-2 (XP_014055068.1); Danio rerio (XP_009289503.1); Ovis aries (NP_001239111.1); Homo
sapiens (NP_055146.1); Mus musculus
PT
(NP_036120.1); Oryctolagus cuniculus (ATO93739.1). The numbers in the phylogram
CE
nodes indicate the bootstrap value (%). The bar at the bottom indicates 5% amino acid divergence in the sequences.
AC
Fig. 4. Tissue-dependent slc7a11 mRNA expression in Malaysian red tilapia. Values with different letters mean significant differences (P<0.05). Fig. 5. Relative expression of slc7a11 mRNA in the ventral skin of three different color patterns of Malaysian red tilapia. WP: whole pink, PB: pink with scattered black spots, PR: pink with scattered red spots. Values with different letters mean significant differences (P<0.05).
ACCEPTED MANUSCRIPT Fig. 6. Immunofluorescence localization of SLC7A11 proteins in the dorsal skin (DS) and ventral skin (VS) of Malaysian red tilapia. Positive signals of anti-SLC7A11 immunolabeling are shown in green (C, D, E, F). The blue fluorescence is nucleus (N). A negative control for DS (A) and VS (B). C, cytoplasm; M, melanin.
T
Fig. 7. Relative expression of slc7a11 mRNA in the dorsal and ventral skin of
IP
Malaysian red tilapia after slc7a11-dsRNA injection. Values with different letters mean
CR
significant differences (P<0.05).
Fig. 8. Relative expression of cbs mRNA in the dorsal and ventral skin of Malaysian
US
red tilapia after slc7a11-dsRNA injection. Values with different letters mean significant
AN
differences (P<0.05).
Fig. 9. Relative expression of tyr mRNA in the dorsal and ventral skin of Malaysian
M
red tilapia after slc7a11-dsRNA injection. Values with different letters mean significant
ED
differences (P<0.05).
Suppleme ntary Fig. Three skin color types of Malaysian red tilapia. (WP: whole pink,
PT
PR: pink with scattered red spots and PB: pink with scattered black spots from left to right
AC
CE
respectively).
ACCEPTED MANUSCRIPT Research Highlights
Three
slc7a11 mRNA expressions were high in the ventral skin of PR fish.
SLC7A11 was concentrated mainly in the cytoplasm and nucleu of fish skin.
The cbs mRNA expression decreased and tyr expression increased after slc7a11
IP
T
full-length cDNA of slc7a11 were identified from Malaysia red tilapia.
RNAi.
CR
slc7a11 plays important role in skin color differentiation through the
CE
PT
ED
M
AN
US
melanogenesis pathways.
AC
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5
Figure 6
Figure 7
Figure 8
Figure 9
Figure 10