Effect of acute exposure to nitrite on physiological parameters, oxidative stress, and apoptosis in Takifugu rubripes

Ecotoxicology and Environmental Safety 188 (2020) 109878

Contents lists available at ScienceDirect

Ecotoxicology and Environmental Safety journal homepage: www.elsevier.com/locate/ecoenv

Effect of acute exposure to nitrite on physiological parameters, oxidative stress, and apoptosis in Takifugu rubripes

T

Xiao-Qiang Gaoa, Fan Feia,c, Huan Huan Huod, Bin Huanga, Xue Song Menge, Tao Zhange, Bao-Liang Liua,b,∗ a Key Laboratory for Sustainable Development of Marine Fisheries, Ministry of Agriculture, Qingdao Key Laboratory for Marine Fish Breeding and Biotechnology, Yellow Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences, Qingdao, 266071, People's Republic of China b Laboratory for Marine Fisheries Science and Food Production Processes, Qingdao National Laboratory for Marine Science and Technology, Qingdao, 266071, People's Republic of China c Key Laboratory of Environment Controlled Aquaculture, Ministry of Education, Dalian Ocean University, Dalian, People's Republic of China d College of Animal Science and Technology, Jiangxi Agricultural University, NanChang, 330045, People's Republic of China e Dalian Tianzheng Industrial Co. Ltd., Dalian, 116000, People's Republic of China

A R T I C LE I N FO

A B S T R A C T

Keywords: Nitrite Blood parameter Oxidative stress Apoptosis Takifugu rubripes

In the present study, we evaluated the effects of nitrite exposure on hematological parameters, oxidative stress, and apoptosis in juvenile Takifugu rubripes. The fish were exposed to nitrite (0, 0.5, 1, 3, and 6 mM) for up to 96 h. In the high nitrite concentration groups (i.e., 3 and 6 mM), the concentrations of methemoglobin (MetHb), cortisol, glucose, heat shock protein (Hsp)-70, Hsp-90, and potassium (K+) were significantly elevated. Whereas, the concentrations of hemoglobin (Hb), triglyceride (TG), total cholesterol (TC), and sodium (Na+) and chloride (Cl−) ions were significantly decreased. Compared with those of the control groups, the concentrations of the antioxidant enzymes, namely, superoxide dismutase (SOD), catalase (CAT), glutathione (GSH), and glutathione peroxidase (GPx), in the gills were considerably elevated at 12 and 24 h after exposure to nitrite (1, 3, and 6 mM), but reduced at 48 and 96 h. The increase in the antioxidant enzymes may contribute to the elimination of reactive oxygen species (ROS) induced by nitrite during early nitrite exposure, when the antioxidant system is not sufficiently effective to eliminate or neutralize excessive ROS. In addition, we found that nitrite exposure could alter the expression patterns of some key apoptosis-related genes (Caspase-3, Caspase-8, Caspase-9, p53, Bax, and Bcl-2). This indicated that the caspase-dependent apoptotic pathway and p53–Bax–Bcl-2 pathway might be involved in apoptosis induced by nitrite exposure. Furthermore, our study provides insights into how acute nitrite exposure affects the physiological responses and potential molecular mechanism of apoptosis in marine fish. The results can help elucidate the mechanisms involved in nitrite-induced aquatic toxicology in marine fish.

1. Introduction Nitrite is toxic to aquatic ecosystem; it is formed by bacterial nitrification of ammonia or denitrification of nitrate. It may accumulate to unusually high concentrations (i.e., to 1 mmol L−1 or higher) in intensified aquaculture, especially in recirculated aquaculture systems, due to imbalanced activities of nitrifying bacteria (Nitrosomas spp. and Nitrobacter spp.) (Colt and Armstrong, 1981; Rakocy et al., 1992; Jensen, 2003). A high concentration of nitrite in the aquatic environment is a potential stress-inducing factor and is generally more toxic to cultured animals (Otfda et al., 2004).

Nitrite bioaccumulates in the blood via the gills (Deane and Woo, 2007), and then enters red blood cells and reacts with oxygenated hemoglobin (Hb) molecule to form methemoglobin (metHb). Nitrite is also oxidized to nitrate or reacts with deoxygenated Hb to form metHb and nitric oxide (Kosaka and Tyuma, 1983; Jensen, 2009). MetHb lowers the oxygen-carrying capacity of blood during nitrite exposure (Jensen, 2007). In addition, nitrite can cause oxidative stress in organisms by increasing the production of reactive oxygen species (ROS) (Wang et al., 2004). Overproduction of stress-induced ROS can indirectly damage important biomacromolecules within the host, including DNA, proteins (oxidation), and lipids (peroxidation), and

∗ Corresponding author. Key Laboratory for Sustainable Development of Marine Fisheries, Ministry of Agriculture, Qingdao Key Laboratory for Marine Fish Breeding and Biotechnology, Yellow Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences, Qingdao, 266071, People's Republic of China. E-mail address: [email protected] (B.-L. Liu).

https://doi.org/10.1016/j.ecoenv.2019.109878 Received 8 August 2019; Received in revised form 16 October 2019; Accepted 25 October 2019 0147-6513/ © 2019 Elsevier Inc. All rights reserved.

Ecotoxicology and Environmental Safety 188 (2020) 109878

X.-Q. Gao, et al.

selected for exposure to the various concentrations [0, 0.5, 1, 3, and 6 mM] of nitrite for up to 96 h. There were 25 juveniles in each group, and the experiments were conducted in triplicate. During the exposure period, half of the water was renewed every 24 h by adding nitrite stock solution to maintain the required nitrite concentrations. The actual concentrations of nitrite in the test solution were confirmed spectrophotometrically according to the Griess method (Bryan and Grisham, 2007). This experiment was carried out in strict accordance with the recommendation in the Guide for the Care and Use of Laboratory Animals of Chinese Academy of Fishery Sciences. The procedures were approved by the Committee on the Ethics of Animal Experiments of Chinese Academy of Fishery Sciences.

