Derivation of iPSC lines from two patients with familial Alzheimer's disease from India

Stem Cell Research 34 (2019) 101370

Contents lists available at ScienceDirect

Stem Cell Research journal homepage: www.elsevier.com/locate/scr

Lab Resource: Multiple Stem Cell Lines

Derivation of iPSC lines from two patients with familial Alzheimer's disease from India

T

Ashaq H. Najara,d,1, Sneha K.M.b,1, Aparna Ashokc, Swathy Babub, Anand G. Subramaniamc, Ramkrishnan Kannanc, Biju Viswanathc, Meera Purushottamc, Mathew Varghesec, Suhel Parvezd, ⁎⁎ ⁎ Mitradas M. Panickera,e,2, Odity Mukherjeea,b, ,2, Sanjeev Jaina,c, a

National Centre for Biological Sciences (NCBS), Tata Institute of Fundamental Research (TIFR), Bengaluru, India Institute for Stem Cell Biology and Regenerative Medicine (InStem), Bengaluru, India c National Institute of Mental Health and Neurosciences (NIMHANS), Bengaluru, India d Department of Toxicology, School of Chemical and Life Sciences, Jamia Hamdard, New Delhi, India e Department of Physiology and Biophysics, School of Medicine, University of California, Irvine, USA b

A B S T R A C T

The current prevalence of diagnosable dementia in India is 1% of people over 60 years (~3.7 million people), but is estimated to increase significantly, as ~15% world's aged population (> 65 years) would be resident here by 2020 (Shah et al., 2016). While several mutations that pose a familial risk have been identified, the ethnic background may influence disease susceptibility, clinical presentation and treatment response. In this study, we report a detailed characterization of two representative HiPSC lines from a well-characterized dementia cohort from India. Availability of these lines, and associated molecular and clinical information, would be useful in the detailed exploration of the genomic contribution(s) to AD.

Gene/locus

Resource table

Unique stem cell line identifier Alternative names of stem cell lines Institution Contact information of distributor Type of cell lines Origin Cell source Clonality Method of reprogramming Multiline rationale Gene modification Type of modification Associated disease

1. NCBSi001-A 2. NCBSi002-A 1. AD3 (NCBSi001-A) 2. AD5 (NCBSi002-A) National Centre for Biological Sciences (NCBS), Bengaluru India. Dr. Sanjeev Jain, Dr. Odity Mukherjee Induced Pluripotent Stem Cell (iPSC) lines Human Peripheral Blood Mononuclear cells (PBMNC)-derived Lymphoblastoid cells (LCLs) Mixed Transient transfection with episomal plasmids containing pluripotency genes (Okita et al., 2011) Ethnicity matched same-disease non-isogenic lines carrying different mutation background No NA Alzheimer's Disease(AD)

Method of modification Name of transgene or resistance Inducible/constitutive system Date archived/stock date Cell line repository/bank

Ethical approval

⁎

1. NCBSi001-A: PSEN1(1q24.2/NC_000014.9- (GRCh37/ hg19), APOE3/3(19q13.32/NC_000019.10- (GRCh37/ hg19) 2. NCBSi002-A: GAP43(3q13.31/NC_000003.12(GRCh37/hg19), APOE3/4(19q13.32/NC_000019.10(GRCh37/hg19) NA NA NA Dec 2017 These cell lines were generated under the aegis of the Department of Biotechnology funded Centre of Excellence grant - BT/01/CEIB/11/VI/11. The lines are available on request ([email protected];[email protected]). NIMHANS IEC/2012/Item No. VI.Sl.No. 6.07; NCBS/1-ICSCRT/2012

Correspondence to: S. Jain, National Institute of Mental Health and Neurosciences (NIMHANS), Bengaluru, Karnataka PIN:560029, India. Correspondence to: O. Mukherjee, Institute for Stem Cell Biology and Regenerative Medicine (inSTEM), GKVK-Post, Bellary Road, Bengaluru, Karnataka PIN: 560065, India. E-mail addresses: [email protected] (O. Mukherjee), [email protected], [email protected] (S. Jain). 1 Equal contribution. 2 Current affiliation. ⁎⁎

https://doi.org/10.1016/j.scr.2018.101370 Received 13 October 2018; Received in revised form 5 December 2018; Accepted 15 December 2018 Available online 19 December 2018 1873-5061/ © 2018 Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/BY-NC-ND/4.0/).

