- Email: [email protected]
IIIa Receptor PlA Polymorphism and Coronary Artery Disease or Carotid Intima-Media Thickness
Thrombosis Research 89 (1998) 85–89
BRIEF COMMUNICATION
Lack of Association between Platelet Glycoprotein IIb/IIIa Receptor PlA Polymorphism and Coronary Artery Disease or Carotid Intima-Media Thickness Uttam C. Garg1, Donna K. Arnett2, Aaron R. Folsom2, Michael A. Province3, Roger R. Williams4 and John H. Eckfeldt1 Department of Laboratory Medicine and Pathology, School of Medicine; 2Division of Epidemiology, School of Public Health, University of Minnesota, Minneapolis, Minnesota; 3Division of Biostatistics, School of Medicine, Washington University, St. Louis, Missouri; 4Cardiovascular Genetics, University of Utah, Salt Lake City, Utah. 1
(Received 30 August 1997 by Editor S. Niewiarowski; revised/accepted 11 November 1997)
Key Words: Platelet receptors; IIb/IIIa polymorphism; Carotid intima-media thickness; Coronary heart disease
P
latelet aggregation plays an important role in the pathogenesis of atherosclerosis, thrombosis, and acute coronary syndromes [1]. The platelet glycoprotein IIb/IIIa receptor is a pivotal mediator of platelet aggregation [2]; fibrinogen and von Willebrand factor bind to the glycoprotein IIb/IIIa receptor on the platelet surface [3–5], forming bridges between adjacent platelets, facilitating platelet aggregation. Alterations in the glycoprotein IIb/IIIa receptor change the affinity of this receptor for fibrinogen. Inhibitors of the glycoprotein IIb/IIIa receptor which bind to the receptor and block the binding of fibrinogen are used in patients undergoing coronary angioplasty and those with unstable angina and acute myocardial infarction [6–8]. A polymorphism of the glycoprotein IIIa gene (PlA2) was recently characterized. A strong association between the polymorphism PlA2 (substitution of cytosine for thymidine at position 1565 in exon 2) and coronary thrombosis in kindreds with a high prevalence of premature myocardial infarction was recently reported [9]. In another study of 180 paCorresponding author: Dr. Donna Arnett, Division of Epidemiology, University of Minnesota, 1300 South Second Street, Suite 300, Minneapolis, MN. Fax: 612-624-0315; E-mail: ,arnett@epivax. epi.umn.edu..
tients with angiographically documented coronary artery disease (104 also with myocardial infarction) no association of the PlA2 polymorphism and myocardial infarction was found [10]. A third study found a trend toward a higher prevalence of PlA2 polymorphism in patients with a history of myocardial infarction, although this trend was not statistically significant [11]. To further evaluate the importance of this polymorphism, we examined the relationship of the PlA2 polymorphism with earlyonset coronary heart disease and ultrasound measures of carotid intima-media thickness in a population-based sample of adults, enriched with families with early-onset coronary heart disease.
1. Materials and Methods 1.1. Selection of Study Subjects and Examination Methods Data for this study were collected as part of the NHLBI Family Heart Study (FHS). FHS was designed to investigate genetic and non-genetic determinants of coronary heart disease (CHD), atherosclerosis, and cardiovascular risk factors [12]. A subset of 1292 adults (n5515 families) was sampled from the FHS population and included (1) sibships in which at least two of the siblings were CHDaffected full siblings; (2) sibships in which at least one sibling was above the 90th percentile of the
0049-3848/98 $19.00 1 .00 1998 Elsevier Science Ltd. Printed in the USA. All rights reserved. PII S0049-3848(97)00295-8
86
U.C. Garg et al./Thrombosis Research 89 (1998) 85–89
distribution of carotid artery intima-media thickness; (3) sibships with at least two full siblings and at least one of the siblings at or above the age-sex specific 80th percentile of the Individual Risk Score (a score derived for each individual using sex-specific proportional hazards models to predict ageof-onset of CHD, based on carotid artery intimamedia thickness, lipids, body mass index, blood pressure, hypertension, diabetes, and a family CHD history score); and (4) randomly selected, unrelated subjects.
