Cu accumulation, detoxification and tolerance in the red swamp crayfish Procambarus clarkii

Ecotoxicology and Environmental Safety 175 (2019) 201–207

Contents lists available at ScienceDirect

Ecotoxicology and Environmental Safety journal homepage: www.elsevier.com/locate/ecoenv

Cu accumulation, detoxification and tolerance in the red swamp crayfish Procambarus clarkii ⁎

Dan Zhaoa, Xiaona Zhanga, , Dasheng Liub,c, Shaoguo Rua,

T

⁎

a

College of Marine Life Sciences, Ocean University of China, 5 Yushan Road, Qingdao 266003, Shandong province, China Ecological Society of Shandong, Zhijinshi Jie 12, Jinan 250012, China c Shandong Institute of Environmental Science, Lishan Lu 50, Jinan 250013, China b

A R T I C LE I N FO

A B S T R A C T

Keywords: Copper Procambarus clarkii Antioxidative system Cu homeostasis Cu detoxification

Copper is an essential metal but potentially toxic to aquatic animals at high levels. The present study investigated physiologically adaptive responses to waterborne Cu2+ exposure (0, 0.03, 0.30, 3.00 mg/L) in a representative species of crustaceans, the red swamp crayfish (Procambarus clarkii) for 7 d, followed by a 7-d depuration period. The tissue-specific distribution of Cu showed that crayfish hepatopancreas was the primary accumulating site among internal tissues. During Cu2+ exposure, crayfish repressed the expression level of Cu homeostasis genes (Ctr1, Atox1, copper-transporting ATPase 2, MTF-1/2, and MT) in hepatopancreas to inhibit intracellular Cu transporting. Cu2+-exposed crayfish increased activities of GPx and GST, GSH contents, and mRNA expression of antioxidative enzyme genes (Cu/Zn-sod, cat, gpx, gst) to cope with the Cu2+-induced oxidative stress which accompanied by an increased MDA content. Additionally, after a 7-d depuration, crayfish effectively eliminated excess Cu from hepatopancreas by up-regulating expression level of Cu homeostasis genes, and recovered from oxidative damage by enhancing antioxidative enzyme gene expression (Cu/Zn-sod, cat, gpx, gst) and consuming more GSH, which thereby caused a return of the MDA level to the control value. Overall, our study provided new insights into the regulatory mechanisms of cellular Cu homeostasis system and antioxidative system, contributing to Cu detoxification and tolerance ability exhibited by crayfish under Cu2+ stress and after withdrawal of Cu2+ stress.

1. Introduction

exposed to elevated concentrations of Cu are expected to have developed adaptive mechanism which might be involved in the detoxification and thus tolerance to the discontinuous Cu contamination. In biological systems, Cu is an essential trace element of several important enzymes, relying on its ability to undergo redox transitions between the Cu2+ and Cu+ state (Kehrer, 2000; Thomas et al., 2009). Paradoxically, this property of Cu also makes it potentially toxic when Cu levels exceed the physiological needs (Bremner, 1998; Kadiiska et al., 1993). To cope with the dualism of Cu essential functions versus its potential toxicity, it is not surprising that eukaryotic organisms from yeast to humans have evolved the cellular Cu homeostasis system, which tightly and effectively regulates the level of this metal by regulating the process of influx, distribution, sequestration, and efflux of Cu (Balamurugan and Schaffner, 2006; Culotta et al., 1999; Mercer and

Copper (Cu) is one of the most commonly used metals and its progressive increase in aquatic environments is of great concern. Cu occurs naturally in unpolluted freshwater systems in levels ranging from 0.0002 to 0.03 mg/L, whereas much higher concentrations were detected in areas polluted by anthropogenic sources (e.g., Cu mining drainage, Cu-based pesticides, antifouling paints) with ranges from 0.1 to 200 mg/L (Andrade et al., 2004; Smolders et al., 2003; Uren Webster et al., 2013; Wang et al., 2011; Wong et al., 2007). In episodic or pulse pollution, some estuarine and coastal species including crustaceans and fish could not only tolerate the exposure of large amounts of Cu, but also recover when the Cu level returns to the background level (Jiang et al., 2016; Naqvi et al., 1998). Therefore, crustaceans that have been

Abbreviation: Ctr 1, high-affinity copper transporter 1; Atox1, antioxidant 1 Cu chaperone; CCS, Cu chaperone for superoxide dismutase; Cu/Zn-SOD, Cu/Zn superoxide dismutase; MT, metallothionein; CHGs, Cu homeostasis genes; ROS, reactive oxygen species; O2-, superoxide anion; H2O2, hydrogen peroxide; HO, hydroxyl radical; SOD, superoxide dismutase; CAT, catalase; GST, glutathione-S-transferase; GPx, glutathione peroxidase; GSH, reduced glutathione; T-SOD, total superoxide dismutase; MDA, malondialdehyde; MTF-1/2, metal-response element-binding transcription factor 1/2; SD, standard deviations; ANOVA, one-way analysis of variance ⁎ Corresponding authors. E-mail addresses: [email protected] (X. Zhang), [email protected] (S. Ru). https://doi.org/10.1016/j.ecoenv.2019.03.031 Received 20 November 2018; Received in revised form 3 March 2019; Accepted 7 March 2019 0147-6513/ © 2019 Elsevier Inc. All rights reserved.

Ecotoxicology and Environmental Safety 175 (2019) 201–207

Dan Zhao, et al.

(gills, hepatopancreas, muscle, digestive gut, and antennal gland) after exposure and Cu elimination in hepatopancreas after depuration were investigated. Then, the response of oxidative stress markers including the activities of total superoxide dismutase (T-SOD), Cu/Zn-SOD, CAT, GST, GPx, and the contents of malondialdehyde (MDA) and GSH in hepatopancreas were measured after both exposure and depuration. Further, transcriptional levels of antioxidative enzyme genes (Cu/Znsod, cat, gpx, gst) and CHGs (Ctr1, Atox1, copper-transporting ATPase 2, metal-response element-binding transcription factor 1/2 (MTF-1/2), and MT) in hepatopancreas were measured using real-time PCR. Our study, for the first time, revealed the adaptive strategies in crayfish for coping with Cu stress, and also identified the potential regulatory mechanisms against Cu toxicity in this species after Cu exposure and depuration.

