- Email: [email protected]
Generation of two iPSC lines (FAMRCi004-A and FAMRCi004-B) from patient with familial progressive cardiac conduction disorder carrying genetic variant DSP p.His1684Arg.
Stem Cell Research 43 (2020) 101720
Contents lists available at ScienceDirect
Stem Cell Research journal homepage: www.elsevier.com/locate/scr
Lab Resource: Multiple Cell Lines
Generation of two iPSC lines (FAMRCi004-A and FAMRCi004-B) from patient with familial progressive cardiac conduction disorder carrying genetic variant DSP p.His1684Arg.
T
Aleksandr Khudiakova, , Kseniya Perepelinaa,b, Polina Klauzena,b,c, Anna Zlotinaa, Konstantin Gusevc, Elena Kaznacheyevac, Anna Malashichevaa,b,c, Anna Kostarevaa ⁎
a b c
Almazov National Medical Research Centre, Saint-Petersburg, Russian Federation Saint Petersburg State University, Saint-Petersburg, Russian Federation Institute of Cytology RAS, Saint-Petersburg, Russian Federation
ABSTRACT
Human iPSC cell lines (FAMRCi004-A and FAMRCi004-B) were generated from patient with progressive cardiac conduction disease and sick sinus syndrome carrying DSP p.His1684Arg genetic variant. Patient-specific adipose tissue-derived mesenchymal multipotent stromal cells were reprogrammed using non-integrative Sendai viruses. Established iPSC lines showed normal karyotype, expressed pluripotent markers and were able to differentiate toward three germ layers in vitro. The reported iPSC lines could be useful tool for in vitro modeling of progressive cardiac conduction disease associated with mutations in desmosomal genes.
Resource Table: Unique stem cell lines identifier Alternative names of stem cell lines Institution Contact information of distributor Type of cell lines Origin Cell Source Clonality Method of reprogramming Multiline rationale Gene modification Type of modification Associated disease Gene/locus Method of modification
⁎
FAMRCi004-A, FAMRCi004-B NA Almazov National Medical Research centre Aleksandr Khudiakov, [email protected] iPSC Human Adipose tissue-derived mesenchymal multipotent stromal cells Clonal Sendai virus including the four reprogramming factors (OCT4, SOX2, KLF4, and CMYC) same disease isogenic cell lines YES Hereditary Familial progressive cardiac conduction, sick sinus syndrome, atrioventricular block DSP NM_004415:c.A5051G, NP_004406.2:p.His1684Arg (Chr6: 7581474A>G, GRCh37) NA
Name of transgene or resistance Inducible/constitutive system Date archived/stock date Cell line repository/bank Ethical approval
NA NA 29th October 2019 https://hpscreg.eu/cell-line/FAMRCi004-A https://hpscreg.eu/cell-line/FAMRCi004-B The local ethical committee of Almazov National Medical Research centre approval obtained. Patient informed consent obtained.
1. Resource utility The iPSC lines generated from patient carrying a disease-associated genetic variant in DSP gene is a useful cellular model for investigation of desmosomal genes-related progressive cardiac conduction disease (Tables 1 and 2). 2. Resource details Progressive cardiac conduction disease (PCCD) is a rare genetic disease associated with excitation conduction delay, atrioventricular
Corresponding author: Institute of molecular biology and genetics, Akkuratova 2, 197341 Saint-Petersburg, Russian Federation E-mail address: [email protected] (A. Khudiakov).
https://doi.org/10.1016/j.scr.2020.101720 Received 4 December 2019; Received in revised form 13 January 2020; Accepted 25 January 2020 Available online 04 February 2020 1873-5061/ © 2020 The Authors. Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/BY-NC-ND/4.0/).
