- Email: [email protected]
Cloning and functional analysis of PKZ (PKR-like) from grass carp (Ctenopharyngodon idellus)
Fish & Shellfish Immunology 31 (2011) 1173e1178
Contents lists available at SciVerse ScienceDirect
Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi
Cloning and functional analysis of PKZ (PKR-like) from grass carp (Ctenopharyngodon idellus) Peng-Jie Yang a, Chu-Xin Wu a, c, Wen Li a, Li-Hua Fan a, Gang Lin a, Cheng-Yu Hu a, b, * a
Department of Bioscience, College of Life Science and Food Engineering, Nanchang University, Nanchang 330031, China Institute of Life Science, Nanchang University, Nanchang 330031, China c Nanchang Teachers College, Nanchang 330029, China b
a r t i c l e i n f o
a b s t r a c t
Article history: Received 29 July 2011 Received in revised form 14 September 2011 Accepted 6 October 2011 Available online 14 October 2011
The new teleost fish PKZ (PKR-like) full-length cDNA (GU299765) had been cloned and identified from grass carp (Ctenopharyngodon idellus). The cDNA of grass carp PKZ (CiPKZ) has 2185 bp in length with a largest open reading frame (ORF) encoding 513aa. CiPKZ possesses a conserved C-terminal catalytic domain of eIF2a kinase family. Within its N-terminal there are two binding domain (Za) named Za1 (1e67aa) and Za2 (81e152aa). BLAST homologous search reveals that CiPKZ has a highlevel homology with other fish PKZs and PKRs. Like other fish PKZs and PKRs, CiPKZ is a ubiquitous tissue expression gene that had a very low level of constitutive expression but up-regulated in response to Poly I:C or hot stress (34 C). For the purpose of searching for the potential function of CiPKZ, we obtained CiPKZ polypeptide via Escherichia coli Rosetta prokaryotic expression and purified with Ni-NTA His-Bind Resin affinity chromatography. CiPKZ polypeptide was used for the test of phosphorylating eIF2a in vitro. The results demonstrated that CiPKZ could be activated by Z-DNA but not by Poly I:C, and with subsequent could phosphorylate eIF2a. Meanwhile, four pcDNA3.1/PKZ recombinant plasmids, including pcDNA3.1/PKZ-wet, pcDNA3.1/PKZ-wet-K198R, pcDNA3.1/PKZ-wet-C, pcDNA3.1/PKZ-wet-C-K198R had been constructed, respectively. Mouse Myeloma cells (Sp2/0) and Human Umbilical Vein Endothelial Cells (HUVEC) were transiently cotransfected with pcDNA3.1/PKZ recombinant plasmid and PGL-3-promoter plasmid. The results revealed that CiPKZ could greatly decrease luciferase level in these cells. Za and the K198 amino acid residue may play a key role in its function. Ó 2011 Published by Elsevier Ltd.
Keywords: Z-DNA PKR PKZ Z-DNA binding protein Teleost fish
1. Introduction In recent years, the protein kinase PKR-like (PKZ) genes had been reported successively in some teleost fish, such as CaPKZ in Goldfish (Carassius auratus) [1], DrPKZ in Zebrafish (Danio rerio) [2], SsPKZ in Atlantic salmon (Salmo salar) [3] and GrPKZ in Rare minnow (Gobiocypris rarus) [4]. Because the proteins encoded by these genes contain two Za domains in N-terminal and can bind Z-DNA, so they were designated as “PKZ” (protein kinase containing Z-DNA binding domain) [2]. It is interested that the C-terminus of PKZ also contains 11 conserved subdomains which are more closely to fish PKR (dsRNA-activated protein kinase) [5], so Rothenburg et al. (2008) considered PKZ as replication of fish PKR and stopped at tetrapod [6].
* Corresponding author. Department of Bioscience, College of Life Science and Food Engineering, Nanchang University, Nanchang 330031, China. Tel.: þ86 791 878 5566; fax: þ86 791 396 9530. E-mail address: [email protected] (C.-Y. Hu). 1050-4648/$ e see front matter Ó 2011 Published by Elsevier Ltd. doi:10.1016/j.fsi.2011.10.012
Hence, PKZ is a special protein kinase, not only is a kind of Z-DNA binding protein but also belongs to an eIF2a protein kinase family. The research on PKZ has a good beginning. The preliminary conclusion is that PKZ is extremely similar to PKR, so it is likely related to the anti-viral effects in cell [1,2]. For the past few years, there are some articles about the affinity between PKZ Za and Z-DNA [7,8]. Moreover, like the others member of eIF2a kinase, DrPKZ and SsPKZ could inhibit protein synthesis [2,3]. In spite of that, there are many unknown remained about the function of fish PKZ in cell. Grass carp (Ctenopharyngodon idella) is one of the major fresh fish in china. Because it is very sensitive to many stresses, so the PKZ from grass carp may be beneficial for us to comprehend the function of fish PKZ. In the paper, we had cloned and identified grass carp PKZ (CiPKZ, GU299765) by taking advantage of the homologous CaPKZ (AY293929). The cDNA of CiPKZ has 2185 bp in length with a largest open reading frame (ORF) encoding 513aa that has a high-level homology with other PKZ. CiPKZ possesses a conserved C-terminal catalytic domain of eIF2a kinase family. Within its N-terminal there are two Z-DNA binding domains (Za). CiPKZ is
1174
P.-J. Yang et al. / Fish & Shellfish Immunology 31 (2011) 1173e1178
Fig. 1. Construction of pcDNA3.1/PKZ recombinant plasmids. An asterisk denoted the position of K198R mutation.
a ubiquitous tissue expression gene that had a very low level of constitutive expression but was up-regulated in response to Poly I:C challenge or hot stress (34 C). CiPKZ could be activated by Z-DNA but not by Poly I:C, and with subsequent could phosphorylate eIF2a. After pcDNA3.1/PKZ recombinant plasmids and PGL-3-promoter were transiently cotransfected into Mouse Myeloma Sp2/0 cells and Human Umbilical Vein Endothelial Cells (HUVEC), respectively, the results revealed that CiPKZ could restrain the level of luciferase in these cells. Za and the K198 amino acid residue may play a key role in its function.