Llanos, 2003; O’Halloran and Culotta, 2000; Puig and Thiele, 2002). Cu can enter cells through Cu importers (high-affinity copper transporter 1, Ctr 1), after which it is bound with several Cu chaperones (antioxidant 1 Cu chaperone, Atox1; Cu chaperone for superoxide dismutase, CCS; cytochrome c oxidase Cu chaperone) responsible for delivering Cu into distinct intracellular compartments (Cu/Zn superoxide dismutase, Cu/ Zn-SOD; cytochrome c oxidase; Cu-transporting ATPase), or complexed by Cu scavengers (metallothionein, MT), finally excreted from cell via Cu exporters (Cu-transporting ATPase) (Gaetke et al., 2014; Prohaska, 2008; Puig and Thiele, 2002). It was found that these intracellular proteins are mainly regulated by the transcriptional activation or repression of Cu homeostasis genes (CHGs) (Bertinato and L’Abbé, 2004; Lane et al., 2004; Petris et al., 2003). Evidence has shown that tolerant species exhibit an enhanced homeostatic mechanism to avoid the buildup of toxic concentrations within the cell and thus prevent the onset of stress or resist the stress (Balamurugan and Schaffner, 2006; Mercer and Llanos, 2003; O’Halloran and Culotta, 2000; Puig and Thiele, 2002); however, few studies have focused on the CHGs regulatory mechanism underlying Cu detoxification/tolerance in a specific crustacean species after Cu exposure and depuration. When excessive Cu overwhelms the Cu homeostasis maintaining in body, it could cause oxidative stress through inducing the generation of reactive oxygen species (ROS), such as superoxide anion (O2-), hydrogen peroxide (H2O2), and hydroxyl radical (HO·) (Bremner, 1998; Gaetke and Chow, 2003; Kadiiska et al., 1993; Kehrer, 2000; Thomas et al., 2009). To scavenge excessive ROS and maintain the balance of redox status, organisms including crustaceans have evolved the cellular antioxidative defense system, including antioxidative enzymes (superoxide dismutase, SOD; catalase, CAT; glutathione-S-transferase, GST; glutathione peroxidase, GPx) and non-enzyme component (reduced glutathione, GSH) (Valavanidis et al., 2006). These antioxidants can act as scavengers to neutralize ROS by directly reacting with them or are intended to inhibit the reactions of membranes lipid peroxidation (Regoli and Giuliani, 2014). Moreover, the neutralizing activity is achieved through induction of both gene expression and catalytic activity of antioxidative enzymes in aquatic organisms exposed to metal pollutants (Lushchak, 2011). The activation of antioxidative system can minimize the Cu-caused oxidative damage, suggesting a correlation between Cu tolerance and the antioxidant defense capacity (Jiang et al., 2011; Murgia et al., 2004; Shalata and Neumann, 2001). Thus, the knowledge of how organisms cope with Cu-induced oxidative stress is of considerable importance in understanding the mechanism of Cu tolerance. The red swamp crayfish (Procambarus clarkii), as a representative species of crustaceans, inhabits a wide range of aquatic environments, including those with heavy metals pollution (Suárez-Serrano et al., 2010). It is known for its hyperaccumulation potential and tolerance to various heavy metals (Bellante et al., 2015). In aquaculture practices, Cu is usually used in the form of CuSO4 as algaecide, antifungal, and antiparasitic agents, which may also cause Cu accumulation in crustaceans body (Chen and Lin, 2001). Over the past decades, many studies have focused on Cu accumulation as well as the ecotoxicological effect of Cu on crayfish (Bini and Chelazzi, 2006; Naqvi et al., 1998; Wei and Yang, 2015a, 2015b, 2016). These studies showed crayfish activated antioxidative system to cope with Cu stress; however, the knowledge of cellular antioxidative system in response to Cu stress in crayfish is still scarcely and scattered at the molecular level, due to a lack of genome resources for this species. Additionally, the greater toxicity observed in these studies was attributed to either a longer duration for Cu exposure or the lack of an opportunity to recover in Cu-free water. Therefore, in the present work, crayfish were exposed to Cu2+ (0.03, 0.30, and 3.00 mg/L) for a 7-d exposure period, followed by a 7-d depuration phase in clean water to assess the adaptive strategies of this species under Cu stress and after withdrawal of Cu stress. Such patterns of exposure are more realistic ways to mimic pulse or episodic Cu pollution under laboratory conditions. Cu accumulation in various tissues

2. Materials and methods 2.1. Animals All crayfish (P. clarkii) used in the test were intermoult adult males with similar age (~ 5 months), weight (16.58 ± 2.85 g), and length (7.21 ± 0.39 cm), and were obtained from a crayfish farm in Jiangsu, China. Crayfish were acclimatized in glass aquariums (50 cm × 35 cm × 40 cm) containing 10 L dechlorinated tap water (21 ± 2 °C) with continuous aeration, under a photoperiod of 12/12 (L:D) for 2 weeks. Crayfish were fed with commercially prepared crayfish pellets (Puyang Company, Hubei, China) three times a week.

2.2. Cu2+ exposure The gradients of Cu concentration were environmentally realistic, for example, the mean concentration in the River Hayle in Cornwall of Southwest England was 0.0349 mg/L (Uren Webster et al., 2013); mean concentration of Cu in vineyard runoff water in Marine river, Champagne, France was 0.38 mg/L (Teisseire, 1999); while over 2.88 mg/L was detected in Tarapaya River of South America (Smolders et al., 2003). Moreover, the nominal concentrations of Cu2+ were also based on 10‰, 1% and 10% of the 96-h LC50 value (Wei and Yang, 2015a). After acclimatization, apparently healthy crayfish were randomly divided into 4 groups of 38 crayfish each. Crayfish were exposed to 0 (control, without extra Cu addition), 0.03, 0.30, and 3.00 mg/L Cu2+ (from CuSO4·5H2O dissolved in distilled water for stock solution) for 7d semi-static exposure (E, exposure period). Half of the test solution was renewed each day to maintain a relatively constant dissolved Cu concentration. Crayfish were not fed during Cu2+ exposure and other conditions were same as those used for acclimation. After the exposure, 19 crayfish of each group were transferred into Cu-free water for another 7 days (D, depuration period) and crayfish were fed three times a week. No mortality and behavioural changes were observed during the acclimation period and throughout test duration. At the end of 7-d Cu2+ exposure, 9 crayfish from each group were dissected into their gills, muscle, hepatopancreas, digestive gut, and antennal gland for evaluation of Cu accumulation (n = 3, 3 crayfish each); 10 crayfish of each group were dissected out hepatopancreas for the measurement of both oxidative stress parameters (n = 5, 2 crayfish each) and mRNA expression levels (n = 4, 2 crayfish each). The samples were frozen using liquid nitrogen and preserved at − 80 °C until use. A second sampling was conducted after the 7-d depuration, and the remaining 19 crayfish were only dissected out hepatopancreas for evaluation of Cu elimination, oxidative stress parameters, and mRNA expression as described above. Particularly, the crayfish were handled according to the National Institute of Health Guidelines for the handling and care of experimental animals. Also, the animal utilization protocol was approved by the Institutional Animal Care and Use Committee of the Ocean University of China. 202

Ecotoxicology and Environmental Safety 175 (2019) 201–207

Dan Zhao, et al.

PCR products. The reaction conditions were 95 °C for 30 s; 40 cycles of 95 °C for 5 s; 57 °C for 30 s; and 72 °C for 30 s. A melting curve was established for each sample. In addition, 2% agarose gel electrophoresis of the PCR products was performed to confirm the presence of single amplicons of the correct predicted size (not shown). For each reaction, the relative target gene mRNA expression levels were normalized to the geometric mean of the β-actin expression levels. The fold change for the relative gene expression was determined by the formula 2−ΔΔCt and plotted on a logarithmic scale (Vandesompele et al., 2002).