Stem Cell Research 43 (2020) 101720
Familial progressive cardiac conduction defect, sick sinus syndrome, atrioventricular block Familial progressive cardiac conduction defect, sick sinus syndrome, atrioventricular block NM_004415:c.A5051G NM_004415:c.A5051G Caucasian Caucasian
block and sudden death. DSP p.His1684Arg genetic variant was previously reported by our group as PCCD causing (Kiselev et al., 2016). In this study, we have generated two iPSC lines (FAMRCi004-A and FAMRCi004-B) from patient-specific adipose tissue-derived mesenchymal multipotent stromal cells. OCT4, SOX2, KLF4 and CMYC reprogramming factors were delivered using CytoTune-iPS 2.0 Sendai Reprogramming Kit (Thermo Fisher Scientific) according to the manufacturer's instructions. iPSCs were generated on feeder layer of mouse embryonic fibroblasts and then transferred to feeder-free conditions for further propagation and characterization. Generated iPSC lines exhibited a typical hESC-like morphology (Fig. 1A). FAMRCi004-A and FAMRCi004-B lines expressed pluripotent markers (OCT4, NANOG, and SEEA4), as was assessed by immunofluorescence staining (Fig. 1B), and expressed alkaline phosphatase (Fig. 1C). QPCR analysis demonstrated that FAMRCi004-A and FAMRCi004-B lines expressed pluripotency-related genes on the level similar to hESCs (Fig. 1D). Exogenous transgenes were eliminated from the generated iPSCs (Fig. 1E). Sanger sequencing results confirmed that the FAMRCi004-A and FAMRCi004-B retained the patient-specific heterozygous DSP mutation (Fig. 1F). Both iPSC lines had a normal 46, XY karyotype (Fig. 1G). Note, that comparative genomic hybridization array analysis (array CGH) does not reveal translocations or inversions, alterations in chromosome structure, mosaicism or polyploidy. Flow cytometry quantitative analysis revealed high expression of human iPSC-specific surface marker SEEA4 in FAMRCi004-A and FAMRCi004-B lines (99.2% and 99.7% respectively) (Fig. 1H). Generated iPSC lines were able to differentiate into three germ layers derivatives in vitro (Fig. 1I). The identity of iPSCs was confirmed using STR analysis (Supplementary file). The FAMRCi004-A and FAMRCi004-B lines were negative for mycoplasma contamination (Supplementary file). In conclusion, generated iPSC lines carrying DSP p.His1684Arg genetic variant would support in vitro functional studies aimed to identify molecular features of PCCD development. 3. Materials and methods 3.1. Ethic statement The study was performed in accordance with the ethical standards of the Almazov National Medical Research centre ethical committee (approval №13/19.06.2014) and with the 1964 Helsinki Declaration and its later amendments or comparable ethical standards. Informed consent was obtained from all individual participants involved in the study. 3.1.1. Isolation and culture of human adipose tissue-derived mesenchymal multipotent stromal cells Adipose tissue-derived mesenchymal multipotent stromal cells were isolated and cultivated as described previously (Khudiakov et al., 2017).
FAMRCi004-A FAMRCi004-B FAMRCi004-A FAMRCi004-B
Male Male
19 19
Disease Ethnicity Abbreviation in figures iPSC line names
Table 1 Summary of lines.
Gender
Age
Genotype of locus
A. Khudiakov, et al.
3.1.2. Generation and cultivation of iPSCs Adipose tissue-derived mesenchymal multipotent stromal cells were reprogrammed to iPSCs using CytoTune™-iPS 2.0 Sendai Reprogramming Kit (Thermo Fisher Scientific) as described previously (Khudiakov et al., 2017), and then were adapted to feeder-free conditions by passaging on Geltrex-coated plates in Essential 8 medium (Thermo Fisher Scientific). Cells were cultured at 37 °C in humidified atmosphere containing 5% CO2, feeding daily until the cells reached 80–90% confluency. Cells were passaged onto fresh Geltrex-coated plates using ReLeSR (Stem Cell Technologies) into Essential 8 medium containing 5 μM Rock kinase inhibitor Y-27632 (Tocris). 3.1.3. DNA sequencing DNA sequencing was performed as described previously (Khudiakov et al., 2017). The primer sequences are listed in Table 3. 2
Stem Cell Research 43 (2020) 101720
A. Khudiakov, et al.
Table 2 Characterization and validation. Classification
Test
Result
Data
Morphology Phenotype
Photography Immunocytochemistry Alkaline Phosphatase staining Flow cytometry
Fig. Fig. Fig. Fig.