initiate a cascade of events that result in impaired cellular function (Zhang et al., 2015). To counteract oxidative stress and maintain a balanced cellular redox state, organisms have evolved antioxidant defense systems that act at different levels to prevent or repair such damages (Cheng et al., 2015). Antioxidant enzymes play a crucial important role in clearing excessive ROS (Dandapat et al., 2003; Cheng et al., 2006). Several studies have reported that high concentrations of nitrite can alter antioxidant enzyme activities in fish (Jiang et al., 2014; Sun et al., 2014; Lin et al., 2018). Heat shock proteins (Hsps) function as an additional protection system against oxidative stress by preventing the irreversible loss of vital proteins and facilitating their subsequent regeneration (Song et al., 2018). Hsps, a group of highly conserved proteins, are expressed at high levels in tissues of fish exposed to different kinds of stress conditions (Grôsvik and Goksôyr, 1996; Sørensen et al., 2003; Sanders, 2008). Although cells have different protective mechanisms against environmental stress, increased stress levels beyond the ability of cells to respond may lead to cell injury, necrosis, and apoptosis (Chandra et al., 2000). Apoptosis, characterized by cell shrinkage, chromatin condensation, internucleosomal DNA fragmentation, and apoptotic body formation, is a highly organized cellular physiological process, which is accompanied by the activation of diverse intracellular proteases and endonucleases (Chandra et al., 2000; Takle and Andersen, 2010). It is one of the central regulatory features of the immune defense mechanism against biological and pathological processes. Takifugu rubripes, the Japanese puffer fish, is a commercially important species in China owing to its taste and high economic value. The species is intensely farmed at high stocking densities in recirculating aquaculture systems, where they are likely to encounter high levels of aquatic nitrite. The gills of teleost fish are a multipurpose organ, which play dominant roles in osmotic and ionic regulation, acidbase regulation, and waste excretion. It is a major organ for the uptake and depuration of many toxicants including nitrite. Thus, it can be seen that gills are more vulnerable to toxicants than other organs. So we chose the gill as a target tissue. To better understand the effects of nitrite exposure, the hematological index, antioxidant enzymes, and some key apoptosis-related genes in the gills of this species exposed to different concentrations of nitrite were investigated.

2.2. Sample collection After exposure for 0, 12, 24, 48, and 96 h, four fish were randomly sampled from each group and dissected after anesthesia with sodium bicarbonate-buffered MS-222 (Sigma Diagnostics INS, St. Louis, MO). Blood samples were collected from the caudal vessels into heparinized syringes. The blood samples (1 mL) were centrifuged at 12000 g for 5 min at 4 °C. The supernatant was then collected and stored at −80 °C prior to the analysis of plasma parameters. The second gill arch on the right side of sacrificed individuals was collected and rapidly frozen in liquid nitrogen, and used to analyze gene expression. The remaining gill tissue was homogenized in ice-cold phosphate buffer (50 mM, pH 7.4) and centrifuged at 12000 g for 15 min at 4 °C. The supernatant was then collected and stored to determine antioxidant enzyme activities. 2.3. Blood parameter analysis The total Hb concentration in the blood was estimated using the cyanmethemoglobin method with a commercially available assay kit (Mlbio, Shanghai, China). MetHb in the blood was measured following the method of Wuertz et al. (2013). Plasma glucose (Glu), triglycerides (TGs), total cholesterol (TC), cortisol, and heat shock protein-70 (Hsp70) were determined using diagnostic reagent kits purchased from Nanjing Jiancheng Bioengineering Institute (Nanjing, China). The whole blood Na+ and K+ concentrations were measured using a flame photometer (Sherwood Model 410; Cambridge, UK), while the concentration of Cl− was estimated using a chloride analyzer (Sherwood Model 926).

2. Materials and methods 2.1. Animals and treatment

2.4. Enzyme activity measurement Takifugu rubripes juveniles (n = 375, average mass: 250.26 ± 5.22 g) were obtained from the Dalian Tianzheng Industrial Corporation Limited (Liaoning, China). The fish were acclimated to experimental conditions for 14 days in a 500-L fiberglass cylinder with aerated saltwater. Half of the water was renewed every 24 h. During the acclimation and test periods, water conditions were maintained as follows, temperature: 20°C–22 °C, salinity: 28–31 ppt, dissolved oxygen: 6–8 mg L−1, pH: 7.5–8.0, total ammonia: < 0.05 mg L−1, and total nitrite: < 0.001 mM. The fish were fed a commercial diet (HaiTong Group Foods, Fujian, China) twice a day at 1.5% their body weight (crude protein: ≥ 48%, crude fat: ≥ 9%, water: ≤ 10%, crude fiber: ≤ 2%, crude ash: ≤ 17%, lysine: ≥ 2.5%, and total phosphorus: 1.5%–3.0%). The fish were fasted on the last two days of the acclimation period. The nitrite concentrations were selected based on a previous study, with minor modifications (Wang et al., 2013). After a preliminary experiment, the 96-h LC50 for T. rubripes juveniles was 11.94 mM under the same experimental conditions. Based on the LC50, we intentionally chose a high concentration of nitrite (50% 96-h LC50) as the maximum concentration to assess the effect of acute nitrite exposure on T. rubripes; therefore, four concentrations of nitrite nitrogen (0.5, 1, 3, and 6 mM), and a control (0 mM) were chosen. Nitrite test solution was prepared according to the method of Gao et al. (2019). The fish were randomly

The activities of superoxide dismutase (SOD), catalase (CAT), and glutathione peroxidase (GPx) in the gills were measured using commercial kits (Nanjing Jiancheng Bioengineering Institute) according to the methods used in a previous study (Liu et al., 2008). One unit of SOD activity was defined as the amount of enzymes required to inhibit the oxidation reaction by 50%, and the activity is expressed as units per mg protein. One unit of CAT activity is defined as the amount of enzyme that consumed 1 μmol of hydrogen peroxide per minute. One unit of GPx activity is defined as 1 mmol NADPH oxidized per minute. The activities of these two enzymes are expressed as units per mg of soluble protein. The glutathione (GSH) concentration was estimated using the colorimetric method as described by Lora et al. (2004) and expressed as microgram per milligram protein. The protein concentrations of the gills were assayed using bovine serum albumin as the standard, according to the Bradford method (Bradford, 1976). 2.5. Total RNA isolation and cDNA synthesis Total RNA was extracted from the gill tissue using the Fast-Pure RNA kit (Takara, Dalian, China) according to the manufacturer's protocol. The quality of the extracted RNA was assessed by measuring the absorbance of the sample at 260 and 280 nm using GeneQuant 1300 2

Ecotoxicology and Environmental Safety 188 (2020) 109878

X.-Q. Gao, et al.