Stem Cell Research 34 (2019) 101370

A.H. Najar et al.

1. Resource utility

CDR = 3; EASI = 12; HMSE = 2 with evidence of cortical atrophy and rapid deterioration; (c). Both cell lines were tested for APOE risk alleles. Sequence evaluation showed NCBSi002-B line to be heterozygous for the risk allele (APOE3/4) (Fig.1K). The cell lines reported in this study match all standard and necessary QC requirements for a HiPSC resource and we believe these could help develop methods to study in detail the contribution of genetic variants on cellular processes Tables 1 and 3.

Given the genetic heritability underlying AD, its projected increase and the paucity of information from the Indian population, we believe the availability of AD HiPSC lines and associated genomic background information will benefit biomedical research in dissecting signatures underlying disease onset, progression and treatment strategies. 2. Resource details

3. Materials and methods AD is a neurodegenerative disease affecting learning and memory, and is the most common form of dementia in the elderly. AD and other forms of dementia are a growing public health problem in India, whose aging population is on the increase, warranting concerted efforts in understanding the biology of the syndrome. Genetic variations play a major role in the disease-onset, as mutations have been identified in genes encoding the amyloid beta and lipid homeostasis pathways. We report a detailed characterization of two representative AD HiPSC lines, of the Indian population selected from an earlier described sample (Syama et al., 2018). HiPSCs were generated by transient transfection of lymphoblastoid cell lines (LCLs) with episomal plasmids encoding human OCT4, SOX2, L-MYC, KLF4, and LIN-28. Primary colonies were obtained by 10–14 DIV (days in vitro) on mouse embryonic fibroblast (MEF) feeders in KOSR media and expanded by mechanical propagation. For long-term culture and storage the cell lines were subsequently cultured feeder-free in E8 media on Matrigel (Fig. 1A). The colonies exhibited classic flattened monolayer morphology, with defined boundaries and increased nuclear to cytoplasmic ratio (Fig. 1A). The lines were determined to be free of mycoplasma, fungus and bacterial contaminants (Table 2). The colonies were positive for the pluripotency markers tested both via immunocytochemistry (Fig. 1B and C) and global RNA signatures using PluriTest (Fig. 1D). To establish induction of pluripotency transcript values for two archetypal pluripotency markers (DNMT3B and NANOG; not present in the episomal plasmids) was determined from the RNAseq data, which confirmed activation of endogenous pluripotency genes in both the lines (Fig. 1E). We also examined transcript values for representative markers of all three germ layers - mesoderm (EOMES, CDX2); ectoderm (KRT1, KRT14, KRT5); endoderm (CDX2) and also trophoblast lineage (CGB, GCM1) to confirm that the HiPSC were not contaminated by spontaneous differentiation (Fig. 1E). Transgene footprints were tested for using DNA isolated from different HiPSC passages against a primer pair specific to the episomal plasmid backbone. DNA from passage 16 for line NCBSi001 and passage 22 for line NCBSi002 confirmed the absence of episomal plasmids (Fig. 1F). The cell line genomic stability was checked by performing karyotype analysis (Fig. 1G) and donor authenticity was confirmed by CODIS markerspecific STR analysis (Supplementaryfile_STR analysis data). The differentiation potential of the HiPSCs was tested using Embryoid bodies (EBs)- cultured in standard ES media without bFGF for a period of 4872 h prior to RNA isolation (Fig 1H). Representative transcripts of the three germ layers were assayed for using equal amounts of total RNA from HiPSCs and the EBs to establish the capability to differentiate into all three germ layers (Fig 1I). Finally, the lines were tested for the continued presence of the disease-specific mutations-–(a) NCBSi001-A: This line carried a familial segregating mutation in the Presenilin gene (PSEN1p.W165C) (Fig. 1J). The mutation is located in the conserved TMIII region of the gene predicted to affect Aβ42 levels (http://www. molgen.ua.ac.be/ADmutations). The subject carrying this mutation manifested a severe form of AD, with an early age of onset -45 years; CDR = 3; EASI = 12; HMSE = 0 with cerebral and cerebellar atrophy and rapid deterioration; (b) NCBSi002-A: This line carried a familial protein-perturbing mutation in the Neuromodulin/Growth Associated Protein 43 (GAP43p.S77G) (Fig. 1J). This gene is implicated in effective regenerative response in the nervous system (Sandelius et al., 2018). The subject manifested a severe form of the illness measured by;