Genotype Identity
CGH-array Microsatellite PCR (mPCR) STR analysis
Visual record of the line: normal OCT4, NANOG, SSEA4 Positive SSEA4: 99.2% (FAMRCi004-A) SSEA4: 99.7% (FAMRCi004-B) 46,XY NA
Mutation analysis (IF APPLICABLE)
Sequencing
11 STR loci were tested, all matched Heterozygous mutation
Submitted as Supplementary file Fig. 1 panel F
Microbiology and virology Differentiation potential Donor screening (OPTIONAL) Genotype additional info (OPTIONAL)
Southern Blot OR WGS Mycoplasma Three germ layers formation HIV 1 + 2 Hepatitis B, Hepatitis C Blood group genotyping HLA tissue typing
NA Mycoplasma testing by RT-PCR, negative Proofs of three germ layers formation in vitro NA NA NA
NA Submitted as Supplementary file Fig. 1 panel I NA NA NA
3.1.4. Comparative genomic hybridization array analysis (array CGH) Array CGH was performed as described previously (Khudiakov et al., 2017) using iPSC lines at passage 10.
1 1 1 1
panel panel panel panel
A B C H
Fig. 1 panel G NA
pluripotency-related genes expression level. RT-PCR analysis with KOS, C-MYC and KLF4 specific primers was used to confirm the elimination of exogenous transgenes in iPSC lines. The primers sequences are shown in Table 3.
3.1.5. Short tandem repeats analysis For demonstration of obtained iPSC lines’ identity, 11 STR loci were analyzed using COrDIS mini2 STR Amplification Kit (Gordiz).
3.1.9. Differentiation of iPSCs into three germ layers STEMdiff™ Trilineage Differentiation Kit (Stem Cell Technologies, Canada) with subsequent immunofluorescent staining against lineagespecific markers was used to validate the differentiation potential of the established iPSC lines. Used antibodies are listed in Table 3.
3.1.6. Immunofluorescence and flow cytometry Immunofluorescent staining of iPSCs was performed as described previously (Khudiakov et al., 2017). Images were captured using AxioObserver Z1 (Zeiss) microscope and processed with Zen software. Flow cytometry was performed using CytoFLEX (Beckman Coulter) and CytExpert software (Beckman Coulter) for data analyzing. Antibodies used in this study are listed in Table 3.
3.1.10. Mycoplasma detection RT-PCR with primers specific to mycoplasma 16S ribosomal RNA (Uphoff and Drexler, 2002) was used to prove the absence of mycoplasma contamination.
3.1.7. Alkaline phosphatase staining Evaluation of alkaline phosphatase activity was performed using NBT/ BCIP (Roche) substrate according to manufacturer's instructions.
Funding The work was supported by grant of the Russian Science Foundation (project № 19-75-00070).
3.1.8. RT-PCR and qPCR Extract RNA reagent (Evrogen) was used for total RNA extraction. RNA was treated with DNaseI (Thermo Fisher Scientific) and reverse transcribed into cDNA by MMLV RT kit (Evrogen). QPCR was performed using the qPCRmix-HS SYBR+LowROX (Evrogen). GAPDH was used as reference gene. C612 hES line was used for comparison of
Declaration of Competing Interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.
3
Stem Cell Research 43 (2020) 101720
A. Khudiakov, et al.
Fig. 1. Characterization of FAMRCi004-A and FAMRCi004-B iPSC lines.