2. Materials and methods 2.1. Cloning and sequence analysis of grass carp PKZ cDNA Grass carp, came from Jiangxi Provincial Fisheries Research Institute, were injected 10 mg/g bodyweight Poly I:C (Pharmacia Biotech). 3d later, total RNA was prepared using SV Total RNA Isolation System (Premega). SMART cDNA was prepared using SuperScript II reverse polymerase (Invitrogen). The ORF of CiPKZ was cloned with primers ORF-F, ORF-R (designed in accordance with the CaPKZ cDNA sequence). PCR system: 10 LA Buffer (plus Mg2þ) 5 ml, SMART cDNA 2.0 ml, primers-F (10 mmol/L) 1 ml, primers-R (10 mmol/L) 1 ml, dNTP (10 mmol/L) 2 ml, Ex Taq (TAKARA) 2.5 U, add DDH2O to 50 ml. CiPKZ cDNA was cloned into pMD18-T vector (Takara) and transform DH5a. After CiPKZ had been sequenced, we forecasted polypeptide by ORF finder, SMART etc online-software. Based on the ORF of CiPKZ, the 30 end was
obtained by RACE-PCR with primer 30 -F (GGC CCT CCG GAA ACC TGG ACC CAT TA) and SMART-R. The full length cDNA of CiPKZ was got by PCR with primers GSP-F and GSP-R (Table 1). 2.2. Tissues expression of CiPKZ Grass carp were treated with 34 C 2 h and injected 0.5 mg/ml Poly I:C challenge 3d, respectively. The control group fish were injected with PBS. Liver (30 mg), kidney (20 mg), muscle (30 mg), spleen (15 mg), heart (60 mg), brain (60 mg) from every group were harvested. Total RNA was extracted by using the kit (Promega). cDNA was reverse transcribed using reverse polymerase M-MLV (Takara). cDNA was diluted to suitable concentration referenced to b-actin (b-actin-F and b-actin-R). According to RT-PCR assay, tissues expressed character of CiPKZ was analyzed with primers ND597-F60 and ND597-R70 (Table 1). 2.3. CiPKZ phosphorylated eIF2a CiPKZ ORF cDNA was inserted into expression vector pET32a (Novagen), and then recombinant vector pET32a/PKZ was transformed into E. coli Rosetta (DE3) (Clontech). DE3 was grown in LB at 37 C to an A600 of 0.6e0.8, then induced with 1 mM isopropyl thio-b-D-galactoside (IPTG) for 4 h. The cells were collected and suspended in binding buffer (20 mM TriseHCl, 50 mM NaCl, 5 mM imidazole, pH7.9), and broken by sonication and centrifuged for 30 min (4 C, 14 000 g). The supernatant was collected and purified with Ni-NTA His-Bind Resin affinity chromatography (QIAGEN)
Table 1 Primers used in this paper. Name
Sequence (50 to 30 )
Application
GSP-F GSP-R ORF-F ORF-R ND597-F60 ND597-R70 b-actin-F b-actin-R PKZ-K198R-F PKZ-K198R-R PKZ-C-K198R-F PKZ-C-K198R PKZ-C-F PKZ-C-R PKZ-WT-F PKZ-WT-R
AGACCGACCAGAGAAGTTGCAG CCAGCCAGCACAACATTTCTTC GAATTCATATGTCTGCCGAAACTCAAA GCTCGAGTCAAATCGTTTTCTGGCTTA CACCGTGAACAGACATTTG TCCCTTACGTGTTTCTCTTC CACTGTGCCCATCTACGAG CCATCTCCTGCTCGAAGTC TCTACGCTGTAAGGAAAGTCGTCTTAACTG AAGACGACTTTCCTTACAGCGTAGATCTTG TCTACGCTGTAAGGAAAGTCGTCTTAACTG AAGACGACTTTCCTTACAGCGTAGATCTTG CGGAATTCATGGGGTTGTCTCAAAGTTTTGATGT CGCTCGAGCTGGCTTAACAGATCCTCATCC CGGAATTCTGATGGCCGAAACTCAAATGGAGAG CGCTCGAGCTACTGGCTTAACAGATCCTCATCC
CiPKZ full length cDNA CiPKZ ORF CiPKZ expression
b-actin expression pcDNA3.1/PKZ-wt-K198R pcDNA3.1/PKZ-wt-C-K198R pcDNA3.1/PKZ-wt-C pcDNA3.1/PKZ-wt
P.-J. Yang et al. / Fish & Shellfish Immunology 31 (2011) 1173e1178
1175
Fig. 2. Nucleotide sequence and deduced amino acid sequence of CiPKZ cDNA. The start (ATG) codon was boxed and the stop (TAA) codon was indicated with an asterisk. The polyadenylation signal sequence (AATAAA) was in italic and bold, the motifs associated with mRNA instability (ATTTA) were underlined with rough words. Two Za domains were shaded. I-XI Serine/threonine kinase subdomains were indicated by the double underline.
1176
P.-J. Yang et al. / Fish & Shellfish Immunology 31 (2011) 1173e1178
according to the manufacturer’s instructions. Pooled fractions containing His-CiPKZ were dialyzed against 150 mM NaCl, 1 mM DTT, 0.5 mM EDTA, 20 mM HEPES, pH7.5, the protein concentrate in PEG20000 (Solarbio), and stored in 70 C until use. 3 mg His-CiPKZ was incubated with 2 mM HEPESKOH, pH7.2, 50 mM KCl, 10% glycerol, 1 mM dithiothreitol, 5 mM MgCl2, 2 mM, MnCl2, 50 mg/L BSA, 20 mg/ml chymotrypsin or 2 ml phosphatase inhibitors mixture (Applygen) if necessary, 500 mM ATP (Solarbio), 3 mg human eIF2a (Abcam), at 30 C for 30 min. The treated group was added Z-DNA or Poly I:C, alternatively. Z-DNA was generated by incubating Poly d(G:C) with 80 mM cobalt hexamine chloride (Sigma) in 10 mM HEPESKOH, pH7.4, 50 mM NaCl overnight at 25 C. Z-DNA preparations were used at 1/10 in kinase assay. Proteins were separated by SDS/PAGE, blotted onto a NC membrane, and probed with rabbit phosphospecific antibodies (Abcam) directed against phosphorylated Ser51 of eIF2a. 2.4. Cell transfections and luciferase activity analysis We had constructed a series of the recombinant plasmid of pcDNA3.1/PKZ-wt, pcDNA3.1/PKZ-wt-K198R, pcDNA3.1/PKZ-wt-C and pcDNA3.1/PKZ-wt-C-K198R, respectively (Fig. 1). Mouse myeloma Sp2/0 cells (Sino-German Joint Research Institute of Nanchang University) and Human Umbilical Vein Endothelial cells (HUVEC) (Institute for Advanced Study, Nanchang University) were cotransfected by using Lipofectamine 2000 (Invitrogen) with 200 ng of luciferase plasmid pGL3 promoter (presented by Dr. Gui JF of Institute of Hydrobiology, Chinese Academy of Sciences) and 200 ng of the respective pcDNA3.1/PKZ recombinant plasmids. For each plasmid, triplicate transfections were performed. After 24 h, cells were harvested, and luciferase activity was determined by using the luciferase detection kit (Promega). Luciferase activities of total cell lysates were measured on fluorescence spectrophotometer (Hitachi). 3. Results 3.1. Sequence of the CiPKZ cDNA As shown in Fig. 2, this CiPKZ cDNA is 2185 bp in length with 67 bp of 50 UTR and 577 bp of 30 UTR. The largest ORF encodes a 513 amino-acid protein. Its 30 UTR contains a polyadenylation signal AATAAA at nucleotide positions 2137e2142 upstream of the poly(A) tract, and four putative instability sequences (ATTTA), a motif possibly are involved in rapid message degradation. N-terminus of CiPKZ is the regulative domain containing two Z-DNA binding domain (Za) named Za1 (1e67aa), Za2 (81e152aa). C-terminus of CiPKZ is a catalytic domain containing 11 conserved subdomains (169e500aa). BLAST homologous search reveals that CiPKZ has a high-level homology with that of Goldfish (C. auratus) (99%), Zebrafish
Fig. 3. Tissue-specific expression of CiPKZ. M: DL2000. A: 34 C stress; B: Poly I:C challenge; C: control group.