Table 1 Primers and sequences referred to in the experiments. Primers

Primer sequence (5′–3′)

Target gene

Reference

p53F p53R BaxF BaxR Bcl-2F Bcl-2R Caspase-3F Caspase-3R Caspase-8F Caspase-8R Caspase-9F Caspase-9R 18sF 18sR β-actinF β-actinR

GCTTGGAAAATGAGCAATGGCA CTCGGAGTAGGTGGAGGTGACG GGAGATGAGCTGGATGGAAATG GTCTGCCAGGTGGGGGTGCC GCGTCTCCATCCGCAGGTGC TGCCGCGGCGTCGTCCCC CGAGGGCGTGTTTTTTGGT GGGATCTTGGTGGTGCTGC GCTGCTCCACACTATCCATCGAAA AGACCCTTCTTTTCCATTTCAGTAA ATCGTCCAGTTATCCAACCCCTTC GGCTTCAGTCTCATGTACTCCCGC AGACAAATCGCTCCACCAAC GACTCAACACGGGAAACCTC CAGGGAGAAGATGACCCAGA CATCACCAGAGTCCATGACG

p53

Cheng et al. (2015)

Bax

Cheng et al. (2015)

Bcl-2

Cheng et al. (2015)

Caspase-3

Cheng et al. (2015)

Caspase-8

Cheng et al. (2015)

Caspase-9

Cheng et al. (2015)

18s

Jia et al., 2018

β-actin

Jia et al., 2018

Fig. 1. Hemoglobin (Hb) and methemoglobin (MetHb) concentrations in blood samples from T. rubripes exposed to different concentrations of nitrite for 96 h. Bars and error bars indicate means ± SDs. Different lowercase letters indicate significant differences (P < 0.05) among groups. The 0 mM nitrite group served as the control. ※P < 0.05.

2.7. Statistical analyses

(GE Healthcare Bioscience, Piscataway, NJ), after normalization to a common concentration in DEPC-treated water. The integrity of the extracted RNA was tested by electrophoresis on a 1.2% agarose gel. Single-stranded cDNA was synthesized from 2 μg of total RNA using a PrimeScript RT Reagent Kit with gDNA Eraser (Takara, Dalian, China), according to the manufacturer's instructions. The cDNA templates were then stored at −80 °C until further analysis.

All statistical analyses were performed using SPSS 18.0 software. Experimental data were expressed as mean ± SD. Normality (Kolmogorov–Smirnov test) and variance homogeneity (Levine test) of the data were checked. Isolated and interactive effects of exposure time and nitrite treatments were analyzed using a two-way ANOVA. If significant differences were found in factors, Tukey's test was used to determine the differences between means. The results with P-values < 0.05 were considered statistically significant.

2.6. Real-time PCR The primer sequences for p53, Bax, Bcl-2, Caspase-3, Caspase-8, and Caspase-9 were designed following Cheng et al. (2015) and Jia et al. (2018), and are listed in Table 1. The specificity of the primers was detected by conventional PCR and sequence analysis. The standard equation and correlation coefficient were determined by generating a standard curve using serial 10-fold dilutions of cDNA. Real-time quantitative PCR was amplified using the ABI PRISM 7500 Detection System (Applied Biosystems, USA) and SYBR Premix Ex Taq (Takara). The reaction mixture contained 2 μL of cDNA template, 10 μL of SYBR Premix Ex Taq™, 0.8 μL each of the forward and reverse primers (10 mM), and ultra-pure water, which was added to make up the final volume to 20 μL. The real-time PCR conditions and cycle index were as follows: 10 s at 94 °C, and then 40 cycles for 5 s at 95 °C and 30 s at 60 °C. After finishing the program, the specificity of PCR amplification was confirmed using the melting curve analysis. Relative gene expression levels were evaluated using the 2−ΔΔCT method (Livak and Schmittgen, 2001). In addition, all samples were run in triplicate, and each assay was repeated three times.

3. Results 3.1. Hb and MetHb concentrations after exposure to nitrite A rapid decrease in the Hb concentration was observed in T. rubripes exposed to 1, 3, and 6 mM nitrite for 24, 48, and 96 h (P < 0.05, Fig. 1A). In contrast, a rapid increase in the MetHb concentration was observed after 12 h of exposure to higher concentrations (3 and 6 mM) of nitrite, which was significantly higher than that of the control group (P < 0.05). However, an increase in the MetHb concentration was observed when the fish were exposed to 1 mM nitrite for 24 h (P < 0.05, Fig. 1B). 3.2. Effect of nitrite exposure on the plasma parameters Compared with that of the control group, 24 h of exposure to 3 and 6 mM nitrite caused a rapid increase in the cortisol concentration 3

Ecotoxicology and Environmental Safety 188 (2020) 109878

X.-Q. Gao, et al.

Fig. 2. The changes of plasma parameters in T. rubripes exposed to different concentrations of nitrite for 96 h. Bars and error bars indicate means ± SDs. Different lowercase letters indicate significant differences (P < 0.05) among groups. The 0 mM nitrite group served as the control. ※P < 0.05.

(P < 0.05, Fig. 2F).

(P < 0.05, Fig. 2A). A similar increase was observed after 48 and 96 h of exposure to 1 mM nitrite (P < 0.05). The glucose concentration increased significantly after 24 h of exposure to 3 and 6 mM nitrite compared with that of the control (P < 0.05, Fig. 2B). Meanwhile, elevated glucose concentration was observed in the fish after exposure to 1 mM nitrite for 48 h (P < 0.05). The TG and TC concentrations in the groups exposed to 3 and 6 mM nitrite for 24, 48, and 96 h were significantly lower than those in the control groups (P < 0.05, Fig. 2C and D). Their concentrations were also decreased in fish exposed to 1 mM nitrite for 48 h (P < 0.05). The concentrations of Hsp-70 and Hsp-90 in groups treated with 1, 3, and 6 mM nitrite for 24, 48, and 96 h were significantly higher than those in the control group (P < 0.05, Fig. 2E and F). The concentration of Hsp-90 was also obviously elevated in fish exposed to 1, 3, and 6 mM nitrite for 12 h

3.3. Effect of nitrite exposure on ion regulation The changes in ion concentrations are shown in Fig. 3. Compared with that in the control group, there was a progressive decline in Na+ concentration after 24 h in the groups exposed to 3 and 6 mM nitrite (P < 0.05). Similar changes were observed for Cl− concentration in the groups treated with 3 and 6 mM nitrite for 24 h. However, 24 h of exposure to 3 and 6 mM nitrite caused a sudden increase in the K+ concentration, and elevated K+ concentration was also observed in fish exposed to 1 mM nitrite for 48 h (P < 0.05).

4

Ecotoxicology and Environmental Safety 188 (2020) 109878

X.-Q. Gao, et al.