2.3. Quantification of Cu in crayfish tissues and test solutions Concentrations of Cu in the crayfish tissues were measured according to the Chinese National Standard for determination of Cu in food (GB 5009.13-2003) with some modifications. Three replicate samples (3 crayfish each) from per treatment group, were weighed, acidified with 10 mL HNO3 (analytical grade, Shanghai Chemical Reagent Corp., Shanghai, China), and digested by a microwave digestion technique (CEM Mars classic, Mattews NC, USA). The microwave was run at 1000 W and 185 °C for 15 min before a 15-min cooling down. The resulting digests were analyzed for Cu concentration by flame atomic absorption spectrophotometer (SHIMADZU, AA-6880, Kyoto, Japan) with a deuterium background correction, equipped with oxygen-acetylene flame, with a detection limit of 0.1 μg/L. The standard Cu solution (National standard sample, GSB04-1725-2004, Beijing, China) was obtained from National Testing Center of Nonferrous Metals and Electronic Materials, and used to prepare elemental calibration standards and to build a standard curve for calculating Cu concentrations in samples. To determine the actual Cu concentrations in exposure solutions, water samples (10 mL) were taken from each test tank at 0 h and 24 h after the last renewal of the test solution, and passed through a 0.45 µm syringe filter. Then, Cu concentrations were analyzed by the atomic absorption spectrophotometer as mentioned above.

2.6. Statistical analyses Data were expressed as mean values ± standard deviations (SD). The significant differences between the control group and experimental groups were analyzed with One-way analysis of variance (ANOVA) followed by LSD’s post-hoc test. Differences between groups was considered to be significant at 0.01 < p < 0.05 and highly significant at p < 0.01.

3. Results 3.1. Cu concentrations in test solutions and tissues As shown in Table 2, the average Cu concentrations in test solutions were 0.049, 0.226, and 3.173 mg/L, corresponding to nominal concentrations of 0.03, 0.30, and 3.00 mg/L. Fig. 1 showed that the order of Cu accumulation in different tissues of Cu2+-exposed crayfish was gills > hepatopancreas > antennal gland > digestive gut > muscle. The hepatopancreas significantly accumulated elevated Cu after the 7-d exposure of 0.30 and 3.00 mg/L Cu2+ (p < 0.01). However, no significant Cu accumulation was found in hepatopancreas in all Cu2+-treated group after the 7-d depuration.

2.4. The parameters of oxidative stress in hepatopancreas Five replicate samples each containing two crayfish hepatopancreas were analyzed per treatment group. Hepatopancreas samples were homogenized in 1/10 (w/v) 0.01 M PBS (pH=7.4) by using JX-24 TissueLyser (Jingxinshiye, Shanghai, China) at 65 Hz frequency for 2 min. Then, homogenates were centrifuged at 4 °C and 1000g for 10 min. The oxidative stress markers (T-SOD, Cu/Zn-SOD, CAT, GPx, GST, GSH, and MDA) were measured in the supernatant, with commercially available kits (Nanjing Jiancheng Bioengineering Institute, Nanjing, China) according to the manufacturer’s protocol. Total protein content in the supernatant was determined with the Bradford assay using bovine serum albumin as a standard, and the absorbance of the samples was measured at 595 nm using a PerkinElmer Enspire plate reader (PerkinElmer, Waltham, USA).

3.2. Responses of the oxidative stress parameters in hepatopancreas Changes of antioxidative enzyme activities including T-SOD, Cu/ZnSOD, CAT, GPx, GST and the levels of GSH and MDA in hepatopancreas were evaluated after both 7-d exposure and 7-d depuration (Table 3). After the 7-d exposure, three doses of Cu2+ significantly decreased CAT activity but increased GPx activity and GSH level, compared to the control. Significant increases of GST activity and MDA level were observed after 7-d exposure of 3.00 mg/L Cu2+. After the 7-d depuration, CAT activity and GSH content were significantly decreased in all exposed group, while activities of GPx and GST returned to the control level. In addition, no significant alteration in T-SOD and Cu/Zn-SOD activity was observed in any treatment group.

2.5. Real-time PCR Total RNA of four replicate samples (2 crayfish hepatopancreas each) per treatment group (control, 0.03, 0.30, and 3.00 mg/L Cu2+ groups) was isolated using TRIzol reagent according to the manufacturer’s protocol (invitrogen, Carlsbad, CA, USA). RNA quantity and quality in each sample were measured using a NanoDrop ND-2000c spectrophotometer (Thermo Scientific, Waltham, MA, USA) and 1.5% agarose gel electrophoresis. Up to 1 μg of total RNA was for genomic DNA elimination reaction and then reverse-transcription reaction to synthesize cDNA as described by Wang et al. (2018). In our previous study, we have deposited the crayfish transcriptome sequencing in the Sequence Read Archive (SRA) data base (http://www.ncbi.nlm.nl.gov/ sra) under the accession code SRP154261. We used the genes sequences data to design the primers for the specific amplification using the Primer Premier 5.0 software (PREMIER Biosoft Int., Palo Alto, CA, USA), listed in Table 1. Real-time PCR was performed using the SYBP Premix Ex Taq (TaKaRa, China), according to the manufacturer’s instructions, on an Eppendorf MasterCycler® ep RealPlex4 (Eppendorf, Wesseling-Berzdorf, Germany). Parallel PCR reactions were conducted to amplify the target genes’ cDNA and reference genes (β-actin)’ cDNA (Jiang et al., 2014). Real-time PCR was performed in 20 μL reaction mixture containing 10 μL of 1 × SYBR Premix Ex Taq, 0.8 μL for each primer, 0.4 μL of ROX Reference Dye, 2 μL of RT reaction (cDNA template), and 6 μL dH2O. A SYBR Premix Ex Taq was used to detect specific

3.3. Responses of the expression profiles of antioxidative enzyme genes and Cu homeostasis genes in hepatopancreas Transcriptional changes of selected genes (Cu/Zn-sod, cat, gpx, gst) coding antioxidative enzymes were shown in Fig. 2. Cu/Zn-sod, gpx, and gst gene expression was significantly up-regulated after 7-d exposure of 0.30 and 3.00 mg/L Cu2+ and in the 3.00 mg/L Cu2+ group after 7-d depuration. Moreover, the cat gene expression was significantly increased in the highest dose (3.00 mg/L) after exposure and depuration, compared to the control. As shown in Fig. 3, the expression of CHGs (Ctr1, Atox1, coppertransporting ATPase 2, MT, MTF-1, and MTF-2) presented a coordinated decrease after 7-d exposure of 0.30 and 3.00 mg/L Cu2+, while a coordinated increase in 3.00 mg/L Cu2+ group after the 7-d depuration. Most of CHGs (except MTF-2) returned to basal expression levels in 0.30 mg/L Cu2+ group after 7-d depuration. 203

Ecotoxicology and Environmental Safety 175 (2019) 201–207

Dan Zhao, et al.