3.1. Generation of LCLs Peripheral blood was collected from patients after obtaining their informed consent approved by the institutional IRB committee. Peripheral Blood Mononuclear cells (PBMNCs) were isolated from blood using Ficoll-based density gradient centrifugation. PBMNCs were then used for generating Lymphoblastoid Cell Lines (LCLs) using Epstein-Barr Virus (EBV)-mediated transformation following a published protocol (Hui-Yuen et al., 2011). Briefly, the EBV-producing B95–8 cell line was cultured in RPM1 media (Gibco, 11,875,093) containing 20% FBS (Invitrogen, 10,082–147), 2 mM Glutamax (Gibco, 35,050–061), 1% Penicillin-Streptomycin (Invitrogen, 15,140–122). The spent media, containing the virus particles was filtered and added to the PBMNCs. After a 3-h incubation, the EBV concentration was diluted with 20% RPMI supplemented with 500 μM Cyclosporine A. Small clumps of LCLs were seen after 3–5 days and identified as cells having uropods. These LCLs were grown and maintained in 20% RPMI media. 3.2. Generation of HiPSCs LCLs were adapted to the standard Human ES (HuES) media which is Knockout DMEM (Gibco, 10,829–018), 20% KOSR (Gibco, 10,828–028), 2 mM Glutamax, 1% Penicillin-Streptomycin, 0.1 mM non-essential amino acids (Gibco, 11,140–050), 0.1 mM beta-mercaptoethanol (Gibco, 21,985–023), 20 ng/ml basic fibroblast growth factor (Gibco, PHG6015). The electroporation was carried out using the Neon Transfection System (Invitrogen, USA) with the following standardized parameters – 1100 V, 20 ms width, 3 pulses with 0.1–0.6 million cells with three episomal plasmids encoding the pluripotency genes (Addgene # 27078, 27,080 & 27,077) and cells maintained in standard HuES media supplemented with 50 μg/ml ascorbic acid (Sigma, A8960) and 0.5 mM sodium butyrate (Sigma, B5887) On day 8 post-electroporation, the cells were shifted onto a feeder layer of gamma-irradiated mouse embryonic fibroblasts (MEFs). By day 10–14 primary iPSC colonies were observed. These were passaged manually for the initial 4–5 passages and subsequent passages were by enzymatic dissociation using StemPro Accutase (Gibco, A1110501) and Revita supplement (Gibco, A26445–01). 3.3. Immunocytochemistry Colonies were fixed using 4% paraformaldehyde (HiMedia, GRM3660) for 15 min, followed by permeabilization (Triton-X 100, Molecular probes, A24881) for 10 min. 1% BSA (Sigma, A9418) was used to block for 1 h. Cells were incubated overnight at 40Cwith Oct4 andSox2 primary antibodies at 1:200 and 1:100 dilutions respectively. Secondary antibodies were added for 1 h in the dark at room temperature at 1:250–1:500 dilution. DAPI was used to mark the nuclei. 3.4. Mycoplasma testing Spent media from a subconfluent HiPSC dish was collected after 48 h in culture and probed with the standard mycoplasm detection kit, namely MycoAlert™ (Lonza, LT07–418) as per the vendor's instructions. 2

Stem Cell Research 34 (2019) 101370

A.H. Najar et al.