Fig. 3. Ion concentration (Na+1, K+1, Cl−1) of T. rubripes exposed to different concentrations of nitrite for 96 h. Bars and error bars indicate means ± SDs. Different lowercase letters indicate significant differences (P < 0.05) among groups. The 0 mM nitrite group served as the control. ※P < 0.05.

3.4. Effect of nitrite exposure on the activity of antioxidant enzymes

4. Discussion

The significant effects of nitrite concentrations and exposure time on antioxidant enzymes are shown in Fig. 4. After exposure to 1, 3, and 6 mM nitrite for 12 and 24 h, the SOD and CAT activities were significantly higher than those in the control groups (P < 0.05), but after 48 and 96 h of exposure, their activities were significantly decreased (P < 0.05). Compared with that in the control group, exposure to 1, 3, and 6 mM nitrite caused a rapid increase in the GSH and GPx activities after 12 and 24 h of exposure (P < 0.05); however, the effect diminished after 48 and 96 h of exposure and the activities of GSH and GPx significantly decreased (P < 0.05).

Nitrite is one of the most important pollutants in aquaculture systems, because it is toxic to aquatic organisms and can disturb several physiological functions (Jensen, 2003). Previous studies in fish have reported that, following uptake, nitrite diffuses from the plasma into erythrocytes, where it readily oxidizes iron in Hb to form MetHb, which decreases the oxygen-carrying capacity of the blood (Madison and Wang, 2006; Jensen, 2009). In the present study, we observed a decrease in the concentration of Hb and an increase in the concentration of MetHb with the increase in nitrite concentration and exposure time. These results are consistent with those previously reported in Cyprinus carpio L., Brycon cephalus, Clarias gariepinus, and Scophthalmus maximus (Avilez et al., 2004; Svobodova et al., 2005; Jia et al., 2015; Roques et al., 2015), which demonstrates that nitrite-induced oxidation of Hb to MetHb causes major toxic effects in fish blood physiology. It is widely accepted that alterations in the external environment or exposure to toxic substances can cause significant stress responses in fish (Kim et al., 2017). Various stress indicators, including cortisol and glucose, are used to evaluate the toxic effects. In the present study, acute nitrite exposure caused a rapid increase in the cortisol concentration, which supported the earlier findings in other marine fish (Mondal and Rai, 2002; Jia et al., 2015). This increase in the cortisol concentration is likely induced by stimulation of the hypothalamic–pituitary–interrenal axis as a general stress response (Jun-Hwan et al., 2018). Additionally, our results also showed a significant increase in the concentration of glucose after exposure to 3 and 6 mM nitrite for 24 h. Kim et al. (2017) reported a general increase in glucose concentration under stress conditions as a mechanism of detoxification. Roques et al. (2015) reported a significant increase in blood glucose

3.5. Effect of nitrite exposure on apoptosis-related gene transcription Fig. 5 shows the altered mRNA levels of genes related to apoptotic signaling processes after nitrite exposure. Compared with that in the control group, the expression of the Caspase-3 gene was significantly upregulated in the fish exposed to 1, 3, and 6 mM nitrite for 48 and 96 h (P < 0.05). Similar results were observed after exposure to 3 and 6 mM nitrite for 24 h (P < 0.05). Compared with those in the control groups, Caspase-9, Caspase-8, and p53 mRNA levels were significantly upregulated (P < 0.05) after exposure to 1, 3, and 6 mM nitrite for 12 h. The transcript level of Bax increased significantly when exposed to 1, 3, and 6 mM nitrite for 24, 48, and 96 h (P < 0.05). Conversely, exposure to 1, 3, and 6 mM nitrite for 24, 48, and 96 h downregulated the level of Bcl-2 mRNA compared with that of the control group (P < 0.05).

5

Ecotoxicology and Environmental Safety 188 (2020) 109878

X.-Q. Gao, et al.

Fig. 4. The changes of antioxidant capacity in gills of T. rubripes exposed to different concentrations of nitrite for 96 h. Bars and error bars indicate means ± SDs. Different lowercase letters indicate significant differences (P < 0.05) among groups. The 0 mM nitrite group served as the control. ※P < 0.05.

(Jensen et al., 2015). Collectively, the observed plasma parameters in the present study indicated that nitrite exposure caused considerable stress to T. rubripes. Nitrite exposure can alter the ionic homeostasis in fish. In carp, nitrite interferes with K+ homeostasis, which leads to extracellular hyperkalemia (Knudsen and Jensen, 1997). Aggergaard and Jensen (2001) showed that rainbow trout (Oncorhynchus mykiss) presented a decrease in plasma Cl− and an increase in plasma K+ in response to nitrite exposure. In the present study, the Cl− concentration progressively decreased after exposure to 3 and 6 mM for more than 24 h. Lewis and Morris, (1986) suggested that nitrite is a competitive inhibitor of Cl− uptake. This inhibition could partially explain the decreased plasma Cl− concentration observed in T. rubripes. Meanwhile, a significant decrease in Na+ was followed by an increase in K+ in the present study, which is consistent with the changes observed in a previous study (Martinez and Souza, 2002). This phenomenon suggests that nitrite exposure may result in the rapid inhibition of ion-translocating enzymes, such as Na+–K+–ATPase, as well as exchangers and ion channels (Martinez and Souza, 2002; Di Giulio and Hinton, 2008). Oxidative stress, primarily due to the increased production of ROS and reactive nitrogen species, is known to be a toxic response to environmental contaminants (Federici et al., 2007; Ching et al., 2009). However, organisms have antioxidant defense mechanisms to protect against the toxic effects of ROS by enhancing the activities of antioxidant enzymes, such as SOD, CAT, GSH, and GPx. SOD is considered the first line of defense against oxidative stress, as O2− is converted into O2 and H2O2, which is subsequently transformed into H2O by CAT and GPx (Sun et al., 2014). Previous studies have showed that nitrite exposure induced the formation of ROS and altered the antioxidant enzymes activities (Bopp et al., 2008; Sun et al., 2014; Jia et al., 2015; Lin et al., 2018). In the present study, we observed a rapid increase in the