4
Stem Cell Research 43 (2020) 101720
A. Khudiakov, et al.
Table 3 Reagents details. Antibodies used for immunocytochemistry/flow-citometry Antibody Pluripotency Markers Goat anti-OCT4 Pluripotency Markers Mouse anti-NANOG Pluripotency Markers Mouse anti-SSEA4 Differentiation Markers Mouse anti-βIII Tubulin Differentiation Markers Goat anti-Brachyury Differentiation Markers Goat anti-GATA6 Secondary antibodies AF488 Goat Anti-Mouse IgG Secondary antibodies AF488 Donkey Anti-Goat IgG Primers Target Sendai virus transgenes (RT-PCR) KOS sequence Sendai virus genome (RT-PCR) Sendai virus genome sequence (SeV) House-keeping gene (RT-PCR) GAPDH Pluripotency markers (RT-PCR) OCT4 Pluripotency markers (RT-PCR) NANOG Pluripotency markers (RT-PCR) SOX2 House-keeping gene (qRT-PCR) GAPDH Mutation sequencing (with M13 DSP exon 23 adapter)
Dilution 1:200 1:200 1:200 1:200 1:200 1:200 1:1000
Company Cat # and RRID Santa Cruz Cat# 9656, RRID:AB_653551 Millipore Cat# MABD24, RRID:AB_11203826 R&D Systems Cat# MAB1435, RRID:AB_357704 R&D Systems Cat# MAB1195, RRID:AB_357520 R&D Systems Cat# AF2085, RRID:AB_2200235 R&D Systems Cat# AF1700 RRID:AB_2,108,901 Invitrogen Cat# A11029, RRID:AB_138404
1:1000
Invitrogen Cat# A11029, RRID:AB_2534102
Forward/Reverse primer (5′−3′) ATGCACCGCTACGACGTGAGCGC/ACCTTGACAATCCTGATGTGG GGATCACTAGGTGATATCGAGC/ACCAGACAAGAGTTTAAGAGATATGTATC CAAGGTCATCCATGACAACTTTG/GTCCACCACCCTGTTGCTGTAG GAAGGAGAAGCTGGAGCAAA/CTTCTGCTTCAGGAGCTTGG CAGCCCTGATTCTTCCACCAGTCCC/TGGAAGGTTCCCAGTCGGGTTCACC AACCCCAAGATGCACAACTC/GCTTAGCCTCGTCGATGAAC AATGAAGGGGTCATTGATGG/AAGGTGAAGGTCGGAGTCAA TGTAAAACGACGGCCAGT ATCAAAATCACCAACCTGACCCA/ CAGGAAACAGCTATGACCATTTTTATCACTGTCCGCTTCGC
Supplementary materials
Tomilin, A., Kostareva, A., Malashicheva, A., 2017. Generation of iPSC line from patient with arrhythmogenic right ventricular cardiomyopathy carrying mutations in PKP2 gene. Stem Cell Res. 24, 85–88. https://doi.org/10.1016/j.scr.2017.08.014. Kiselev, A., Mikhaylov, E., Parmon, E., Sjoberg, G., Sejersen, T., Tarnovskaya, S., Nugnyi, P., Mitrofanova, L., Lebedev, D., Kostareva, A., 2016. Progressive cardiac conduction disease associated with a DSP gene mutation. Int. J. Cardiol. 216, 188–189. https:// doi.org/10.1016/j.ijcard.2016.04.164. Uphoff, C.C., Drexler, H.G., 2002. Comparative PCR analysis for detection of mycoplasma infections in continuous cell lines. Vitr. Cell. Dev. Biol. - Anim. 38, 79. https://doi. org/10.1290/1071-2690(2002)038<0079:CPAFDO>2.0.CO;2.