(D. rerio) (77%), Atlantic salmon (Salmo sala) (98%), Rare minnow (G. rarus) (85%), respectively. 3.2. Tissue expression of CiPKZ CiPKZ was a ubiquitous expression gene. Comparing with constitutive expression, CiPKZ was up-regulated by Poly I:C or 34 C hot stress highly (Fig. 3). The expression level of CiPKZ in kidney and spleen was the highest, secondly in liver, muscle and brain, relatively lower expression level in heart. 3.3. CiPKZ phosphorylated eIF2a His-tag fusion protein of CiPKZ was harvested via E. coli Rosetta prokaryotic expression and Ni-NTA His-Bind Resin affinity chromatography (Fig. 4A). Because CiPKZ could not autophosphorylate in the presence of phosphatase (PP1ca), so CiPKZ was in a inactivated state and could not phosphorylate eIF2a (Fig. 4B, lane 1). On the contrary, when we added phosphatase inhibitors mixture (PIM) to protect the native autophosphorylation from E. coli, CiPKZ was able to phosphorylate eIF2a (Fig. 4B, lane 2). However, when the dephosphorylated CiPKZ was incubated with Z-DNA, eIF2a could be phosphorylated (Fig. 4B, lane3). When Z-DNA was displaced with Poly I:C, CiPKZ could not been activated, of course, the inactivated CiPKZ could not phosphorylate eIF2a (Fig. 4B, lane 4). So, autophosphorylation was necessary for the activation of CiPKZ, only the activated CiPKZ was able to phosphorylate its substrate, eIF2a and so on. Interestingly, CiPKZ could be re-activated in the presence of Z-DNA.
Fig. 4. CiPKZ phosphorylated eIF2a. A: fusion protein of CiPKZ. B: analysis of CiPKZ activity (phosphorylated eIF2a) by detection with eIF2a (phospho S51) antibody.
P.-J. Yang et al. / Fish & Shellfish Immunology 31 (2011) 1173e1178
Fig. 5. CiPKZ inhibited protein synthesis. The plasmid PGL3 promoter (200 ng) and a series of pcDNA3.1/PKZ recombinant plasmids (200 ng, respectively) were cotransfected into SP/20 cells and Human Umbilical Vein Endothelial Cells (HUVEC), respectively. Empty pcDNA3.1 plasmid was used as control. Cells were harvested 24 h after transfected and assayed for luciferase activity. Each bar was the average of three independent experiments.
3.4. CiPKZ inhibited protein synthesis in vivo In Fig. 5, CiPKZ was able to reduce the value of luciferase seriously both in SP/20 cells and HUVEC cells (PKZ-WT). K198 was the most key site for activating eIF2a kinase, because the mutated K198R of CiPKZ (PKZ-K198R) could not possess the kinase function. Similarly, the deletion of Za domain of CiPKZ (CiPKZ-WT-C) had less kinase effective than that of PKZ-WT, therefore Za domain was very important for CiPKZ. Unquestionably, PKZ-C-K198R (K198R mutated along with the deletion of Za domain) was an inactive kinase. 4. Discussion Fish is the aquatic vertebrate of poikilotherm. Comparing with the terrestrial vertebrate, they may have evolved a series of special molecular mechanisms, and it is possible that fish has some unique genes and proteins, such as PKZ, etc. PKZ is a special protein kinase. In addition, PKZ shares high homologous with fish PKR because of the 11 conserved subdomains in the C-terminus [5]. In the paper, we had cloned and identified grass carp PKZ (CiPKZ). BLAST homologous search reveals that CiPKZ possess a high-level homology with CaPKZ (99%), DrPKZ (77%), SsPKZ (98%), GrPKZ (85%), respectively. The research on the function of PKZ will be helpful for us to comprehend the innate immune system of fish. As the same as genes of host interferon system [9,10], PKZ had the character of wide tissue expression. The constitutive expression level of PKZ was very low, but was highly up-regulated induced by IFN, Poly I:C [1e3]. Not only CiPKZ had the same expression character as the homologues, but also in the paper, we found that CiPKZ could be up-regulated by 34 C heat shock (Fig. 3). This implies that besides the potential function of antivirus in cell, PKZ may be multfunction. Perhaps it could act as a kind of intracellular adaptor responded to various stress as revealed in mammalian PKR [11]. Autophosphorylation played a key role in the function of PKR and PKZ. Because the fusion PKZ and PKR protein extracted from E. coli had been activated in the absence of activators [3,12], so, in the paper the same bottles of E. coli was divided into two parts, one part was added phosphatase inhibitors mixture (PIM) to avoid PKZ from the phosphorylated state reversing to the dephosphorylated state when broke the E. coli and affinity chromatography. The other part did not add PIM but was added phosphatase in the fusion protein. We found CiPKZ mixed with PIM was able to phosphorylate eIF2a, but in the absent of the phosphatase inhibitors, there was no band of eIF2a phosphorylated (Fig. 4). This result was consistent
1177
with the character of PKR that autophosphorylate lead to its high activity [5,13,14]. Moreover, when Z-DNA or Poly I:C was incubated with the dephosphorylated PKZ, we found that Z-DNA but not Poly I:C could revive PKZ (Fig. 4). The result was similar to SsPKZ [3] and others Z-DNA binding protein, such as ADAR1 (Adenosine Deaminases Acting on RNA type I) [15,16], ZBP-1 (Z-DNA binding protein) [17], E3L [18]. Therefore, intracellular Z-DNA is needed for the activation of PKZ. There are many disputes about how Z-DNA to form and its function in vivo. In gene transcription, RNA polymerase ploughed out the double helix of DNA [19], 50 end of this DNA produced stress to form negative supercoiling which was able to touch off formation of locality Z-DNA [16]. But Li et al. (2009) discovered that in the 186 individual Z-DNA hotspot only two were located in promoter region, and the remainders were situated at highly repetitive sequence of centromere and others [20]. Because Z-DNA was a high energy form in the thermodynamics, so it was unstable and would release energy via converting into B-DNA which was stable form with low energy, or crack the DNA. Consequently, Z-DNA was often in the hotspot of chromosome breakage, this implies chromosome breakage, translocation and recombination may be closely related to instability of Z-DNA [21e23]. Za, existing in human ADAR1, ZBP-1, Poxvirus virulence factor E3L and fish PKZ, is able to combine and stabilize Z-DNA conformation specifically [24]. Za works as regulator, is located in the N-terminus regulation of these proteins. According to these proteins responsed to Z-DNA, Z-DNA may be related to disease attacked and start of innate immune system [25]. As the same as the others Z-DNA binding protein, Za from PKZ was able to bind to Z-DNA [8]. The test of cotransfection revealed that Za was essential for its function (Fig. 4). Some amino acid residues may be important to eIF2a kinase. In PKR, a point mutation of K296R abolished its enzymatic activity [26]. Similar to PKR, mutant K199R of DrPKZ led to the abolition of enzymatic activity [2]. Parallelism to the DrPKZ K199 is the CiPKZ K198. Not surprisingly, CiPKZ K198R was failure to inhibit luciferase synthesis (Fig. 5). PKZ is a new member of eIF2a protein kinase family. Like the others such as HRI (heme regulated initiation of translation) [27], PERK/PEK (endoplasmic reticulum resident kinase) [28], PKR and GCN2 (general control nonderepressible) [29], PKZ could respond to the stress in cell, and then phosphorylated eIF2a, finally inhibited protein synthesis and resulted in cell apoptosis. The existing information prompted that PKZ may play a key role in the “Stress / Z-DNA/Z-RNA / PKZ / eIF2a / apoptosis” pathway. Acknowledgements This work was supported by grants from the National Natural Science Foundation of China (30560116, 30860218). Special gratitude was due to Dr. Hua Wei and Mrs. Jiang Hu of the Sino-Germany Joint Research Institute of Nanchang University for cell culture and cotransfection techniques. References [1] Hu CY, Zhang YB, Huang GP, Zhang QY, Gui JF. Molecular cloning and characterisation of a fish PKR-like gene from cultured CAB cells induced by UV-inactivated virus. Fish Shellfish Immunol 2004;17:353e66. [2] Rothenburg S, Deigendesch N, Dittmar K, Koch-Nolte F, Haag F, Lowenhaupt K. A PKR-like eukaryotic initiation factor2a kinase from zebrafish contains Z-DNA binding domains instead of dsRNA binding domains. Proc Natl Acad Sci U S A 2005;102:1602e7. [3] Bergan V, Jagus R, Lauksund S, Kileng Ø, Robertsen B. The Atlantic salmon Z-DNA binding protein kinase phosphorylates translation initiation factor 2 alpha and constitutes a unique orthologue to the mammalian dsRNA activated protein kinase R. FEBS J 2008;275:184e97.