Table 1 Genes and specific primer pairs used in real-time PCR analysis. Gene Symbol

Function description

Transcript ID

Primer Sequence (5'-3')

Reference

β-actin

beta-actin, house keeping gene

HQ414542.1

MTF−2

metal-response element-binding transcription factor 2

TRINITY_DN90570_c1_g3

MTF−1

metal-response element-binding transcription factor 1

TRINITY_DN131745_c2_g2

ATP2

copper-transporting ATPase 2

TRINITY_DN92372_c1_g1

Ctr1

high-affinity copper transporter 1

TRINITY_DN77970_c0_g1

Atox1

copper transport protein ATOX1

TRINITY_DN85743_c0_g1

MT

metallothionein

TRINITY_DN83992_c0_g3

sod

Cu/Zn-SOD

TRINITY_DN63424_c1_g1

cat

catalase

TRINITY_DN27834_c0_g1

gpx

glutathione peroxidase

TRINITY_DN125097_c0_g2

gst

glutathione S-transferase

TRINITY_DN129262_c0_g1

F: GTCAGGTCATCACCATCGGCA R: CGGTCTCGTGAACACCAGCA F: TGGGGACAGCGAGGGAGAC R: CATTTTCACAATCAACCACGACT F: AAGTGTGAAGAAGATGGTTGTGGC R: CCGTTCACCAGTGTGTATCCGT F: TCCAAGAAAACTGTGCGTAGAATCC R: TGGCTGTAAGTAAAAACCGAAAGGC F: AAACGCAGGCAGAAGCAAAA R: GTCAGCAACACAGACCGACA F: AAGCACTCTTTGACCCAATGTATG R: CAAGTGTGTTGTCAGCAGAGGA F: AGCAACAGGTTCCAGACCCACAC R: GTCCTCCACACCAGCCTTCTTCA F: CGCCGATGTAAGACTGGGACG R: CTCCAGGTAAACACGGCTTCCAT F: TCCTGTGAACTGTCCCTATCGTG R: AACCCAGTCTTCTTACAATCAACG F: AGAAGACTGAGGTGAATGGGAAGG R: GCTCGTAGAACAAGTTAGCCAAGAA F: GGTGGATGCCATTCTGAACTTTGAT R: CACAAGGACGAGGTCAGCAACAG

Jiang et al. (2014) – – – – – – – – – – – – – – – – – – – – –

F: Forward primer sequence, R: Reverse primer sequence.

internal tissues of crustaceans to be detoxified or excreted (Marsden and Rainbow, 2004; Rainbow, 2002, 2007; Rtal and Truchot, 1996). Exposure to 0.30 and 3.00 mg/L Cu2+ for 7 d elicited high Cu levels in crayfish tissues with the following order: gills > hepatopancreas > antennal gland > digestive gut > muscle. Organisms are able to minimize the adverse effect of excessive metal by summation of the separate regulation of metal levels in different tissues (Ahearn et al., 2004; Bryan, 1971; Bryan and Darracott, 1979; Rainbow, 1998). Thus, the tissue-specific distribution of Cu might be one of detoxified strategies to regulate Cu levels in crayfish body. However, exposure to 0.03 mg/L Cu2+ for 7 d showed a fairly constant Cu level in all tissues. Soedarini et al. (2012) also found no Cu accumulation in tissues of Marbled crayfish (Procambarus sp.) exposed to 0.031 mg/L Cu2+. One possible explanation was that crayfish could eliminated excessive Cu under lowlevel Cu2+ exposure for 7 d. Most importantly, our result showed hepatopancreas was the main accumulator of Cu in internal tissues of crayfish, which was also confirmed in many other studies focused on crustaceans (Ahearn et al., 2004; Alcorlo et al., 2006; Chavez-Crooker et al., 2003; Legras et al., 2000; Rainbow, 2007; Suárez-Serrano et al., 2010). The hepatopancreas has a capability to concentrate metals from haemolymph, and it appears to be the major tissue to store or detoxify waterborne metals in crustaceans (Ahearn et al., 2004; Icely and Nott, 1992; Roldan and Shivers, 1987). Moreover, following a 7-d depuration period, accumulated Cu in hepatopancreas was completely removed, suggesting an ability of crayfish to manipulate Cu levels for their own metabolic profit in hepatopancreas. Similarly, Naqvi et al. (1998) also demonstrated that crayfish had a great capability for rapid Cu accumulation and elimination. This capability might be accompanied by an induction of a variety of cellular changes in hepatopancreas, which would contribute to Cu detoxification and tolerance in crayfish. Besides its function in metabolism, hepatopancreas also plays an important role in maintaining Cu homeostasis in several species (Ahearn et al., 2004; Chavez-Crooker et al., 2003; Donker et al., 1990; Lyon et al., 1983). In this study, after exposure to 0.30 and 3.00 mg/L Cu2+ for 7 d, crayfish coordinately reduced the expression level of CHGs (Ctr1, Atox1, MTF1, MTF2, MT, and Cu-transporting ATPase 2) in hepatopancreas, indicating that Cu uptake and distribution at the cellular and tissue level were probably inhibited. Essential metals, such as Cu and Zn, are regulated to maintain a homeostatic status, but once reaching a threshold, the regulatory process becomes saturated and accumulation begins (Engel and Brouwer,

Table 2 Cu concentrations in test solutions. Nominal Cu concentrations (mg/L)

Measured Cu concentrations at 0 h (mg/L)

Measured Cu concentrations at 24 h (mg/L)

0 0.03 0.30 3.00

ND 0.049 ± 0.002 0.226 ± 0.009 3.173 ± 0.290

ND < DL 0.061 ± 0.005 0.634 ± 0.050

ND = no detect; DL= detection limit.

Fig. 1. Cu concentrations in tissues of crayfish. E = 7-d exposure period; D = 7d depuration period. Data are expressed as mean ± SD, n = 3 for each group. Significant differences between exposure groups and the control are indicated by * 0.01 < p < 0.05, ** p < 0.01.

4. Discussion Cu is an essential micronutrient and thus readily taken up by crustaceans from water or food (Ahearn et al., 2004; Anderson et al., 1997; Rainbow, 2007; Soedarini et al., 2012). The gills are in direct contact with the aquatic environment, and crayfish can assimilate significant amount of Cu from the water via this tissue. Accordingly, the highest Cu level was observed in crayfish gills under waterborne Cu2+ exposure in our study. Further, Cu is transported via haemolymph to 204

Ecotoxicology and Environmental Safety 175 (2019) 201–207

Dan Zhao, et al.

Table 3 Responses of the oxidative stress parameters in crayfish hepatopancreas. Parameter

Exposure time

Test groups Cu2 + (mg/L) 0.00

T-SOD (U/mg protein) Cu/Zn-SOD (U/mg protein) CAT (U/mg protein) GPx (U/mg protein) GST (U/mg protein) GSH (μmol/g protein) MDA (nmol/mg protein)

E7d D7d E7d D7d E7d D7d D7d D7d E7d D7d E7d D7d E7d D7d

120.11 192.86 198.91 270.70 12.07 11.38 652.59 817.46 318.75 211.00 2154.22 4200.98 4.86 2.64

0.03 ± ± ± ± ± ± ± ± ± ± ± ± ± ±

28.09 29.76 39.04 30.18 1.29 0.98 153.64 56.08 50.79 29.02 148.68 500.93 1.24 0.12

112.58 167.88 160.46 214.55 8.00 9.20 943.27 701.95 335.67 193.51 2560.90 3471.09 4.47 2.91

0.30 ± ± ± ± ± ± ± ± ± ± ± ± ± ±

21.93 24.28 40.25 65.50 0.36 * * 1.00 * 131.96 * * 182.00 43.52 30.46 147.04 * 617.66 * 1.92 0.59