1.2. Physiologic Measurements Blood pressure measurements were taken with a random zero sphygmomanometer. Body mass index was calculated as weight (kg) divided by height (m2). Smoking status was based on self-report. LDL and HDL cholesterol and fibrinogen were measured using standard techniques. Carotid B-mode ultrasound examinations were performed with a Biosound 2000IIsa using a common scanning protocol; readings were conducted by trained and certified readers at a central reading center. Measurements of intima-media thickness were derived in the far wall of three segments of the right and left extracranial carotid arteries: (1) the common carotid artery (one centimeter proximal to the dilatation of the carotid bulb); (2) the bifurcation (the one centimeter segment proximal to the flow divider); and (3) the internal carotid artery (the one centimeter segment in the internal branch distal to the flow divider). Eleven contiguous measurements (one millimeter each) were attempted in each of the six segments, and the overall average value of the mean wall thickness at the six segments combined was calculated and used in the analysis. CHD was defined by a stringent validation system using medical records; CHD was defined by hospital discharge diagnoses of myocardial infarction and/or revascularization procedure (angioplasty or coronary artery bypass grafting) during the hospitalization. These CHD events occurred prior to entry into the Family Heart Study. Early-onset CHD was used in analysis, and was defined by age of onset before age 55 years in men or 65 years in women.
1.3. PlA Genotyping PlA genotyping was done as described by Weiss et al. [9]. A 266-bp DNA fragment containing exon 2
was amplified by polymerase chain reaction (PCR) using sense primer (59TTCTGATTGCTGGACTTCTCTT39) and antisense primer (59TCTCTCCCCATGGCAAAGAGT39). The primers used were synthesized on a DNA synthesizer (Model ABI 394, Applied Biosystems, Inc., Foster City, CA) by the Microchemical Facility at the University of Minnesota and purified by HPLC. PCR reactions were carried out with approximately 50 ng of genomic DNA and 2.5 units of AmpliTaq DNA polymerase (Perkin-Elmer Cetus, Norwalk, CT) in a volume of 50 ml, containing 1 ml of dimethylsulfoxide, 10 mmol/L Tris (pH 8.3), 1.5 mmol/L MgCl2, 50 mmol/L KCl, 0.2 mmol/L of all four deoxynucleoside triphosphates and 0.2 mmol/L of each primer. After denaturation for 3 minutes at 958C, the temperature was cycled 30 times (958C, 1 minute; 608C, 1 minute; and 728C, 2 minutes) followed by extension at 728C for 5 minutes to amplify the target DNA (Ericomp Twin Blocke System, Easy Cyclere Series, Ericomp Inc., San Diego, CA). To verify amplification, the PCR products were electrophoresed on a 2% low melting point agarose gel (NuSieve GTG; FMC Bioproducts) containing ethidium bromide. To distinguish PlA1 from PlA2, the PCR product was digested with MspI restriction enzyme according to the manufacturer’s (Gibco Life Sciences) instructions. A new restriction site is generated as the result of the PlA2 polymorphism [9]. Restriction digest products were separated on 12% polyacrylamide gels. After electrophoresis, the polyacrylamide gels were fixed with 10% ethanol/0.5% acetic acid, stained with 0.1% AgN03, and developed with 1.5% NaOH, 0.01% NaBH4, and 0.15% formaldehyde.
1.4. Statistical Analysis Differences in frequencies and means of study variables by the presence/absence of the mutation were tested using chi-square and t-test statistics. To test the association of the presence/absence of the mutation with intima-media thickness and early-onset CHD, analysis of covariance and logistic regression models were used. Models were adjusted for factors possibly associated with IMT/CHD and the Pl IIb/IIIa mutation (sex, smoking, systolic blood pressure, fibrinogen, and LDL and HDL cholesterol concentrations). Late-onset CHD cases were classified as “non-cases” for this report; however,
U.C. Garg et al./Thrombosis Research 89 (1998) 85–89
Table 1. Frequencies for glycoprotein IIIa receptor (PlA) genotypes Genotype PlA2/PlA2 PlA1/PlA2 PlA1/PlA1 a
Number of subjects
Observed (%)
Expected (%)a
37 361 894
2.9 27.9 69.2
3.6 30.8 65.6
Based on Hardy-Weinberg equilibrium.
analyses either excluding or reclassifying them as CHD cases yielded results of similar magnitude. A bootstrap procedure was used to correct the standard errors in the statistical tests performed. The bootstrap randomly selects one individual per family and models over 300 replications, thereby eliminating the familial correlations inherent in the data. All analyses were conducted using the Statistical Analysis System (SAS) version 6.11.