1178
P.-J. Yang et al. / Fish & Shellfish Immunology 31 (2011) 1173e1178
[4] Su JG, Zhu ZY, Wang YP. Molecular cloning, characterization and expression analysis of the PKZ gene in rare minnow Gobiocypris rarus. Fish Shellfish Immunol 2008;25:106e13. [5] Zhu R, Zhang YB, Zhang QY, Gui JF. Functional domains and the antiviral effect of the dsRNA-dependent protein kinase PKR from Paralichthys olivaceu. J Virol 2008;82:6889e901. [6] Rothenburg S, Deigendesch N, Dey M, Dever TE, Tazi L. Double-stranded RNA-activated protein kinase PKR of fishes and amphibians: varying the number of double-stranded RNA binding domains and lineage-specific duplications. BMC Biol 2008;6:12. [7] Kim D, Hwang HY, Kim YG, Kim KK. Crystallization and preliminary X-ray crystallographic studies of the Z-DNA-binding domain of a PKR-like kinase (PKZ) in complex with Z-DNA. Acta Crystallogr 2009;F65:267e70. [8] Wu CX, Wang SJ, Lin G, Hu CY. The Za domain of PKZ from Carassius auratus can bind to d(GC)n in negative supercoils. Fish Shellfish Immunol 2010;28:783e8. [9] Zhang YB, Jiang Jun, Chen YD, Zhu R, Shi Y, Zhang QY, et al. The innate immune response to grass carp haemorrhagic virus (GCHV) in cultured Carassius auratus blastulae (CAB) cells. Dev Comp Immunol 2007;31:232e43. [10] Sun F, Zhang YB, Liu TK, Gan L, Yu FF, Liu Y, et al. Characterization of fish IRF3 as an IFN-inducible protein reveals evolving regulation of IFN response in vertebrates. J Immunol 2010;185:7573e82. [11] Williams BRG. PKR; a sentinel kinase for cellular stress. Oncogene 1999;18: 6112e20. [12] Romano PR, Garcia-Barrio MT, Zhang X, Wang Q, Taylor DR, Zhang F, et al. Autophosphorylation in the activation loop is required for full kinase activity in vivo of human and yeast eukaryotic initiation factor 2 alpha kinases PKR and GCN2. Mol Cell Biol 1998;18:2282e97. [13] Taylor DR, Lee SB, Romano PR, Marshak DR, Hinnebusch AG, Esteban M, et al. Autophosphorylation sites participate in the activation of the doublestranded-RNA-activated protein kinase PKR. Mol Cell Biol 1996;16:6295e302. [14] Koromilas AE, Roy S, Barber GN, Katze MG, Sonenberg N. Malignant transformation by a mutant of the IFN-inducible dsRNA-dependent protein kinase. Science 1992;257:1685e9. [15] Brown II BA, Lowenhaupt K, Wilbert CM, Hanlon EB, Rich A. The zalpha domain of the editing enzyme dsRNA adenosine deaminase binds left-handed Z-RNA as well as Z-DNA. Proc Natl Acad Sci U S A 2000;97:13532e6. [16] Brown II BA, Rich A. The left-handed double helical nucleic acids. Acta Biochim Pol 2001;48:295e312.
[17] Pham HT, Park MY, Kim KK, Kim YG, Ahn JH. Intracellular localization of human ZBP1: differential regulation by the Z-DNA binding domain, Za, in splice variant. Biochem Biophys Res Commun 2006;348:145e52. [18] Kim YG, Lowenhaupt K, Oh DB, Kim KK, Rich A. Evidence that vaccinia virulence factor E3L binds to Z-DNA in vivo: implications for development of a therapy for poxvirus infection. Proc Natl Acad Sci U S A 2004;101:1514e8. [19] Liu LF, Wang JC. Supercoiling of the DNA template during transcription. Proc Natl Acad Sci U S A 1987;84:7024e7. [20] Li H, Xiao J, Li J, Lu L, Feng S, Droge P. Human genomic Z-DNA segments probed by the Za domain of ADAR1. Nucleic Acids Res 2009;37:2737e46. [21] Blaho JA, Wells RD. Left-handed Z-DNA and genetic recombination. Prog Nucleic Acid Res Mol Biol 1989;37:107e26. [22] Wahls WP, Wallace LJ, Moore PD. The Z-DNA motif d(TG)30 promotes reception of information during gene conversion events while stimulating homologous recombination in human cells in culture. Mol Cell Biol 1990;10: 785e93. [23] Wang G, Christensen LA, Vasquez KM. Z-DNA-forming sequences generate large-scale deletions in mammalian cells. Proc Natl Acad Sci U S A 2006;103: 2677e82. [24] Schade M. Structure and function of the Z-DNA binding protein domain Za. Ph.D thesis. [25] Rich A, Zhang S. Z-DNA: the long road to biological function. Nat Rev Genet 2003;4:566e72. [26] Katze MG, Wambach M, Wong ML, Garfinkel M, Meurs E, Chong K, et al. Functional expression and RNA binding analysis of the interferon-induced, double-stranded RNA-activated, 68,000-Mr protein kinase in a cell-free system. Mol Cell Biol 1991;11:5497e505. [27] Igarashi J, Sasaki T, Kobayashi N, Yoshioka S, Matsushita M, Shimizu T. Autophosphorylation of heme-regulated eukaryotic initiation factor 2a kinase and the role of the modification in catalysis. FEBS J 2011;278:918e28. [28] Zhang P, McGrath B, Li S, Frank A, Zambito F, Reinert J, et al. The PERK eukaryotic initiation factor 2a kinase is required for the development of the skeletal system, postnatal growth, and the function and viability of the pancreas. Mol Cell Biol 2002;22:3864e74. [29] Bunpo P, Dudley A, Cundiff JK, Cavener DR, Wek RC, Anthony TG. GCN2 protein kinase is required to activate amino acid deprivation responses in mice treated with the anti-cancer agent l-asparaginase. J Biol Chem 2009;284: 32742e9.