Fig. 1. Cellular and molecular characterization of iPSC lines.

3

Stem Cell Research 34 (2019) 101370

A.H. Najar et al.

Table 1 Summary of lines. iPSC line names

Abbreviation

Gender

Age

Ethnicity

Genotype of locus

Disease

NCBSi001-A NCBSi002-A

AD3 AD5

Female Female

49 72

North Indian South Indian

PSEN1(1q24.2/NC_000014.9- (GRCh37/hg19) 1. GAP43(3q13.31/NC_000003.12- (GRCh37/hg19) 2. APOE3/4(19q13.32/NC_000019.10- (GRCh37/hg19)

Alzheimer's disease Alzheimer's disease

Table 2 Characterization and validation. Classification

Test

Result

Data

Morphology Phenotype

Microscopy Qualitative analysis Immunocytochemistry Quantitative analysis

Normal Immunostaining of pluripotency markers SOX2 and OCT4

Fig. 1A Fig. 1B

1. Co-localization of SOX2 and OCT4 with nuclear marker DAPI 2. PluriTest 3. Expression values for typical markers of pluripotency and differentiated state by RNA-Seq

HIV

2. Both cell lines passed the test acquiring high PluriTest score and low novel classic score 3. Both cell lines showed high expression values for pluripotentstate markers and low expression values for differentiated-state markers 1. NCBSi001-A: 46XX Resolution: 450 2. NCBSi002-A: 46XX Resolution: 550 Performed 10 loci tested for each line, All matched 1. NCBSi001-A: PSEN1 (Heterozygous) 2. NCBSi002-A: GAP43, APOE3/4 (both heterozygous) NA 1. NCBSi001-A: B/A ratio = 0.474 < 0.9 (negative) 2. NCBSi002-A: B/A ratio = 0.186 < 0.9 (negative) Expression of germ layer marker genes in embryoid body – SOX1(ectoderm), Activin A (mesoderm), GATA4 (endoderm) Negative

Blood group genotyping

Inferred blood group using WES

HLA tissue typing

Inferred blood group using WES

Genotype

Karyotype (G-banding) and resolution

Identity

STR analysis

Mutation analysis

Whole exome sequencing and Sanger sequencing

Microbiology and virology Differentiation potential Donor screening (OPTIONAL) Genotype additional info (OPTIONAL)

Southern Blot or WGS Mycoplasma detection by luminescence (MycoAlert™ mycoplasma detection kit; Lonza, LT07–418) Embryoid body formation

1. Fig. 1C 2. Fig. 1D 3. Fig. 1E

1. (a) NCBSi001-A i) R2 = 0.92; SOX2 vs DAPI) ii) R2 = 0.92; OCT4 vs DAPI) (b) NCBSi002-A i) R2 = 0.98; SOX2 vs DAPI) ii) R2 = 0.92; OCT4 vs DAPI)

Fig. 1G Submitted as an archive file Fig. 1J, K (Syama et al., 2018) NA NA Fig. 1H,I Data available but not shown Data available but not shown Data available but not shown

Table 3 Reagents details. Antibodies used for immunocytochemistry

Pluripotency markers Pluripotency markers Pluripotency markers Nuclear marker Secondary antibodies Secondary antibodies Secondary antibodies Secondary antibodies

Antibody

Dilution

Company Cat # and RRID

Rabbit Anti-OCT4 Mouse Anti-OCT3/4 (C-10) Rat Anti-SOX2 DAPI Alexa Fluor® 594 Donkey anti-rabbit Alexa Fluor® 488 Donkey anti-rat Alexa Fluor® 647 Goat Anti-Mouse IgG (H + L) Alexa Fluor® 568 Goat Anti-Mouse IgG (H + L)