concentration in Claris gariepinus exposed to nitrite. Jun-Hwan et al. (2018) also reported a significant increase in the plasma glucose concentration in Paralichthys olivaceus after exposure to waterborne nitrite. The elevated glucose concentration suggests that nitrite exposure induces an increase in the metabolism of carbohydrate in fish to meet energy needs to cope with the resulting stress responses. Lipids act as a major energy source and support various physiological, developmental, and reproductive processes (Tocher, 2003). Several pollutants have been reported to disturb lipid homeostasis in fish (Fadhlaoui and Couture, 2016; Song et al., 2016; Silveyra et al., 2018). In addition, Jia et al. (2015) found that exposure to 0.8 mM nitrite caused a considerable increase in the TG concentration in turbot, and the GH concentration was not different between nitrite treatments. Kim et al. (2018) also reported that the plasma cholesterol concentration in P. olivaceus increased, and that in bio-floc and seawater was significantly reduced after exposure to nitrite. In the present study, the TG and TC concentrations were significantly lower after exposure to 3 and 6 mM nitrite for 24, 48, and 96 h. Thus, these results indicated that nitrite exposure may disrupt lipid metabolism. Hsp-70 and Hsp-90 are the most highly conserved Hsp family members, and they play important roles in preventing and repairing protein injury (Deane and Woo, 2007). Increased Hsp-70 and Hsp-90 concentrations in fish may reflect a protective response against many types of stress, including heat stress, crowding, and chemical stress (Jun-Hwan et al., 2018). Several studies have demonstrated that nitrite exposure increased the concentrations of Hsp-70 and Hsp-90 in various fish species (Deane and Woo, 2007; Banerjee et al., 2015). Our findings are consistent with those previous study findings. We found that the concentrations of Hsp-70 and Hsp-90 in the gills of T. rubripes were significantly increased after nitrite exposure. This suggests that nitrite exposure resulted in tissue damage and thus induced an increase in the expression of Hsp-70 and Hsp-90 6

Ecotoxicology and Environmental Safety 188 (2020) 109878

X.-Q. Gao, et al.

Fig. 5. Relative expression levels of apoptosis-related genes: Caspase-3, Caspase-9, Caspase-8, P53, Bax, and Bcl-2 in the gills of T. rubripes exposed to different concentrations of nitrite for 96 h. Bars and error bars indicate means ± SDs. Different lowercase letters indicate significant differences (P < 0.05) among groups. The 0 mM nitrite group served as the control. ※P < 0.05.

such as heavy metals and chemical contaminants (Guo et al., 2013; Jin et al., 2017; Li et al., 2017; Sayed and Hamed, 2017). Apoptosis is a normal physiological process involved in the removal of excess, damaged, necrotic, or potentially dangerous cells. Apoptosis generally occurs with two major pathways: the extrinsic pathway (the receptorapoptotic pathway) and intrinsic pathway (the mitochondrial-apoptotic pathway). The extrinsic pathway is modulated by extracellular signals via the death receptors (Fas/CD95, TNFR, and DR4/DR5), and can recruit proteins associated with the FAS-associated death domain and Caspase-8. The activation of Caspase-8 activates Caspase-3 directly or indirectly (Bridgham et al., 2003; Zhang et al., 2011). The intrinsic pathway is triggered by the complex composition of cytochrome C, which is activated by Apaf-1, Pre-Caspase-9, and dATP, which further

SOD, CAT, GSH, and GPx activities in the gills after exposure to 1, 3, and 6 mM nitrite for 12 and 24 h, and then reductions in the same parameters after 48 and 96 h of exposure. It is possible that the increase in the antioxidant enzymes may contribute to the elimination of the ROS induced by nitrite exposure, thereby protecting cells from oxidative damage (at least during early nitrite exposure). However, with prolonged exposure and higher nitrite concentrations, the physiological antioxidant system may not be sufficiently effective in eliminating or neutralizing excessive ROS, and severe oxidative damage might occur. This in turn may decrease the concentrations or even degrade the antioxidant enzymes (Zhang et al., 2008). Potent excessive ROS production is known to trigger frequent apoptosis of cells when exposed to some environmental stress factors, 7

Ecotoxicology and Environmental Safety 188 (2020) 109878

X.-Q. Gao, et al.

Data availability statement The data that support the findings of this study are openly available in “figshare” at https://figshare.com/s/9b2deb35f6a2e4417e1b; https://doi.org/10.6084/m9.figshare.9248999. Declaration of competing interest All authors have no any potential sources of conflict of interest. Acknowledgments This study was supported by the Central Public-Interest Scientific Institution Basal Research Fund, YSFRI, CAFS (NO.) (20603022018015); the National Key R&D Program of China (2017YFD0701701); the Key Laboratory of Mariculture & Stock Enhancement in North China's Sea, Ministry of Agriculture and Rural Affairs, Dalian Ocean University, P. R. China (2018-KF-02); the Modern Agriculture Industry System Construction of Special Funds (CARS-50G10); and the demonstration project of collaborative innovation in the industry chain of intelligent cage assembly equipment of far-reaching sea. We thank the Dalian Tianzheng Industrial Co. Ltd. for providing the samples used in this study and the Yellow Sea Fisheries Research Institute for their excellent technical assistance.

Fig. 6. The plausible mechanisms of nitrite-induced hematological parameters, oxidative stress, and apoptosis in Takifugu rubripes.

activates the downstream effectors Caspase-9 and Caspase-3 (Chang and Yang, 2000; Fulda and Debatin, 2006). In addition, it has been reported that nitrite-induced cell apoptosis can alter the expression levels of apoptosis-related genes in aquatic animal (Jensen and Hansen, 2011; Zheng et al., 2016; Cheng et al., 2019). In the present study, we observed nitrite-induced increase in the mRNA levels of Caspase-3, Caspase-8, and Caspase-9 in the gills of T. rubripes, which further indicated that nitrite-induced apoptosis occurred by activating the caspase-dependent apoptotic pathway. The tumor suppressor protein, p53, is a universal sensor of genotoxicity and plays pivotal regulatory roles in cell cycle check points, genetic stability, and apoptosis (Vousden and Lane, 2007). Previous studies have suggested that p53 can be activated in fish by genotoxic stress (Cheng et al., 2015). In the present study, exposure to nitrite significantly increased the mRNA levels of p53, which indicated that p53 may be involved in nitrite-induced apoptosis. A similar expression pattern of p53 was observed in fish exposed to different levels of environmental contaminants (Lee et al., 2008; Di et al., 2011; Luzio et al., 2013). Moreover, Wang et al. (2019) reported that p53 can induce apoptosis by upregulating the transcription of pro-apoptotic genes (such as Bax) and downregulating that the transcription of anti-apoptotic genes (such as Bcl-2). Consistent with this previous study finding, in the present study, the mRNA expression level of Bax was significantly increased and that of Bcl-2 was apparently decreased after exposure to high concentrations of nitrite. Additionally, studies have indicated that alterations in the intracellular Bax and Bcl-2 expression patterns can affect mitochondrial cytochrome c release and that an increase in the Bax-to-Bcl-2 ratio can induce cell apoptosis (Whiteman et al., 2007; Zhang et al., 2012). In the present study, we also observed an increase in the Bax-to-Bcl-2 ratio after exposure to nitrite. Based on these findings, we speculate that nitrite exposure might trigger apoptosis via the p53–Bax–Bcl-2 pathway in the gills of T. rubripes.