Contents lists available at SciVerse ScienceDirect
Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi
Cloning and functional analysis of PKZ (PKR-like) from grass carp (Ctenopharyngodon idellus) Peng-Jie Yang a, Chu-Xin Wu a, c, Wen Li a, Li-Hua Fan a, Gang Lin a, Cheng-Yu Hu a, b, * a
Department of Bioscience, College of Life Science and Food Engineering, Nanchang University, Nanchang 330031, China Institute of Life Science, Nanchang University, Nanchang 330031, China c Nanchang Teachers College, Nanchang 330029, China b
a r t i c l e i n f o
a b s t r a c t
Article history: Received 29 July 2011 Received in revised form 14 September 2011 Accepted 6 October 2011 Available online 14 October 2011
The new teleost fish PKZ (PKR-like) full-length cDNA (GU299765) had been cloned and identified from grass carp (Ctenopharyngodon idellus). The cDNA of grass carp PKZ (CiPKZ) has 2185 bp in length with a largest open reading frame (ORF) encoding 513aa. CiPKZ possesses a conserved C-terminal catalytic domain of eIF2a kinase family. Within its N-terminal there are two binding domain (Za) named Za1 (1e67aa) and Za2 (81e152aa). BLAST homologous search reveals that CiPKZ has a highlevel homology with other fish PKZs and PKRs. Like other fish PKZs and PKRs, CiPKZ is a ubiquitous tissue expression gene that had a very low level of constitutive expression but up-regulated in response to Poly I:C or hot stress (34 C). For the purpose of searching for the potential function of CiPKZ, we obtained CiPKZ polypeptide via Escherichia coli Rosetta prokaryotic expression and purified with Ni-NTA His-Bind Resin affinity chromatography. CiPKZ polypeptide was used for the test of phosphorylating eIF2a in vitro. The results demonstrated that CiPKZ could be activated by Z-DNA but not by Poly I:C, and with subsequent could phosphorylate eIF2a. Meanwhile, four pcDNA3.1/PKZ recombinant plasmids, including pcDNA3.1/PKZ-wet, pcDNA3.1/PKZ-wet-K198R, pcDNA3.1/PKZ-wet-C, pcDNA3.1/PKZ-wet-C-K198R had been constructed, respectively. Mouse Myeloma cells (Sp2/0) and Human Umbilical Vein Endothelial Cells (HUVEC) were transiently cotransfected with pcDNA3.1/PKZ recombinant plasmid and PGL-3-promoter plasmid. The results revealed that CiPKZ could greatly decrease luciferase level in these cells. Za and the K198 amino acid residue may play a key role in its function. Ó 2011 Published by Elsevier Ltd.
Keywords: Z-DNA PKR PKZ Z-DNA binding protein Teleost fish
1. Introduction In recent years, the protein kinase PKR-like (PKZ) genes had been reported successively in some teleost fish, such as CaPKZ in Goldfish (Carassius auratus) [1], DrPKZ in Zebrafish (Danio rerio) [2], SsPKZ in Atlantic salmon (Salmo salar) [3] and GrPKZ in Rare minnow (Gobiocypris rarus) [4]. Because the proteins encoded by these genes contain two Za domains in N-terminal and can bind Z-DNA, so they were designated as “PKZ” (protein kinase containing Z-DNA binding domain) [2]. It is interested that the C-terminus of PKZ also contains 11 conserved subdomains which are more closely to fish PKR (dsRNA-activated protein kinase) [5], so Rothenburg et al. (2008) considered PKZ as replication of fish PKR and stopped at tetrapod [6].
* Corresponding author. Department of Bioscience, College of Life Science and Food Engineering, Nanchang University, Nanchang 330031, China. Tel.: þ86 791 878 5566; fax: þ86 791 396 9530. E-mail address: [email protected] (C.-Y. Hu). 1050-4648/$ e see front matter Ó 2011 Published by Elsevier Ltd. doi:10.1016/j.fsi.2011.10.012
Hence, PKZ is a special protein kinase, not only is a kind of Z-DNA binding protein but also belongs to an eIF2a protein kinase family. The research on PKZ has a good beginning. The preliminary conclusion is that PKZ is extremely similar to PKR, so it is likely related to the anti-viral effects in cell [1,2]. For the past few years, there are some articles about the affinity between PKZ Za and Z-DNA [7,8]. Moreover, like the others member of eIF2a kinase, DrPKZ and SsPKZ could inhibit protein synthesis [2,3]. In spite of that, there are many unknown remained about the function of fish PKZ in cell. Grass carp (Ctenopharyngodon idella) is one of the major fresh fish in china. Because it is very sensitive to many stresses, so the PKZ from grass carp may be beneficial for us to comprehend the function of fish PKZ. In the paper, we had cloned and identified grass carp PKZ (CiPKZ, GU299765) by taking advantage of the homologous CaPKZ (AY293929). The cDNA of CiPKZ has 2185 bp in length with a largest open reading frame (ORF) encoding 513aa that has a high-level homology with other PKZ. CiPKZ possesses a conserved C-terminal catalytic domain of eIF2a kinase family. Within its N-terminal there are two Z-DNA binding domains (Za). CiPKZ is
1174
P.-J. Yang et al. / Fish & Shellfish Immunology 31 (2011) 1173e1178
Fig. 1. Construction of pcDNA3.1/PKZ recombinant plasmids. An asterisk denoted the position of K198R mutation.
a ubiquitous tissue expression gene that had a very low level of constitutive expression but was up-regulated in response to Poly I:C challenge or hot stress (34 C). CiPKZ could be activated by Z-DNA but not by Poly I:C, and with subsequent could phosphorylate eIF2a. After pcDNA3.1/PKZ recombinant plasmids and PGL-3-promoter were transiently cotransfected into Mouse Myeloma Sp2/0 cells and Human Umbilical Vein Endothelial Cells (HUVEC), respectively, the results revealed that CiPKZ could restrain the level of luciferase in these cells. Za and the K198 amino acid residue may play a key role in its function.