93.92 165.59 219.21 246.16 8.22 5.61 1021.23 759.22 329.01 191.07 2781.00 3323.93 3.55 2.64

3.00 ± ± ± ± ± ± ± ± ± ± ± ± ± ±

9.18 33.47 39.98 32.57 1.40 * * 1.53 * * 93.23 * * 119.47 58.66 8.97 259.84 * * 313.33 * * 1.47 0.30

119.49 143.22 181.15 304.52 8.06 7.12 1089.95 789.50 452.63 222.39 2729.29 3428.33 14.76 2.75

± ± ± ± ± ± ± ± ± ± ± ± ± ±

10.18 26.04 54.26 59.34 1.15 * * 2.30 * 128.70 * * 47.32 76.31 * * 11.04 403.22 * * 198.03 * 4.47 * * 0.50

E = 7-d exposure period; D = 7-d depuration period. Data are expressed as mean ± SD, n = 5 for each group. Significant differences between exposure groups and the control are indicated by * 0.01 < p < 0.05, ** p < 0.01.

Cu transport genes (Atox1, MT, and Cu-transporting ATPase) responsible for distribution, sequestration, and efflux of intracellular Cu, thereby repressing the transport processes of intracellular Cu. However, the lowest dose (0.03 mg/L) of Cu2+ caused no significant changes in CHGs expression or Cu levels in hepatopancreas, suggesting crayfish has a tolerance ability to maintain normal Cu levels during low-level Cu contamination. Consistently, this tolerance ability was also confirmed by results of the depuration test, that a coordinated increase in CHGs expression level was observed in 3.00 mg/L Cu2+ exposed group after a 7-d depuration, indicating a fast Cu elimination from hepatopancreas. In particular, the up-regulation of Ctr1 might supply Cu to sustain normal cellular processes in addition to detoxificatory pathways after withdrawal of Cu stress. Since any free Cu2+ into the cell is highly toxic, intracellular Cu can be stored as an inert form by binding with specialized chaperone proteins (Kim et al., 2008; Markossian and Kurganov, 2003). Accordingly, the increased Atox1 and MT expression suggested that crayfish could store and sequester excess Cu by binding with certain proteins in a detoxified form to limit its bioavailability. Sequestration within the MT has been reported as a central mechanism against Cu toxicity in most studies (Heuchel et al., 1994; Westin and Schaffner, 1988), thus up-regulation of MT and its transcription factor MTF-1 and MTF-2 was also a predominant strategy by which crayfish elicited to eliminate excessive Cu during the depuration. In addition, Cu chaperone proteins can transport Cu to the secretory pathway, and thereby the up-regulation of Cu exporter (copper-transporting ATPase 2) indicated that crayfish could increase the efflux rate of Cu to eliminate the excessive intracellular Cu during the depuration. In 0.03 and 0.30 mg/L Cu2+-exposed group after 7-d depuration, the expression level of most CHGs returned to basal values except for the MTF-2 gene, suggesting that at the transcriptional level, crayfish have recovered their basal Cu homeostasis status after depuration. When Cu is accumulated at high levels beyond the ability of cells to homeostatically balance uptake with detoxification, it has the potential to be toxic. Wei and Yang (2015b) reported that exposure to 0.75 and 3.00 mg/L Cu2+ for 96 h caused over-production of ROS in crayfish hepatopancreas. To scavenge the toxic ROS produced during Cu stress, crayfish are equipped with an efficient antioxidative defense system, which might be involved in the detoxification and thus tolerance to Cu stress. Changes in activities of antioxidant enzymes demonstrate an adaptation to address environmental pollutants-induced stress, and an attempt to neutralize the over-produced ROS (Mazhoudi et al., 1997; Mittler, 2002; Stobrawa and Lorenc-Plucinska, 2007). Increases in the activity of SOD and CAT are usually observed upon exposure to pollutants (Dautremepuits et al., 2004), since SOD-CAT system constitutes

Fig. 2. Responses of antioxidant enzyme genes expression in crayfish hepatopancreas. E = 7-d exposure period; D = 7-d depuration period; sod = Cu/Znsod. Data are expressed as mean ± SD, n = 4 for each group. Significant differences between exposure groups and the control are indicated by * 0.01 < p < 0.05, ** p < 0.01.

Fig. 3. Responses of Cu homeostasis genes expression in crayfish hepatopancreas. E = 7-d exposure period; D = 7-d depuration period; ATP2 = coppertransporting ATPase 2 gene. Data are expressed as mean ± SD, n = 4 for each group. Significant differences between exposure groups and the control are indicated by * 0.01 < p < 0.05, ** p < 0.01.

1987; Rainbow, 1985, 2002; Wang and Rainbow, 2008). Especially, Ctr1 is a limiting component in the Cu uptake system, and expression of Ctr1 stimulated Cu uptake in cultured cells (Kim et al., 2008; Kuo et al., 2007; Lee et al., 2000; Zhou, Gitschier, 1997). Accordingly, upon the excessive Cu2+ stress, the decreased Ctr1 expression was supposed to be an adaptive response to limit Cu uptake and transport, which resulted in excessive intracellular Cu accumulation. In addition, Cu homeostasis imbalance was also attributed to the decreased expression level of other 205

Ecotoxicology and Environmental Safety 175 (2019) 201–207

Dan Zhao, et al.