Supplementary material associated with this article can be found, in the online version, at doi:10.1016/j.scr.2020.101720. References Khudiakov, A., Kostina, D., Zlotina, A., Yany, N., Sergushichev, A., Pervunina, T.,
5
Contents lists available at ScienceDirect
Stem Cell Research journal homepage: www.elsevier.com/locate/scr
Lab Resource: Multiple Cell Lines
Generation of two iPSC lines (FAMRCi004-A and FAMRCi004-B) from patient with familial progressive cardiac conduction disorder carrying genetic variant DSP p.His1684Arg.
T
Aleksandr Khudiakova, , Kseniya Perepelinaa,b, Polina Klauzena,b,c, Anna Zlotinaa, Konstantin Gusevc, Elena Kaznacheyevac, Anna Malashichevaa,b,c, Anna Kostarevaa ⁎
a b c
Almazov National Medical Research Centre, Saint-Petersburg, Russian Federation Saint Petersburg State University, Saint-Petersburg, Russian Federation Institute of Cytology RAS, Saint-Petersburg, Russian Federation
ABSTRACT
Human iPSC cell lines (FAMRCi004-A and FAMRCi004-B) were generated from patient with progressive cardiac conduction disease and sick sinus syndrome carrying DSP p.His1684Arg genetic variant. Patient-specific adipose tissue-derived mesenchymal multipotent stromal cells were reprogrammed using non-integrative Sendai viruses. Established iPSC lines showed normal karyotype, expressed pluripotent markers and were able to differentiate toward three germ layers in vitro. The reported iPSC lines could be useful tool for in vitro modeling of progressive cardiac conduction disease associated with mutations in desmosomal genes.
Resource Table: Unique stem cell lines identifier Alternative names of stem cell lines Institution Contact information of distributor Type of cell lines Origin Cell Source Clonality Method of reprogramming Multiline rationale Gene modification Type of modification Associated disease Gene/locus Method of modification
⁎
FAMRCi004-A, FAMRCi004-B NA Almazov National Medical Research centre Aleksandr Khudiakov, [email protected] iPSC Human Adipose tissue-derived mesenchymal multipotent stromal cells Clonal Sendai virus including the four reprogramming factors (OCT4, SOX2, KLF4, and CMYC) same disease isogenic cell lines YES Hereditary Familial progressive cardiac conduction, sick sinus syndrome, atrioventricular block DSP NM_004415:c.A5051G, NP_004406.2:p.His1684Arg (Chr6: 7581474A>G, GRCh37) NA
Name of transgene or resistance Inducible/constitutive system Date archived/stock date Cell line repository/bank Ethical approval
NA NA 29th October 2019 https://hpscreg.eu/cell-line/FAMRCi004-A https://hpscreg.eu/cell-line/FAMRCi004-B The local ethical committee of Almazov National Medical Research centre approval obtained. Patient informed consent obtained.
1. Resource utility The iPSC lines generated from patient carrying a disease-associated genetic variant in DSP gene is a useful cellular model for investigation of desmosomal genes-related progressive cardiac conduction disease (Tables 1 and 2). 2. Resource details Progressive cardiac conduction disease (PCCD) is a rare genetic disease associated with excitation conduction delay, atrioventricular
Corresponding author: Institute of molecular biology and genetics, Akkuratova 2, 197341 Saint-Petersburg, Russian Federation E-mail address: [email protected] (A. Khudiakov).
https://doi.org/10.1016/j.scr.2020.101720 Received 4 December 2019; Received in revised form 13 January 2020; Accepted 25 January 2020 Available online 04 February 2020 1873-5061/ © 2020 The Authors. Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/BY-NC-ND/4.0/).