2. Materials and methods 2.1. Cloning and sequence analysis of grass carp PKZ cDNA Grass carp, came from Jiangxi Provincial Fisheries Research Institute, were injected 10 mg/g bodyweight Poly I:C (Pharmacia Biotech). 3d later, total RNA was prepared using SV Total RNA Isolation System (Premega). SMART cDNA was prepared using SuperScript II reverse polymerase (Invitrogen). The ORF of CiPKZ was cloned with primers ORF-F, ORF-R (designed in accordance with the CaPKZ cDNA sequence). PCR system: 10 LA Buffer (plus Mg2þ) 5 ml, SMART cDNA 2.0 ml, primers-F (10 mmol/L) 1 ml, primers-R (10 mmol/L) 1 ml, dNTP (10 mmol/L) 2 ml, Ex Taq (TAKARA) 2.5 U, add DDH2O to 50 ml. CiPKZ cDNA was cloned into pMD18-T vector (Takara) and transform DH5a. After CiPKZ had been sequenced, we forecasted polypeptide by ORF finder, SMART etc online-software. Based on the ORF of CiPKZ, the 30 end was
obtained by RACE-PCR with primer 30 -F (GGC CCT CCG GAA ACC TGG ACC CAT TA) and SMART-R. The full length cDNA of CiPKZ was got by PCR with primers GSP-F and GSP-R (Table 1). 2.2. Tissues expression of CiPKZ Grass carp were treated with 34 C 2 h and injected 0.5 mg/ml Poly I:C challenge 3d, respectively. The control group fish were injected with PBS. Liver (30 mg), kidney (20 mg), muscle (30 mg), spleen (15 mg), heart (60 mg), brain (60 mg) from every group were harvested. Total RNA was extracted by using the kit (Promega). cDNA was reverse transcribed using reverse polymerase M-MLV (Takara). cDNA was diluted to suitable concentration referenced to b-actin (b-actin-F and b-actin-R). According to RT-PCR assay, tissues expressed character of CiPKZ was analyzed with primers ND597-F60 and ND597-R70 (Table 1). 2.3. CiPKZ phosphorylated eIF2a CiPKZ ORF cDNA was inserted into expression vector pET32a (Novagen), and then recombinant vector pET32a/PKZ was transformed into E. coli Rosetta (DE3) (Clontech). DE3 was grown in LB at 37 C to an A600 of 0.6e0.8, then induced with 1 mM isopropyl thio-b-D-galactoside (IPTG) for 4 h. The cells were collected and suspended in binding buffer (20 mM TriseHCl, 50 mM NaCl, 5 mM imidazole, pH7.9), and broken by sonication and centrifuged for 30 min (4 C, 14 000 g). The supernatant was collected and purified with Ni-NTA His-Bind Resin affinity chromatography (QIAGEN)
Table 1 Primers used in this paper. Name
Sequence (50 to 30 )
Application
GSP-F GSP-R ORF-F ORF-R ND597-F60 ND597-R70 b-actin-F b-actin-R PKZ-K198R-F PKZ-K198R-R PKZ-C-K198R-F PKZ-C-K198R PKZ-C-F PKZ-C-R PKZ-WT-F PKZ-WT-R
AGACCGACCAGAGAAGTTGCAG CCAGCCAGCACAACATTTCTTC GAATTCATATGTCTGCCGAAACTCAAA GCTCGAGTCAAATCGTTTTCTGGCTTA CACCGTGAACAGACATTTG TCCCTTACGTGTTTCTCTTC CACTGTGCCCATCTACGAG CCATCTCCTGCTCGAAGTC TCTACGCTGTAAGGAAAGTCGTCTTAACTG AAGACGACTTTCCTTACAGCGTAGATCTTG TCTACGCTGTAAGGAAAGTCGTCTTAACTG AAGACGACTTTCCTTACAGCGTAGATCTTG CGGAATTCATGGGGTTGTCTCAAAGTTTTGATGT CGCTCGAGCTGGCTTAACAGATCCTCATCC CGGAATTCTGATGGCCGAAACTCAAATGGAGAG CGCTCGAGCTACTGGCTTAACAGATCCTCATCC
CiPKZ full length cDNA CiPKZ ORF CiPKZ expression
b-actin expression pcDNA3.1/PKZ-wt-K198R pcDNA3.1/PKZ-wt-C-K198R pcDNA3.1/PKZ-wt-C pcDNA3.1/PKZ-wt
P.-J. Yang et al. / Fish & Shellfish Immunology 31 (2011) 1173e1178
1175
Fig. 2. Nucleotide sequence and deduced amino acid sequence of CiPKZ cDNA. The start (ATG) codon was boxed and the stop (TAA) codon was indicated with an asterisk. The polyadenylation signal sequence (AATAAA) was in italic and bold, the motifs associated with mRNA instability (ATTTA) were underlined with rough words. Two Za domains were shaded. I-XI Serine/threonine kinase subdomains were indicated by the double underline.
1176
P.-J. Yang et al. / Fish & Shellfish Immunology 31 (2011) 1173e1178
according to the manufacturer’s instructions. Pooled fractions containing His-CiPKZ were dialyzed against 150 mM NaCl, 1 mM DTT, 0.5 mM EDTA, 20 mM HEPES, pH7.5, the protein concentrate in PEG20000 (Solarbio), and stored in 70 C until use. 3 mg His-CiPKZ was incubated with 2 mM HEPESKOH, pH7.2, 50 mM KCl, 10% glycerol, 1 mM dithiothreitol, 5 mM MgCl2, 2 mM, MnCl2, 50 mg/L BSA, 20 mg/ml chymotrypsin or 2 ml phosphatase inhibitors mixture (Applygen) if necessary, 500 mM ATP (Solarbio), 3 mg human eIF2a (Abcam), at 30 C for 30 min. The treated group was added Z-DNA or Poly I:C, alternatively. Z-DNA was generated by incubating Poly d(G:C) with 80 mM cobalt hexamine chloride (Sigma) in 10 mM HEPESKOH, pH7.4, 50 mM NaCl overnight at 25 C. Z-DNA preparations were used at 1/10 in kinase assay. Proteins were separated by SDS/PAGE, blotted onto a NC membrane, and probed with rabbit phosphospecific antibodies (Abcam) directed against phosphorylated Ser51 of eIF2a. 2.4. Cell transfections and luciferase activity analysis We had constructed a series of the recombinant plasmid of pcDNA3.1/PKZ-wt, pcDNA3.1/PKZ-wt-K198R, pcDNA3.1/PKZ-wt-C and pcDNA3.1/PKZ-wt-C-K198R, respectively (Fig. 1). Mouse myeloma Sp2/0 cells (Sino-German Joint Research Institute of Nanchang University) and Human Umbilical Vein Endothelial cells (HUVEC) (Institute for Advanced Study, Nanchang University) were cotransfected by using Lipofectamine 2000 (Invitrogen) with 200 ng of luciferase plasmid pGL3 promoter (presented by Dr. Gui JF of Institute of Hydrobiology, Chinese Academy of Sciences) and 200 ng of the respective pcDNA3.1/PKZ recombinant plasmids. For each plasmid, triplicate transfections were performed. After 24 h, cells were harvested, and luciferase activity was determined by using the luciferase detection kit (Promega). Luciferase activities of total cell lysates were measured on fluorescence spectrophotometer (Hitachi). 3. Results 3.1. Sequence of the CiPKZ cDNA As shown in Fig. 2, this CiPKZ cDNA is 2185 bp in length with 67 bp of 50 UTR and 577 bp of 30 UTR. The largest ORF encodes a 513 amino-acid protein. Its 30 UTR contains a polyadenylation signal AATAAA at nucleotide positions 2137e2142 upstream of the poly(A) tract, and four putative instability sequences (ATTTA), a motif possibly are involved in rapid message degradation. N-terminus of CiPKZ is the regulative domain containing two Z-DNA binding domain (Za) named Za1 (1e67aa), Za2 (81e152aa). C-terminus of CiPKZ is a catalytic domain containing 11 conserved subdomains (169e500aa). BLAST homologous search reveals that CiPKZ has a high-level homology with that of Goldfish (C. auratus) (99%), Zebrafish
Fig. 3. Tissue-specific expression of CiPKZ. M: DL2000. A: 34 C stress; B: Poly I:C challenge; C: control group.