the first line of defense against oxidative stress (McCord, 1996). However, in the present study, the CAT activity was significantly decreased, and T-SOD and Cu/Zn-SOD activities were unchanged in hepatopancreas of crayfish exposed to Cu2+ for 7 d. The decreased CAT activity might be related to the excessive O2- and H2O2 due to the insufficient scavenging activity of SOD (Atli and Canli, 2010; Stanic et al., 2005). The inhibition of CAT activity has also been reported in Cu-exposed animals, for example, exposure to sublethal concentrations of Cu2+ (20 μM) for 48 h inhibited CAT activity in liver of freshwater fish Oreochromis niloticus (Atli and Canli, 2010). Since GPx and CAT share the same substrate and catalyze the reduction of H2O2, the main precursor of HO·(Matés and Sánchez-Jiménez, 1999), the significant increase of GPx activity in hepatopancreas could be a compensatory response to effectively eliminate H2O2 (Regoli et al., 2003, 2011). In addition, the elevated GST activity and GSH content in hepatopancreas could conjugate more lipid peroxidation products and also provide an important line of defense against oxidative stress in Cu2+-exposed crayfish. Similarly, increased activities of GPx and GST as well as a marginal but not significant increase of T-SOD activity have been reported in the freshwater cladoceran Daphnia magna exposed to 20 μg/L Cu2+ (Barata et al., 2005). Like other organisms, crayfish can combat the excessive ROS depending on these antioxidative enzymes not only in their catalytic activities but also in their genes expression level. After exposure to 0.30 and 3.00 mg/L Cu2+, the expression level of antioxidative enzyme genes (Cu/Zn-sod, cat, gpx, gst) was up-regulated in hepatopancreas, which also plays an important role in the acquisition of tolerance to oxidative stress in exposed crayfish. Nevertheless, a significantly increased level of MDA, an indicator of lipid peroxidation, was found in 3.00 mg/L Cu2+-exposed crayfish, probably suggesting a failure of the antioxidant defense system upon the highest-level Cu2+ exposure. Even though, after the depuration period, MDA level in the hepatopancreas returned to the control level, which was, at least partly, attributed to the increased antioxidative enzyme gene expression (Cu/Zn-sod, cat, gpx, gst). On the other hand, GSH can also conjugate with Cu, rendering it water soluble and thus biologically inactive (Freedman et al., 1989; Jimenez and Speisky, 2000). Accordingly, more GSH was consumed to bind excessive Cu and then was excreted from cell during depuration period, which also certainly contributed to the recovery from oxidative damage in exposed crayfish. Subsequently, the oxidative status of exposed crayfish may either return to pre-exposure conditions or establish new balance due to increased tolerance. P. clarkii has been have been used as an indicator species of heavy metals pollution, because their dose- and time-dependent accumulation of heavy metals in tissues may be reflective of the levels of non-essential metals present in contaminated area (Alcorlo et al., 2006; Martín-Díaz et al., 2006; Suárez-Serrano et al., 2010). However, essential metals, such as Cu and Zn, were mainly regulated regardless of environmental levels but for their own profit, thus the measure of Cu concentration in crayfish tissues cannot provide an efficient and accurate indicator of Cu contamination (Alcorlo et al., 2006). Otherwise, the oxidative stress parameters are commonly used as biomarkers in ecotoxicological studies (Regoli and Giuliani, 2014; Valavanidis et al., 2006). Results of the present study also suggested the oxidative stress parameters and Cu homeostasis genes should be used for evaluation of Cu contamination in aquatic environment. This evaluation might be relevant, for instance, for future management plans of the crayfish farming activities (including excessive Cu-based pesticides application) focused on improving water quality. In conclusion, this study showed that a 7-d Cu2+ exposure caused significant Cu accumulation in crayfish hepatopancreas, and crayfish has a resistant and detoxification ability to tolerate this short-term Cu stress. During the exposure, crayfish repressed the expression level of CHGs in hepatopancreas to inhibit intracellular Cu transporting and increased activities and gene expression level of antioxidative enzymes to cope with Cu-induced oxidative stress. Additionally, after a 7-d Cu2+ depuration, crayfish eliminated excess Cu from hepatopancreas and

recovered from the oxidative damage by up-regulating expression of CHGs and antioxidative enzyme genes. P. clarkii has been one of the most economically important farmed species in China and crayfish metals might pose a health risk for high rate consumers, thus our results also indicated that their capability of elimination and detoxification of heavy metals may help reduce the potential hazard, especially for high consumption individuals. Acknowledgements This work was supported by the National Key Research and Development Program of China (2017YFC1600705) and Shandong Xiaoqing River & Nasi Lake Biodiversity Program, Huanbao Yanfa (water environment bio-map) project. Thanks are also due to our peer reviewers for comments. Declarations of interest The authors declare that there are no conflicts of interest. References Ahearn, G.A., Mandal, P.K., Mandal, A., 2004. Mechanisms of heavy-metal sequestration and detoxification in crustaceans: a review. J. Comp. Physiol. B 174, 439–452. Alcorlo, P., Otero, M., Crehuet, M., Baltanás, A., Montes, C., 2006. The use of the red swamp crayfish (Procambarus clarkii, Girard) as indicator of the bioavailability of heavy metals in environmental monitoring in the River Guadiamar (SW, Spain). Sci. Total Environ. 366, 380–390. Anderson, M.B., Reddy, P., Preslan, J.E., Fingerman, M., Bollinger, J., Jolibois, L., Maheshwarudu, G., George, W.J., 1997. Metal accumulation in crayfish, Procambarus clarkii, exposed to a petroleum-contaminated bayou in Louisiana. Ecotoxicol. Environ. Saf. 37, 267–272. Andrade, L.R., Farina, M., Amado Filho, G.M., 2004. Effects of copper on Enteromorpha flexuosa (Chlorophyta) in vitro. Ecotoxicol. Environ. Saf. 58, 117–125. Atli, G., Canli, M., 2010. Response of antioxidant system of freshwater fish Oreochromis niloticus to acute and chronic metal (Cd, Cu, Cr, Zn, Fe) exposures. Ecotoxicol. Environ. Saf. 73, 1884–1889. Balamurugan, K., Schaffner, W., 2006. Copper homeostasis in eukaryotes: teetering on a tightrope. Biochim. Biophys. Acta 1763, 737–746. Barata, C., Varo, I., Navarro, J.C., Arun, S., Porte, C., 2005. Antioxidant enzyme activities and lipid peroxidation in the freshwater cladoceran Daphnia magna exposed to redox cycling compounds. Comp. Biochem. Physiol. C Toxicol. Pharmacol. 140, 175–186. Bellante, A., Maccarone, V., Buscaino, G., Buffa, G., Filiciotto, F., Traina, A., Del Core, M., Mazzola, S., Sprovieri, M., 2015. Trace element concentrations in red swamp crayfish (Procambarus clarkii) and surface sediments in Lake Preola and Gorghi Tondi natural reserve, SW Sicily. Environ. Monit. Assess. 187, 404. Bertinato, J., L’Abbé, M.R., 2004. Maintaining copper homeostasis: regulation of coppertrafficking proteins in response to copper deficiency or overload. J. Nutr. Biochem. 15, 316–322. Bini, G., Chelazzi, G., 2006. Acclimatable cardiac and ventilatory responses to copper in the freshwater crayfish Procambarus clarkii. Comp. Biochem. Physiol. C Toxicol. Pharmacol. 144, 235–241. Bremner, I., 1998. Manifestations of copper excess. Am. J. Clin. Nutr. 67, 1069S–1073S. Bryan, G.H., 1971. The effects of heavy metals (other than mercury) on marine and estuarine organisms. Proc. R. Soc. Lond. B Biol. Sci. 177, 389–410. Bryan, G.W., Darracott, A., 1979. Bioaccumulation of marine pollutants. Philos. Trans. R. Soc. Lond. B 286, 483–505. Chavez-Crooker, P., Garrido, N., Pozo, P., Ahearn, G.A., 2003. Copper transport by lobster (Homarus americanus) hepatopancreatic lysosomes. Comp. Biochem. Physiol. C Toxicol. Pharmacol. 135, 107–118. Chen, J.C., Lin, C.H., 2001. Toxicity of copper sulfate for survival, growth, molting and feeding of juveniles of the tiger shrimp, Penaeus monodon. Aquaculture 192, 55–65. Culotta, V.C., Lin, S.J., Schmidt, P., Klomp, L.W., Casareno, R.L.B., Gitlin, J., 1999. Intracellular pathways of copper trafficking in yeast and humans. Adv. Exp. Med. Biol. 448, 247–254. Dautremepuits, C., Paris-Palacios, S., Betoulle, S., Vernet, G., 2004. Modulation in hepatic and head kidney parameters of carp (Cyprinus carpio L.) induced by copper and chitosan. Comp. Biochem. Physiol. C Toxicol. Pharmacol. 137, 325–333. Donker, M.H., Koevoets, P., Verkleij, J.A., Van Straalen, N.M., 1990. Metal binding compounds in hepatopancreas and haemolymph of Porcellio scaber (Isopoda) from contaminated and reference areas. Comp. Biochem. Physiol. C. 97, 119–126. Engel, D.W., Brouwer, M., 1987. Metal regulation and molting in the blue crab, Callinectes sapidus: metallothionein function in metal metabolism. Biol. Bull. 173, 239–251. Freedman, J.H., Ciriolo, M.R., Peisach, J., 1989. The role of glutathione in copper metabolism and toxicity. J. Biol. Chem. 264, 5598–5605. Gaetke, L.M., Chow, C.K., 2003. Copper toxicity, oxidative stress, and antioxidant nutrients. Toxicology 189, 147–163. Gaetke, L.M., Chow-Johnson, H.S., Chow, C.K., 2014. Copper: toxicological relevance and mechanisms. Arch. Toxicol. 88, 1929–1938.