Stem Cell Research 43 (2020) 101720
Familial progressive cardiac conduction defect, sick sinus syndrome, atrioventricular block Familial progressive cardiac conduction defect, sick sinus syndrome, atrioventricular block NM_004415:c.A5051G NM_004415:c.A5051G Caucasian Caucasian
block and sudden death. DSP p.His1684Arg genetic variant was previously reported by our group as PCCD causing (Kiselev et al., 2016). In this study, we have generated two iPSC lines (FAMRCi004-A and FAMRCi004-B) from patient-specific adipose tissue-derived mesenchymal multipotent stromal cells. OCT4, SOX2, KLF4 and CMYC reprogramming factors were delivered using CytoTune-iPS 2.0 Sendai Reprogramming Kit (Thermo Fisher Scientific) according to the manufacturer's instructions. iPSCs were generated on feeder layer of mouse embryonic fibroblasts and then transferred to feeder-free conditions for further propagation and characterization. Generated iPSC lines exhibited a typical hESC-like morphology (Fig. 1A). FAMRCi004-A and FAMRCi004-B lines expressed pluripotent markers (OCT4, NANOG, and SEEA4), as was assessed by immunofluorescence staining (Fig. 1B), and expressed alkaline phosphatase (Fig. 1C). QPCR analysis demonstrated that FAMRCi004-A and FAMRCi004-B lines expressed pluripotency-related genes on the level similar to hESCs (Fig. 1D). Exogenous transgenes were eliminated from the generated iPSCs (Fig. 1E). Sanger sequencing results confirmed that the FAMRCi004-A and FAMRCi004-B retained the patient-specific heterozygous DSP mutation (Fig. 1F). Both iPSC lines had a normal 46, XY karyotype (Fig. 1G). Note, that comparative genomic hybridization array analysis (array CGH) does not reveal translocations or inversions, alterations in chromosome structure, mosaicism or polyploidy. Flow cytometry quantitative analysis revealed high expression of human iPSC-specific surface marker SEEA4 in FAMRCi004-A and FAMRCi004-B lines (99.2% and 99.7% respectively) (Fig. 1H). Generated iPSC lines were able to differentiate into three germ layers derivatives in vitro (Fig. 1I). The identity of iPSCs was confirmed using STR analysis (Supplementary file). The FAMRCi004-A and FAMRCi004-B lines were negative for mycoplasma contamination (Supplementary file). In conclusion, generated iPSC lines carrying DSP p.His1684Arg genetic variant would support in vitro functional studies aimed to identify molecular features of PCCD development. 3. Materials and methods 3.1. Ethic statement The study was performed in accordance with the ethical standards of the Almazov National Medical Research centre ethical committee (approval №13/19.06.2014) and with the 1964 Helsinki Declaration and its later amendments or comparable ethical standards. Informed consent was obtained from all individual participants involved in the study. 3.1.1. Isolation and culture of human adipose tissue-derived mesenchymal multipotent stromal cells Adipose tissue-derived mesenchymal multipotent stromal cells were isolated and cultivated as described previously (Khudiakov et al., 2017).
FAMRCi004-A FAMRCi004-B FAMRCi004-A FAMRCi004-B
Male Male
19 19
Disease Ethnicity Abbreviation in figures iPSC line names
Table 1 Summary of lines.
Gender
Age
Genotype of locus
A. Khudiakov, et al.
3.1.2. Generation and cultivation of iPSCs Adipose tissue-derived mesenchymal multipotent stromal cells were reprogrammed to iPSCs using CytoTune™-iPS 2.0 Sendai Reprogramming Kit (Thermo Fisher Scientific) as described previously (Khudiakov et al., 2017), and then were adapted to feeder-free conditions by passaging on Geltrex-coated plates in Essential 8 medium (Thermo Fisher Scientific). Cells were cultured at 37 °C in humidified atmosphere containing 5% CO2, feeding daily until the cells reached 80–90% confluency. Cells were passaged onto fresh Geltrex-coated plates using ReLeSR (Stem Cell Technologies) into Essential 8 medium containing 5 μM Rock kinase inhibitor Y-27632 (Tocris). 3.1.3. DNA sequencing DNA sequencing was performed as described previously (Khudiakov et al., 2017). The primer sequences are listed in Table 3. 2
Stem Cell Research 43 (2020) 101720
A. Khudiakov, et al.
Table 2 Characterization and validation. Classification
Test
Result
Data
Morphology Phenotype
Photography Immunocytochemistry Alkaline Phosphatase staining Flow cytometry
Fig. Fig. Fig. Fig.