Appendix A. Supplementary data Supplementary data to this article can be found online at https:// doi.org/10.1016/j.ecoenv.2019.109878. References Aggergaard, S., Jensen, F.B., 2001. Cardiovascular changes and physiological response during nitrite exposure in rainbow trout. J. Fish Biol. 59, 13–27. Avilez, I.M., Altran, A.E., Aguiar, L.H., Moraes, G., 2004. Hematological responses of the Neotropical teleost matrinxa (Brycon cephalus) to environmental nitrite. Comp. Biochem. Physiol. C Toxicol. Pharmacol. 139, 135–139. Banerjee, S., Mitra, T., Purohit, G.K., Mohanty, S., Mohanty, B.P., 2015. Immunomodulatory effect of arsenic on cytokine and HSP gene expression in Labeo rohita fingerlings. Fish Shellfish Immunol. 44, 43–49. Bopp, S.K., Abicht, H.K., Knauer, K., 2008. Copper-induced oxidative stress in rainbow trout gill cells. Aquat. Toxicol. 86, 197–204. Bradford, M.M., 1976. A rapid and sensitive method for the quantitation of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72, 248–254. Bridgham, J.T., Wilder, J.A., Hollocher, H., Johnson, A.L., 2003. All in the family: evolutionary and functional relationships among death receptors. Cell Death Differ. 10, 19–25. Bryan, N.S., Grisham, M.B., 2007. Methods to detect nitric oxide and its metabolites in biological samples. Free Radical Biol. Med. 43, 645–657. Chandra, J., Samali, A., Orrenius, S., 2000. Triggering and modulation of apoptosis by oxidative stress. Free Radical Biol. Med. 29, 323–333. Chang, H.Y., Yang, X., 2000. Proteases for cell suicide: functions and regulation of caspases. Microbiol. Mol. Biol. Rev. 64, 821–846. Cheng, W., Tung, Y.H., Liu, C.H., Chen, J.C., 2006. Molecular cloning and characterisation of cytosolic manganese superoxide dismutase (cytmn-sod) from the giant freshwater prawn macrobrachium rosenbergii. Fish Shellfish Immunol. 20, 438–449. Cheng, C.H., Yang, F.F., Ling, R.Z., Liao, S.A., Miao, Y.T., Ye, C.X., 2015. Effects of ammonia exposure on apoptosis, oxidative stress and immune response in pufferfish (takifugu obscurus). Aquat. Toxicol. 164, 61–71. Cheng, C.H., Su, Y.L., Ma, H.L., Deng, Y.Q., Feng, J., Chen, X.L., Jie, Y.K., Guo, Z.X., 2019. Effect of nitrite exposure on oxidative stress, DNA damage and apoptosis in mud crab (Scylla paramamosain). Chemosphere 239. https://doi.org/10.1016/j.chemosphere. 2019.124668. Ching, B., Chew, S.F., Wong, W.P., Ip, Y.K., 2009. Environmental ammonia exposure induces oxidative stress in gills and brain of Boleophthalmus boddarti (mudskipper). Aquat. Toxicol. 95, 203–212. Colt, J.E., Armstrong, D.A., 1981. Nitrogen Toxicity to Crustaceans, Fish, and Molluscs. Dandapat, J., Chainy, G.B., Rao, K.J., 2003. Lipid peroxidation and antioxidant defence status during larval development and metamorphosis of giant prawn, macrobrachium rosenbergii. Comp. Biochem. Physiol Toxicol. Pharmacol. Cbp 135, 221–233. Deane, E.E., Woo, N.Y., 2007. Impact of nitrite exposure on endocrine, osmoregulatory and cytoprotective functions in the marine teleost sparus sarba. Aquat. Toxicol. 82, 85–93. Di, Y., Schroeder, D.C., Highfield, A., Readman, J.W., Jha, A.N., 2011. Tissue-specific expression of p53 and ras genes in response to the environmental genotoxicant benzo pyrene in marine mussels. Environ. Sci. Technol. 45, 8974–8981.

5. Conclusions In summary, we elucidated the effects of nitrite exposure on the hematological parameters, oxidative stress, and apoptosis in T. rubripes. Our results indicated that nitrite exposure can cause an increase in the MetHb, cortisol, and glucose concentrations; interrupt the ionic homeostasis; and subsequently decrease the TG and TC concentrations; these changes can result in major toxic effects on fish blood physiology. Nitrite stress also activated the antioxidant and immune defense systems to protect the cells from oxidative stress and apoptosis. Additionally, we demonstrated nitrite-induced apoptosis in the gills of T. rubripes via the mitochondria-mediated caspase-dependent pathway and p53–Bax–Bcl-2 pathway (Fig. 6). 8

Ecotoxicology and Environmental Safety 188 (2020) 109878

X.-Q. Gao, et al.