1:100 1:300 1:100 N/A 1:250 1:250 1:250 1:500

Molecular Probes Cat# A24867, RRID: AB_2650999 Santa Cruz Biotechnology, cat. No. sc5279, RRID: AB_628051 Molecular Probes Cat# A24759, RRID: AB_2651000 Molecular Probes Cat# R37606, RRID: Not available Molecular Probes Cat# A24870, RRID: Not available Molecular Probes Cat# A24876, RRID: AB_2651007 Molecular Probes Cat# A21236, RRID: AB_141725 Molecular Probes Cat# A11126, RRID: AB_221538

Primers

Housekeeping genes (PCR on cDNA from EBs) Differentiation markers (PCR on cDNA from EBs) Differentiation markers (PCR on cDNA from EBs) Differentiation markers (PCR on cDNA from EBs) Plasmid footprint APOE genotype APOE genotype

Target

Forward/Reverse primer (5′-3′)

β-Actin SOX1 (Ectoderm) Activin A (Mesoderm) GATA4 (Endoderm) SOX2-KLF4 junction within the episomal plasmid E3 E4

TCACCCACACTGTGCCCATCTACGA/CAGCGGAACCGCTCATTGCCAATGG GGGAAAACGGGCAAAATAAT/CCATCTGGGCTTCAAGTGTT GAATGAACTTATGGAGCAGACC/TCACTCCTCTCCCCCTTTAAGCCCA TCCAAACCAGAAAACGGAAG/CTGTGCCCGTAGTGAGATGA TTCTTCTTTTTCCTACAGCTCC/TAAAAATGTCTCTTCATGTGTAAGG

4

CGGACATGGAGGACGTGT/CTGGTACACTGCCAGGCG CGGACATGGAGGACGTGC/CTGGTACACTGCCAGGCG

Stem Cell Research 34 (2019) 101370

A.H. Najar et al.

Wheeler aligner, followed by removal of polymerase chain reaction duplicates. We used genome analysis toolkit and Varscan version 2.3.6 for indel alignment and single nucleotide polymorphism calling (coverage of ≥8 and p-value of 0.001). ii) Validation by Sanger sequencing: Genomic DNA from HiPSCs was isolated and amplified using primers specific for the disease-associated genes (PSEN1, GAP43, APOE). The purified PCR products were sequenced bidirectionally to confirm the donor-specific mutation profile.

3.5. Pluripotency test i) PluriTest: RNA was isolated from off-feeder grown HiPSCs using the standard Trizol protocol. Data was generated using IlluminaHiseq 2000 sequencer. The resulting FASTQ files from RNA sequencing data were used for the PluriTestanalysis, which compared the expression values of the HiPSC samples with a database of RNA transcripts from stem cells and other differentiated cell lines and the PluriTest scores were obtained. A good HiPSC line is expected to have a high PluriTest score and a low novel classic score indicating increased similarity to undifferentiated HiPSC than to differentiated cells.

3.8. ApoE genotyping gDNA from HiPSCs was used for ApoE haplotyping to confirm the ApoE status as per an earlier established protocol (Pantelidis et al., 2003). Briefly, specific primer PCR (SSP-PCR) methodology was used wherein a pair of internal control and a combination of APOE genotypespecific primers were used.

ii) Embryoid body (EB)-derived transcript analysis EBs were formed by allowing the HiPSCs to self-aggregate in suspension in standard HuES media without bFGF i.e. 20% KOSR minus bFGF for 48–72 h. RNA was isolated using the standard Trizol method and converted to cDNA using superscript III reverse transcriptase (Invitrogen, 18,080–093). Lineage-specific gene (ectoderm- SOX1; mesoderm- Activin A; endoderm- GATA4) transcript values were determined by RT-PCR.