(D. rerio) (77%), Atlantic salmon (Salmo sala) (98%), Rare minnow (G. rarus) (85%), respectively. 3.2. Tissue expression of CiPKZ CiPKZ was a ubiquitous expression gene. Comparing with constitutive expression, CiPKZ was up-regulated by Poly I:C or 34 C hot stress highly (Fig. 3). The expression level of CiPKZ in kidney and spleen was the highest, secondly in liver, muscle and brain, relatively lower expression level in heart. 3.3. CiPKZ phosphorylated eIF2a His-tag fusion protein of CiPKZ was harvested via E. coli Rosetta prokaryotic expression and Ni-NTA His-Bind Resin affinity chromatography (Fig. 4A). Because CiPKZ could not autophosphorylate in the presence of phosphatase (PP1ca), so CiPKZ was in a inactivated state and could not phosphorylate eIF2a (Fig. 4B, lane 1). On the contrary, when we added phosphatase inhibitors mixture (PIM) to protect the native autophosphorylation from E. coli, CiPKZ was able to phosphorylate eIF2a (Fig. 4B, lane 2). However, when the dephosphorylated CiPKZ was incubated with Z-DNA, eIF2a could be phosphorylated (Fig. 4B, lane3). When Z-DNA was displaced with Poly I:C, CiPKZ could not been activated, of course, the inactivated CiPKZ could not phosphorylate eIF2a (Fig. 4B, lane 4). So, autophosphorylation was necessary for the activation of CiPKZ, only the activated CiPKZ was able to phosphorylate its substrate, eIF2a and so on. Interestingly, CiPKZ could be re-activated in the presence of Z-DNA.
Fig. 4. CiPKZ phosphorylated eIF2a. A: fusion protein of CiPKZ. B: analysis of CiPKZ activity (phosphorylated eIF2a) by detection with eIF2a (phospho S51) antibody.
P.-J. Yang et al. / Fish & Shellfish Immunology 31 (2011) 1173e1178
Fig. 5. CiPKZ inhibited protein synthesis. The plasmid PGL3 promoter (200 ng) and a series of pcDNA3.1/PKZ recombinant plasmids (200 ng, respectively) were cotransfected into SP/20 cells and Human Umbilical Vein Endothelial Cells (HUVEC), respectively. Empty pcDNA3.1 plasmid was used as control. Cells were harvested 24 h after transfected and assayed for luciferase activity. Each bar was the average of three independent experiments.
3.4. CiPKZ inhibited protein synthesis in vivo In Fig. 5, CiPKZ was able to reduce the value of luciferase seriously both in SP/20 cells and HUVEC cells (PKZ-WT). K198 was the most key site for activating eIF2a kinase, because the mutated K198R of CiPKZ (PKZ-K198R) could not possess the kinase function. Similarly, the deletion of Za domain of CiPKZ (CiPKZ-WT-C) had less kinase effective than that of PKZ-WT, therefore Za domain was very important for CiPKZ. Unquestionably, PKZ-C-K198R (K198R mutated along with the deletion of Za domain) was an inactive kinase. 4. Discussion Fish is the aquatic vertebrate of poikilotherm. Comparing with the terrestrial vertebrate, they may have evolved a series of special molecular mechanisms, and it is possible that fish has some unique genes and proteins, such as PKZ, etc. PKZ is a special protein kinase. In addition, PKZ shares high homologous with fish PKR because of the 11 conserved subdomains in the C-terminus [5]. In the paper, we had cloned and identified grass carp PKZ (CiPKZ). BLAST homologous search reveals that CiPKZ possess a high-level homology with CaPKZ (99%), DrPKZ (77%), SsPKZ (98%), GrPKZ (85%), respectively. The research on the function of PKZ will be helpful for us to comprehend the innate immune system of fish. As the same as genes of host interferon system [9,10], PKZ had the character of wide tissue expression. The constitutive expression level of PKZ was very low, but was highly up-regulated induced by IFN, Poly I:C [1e3]. Not only CiPKZ had the same expression character as the homologues, but also in the paper, we found that CiPKZ could be up-regulated by 34 C heat shock (Fig. 3). This implies that besides the potential function of antivirus in cell, PKZ may be multfunction. Perhaps it could act as a kind of intracellular adaptor responded to various stress as revealed in mammalian PKR [11]. Autophosphorylation played a key role in the function of PKR and PKZ. Because the fusion PKZ and PKR protein extracted from E. coli had been activated in the absence of activators [3,12], so, in the paper the same bottles of E. coli was divided into two parts, one part was added phosphatase inhibitors mixture (PIM) to avoid PKZ from the phosphorylated state reversing to the dephosphorylated state when broke the E. coli and affinity chromatography. The other part did not add PIM but was added phosphatase in the fusion protein. We found CiPKZ mixed with PIM was able to phosphorylate eIF2a, but in the absent of the phosphatase inhibitors, there was no band of eIF2a phosphorylated (Fig. 4). This result was consistent
1177
with the character of PKR that autophosphorylate lead to its high activity [5,13,14]. Moreover, when Z-DNA or Poly I:C was incubated with the dephosphorylated PKZ, we found that Z-DNA but not Poly I:C could revive PKZ (Fig. 4). The result was similar to SsPKZ [3] and others Z-DNA binding protein, such as ADAR1 (Adenosine Deaminases Acting on RNA type I) [15,16], ZBP-1 (Z-DNA binding protein) [17], E3L [18]. Therefore, intracellular Z-DNA is needed for the activation of PKZ. There are many disputes about how Z-DNA to form and its function in vivo. In gene transcription, RNA polymerase ploughed out the double helix of DNA [19], 50 end of this DNA produced stress to form negative supercoiling which was able to touch off formation of locality Z-DNA [16]. But Li et al. (2009) discovered that in the 186 individual Z-DNA hotspot only two were located in promoter region, and the remainders were situated at highly repetitive sequence of centromere and others [20]. Because Z-DNA was a high energy form in the thermodynamics, so it was unstable and would release energy via converting into B-DNA which was stable form with low energy, or crack the DNA. Consequently, Z-DNA was often in the hotspot of chromosome breakage, this implies chromosome breakage, translocation and recombination may be closely related to instability of Z-DNA [21e23]. Za, existing in human ADAR1, ZBP-1, Poxvirus virulence factor E3L and fish PKZ, is able to combine and stabilize Z-DNA conformation specifically [24]. Za works as regulator, is located in the N-terminus regulation of these proteins. According to these proteins responsed to Z-DNA, Z-DNA may be related to disease attacked and start of innate immune system [25]. As the same as the others Z-DNA binding protein, Za from PKZ was able to bind to Z-DNA [8]. The test of cotransfection revealed that Za was essential for its function (Fig. 4). Some amino acid residues may be important to eIF2a kinase. In PKR, a point mutation of K296R abolished its enzymatic activity [26]. Similar to PKR, mutant K199R of DrPKZ led to the abolition of enzymatic activity [2]. Parallelism to the DrPKZ K199 is the CiPKZ K198. Not surprisingly, CiPKZ K198R was failure to inhibit luciferase synthesis (Fig. 5). PKZ is a new member of eIF2a protein kinase family. Like the others such as HRI (heme regulated initiation of translation) [27], PERK/PEK (endoplasmic reticulum resident kinase) [28], PKR and GCN2 (general control nonderepressible) [29], PKZ could respond to the stress in cell, and then phosphorylated eIF2a, finally inhibited protein synthesis and resulted in cell apoptosis. The existing information prompted that PKZ may play a key role in the “Stress / Z-DNA/Z-RNA / PKZ / eIF2a / apoptosis” pathway. Acknowledgements This work was supported by grants from the National Natural Science Foundation of China (30560116, 30860218). Special gratitude was due to Dr. Hua Wei and Mrs. Jiang Hu of the Sino-Germany Joint Research Institute of Nanchang University for cell culture and cotransfection techniques. References [1] Hu CY, Zhang YB, Huang GP, Zhang QY, Gui JF. Molecular cloning and characterisation of a fish PKR-like gene from cultured CAB cells induced by UV-inactivated virus. Fish Shellfish Immunol 2004;17:353e66. [2] Rothenburg S, Deigendesch N, Dittmar K, Koch-Nolte F, Haag F, Lowenhaupt K. A PKR-like eukaryotic initiation factor2a kinase from zebrafish contains Z-DNA binding domains instead of dsRNA binding domains. Proc Natl Acad Sci U S A 2005;102:1602e7. [3] Bergan V, Jagus R, Lauksund S, Kileng Ø, Robertsen B. The Atlantic salmon Z-DNA binding protein kinase phosphorylates translation initiation factor 2 alpha and constitutes a unique orthologue to the mammalian dsRNA activated protein kinase R. FEBS J 2008;275:184e97.