M., Coimbra, A.M., 2013. Copper induced upregulation of apoptosis related genes in zebrafish (danio rerio) gill. Aquat. Toxicol. 128–129, 183–189. Madison, B.N., Wang, Y.S., 2006. Haematological responses of acute nitrite exposure in walleye (Sander vitreus). Aquat. Toxicol. 79, 16–23. Martinez, C.B., Souza, M.M., 2002. Acute effects of nitrite on ion regulation in two neotropical fish species. Comp. Biochem. Physiol. Part A Molecular and Integrative Physiology 133, 151–160. Mondal, S., Rai, U., 2002. Dose and time-related in vitro effects of glucocorticoid on phagocytosis and nitrite release by splenic macrophages of wall lizard Hemidactylus flaviviridis. Comp. Biochem. Physiol. C Toxicol. Pharmacol. 132, 461–470. Otfda, C., Djdoss, F., Lo, P.M.F., Fernandes, M.N., 2004. Susceptibility of the amazonian fish, colossoma macropomum (serrasalminae), to short-term exposure to nitrite. Aquaculture 232, 627–636. Rakocy, J.E., Masser, M.P., Losordo, T.M., 1992. In: Recirculating Aquaculture Tank Production Systems: Aquaponics-Integrating Fish and Plant Culture. Srac Publication. Roques, J.A.C., Schram, E., Spanings, T., Schaik, T.V., Abbink, W., Boerrigter, J., Vries, P.D., Vis, H.V.D., Flik, G., 2015. The impact of elevated water nitrite concentration on physiology, growth and feed intake of African catfish Clarias gariepinus (Burchell 1822). Aquacult. Res. 46, 1384–1395. Sanders, B.M., 2008. Stress proteins in aquatic organisms: an environmental perspective. Crit. Rev. Toxicol. 23, 49–75. Sayed, E.D.H., Hamed, H.S., 2017. Induction of apoptosis and DNA damage by 4-nonylphenol in african catfish (clarias gariepinus) and the antioxidant role of, cydonia oblonga. Ecotoxicol. Environ. Saf. 139, 97–101. Silveyra, G.R., Silveyra, P., Vatnick, I., Medesani, D.A., Rodríguez, Enrique Marcelo, 2018. Effects of atrazine on vitellogenesis, steroid levels and lipid peroxidation, in female red swamp crayfish, procambarus clarkii. Aquat. Toxicol. 197, 136–142. Song, Y.F., Huang, C., Shi, X., Pan, Y.X., Liu, X., Luo, Z., 2016. Endoplasmic reticulum stress and dysregulation of calcium homeostasis mediate cu-induced alteration in hepatic lipid metabolism of javelin goby synechogobius hasta. Aquat. Toxicol. 175, 20–29. Song, C., Cui, Y., Liu, B., Xie, J., Ge, X., Xu, P., 2018. Hsp 60 and hsp90β from blunt snout bream, megalobrama amblycephala : molecular cloning, characterization, and comparative response to intermittent thermal stress and aeromonas hydrophila, infection. Fish Shellfish Immunol. 74, 119–132. Sørensen, J.G., Kristensen, T.N., Loeschcke, V., 2003. The evolutionary and ecological role of heat shock proteins. Ecol. Lett. 6, 1025–1037. Sun, S., Ge, X., Zhu, J., Xuan, F., Jiang, X., 2014. Identification and MRNA expression of antioxidant enzyme genes associated with the oxidative stress response in the wuchang bream (megalobrama amblycephala) in response to acute nitrite exposure. Comp. Biochem. Physiol. C Toxicol. Pharmacol. 159, 69–77. Svobodova, Z., Machova, J., Drastichova, J., Groch, L., Luskova, V., Poleszczuk, G., Velisek, J., Kroupova, H., 2005. Haematological and biochemical profiles of carp blood following nitrite exposure at different concentrations of chloride. Aquacult. Res. 36, 1177–1184. Takle, H., Andersen, O., 2010. Caspases and apoptosis in fish. J. Fish Biol. 71, 326–349. Tocher, D.R., 2003. Metabolism and functions of lipids and fatty acids in teleost fish. Rev. Fish. Sci. 11, 107–184. Vousden, K.H., Lane, D.P., 2007. P53 in health and disease. Nat. Rev. Mol. Cell Biol. 8, 275–283. Wang, W.N., Wang, A.L., Zhang, Y.J., Li, Z.H., Wang, J.X., Sun, R.Y., 2004. Effects of nitrite on lethal and immune response of macrobrachium nipponense. Aquaculture 232, 679–686. Wang, J.X., Zhang, Z., Hu, P., Jiang, Z.Q., Wang, X., Yang, J.J., 2013. Effect of nitrite on hepatic antioxidant enzymes and acute toxicity in juvenile takifugu rubripe. J. Guangdong Ocean Univ. 33, 52–56. Wang, T., Wen, X., Hu, Y., Zhang, X., Wang, D., Yin, S., 2019. Copper nanoparticles induced oxidation stress, cell apoptosis and immune response in the liver of juvenile takifugu fasciatus. Fish Shellfish Immunol. 84, 648–655. Whiteman, M., Chu, S.H., Siau, J.L., Rose, P., Sabapathy, K., Schantz, J.T., 2007. The proinflammatory oxidant hypochlorous acid induces bax-dependent mitochondrial permeabilisation and cell death through aif-/endog-dependent pathways. Cell. Signal. 19, 705–714. Wuertz, S., Schulze, S.G., Eberhardt, U., Schulz, C., Schroeder, J.P., 2013. Acute and chronic nitrite toxicity in juvenile pike-perch (sander lucioperca) and its compensation by chloride. Comp. Biochem. Physiol. C Toxicol. Pharmacol. 157, 352–360. Zhang, X., Yang, F., Zhang, X., Xu, Y., Liao, T., Song, S., Wang, H., 2008. Induction of hepatic enzymes and oxidative stress in Chinese rare minnow (Gobiocypris rarus) exposed to waterborne hexabromocyclododecane (HBCDD). Aquat. Toxicol. 86, 4–11. Zhang, L., Li, L., Zhang, G., 2011. Gene discovery, comparative analysis and expression profile reveal the complexity of the crassostrea gigas apoptosis system. Dev. Comp. Immunol. 35, 603–610. Zhang, H., Shao, D., Wu, Y., Cai, C., Hu, C., Shou, X., 2012. Apoptotic responses of carassius auratus lymphocytes to nodularin exposure in vitro. Fish Shellfish Immunol. 33, 1229–1237. Zhang, Y., Ye, C., Wang, A., Xuan, Z., Chen, C., Xian, J., 2015. Isolated and combined exposure to ammonia and nitrite in giant freshwater pawn (macrobrachium rosenbergii): effects on the oxidative stress, antioxidant enzymatic activities and apoptosis in haemocytes. Ecotoxicology 24, 1601–1610. Zheng, J., Mao, Y., Su, Y., Wang, J., 2016. Effects of nitrite stress on mrna expresson of antioxidant enzymes, immune-related genes and apoptosis-related proteins in marsupenaeus japonicus. Fish Shellfish Immunol. 58, 239–252.