2. Results and Discussion The formation of platelet aggregates requires the binding of fibrinogen and von Willebrand factor to the glycoprotein IIb/IIIa receptor on platelet surfaces [2–5]. Antibodies directed against the IIb/ IIIa glycoprotein receptor reduce ischemic complications of coronary angioplasty and athrectomy, showing the importance of this receptor in platelet aggregation [6,7]. A polymorphism which alters the receptor structure may change the affinity of the receptor to fibrinogen and von Willebrand factor, thereby increasing or decreasing platelet aggregation. Indeed, Glanzmann thrombasthenia, an autosomal recessive disorder characterized by severe mucocutaneous bleeding, results from mutations in the glycoprotein IIb/IIIa genes. Because platelets are unable to bind to fibrinogen, a plug cannot be formed at the site of injury [13,14]. It is conceivable that there may be mutations in the glycoprotein IIb/IIIa receptor which increase the affinity of this receptor for fibrinogen, leading to a hypercoagulable state. Recently, conflicting results have been reported on the association between polymorphism PlA2 of the gene encoding glycoprotein IIIa and coronary artery disease. Reasons for these discrepancies may be related to differences in study populations, coronary heart disease case definitions, or inadequate
87
sample sizes. We studied the association of the PlA2 polymorphism with prevalent early-onset CHD and carotid intima-media thickness in a large sample of adults recruited as part of the NHLBI Family Heart Study [12]. Table 1 shows the glycoprotein IIIa genotype frequencies at the PlA locus for all subjects studied. There is excellent agreement between the observed and expected (based on Hardy-Weinberg equilibrium) frequencies providing the allelic frequencies of PlA1 and PlA2 of 0.81 and 0.19, respectively. The allelic frequencies observed in our population are comparable with the frequencies observed in other studies; however, our PlA2 allele frequency was lower than that observed in cases (23% PlA2 frequency), and higher in controls (10% PlA2 frequency) of the Weiss et al. study [9]. Table 2 shows the characteristics of the study subjects with respect to the presence or absence of PlA2 polymorphism. There were no significant differences in any of the variables by genotype; however, LDL cholesterol and current smoking were slightly higher in the subjects with PlA2 polymorphism. Of particular relevance given the relationship of the glycoprotein IIb/IIIa receptor and fibrinogen, no difference in fibrinogen levels were found in those with and without the mutation. The presence of the PlA2 polymorphism was not associated with carotid intima-media thickness before or after adjustment for fibrinogen, smoking and LDL cholesterol (Figure 1). Early-onset CHD prevalence did not differ by the presence/absence of the PlA2 polymorphism (see Table 1). There were 51 cases (12.7% prevalence) of early-onset CHD in those with the PlA2 polymorphism compared to 124 cases (13.9% prevalence) in those who were PlA2 homozygotes. After adjusting for fibrinogen alone, early-onset CHD cases were 40% more likely to have the PlA2 polymorphism present, (odds ratio 1.4, 95% confidence interval 4.0–5.6). Additional adjustment for smoking and LDL cholesterol did not materially alter the results (odds ratio 1.8, 95% confidence interval 0.4–7.9) (Table 3). In summary, this is, to our knowledge, the first report of the relationship between the PlA2 polymorphism and ultrasound measured carotid atherosclerosis. The data indicate no association between PlA2 polymorphism and carotid intima-media thickness. In addition, we found a non-significant
88
U.C. Garg et al./Thrombosis Research 89 (1998) 85–89
Table 2. Number of study subjects, frequencies of male gender, smoking and coronary heart disease, and means (standard deviations) of blood pressure, lipids, fibrinogen, body mass index, and intima-media thickness by glycoprotein receptor polymorphism genotypes, and p-values of tests for differences by glycoprotein receptor IIIa genotypes Variable Number Age (years) Male (%) Current smoking (%) Systolic BP (mm Hg) HDL cholesterol (mg/dL) LDL cholesterol (mg/dL) Fibrinogen (mg/dL) Body mass index (kg/m2) Intima-media thickness (mm) Coronary heart disease (%)
PlA1/PlA21PlA2/PlA2 398 55.6 49.0 17.8 119.9 47.3 132.9 323.0 28.5 0.802 12.7
association of the PlA2 polymorphism with earlyonset CHD, similar to Cartet et al. [11] but unlike Weiss et al. [9]. The later study showed a strong association between PlA2 polymorphism and acute coronary thrombosis in general, and in particular in patients with myocardial infarction before the age of 60 years. These discrepancies could reflect different methods used in selection of study subjects and/or the definition of coronary heart disease cases. For example, we used a hospital record vali-
(11.9)
(18.5) (14.0) (36.8) (77.9) (5.7) (0.264)
PlA1/PlA1 894 55.6 46.3 14.0 119.6 48.3 128.8 325.4 28.5 0.811 13.9
(11.1)
(18.6) (15.6) (34.7) (78.7) (5.7) (0.287)
p-value 0.92 0.37 0.07 0.78 0.21 0.06 0.62 0.94 0.61 0.55
dation of myocardial infarction and/or coronary revascularization procedure, while Weiss used hospital admissions for myocardial infarction or unstable angina. Of particular concern in the Weiss study was the low PlA2 allele frequency in the control patients; patients were selected from admissions to general medicine and intensive care services of the hospital. It is possible that the PlA2 allele frequency in this patient series does not reflect that of the source population that generated the cases. Our
Fig. 1. Mean carotid intima-media thickness and 95% confidence interval by platelet receptor IIIa genotype, after adjusting for fibrinogen, and fibrinogen, smoking and LDL cholesterol.