Acknowledgements The authors thank Department of Biotechnology - DBT sanction Ref No. BT/01/CEIB/11/VI/11 (Sanction No. 102/IFD/SAN/363/20122013) funded Centre of Excellence grant, "Targeted generation and interrogation of cellular models and networks in neuro-psychiatric disorders using candidate genes" for financial support.

iii) For an additional set of markers representative of the three germ layers and trophoblast lineage, transcript values were extracted from the HiPSC RNAseq data to ascertain endogenous activation of pluripotency genes and levels (if any) of spontaneous differentiation.

Appendix A. Supplementary data Supplementary data to this article can be found online at https:// doi.org/10.1016/j.scr.2018.101370.

3.6. Karyotyping References Karyotyping was performed using 60–80% confluent off-feeder HiPSC cultures. The dish was pre-incubated with fresh E8 media for 2 h before the start of the experiment. Cells were arrested at metaphase using 0.1 μg/ml Colcemid (Gibco, 15,212–012) by incubating for 45 min at 37 °C. The cell pellet was resuspended in a hypotonic solution [comprising 1 g of Potassium chloride and 1 g of Trisodium citrate in 400 ml of water] and fixed in Carnoy's fixative (3:1:: methanol: glacial acetic acid). G-banding was performed on metaphase-arrested chromosome images by trained pathologists.

Hui-Yuen, J., McAllister, S., Koganti, S., Hill, E., Bhaduri-McIntosh, S., 2011. Establishment of epstein-barr virus growth-transformed lymphoblastoid cell lines. J. Vis. Exp. https://doi.org/10.3791/3321. e3321–e3321. Okita, K., Matsumura, Y., Sato, Y., Okada, A., Morizane, A., Okamoto, S., Hong, H., Nakagawa, M., Tanabe, K., Tezuka, K., et al., 2011. A more efficient method to generate integration-free human iPS cells. Nat. Methods 8, 409–412. https://doi.org/ 10.1038/nmeth.1591. Pantelidis, P., Lambert-Hammill, M., Wierzbicki, A.S., 2003. Simple sequence-specificprimer-PCR method to identify the three main apolipoprotein E haplotypes. Clin. Chem. 49, 1945–1948. https://doi.org/10.1373/clinchem.2003.021683. Sandelius, Å., Portelius, E., Källén, Å., Zetterberg, H., Rot, U., Olsson, B., Toledo, J.B., Shaw, L.M., Lee, V.M.Y., Irwin, D.J., et al., 2018. Elevated CSF GAP-43 is Alzheimer's disease specific and associated with tau and amyloid pathology. Alzheimers Dement. https://doi.org/10.1016/j.jalz.2018.08.006. Shah, H., Albanese, E., Duggan, C., Rudan, I., Langa, K.M., Carrillo, M.C., Chan, K.Y., Joanette, Y., Prince, M., Rossor, M., et al., 2016. Research priorities to reduce the global burden of dementia by 2025. Lancet Neurol. 15, 1285–1294. https://doi.org/ 10.1016/S1474-4422(16)30235-6. Syama, A., Sen, S., Kota, L.N., Viswanath, B., Purushottam, M., Varghese, M., Jain, S., Panicker, M.M., Mukherjee, O., 2018. Mutation burden profile in familial Alzheimer's disease cases from India. Neurobiol. Aging 64, 158.e7–158.e13. https://doi.org/10. 1016/j.neurobiolaging.2017.12.002.

3.7. Sequencing i) NGS: DNA library preparation for the exome sequencing was performed using Nextera rapid capture kit as per the manufacturer's protocol. Sequencing was performed on Illumina Hiseq 2000 using 100-bp paired-end reads. The quality check was performed on the raw sequence data using FastQC and reads with a quality score < 20 and/or singletons were removed using PRINSEQ. Paired-end reads were then aligned to hg19 (GRCh37) using the Burrows-

5