Di Giulio, R.T., Hinton, D.E. (Eds.), 2008. The Toxicology of Fishes. CRC Press, Taylor and Francis Group, Boca Raton, pp. 1096. Fadhlaoui, M., Couture, P., 2016. Combined effects of temperature and metal exposure on the fatty acid composition of cell membranes, antioxidant enzyme activities and lipid peroxidation in yellow perch (perca flavescens). Aquat. Toxicol. 180, 45–55. Federici, G., Shaw, B.J., Handy, R.D., 2007. Toxicity of titanium dioxide nanoparticles to rainbow trout (Oncorhynchus mykiss): gill injury, oxidative stress, and other physiological effects. Aquat. Toxicol. 84, 415–430. Fulda, S., Debatin, K.M., 2006. Extrinsic versus intrinsic apoptosis pathways in anticancer chemotherapy. Oncogene 25, 4798–4811. Gao, X.Q., Fei, F., Huo, H.H., Huang, B., Meng, X.S., Zhang, T., Liu, B.W., Liu, B.L., 2019. Exposure to nitrite alters thyroid hormone levels and morphology in Takifugu rubripes. Comp. Biochem. Physiol., C 225. https://doi.org/10.1016/j.cbpc.2019. 108578. Grôsvik, B.E., Goksôyr, A., 1996. Biomarker protein expression in primary cultures of salmon (salmo salar l.) hepatocytes exposed to environmental pollutants. Biomarkers : Biochem. Indic. Expo., Response, Susceptibility Chem. 1, 45–53. Guo, H., Xian, J.A., Li, B., Ye, C.X., Wang, A.L., Miao, Y.T., 2013. Gene expression of apoptosis-related genes, stress protein and antioxidant enzymes in hemocytes of white shrimp litopenaeus vannamei under nitrite stress. Comp. Biochem. Physiol. 157, 366–371. Jensen, F.B., 2003. Nitrite disrupts multiple physiological functions in aquatic animals. Comp. Biochem. Physiol. Mol. Integr. Physiol. 135, 9–24. Jensen, F.B., 2007. Nitric oxide formation from nitrite in zebrafish. J. Exp. Biol. 210, 3387–3394. Jensen, F.B., 2009. The role of nitrite in nitric oxide homeostasis: a comparative perspective. Biochim. Biophys. Acta Bioenerg. 1787, 841–848. Jensen, F.B., Hansen, M.N., 2011. Differential uptake and metabolism of nitrite in normoxic and hypoxic goldfish. Aquat. Toxicol. 101, 318–325. Jensen, F.B., Gerber, L., Hansen, M.N., Madsen, S.S., 2015. Metabolic fates and effects of nitrite on brown trout under normoxic and hypoxic conditions: blood and tissue nitrite metabolism and interactions with branchial NOS, Naþ/Kþ-ATPase and hsp 70 expression. J. Exp. Biol. 218, 2015–2022. Jia, R., Han, C., Lei, J.L., Liu, B.L., Huang, B., Huo, H.H., 2015. Effects of nitrite exposure on haematological parameters, oxidative stress and apoptosis in juvenile turbot (scophthalmus maximus). Aquat. Toxicol. 169, 1–9. Jia, Yd J., Qiqi, J., Zhijun, X., Xiaoqiang, G., Jieming, Z., Changtao, G., 2018. Effects of two different culture systems on the growth performance and physiological metabolism of tiger pufferfish (takifugu rubripes). Aquaculture 495, 267–272. Jiang, Q., Zhang, W., Tan, H., Pan, D., Yang, Y., Ren, Q., 2014. Analysis of gene expression changes, caused by exposure to nitrite, in metabolic and antioxidant enzymes in the red claw crayfish, cherax quadricarinatus. Ecotoxicol. Environ. Saf. 104, 423–428. Jin, J., Wang, Y., Wu, Z., Hergazy, A., Lan, J., Zhao, L., 2017. Transcriptomic analysis of liver from grass carp (ctenopharyngodon idellus) exposed to high environmental ammonia reveals the activation of antioxidant and apoptosis pathways. Fish Shellfish Immunol. 63, 444–451. Jun-Hwan, K., Jin-Young, K., Lok-Ji, L., Kyoung, K.S., Sung, C.H., Baek, H.Y., 2018. Effects of waterborne nitrite on hematological parameters and stress indicators in olive flounders, paralichthys olivaceus, raised in bio-floc and seawater. Chemosphere 209, 28–34. Kim, J.H., Park, H.J., Kang, J.C., 2017. Alterations in growth performance and stress responses in juvenile rockfish, Sebastes schlegelii, exposed to dietary chromium with varying levels of dietary ascorbic acid supplementation. Chemosphere 189, 672–678. Kim, J.H., Kim, J.Y., Lim, L.J., Su, K.K., Choi, H.S., Hur, Y.B., 2018. Effects of waterborne nitrite on hematological parameters and stress indicators in olive flounders, paralichthys olivaceus, raised in bio-floc and seawater. Chemosphere 209, 28–34. Knudsen, P.K., Jensen, F.B., 1997. Recovery from nitrite-induced methaemoglobinaemia and potassium balance disturbances in carp. Fish Physiol. Biochem. 16, 1–10. Kosaka, H., Tyuma, I., 1983. Mechanism of autocatalytic oxidation of oxyhemoglobin by nitrite. Environ. Health Perspect. 42, 237–241. Lee, Y.M., Rhee, J.S., Hwang, D.S., Kim, I.C., Raisuddin, S., Lee, J.S., 2008. P53 gene expression is modulated by endocrine disrupting chemicals in the hermaphroditic fish, kryptolebias marmoratus. Comp. Biochem. Physiol. C Toxicol. Pharmacol. 147, 150–157. Lewis, W.M., Morris, D.P., 1986. Toxicity of nitrite to fish: a review. Tran. Am. Fish. Soc. 115 (2), 183–195. Li, D.D., Luo, Z., Chen, G.H., Song, Y.F., Wei, C.C., Pan, Y.X., 2017. Identification of apoptosis-related genes bcl 2 and bax from yellow catfish, pelteobagrus fulvidraco, and their transcriptional responses to waterborne and dietborne zinc exposure. Gene 633, 1–8. Lin, Y., Miao, L.H., Pan, W.J., Huang, X., Dengu, J.M., Zhang, W.X., 2018. Effect of nitrite exposure on the antioxidant enzymes and glutathione system in the liver of bighead carp, aristichthys nobilis. Fish Shellfish Immunol. 76, 126–132. Liu, Y., Freedman, B.I., Burdon, K.P., Langefeld, C.D., Howard, T., Herrington, D., 2008. Association of arachidonate 12-lipoxygenase genotype variation and glycemic control with albuminuria in type 2 diabetes. Am. J. Kidney Dis. 52, 242–250. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real time quantitative PCR and the 2-ΔΔCT method. Methods 25, 402–408. Lora, J., Alonso, F.J., Segura, J.A., Lobo, C., Marquez, J., Mates, J.M., 2004. Antisense glutaminase inhibition decreases glutathione antioxidant capacity and increases apoptosis in Ehrlich ascitic tumour cells. Eur. J. Biochem. 271, 4298–4306. Luzio, A., Monteiro, S.M., Fontaínhas-Fernandes, António A., Pinto-Carnide, O., Matos,

9