206

Ecotoxicology and Environmental Safety 175 (2019) 201–207

Dan Zhao, et al.

Rainbow, P.S., 2002. Trace metal concentrations in aquatic invertebrates: why and so what? Environ. Pollut. 120, 497–507. Rainbow, P.S., 2007. Trace metal bioaccumulation: models, metabolic availability, and toxicity. Environ. Int. 33, 576–582. Regoli, F., Giuliani, M.E., 2014. Oxidative pathways of chemical toxicity and oxidative stress biomarkers in marine organisms. Mar. Environ. Res. 93, 106–117. Regoli, F., Winston, G.W., Gorbi, S., Frenzilli, G., Nigro, M., Corsi, I., Focardi, S., 2003. Integrating enzymatic responses to organic chemical exposure with total oxyradical absorbing capacity and DNA damage in the European eel Anguilla anguilla. Environ. Toxicol. Chem. 22, 2120–2129. Regoli, F., Giuliani, M.E., Benedetti, M., Arukwe, A., 2011. Molecular and biochemical biomarkers in environmental monitoring: a comparison of biotransformation and antioxidant defense systems in multiple tissues. Aquat. Toxicol. 105, 56–66. Roldan, B.M., Shivers, R.R., 1987. The uptake and storage of iron and lead in cells of the crayfish Orconectes propinquus) hepatopancreas and antennal gland. Comp. Biochem. Physiol. C 86, 201–214. Rtal, A., Truchot, J.P., 1996. Haemolymph transport and tissue accumulation of exogenous copper in the shore crab, Carcinus maenas. Mar. Pollut. Bull. 32, 802–811. Shalata, A., Neumann, P.M., 2001. Exogenous ascorbic acid (vitamin C) increases resistance to salt stress and reduces lipid peroxidation. J. Exp. Bot. 52, 2207–2211. Smolders, A.J.P., Lock, R.A.C., Van der Velde, G., Hoyos, R.M., Roelofs, J.G.M., 2003. Effects of mining activities on heavy metal concentrations in water, sediment, and macroinvertebrates in different reaches of the Pilcomayo River, South America. Arch. Environ. Contam. Toxicol. 44, 0314–0323. Soedarini, B., Klaver, L., Roessink, I., Widianarko, B., Van Straalen, N.M., Van Gestel, C.A.M., 2012. Copper kinetics and internal distribution in the marbled crayfish (Procambarus sp.). Chemosphere 87, 333–338. Stanic, B., Andric, N., Zoric, S., Grubor-Lajsic, G., Kovacevic, R., 2005. Assessing pollution in the Danube River near Novi Sad (Serbia) using several biomarkers in sterlet (Acipenser ruthenus L.). Ecotoxicol. Environ. Saf. 65, 395–402. Stobrawa, K., Lorenc-Plucinska, G., 2007. Changes in antioxidant enzyme activity in the fine roots of black poplar (Populus nigra L.) and cottonwood (Populus deltoides Bartr. ex Marsch) in a heavy-metal-polluted environment. Plant Soil 298, 57–68. Suárez-Serrano, A., Alcaraz, C., Ibáñez, C., Trobajo, R., Barata, C., 2010. Procambarus clarkii as a bioindicator of heavy metal pollution sources in the lower Ebro River and Delta. Ecotoxicol. Environ. Saf. 73, 280–286. Teisseire, H., 1999. Toxicologie et ecotoxicologie des pesticides et des métaux lourds susceptibles d’être présents dans le vignoble champenois: étude de leur impact physiologique et biochimique sur Lemna minor. Thèse de l’Université de Reims Champagne-Ardenne, Reims, France, 272 p.(Doctoral dissertation, Reims). Thomas, C., Mackey, M.M., Diaz, A.A., Cox, D.P., 2009. Hydroxyl radical is produced via the Fenton reaction in submitochondrial particles under oxidative stress: implications for diseases associated with iron accumulation. Redox Rep. 14, 102–108. Uren Webster, T.M., Bury, N., van Aerle, R., Santos, E.M., 2013. Global transcriptome profiling reveals molecular mechanisms of metal tolerance in a chronically exposed wild population of brown trout. Environ. Sci. Technol. 47, 8869–8877. Valavanidis, A., Vlahogianni, T., Dassenakis, M., Scoullos, M., 2006. Molecular biomarkers of oxidative stress in aquatic organisms in relation to toxic environmental pollutants. Ecotoxicol. Environ. Saf. 64, 178–189. Vandesompele, J., De Preter, K., Pattyn, F., Poppe, B., Van Roy, N., De Paepe, A., Speleman, F., 2002. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 3 (RESEARCH0034). Wang, W., Zhang, X., Wang, Z., Qin, J., Wang, W., Tian, H., Ru, S., 2018. Bisphenol S induces obesogenic effects through deregulating lipid metabolism in zebrafish (Danio rerio) larvae. Chemosphere 199, 286–296. Wang, W.X., Rainbow, P.S., 2008. Comparative approaches to understand metal bioaccumulation in aquatic animals. Comp. Biochem. Physiol. C Toxicol. Pharmacol. 148, 315–323. Wang, W.X., Yang, Y.B., Guo, X.Y., He, M., Guo, F., Ke, C.H., 2011. Copper and zinc contamination in oysters: subcellular distribution and detoxification. Environ. Toxicol. Chem. 30, 1767–1774. Wei, K., Yang, J., 2015a. Oxidative damage induced by copper and beta-cypermethrin in gill of the freshwater crayfish Procambarus clarkii. Ecotoxicol. Environ. Saf. 113, 446–453. Wei, K., Yang, J., 2015b. Oxidative damage of hepatopancreas induced by pollution depresses humoral immunity response in the freshwater crayfish Procambarus clarkii. Fish. Shellfish Immunol. 43, 510–519. Wei, K., Yang, J., 2016. Copper-induced oxidative damage to the prophenoloxidase-activating system in the freshwater crayfish Procambarus clarkii. Fish. Shellfish Immunol. 52, 221–229. Westin, G., Schaffner, W., 1988. A zinc-responsive factor interacts with a metal-regulated enhancer element (MRE) of the mouse metallothionein-I gene. EMBO J. 7, 3763–3770. Wong, C.S., Wu, S.C., Duzgoren-Aydin, N.S., Aydin, A., Wong, M.H., 2007. Trace metal contamination of sediments in an e-waste processing village in China. Environ. Pollut. 145, 434–442. Zhou, B., Gitschier, J., 1997. hCTR1: a human gene for copper uptake identified by complementation in yeast. Proc. Natl. Acad. Sci. USA 94, 7481–7486.