Genotype Identity
CGH-array Microsatellite PCR (mPCR) STR analysis
Visual record of the line: normal OCT4, NANOG, SSEA4 Positive SSEA4: 99.2% (FAMRCi004-A) SSEA4: 99.7% (FAMRCi004-B) 46,XY NA
Mutation analysis (IF APPLICABLE)
Sequencing
11 STR loci were tested, all matched Heterozygous mutation
Submitted as Supplementary file Fig. 1 panel F
Microbiology and virology Differentiation potential Donor screening (OPTIONAL) Genotype additional info (OPTIONAL)
Southern Blot OR WGS Mycoplasma Three germ layers formation HIV 1 + 2 Hepatitis B, Hepatitis C Blood group genotyping HLA tissue typing
NA Mycoplasma testing by RT-PCR, negative Proofs of three germ layers formation in vitro NA NA NA
NA Submitted as Supplementary file Fig. 1 panel I NA NA NA
3.1.4. Comparative genomic hybridization array analysis (array CGH) Array CGH was performed as described previously (Khudiakov et al., 2017) using iPSC lines at passage 10.
1 1 1 1
panel panel panel panel
A B C H
Fig. 1 panel G NA
pluripotency-related genes expression level. RT-PCR analysis with KOS, C-MYC and KLF4 specific primers was used to confirm the elimination of exogenous transgenes in iPSC lines. The primers sequences are shown in Table 3.
3.1.5. Short tandem repeats analysis For demonstration of obtained iPSC lines’ identity, 11 STR loci were analyzed using COrDIS mini2 STR Amplification Kit (Gordiz).
3.1.9. Differentiation of iPSCs into three germ layers STEMdiff™ Trilineage Differentiation Kit (Stem Cell Technologies, Canada) with subsequent immunofluorescent staining against lineagespecific markers was used to validate the differentiation potential of the established iPSC lines. Used antibodies are listed in Table 3.
3.1.6. Immunofluorescence and flow cytometry Immunofluorescent staining of iPSCs was performed as described previously (Khudiakov et al., 2017). Images were captured using AxioObserver Z1 (Zeiss) microscope and processed with Zen software. Flow cytometry was performed using CytoFLEX (Beckman Coulter) and CytExpert software (Beckman Coulter) for data analyzing. Antibodies used in this study are listed in Table 3.
3.1.10. Mycoplasma detection RT-PCR with primers specific to mycoplasma 16S ribosomal RNA (Uphoff and Drexler, 2002) was used to prove the absence of mycoplasma contamination.
3.1.7. Alkaline phosphatase staining Evaluation of alkaline phosphatase activity was performed using NBT/ BCIP (Roche) substrate according to manufacturer's instructions.
Funding The work was supported by grant of the Russian Science Foundation (project № 19-75-00070).
3.1.8. RT-PCR and qPCR Extract RNA reagent (Evrogen) was used for total RNA extraction. RNA was treated with DNaseI (Thermo Fisher Scientific) and reverse transcribed into cDNA by MMLV RT kit (Evrogen). QPCR was performed using the qPCRmix-HS SYBR+LowROX (Evrogen). GAPDH was used as reference gene. C612 hES line was used for comparison of
Declaration of Competing Interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.
3
Stem Cell Research 43 (2020) 101720
A. Khudiakov, et al.
Fig. 1. Characterization of FAMRCi004-A and FAMRCi004-B iPSC lines.