1178
P.-J. Yang et al. / Fish & Shellfish Immunology 31 (2011) 1173e1178
[4] Su JG, Zhu ZY, Wang YP. Molecular cloning, characterization and expression analysis of the PKZ gene in rare minnow Gobiocypris rarus. Fish Shellfish Immunol 2008;25:106e13. [5] Zhu R, Zhang YB, Zhang QY, Gui JF. Functional domains and the antiviral effect of the dsRNA-dependent protein kinase PKR from Paralichthys olivaceu. J Virol 2008;82:6889e901. [6] Rothenburg S, Deigendesch N, Dey M, Dever TE, Tazi L. Double-stranded RNA-activated protein kinase PKR of fishes and amphibians: varying the number of double-stranded RNA binding domains and lineage-specific duplications. BMC Biol 2008;6:12. [7] Kim D, Hwang HY, Kim YG, Kim KK. Crystallization and preliminary X-ray crystallographic studies of the Z-DNA-binding domain of a PKR-like kinase (PKZ) in complex with Z-DNA. Acta Crystallogr 2009;F65:267e70. [8] Wu CX, Wang SJ, Lin G, Hu CY. The Za domain of PKZ from Carassius auratus can bind to d(GC)n in negative supercoils. Fish Shellfish Immunol 2010;28:783e8. [9] Zhang YB, Jiang Jun, Chen YD, Zhu R, Shi Y, Zhang QY, et al. The innate immune response to grass carp haemorrhagic virus (GCHV) in cultured Carassius auratus blastulae (CAB) cells. Dev Comp Immunol 2007;31:232e43. [10] Sun F, Zhang YB, Liu TK, Gan L, Yu FF, Liu Y, et al. Characterization of fish IRF3 as an IFN-inducible protein reveals evolving regulation of IFN response in vertebrates. J Immunol 2010;185:7573e82. [11] Williams BRG. PKR; a sentinel kinase for cellular stress. Oncogene 1999;18: 6112e20. [12] Romano PR, Garcia-Barrio MT, Zhang X, Wang Q, Taylor DR, Zhang F, et al. Autophosphorylation in the activation loop is required for full kinase activity in vivo of human and yeast eukaryotic initiation factor 2 alpha kinases PKR and GCN2. Mol Cell Biol 1998;18:2282e97. [13] Taylor DR, Lee SB, Romano PR, Marshak DR, Hinnebusch AG, Esteban M, et al. Autophosphorylation sites participate in the activation of the doublestranded-RNA-activated protein kinase PKR. Mol Cell Biol 1996;16:6295e302. [14] Koromilas AE, Roy S, Barber GN, Katze MG, Sonenberg N. Malignant transformation by a mutant of the IFN-inducible dsRNA-dependent protein kinase. Science 1992;257:1685e9. [15] Brown II BA, Lowenhaupt K, Wilbert CM, Hanlon EB, Rich A. The zalpha domain of the editing enzyme dsRNA adenosine deaminase binds left-handed Z-RNA as well as Z-DNA. Proc Natl Acad Sci U S A 2000;97:13532e6. [16] Brown II BA, Rich A. The left-handed double helical nucleic acids. Acta Biochim Pol 2001;48:295e312.
[17] Pham HT, Park MY, Kim KK, Kim YG, Ahn JH. Intracellular localization of human ZBP1: differential regulation by the Z-DNA binding domain, Za, in splice variant. Biochem Biophys Res Commun 2006;348:145e52. [18] Kim YG, Lowenhaupt K, Oh DB, Kim KK, Rich A. Evidence that vaccinia virulence factor E3L binds to Z-DNA in vivo: implications for development of a therapy for poxvirus infection. Proc Natl Acad Sci U S A 2004;101:1514e8. [19] Liu LF, Wang JC. Supercoiling of the DNA template during transcription. Proc Natl Acad Sci U S A 1987;84:7024e7. [20] Li H, Xiao J, Li J, Lu L, Feng S, Droge P. Human genomic Z-DNA segments probed by the Za domain of ADAR1. Nucleic Acids Res 2009;37:2737e46. [21] Blaho JA, Wells RD. Left-handed Z-DNA and genetic recombination. Prog Nucleic Acid Res Mol Biol 1989;37:107e26. [22] Wahls WP, Wallace LJ, Moore PD. The Z-DNA motif d(TG)30 promotes reception of information during gene conversion events while stimulating homologous recombination in human cells in culture. Mol Cell Biol 1990;10: 785e93. [23] Wang G, Christensen LA, Vasquez KM. Z-DNA-forming sequences generate large-scale deletions in mammalian cells. Proc Natl Acad Sci U S A 2006;103: 2677e82. [24] Schade M. Structure and function of the Z-DNA binding protein domain Za. Ph.D thesis. [25] Rich A, Zhang S. Z-DNA: the long road to biological function. Nat Rev Genet 2003;4:566e72. [26] Katze MG, Wambach M, Wong ML, Garfinkel M, Meurs E, Chong K, et al. Functional expression and RNA binding analysis of the interferon-induced, double-stranded RNA-activated, 68,000-Mr protein kinase in a cell-free system. Mol Cell Biol 1991;11:5497e505. [27] Igarashi J, Sasaki T, Kobayashi N, Yoshioka S, Matsushita M, Shimizu T. Autophosphorylation of heme-regulated eukaryotic initiation factor 2a kinase and the role of the modification in catalysis. FEBS J 2011;278:918e28. [28] Zhang P, McGrath B, Li S, Frank A, Zambito F, Reinert J, et al. The PERK eukaryotic initiation factor 2a kinase is required for the development of the skeletal system, postnatal growth, and the function and viability of the pancreas. Mol Cell Biol 2002;22:3864e74. [29] Bunpo P, Dudley A, Cundiff JK, Cavener DR, Wek RC, Anthony TG. GCN2 protein kinase is required to activate amino acid deprivation responses in mice treated with the anti-cancer agent l-asparaginase. J Biol Chem 2009;284: 32742e9.