Heuchel, R., Radtke, F., Georgiev, O., Stark, G., Aguet, M., Schaffner, W., 1994. The transcription factor MTF-1 is essential for basal and heavy metal-induced metallothionein gene expression. EMBO J. 13, 2870–2875. Icely, J.D., Nott, J.A., 1992. Digestion and absorption: digestive systems and associated organisms. In: Harrison, F.W., Humes, A.G. (Eds.), Microscopic Anatomy of Invertebrates, Decapod crustacea, Inc. Wiley-Liss, New York, pp. 147–201. Jiang, H., Xing, Z., Lu, W., Qian, Z., Yu, H., Li, J., 2014. Transcriptome analysis of red swamp crawfish Procambarus clarkii reveals genes involved in gonadal development. PLoS One 9, 105–122. Jiang, H., Kong, X., Wang, S., Guo, H., 2016. Effect of copper on growth, digestive and antioxidant enzyme activities of Juvenile Qihe Crucian Carp, Carassius carassius, during exposure and recovery. Bull. Environ. Contam. Toxicol. 96, 333–340. Jiang, W.D., Wu, P., Kuang, S.Y., Liu, Y., Jiang, J., Hu, K., Li, S.H., Tang, L., Feng, L., Zhou, X.Q., 2011. Myo-inositol prevents copper-induced oxidative damage and changes in antioxidant capacity in various organs and the enterocytes of juvenile Jian carp (Cyprinus carpio var. Jian). Aquat. Toxicol. 105, 543–551. Jimenez, I., Speisky, H., 2000. Effects of copper ions on the free radical-scavenging properties of reduced gluthathione: implications of a complex formation. J. Trace Elem. Med. Biol. 14, 161–167. Kadiiska, M.B., Hanna, P.M., Jordan, S.J., Mason, R.P., 1993. Electron spin resonance evidence for free radical generation in copper-treated vitamin E-and selenium-deficient rats: in vivo spin-trapping investigation. Mol. Pharmacol. 44, 222–227. Kehrer, J.P., 2000. The Haber-Weiss reaction and mechanisms of toxicity. Toxicology 149, 43–50. Kim, B.E., Nevitt, T., Thiele, D.J., 2008. Mechanisms for copper acquisition, distribution and regulation. Nat. Chem. Biol. 4, 176–185. Kuo, M.T., Chen, H.H., Song, I.S., Savaraj, N., Ishikawa, T., 2007. The roles of copper transporters in cisplatin resistance. Cancer Metastas-. Rev. 26, 71–83. Lane, C., Petris, M.J., Benmerah, A., Greenough, M., Camakaris, J., 2004. Studies on endocytic mechanisms of the Menkes copper-translocating P-type ATPase (ATP7A; MNK). Endocytosis of the Menkes protein. Biometals 17, 87–98. Lee, J., Prohaska, J.R., Dagenais, S.L., Glover, T.W., Thiele, D.J., 2000. Isolation of a murine copper transporter gene, tissue specific expression and functional complementation of a yeast copper transport mutant. Gene 254, 87–96. Legras, S., Mouneyrac, C., Amiard, J.C., Amiard-Triquet, C., Rainbow, P.S., 2000. Changes in metallothionein concentrations in response to variation in natural factors (salinity, sex, weight) and metal contamination in crabs from a metal-rich estuary. J. Exp. Mar. Biol. Ecol. 246, 259–279. Lushchak, V.I., 2011. Environmentally induced oxidative stress in aquatic animals. Aquat. Toxicol. 101, 13–30. Lyon, R., Taylor, M., Simkiss, K., 1983. Metal-binding proteins in the hepatopancreas of the crayfish (Austropotamobius pallipes). Comp. Biochem. Physiol. C 74, 51–54. Markossian, K.A., Kurganov, B.I., 2003. Copper chaperones, intracellular copper trafficking proteins. Function, structure, and mechanism of action. Biochemistry 68, 827–837. Marsden, I.D., Rainbow, P.S., 2004. Does the accumulation of trace metals in crustaceans affect their ecology-the amphipod example? J. Exp. Mar. Biol. Ecol. 300, 373–408. Martín-Díaz, M.L., Tuberty, S.R., McKenney, C.L., Blasco, Jr, Sarasquete, J., Delvalls, T.A, C., 2006. The use of bioaccumulation, biomarkers and histopathology diseases in Procambarus clarkii to establish bioavailability of Cd and Zn after a mining spill. Environ. Monit. Assess. 116, 169–184. Matés, J.M., Sánchez-Jiménez, F., 1999. Antioxidant enzymes and their implications in pathophysiologic processes. Front. Biosci. 4, D339–345. Mazhoudi, S., Chaoui, A., Ghorbal, M.H., El Ferjani, E., 1997. Response of antioxidant enzymes to excess copper in tomato (Lycopersicon esculentum, Mill.). Plant Sci. 127, 129–137. McCord, J.M., 1996. Effects of positive iron status at a cellular level. Nutr. Rev. 54, 85–88. Mercer, J.F., Llanos, R.M., 2003. Molecular and cellular aspects of copper transport in developing mammals. J. Nutr. 133, 1481S–1484S. Mittler, R., 2002. Oxidative stress, antioxidants and stress tolerance. Trends Plant Sci. 7, 405–410. Murgia, I., Tarantino, D., Vannini, C., Bracale, M., Carravieri, S., Soave, C., 2004. Arabidopsis thaliana plants overexpressing thylakoidal ascorbate peroxidase show increased resistance to Paraquat-induced photooxidative stress and to nitric oxideinduced cell death. Plant J. 38, 940–953. Naqvi, S.M., Devalraju, I., Naqvi, N.H., 1998. Copper bioaccumulation and depuration by red swamp crayfish, Procambarus clarkii. Bull. Environ. Contam. Toxicol. 61, 65–71. O’Halloran, T.V., Culotta, V.C., 2000. Metallochaperones, an intracellular shuttle service for metal ions. J. Biol. Chem. 275, 25057–25060. Petris, M.J., Smith, K., Lee, J., Thiele, D.J., 2003. Copper-stimulated endocytosis and degradation of the human copper transporter, hCtr1. J. Biol. Chem. 278, 9639–9646. Prohaska, J.R., 2008. Role of copper transporters in copper homeostasis. Am. J. Clin. Nutr. 88, 826S–829S. Puig, S., Thiele, D.J., 2002. Molecular mechanisms of copper uptake and distribution. Curr. Opin. Chem. Biol. 6, 171–180. Rainbow, P.S., 1985. Accumulation of Zn, Cu and Cd by crabs and barnacles. Estuar. Coast. Shelf Sci. 21, 669–686. Rainbow, P.S., 1998. Phylogeny of trace metal accumulation in crustacean. In: Langston, W.J., Bebiano, M.J. (Eds.), Metal Metabolism in Aquatic Environments. Chapman and Hall, London, pp. 285–319.

207