4
Stem Cell Research 43 (2020) 101720
A. Khudiakov, et al.
Table 3 Reagents details. Antibodies used for immunocytochemistry/flow-citometry Antibody Pluripotency Markers Goat anti-OCT4 Pluripotency Markers Mouse anti-NANOG Pluripotency Markers Mouse anti-SSEA4 Differentiation Markers Mouse anti-βIII Tubulin Differentiation Markers Goat anti-Brachyury Differentiation Markers Goat anti-GATA6 Secondary antibodies AF488 Goat Anti-Mouse IgG Secondary antibodies AF488 Donkey Anti-Goat IgG Primers Target Sendai virus transgenes (RT-PCR) KOS sequence Sendai virus genome (RT-PCR) Sendai virus genome sequence (SeV) House-keeping gene (RT-PCR) GAPDH Pluripotency markers (RT-PCR) OCT4 Pluripotency markers (RT-PCR) NANOG Pluripotency markers (RT-PCR) SOX2 House-keeping gene (qRT-PCR) GAPDH Mutation sequencing (with M13 DSP exon 23 adapter)
Dilution 1:200 1:200 1:200 1:200 1:200 1:200 1:1000
Company Cat # and RRID Santa Cruz Cat# 9656, RRID:AB_653551 Millipore Cat# MABD24, RRID:AB_11203826 R&D Systems Cat# MAB1435, RRID:AB_357704 R&D Systems Cat# MAB1195, RRID:AB_357520 R&D Systems Cat# AF2085, RRID:AB_2200235 R&D Systems Cat# AF1700 RRID:AB_2,108,901 Invitrogen Cat# A11029, RRID:AB_138404
1:1000
Invitrogen Cat# A11029, RRID:AB_2534102
Forward/Reverse primer (5′−3′) ATGCACCGCTACGACGTGAGCGC/ACCTTGACAATCCTGATGTGG GGATCACTAGGTGATATCGAGC/ACCAGACAAGAGTTTAAGAGATATGTATC CAAGGTCATCCATGACAACTTTG/GTCCACCACCCTGTTGCTGTAG GAAGGAGAAGCTGGAGCAAA/CTTCTGCTTCAGGAGCTTGG CAGCCCTGATTCTTCCACCAGTCCC/TGGAAGGTTCCCAGTCGGGTTCACC AACCCCAAGATGCACAACTC/GCTTAGCCTCGTCGATGAAC AATGAAGGGGTCATTGATGG/AAGGTGAAGGTCGGAGTCAA TGTAAAACGACGGCCAGT ATCAAAATCACCAACCTGACCCA/ CAGGAAACAGCTATGACCATTTTTATCACTGTCCGCTTCGC
Supplementary materials
Tomilin, A., Kostareva, A., Malashicheva, A., 2017. Generation of iPSC line from patient with arrhythmogenic right ventricular cardiomyopathy carrying mutations in PKP2 gene. Stem Cell Res. 24, 85–88. https://doi.org/10.1016/j.scr.2017.08.014. Kiselev, A., Mikhaylov, E., Parmon, E., Sjoberg, G., Sejersen, T., Tarnovskaya, S., Nugnyi, P., Mitrofanova, L., Lebedev, D., Kostareva, A., 2016. Progressive cardiac conduction disease associated with a DSP gene mutation. Int. J. Cardiol. 216, 188–189. https:// doi.org/10.1016/j.ijcard.2016.04.164. Uphoff, C.C., Drexler, H.G., 2002. Comparative PCR analysis for detection of mycoplasma infections in continuous cell lines. Vitr. Cell. Dev. Biol. - Anim. 38, 79. https://doi. org/10.1290/1071-2690(2002)038<0079:CPAFDO>2.0.CO;2.
Supplementary material associated with this article can be found, in the online version, at doi:10.1016/j.scr.2020.101720. References Khudiakov, A., Kostina, D., Zlotina, A., Yany, N., Sergushichev, A., Pervunina, T.,
5