U.C. Garg et al./Thrombosis Research 89 (1998) 85–89
Table 3. Logistic odds ratios and 95% confidence intervals for CHD in association with the presence/absence of the PlA2 polymorphism after adjustment for fibrinogen, and fibrinogen, smoking, and LDL cholesterol Adjusted for Fibrinogen only Fibrinogen, smoking, LDL cholesterol
Odds ratio
95% Confidence interval
1.4
0.4–5.6
1.8
0.4–7.9
sample was also much larger than that of Weiss. We studied a total of 1292 adults of which 175 had validated coronary heart disease, in comparison to Weiss’s 71 cases and 68 controls. The use of prevalent cases of CHD in our study may also have biased the observed risk estimate toward the null value since incident cases with the glycoprotein PlA2 mutation may have died prior to detection, however, the PlA2 allele frequency was just slightly lower in the overall FHS population than that of Weiss et al. cases (19% versus 23%, respectively).
References 1. Fuster V, Badimon L, Badimon JJ, Chesebro JH. The pathogenesis of coronary artery disease and the acute coronary syndromes. N Engl J Med 1992;326:310–8. 2. Lefkovits J, Plow EF, Topol EJ. Platelet glycoprotein IIb/IIIa receptors in cardiovascular medicine. N Engl J Med 1995;332:1553–9. 3. Hantgan RR, Hindriks G, Taylor RG, Sixma JJ, de Groot PG. Glycoprotein Ib, von Willebrand factor, and glycoprotein IIb:IIIa are involved in platelet adhesion to fibrin in flowing whole blood. Blood 1990;76:345–63. 4. Jang Y, Lincoff AM, Plow EF, Topol EJ. Cell adhesion molecules in coronary artery disease. J Am Coll Cardiol 1994;24:1591–601. 5. Parise LV, Steiner B, Nannizzi L, Criss AB, Phillips DR. Evidence for novel binding sites on the platelet glycoprotein IIb and IIIa subunits and immobilized fibrinogen. Biochemical J 1993;289:45–51.
89
6. The EPIC Investigators. Use of a monoclonal antibody directed against the platelet glycoprotein IIb/IIIa receptor in high risk coronary angioplasty. N Engl J Med 1994;330:956–61. 7. Lefkovits J, Ivanhoe RJ, Califf RM, Bergelson BA, Anderson KM, Stoner GL, Weisman HF, Topol EJ. Effects of platelet glycoprotein IIb/ IIIa receptor blockade by a chimeric monoclonal antibody (abciximab) on acute and sixmonth outcomes after percutaneous transluminal coronary angioplasty for acute myocardial infarction. EPIC investigators. Am J Cardiol 1996;77:1045–51. 8. Matsuno H, Stassen JM, Vermtlen J, Deckmyn H. Inhibition of integrin function by a cyclic RGD-containing peptide prevents neointima formation. Circulation 1994;90:2203–6. 9. Weiss EJ, Bray PF, Tayback M, Schulman SP, Kickler TS, Becker LC, Weiss JL, Gerstenblith G, Goldschmidt-Clermont PJ. A polymorphism of a platelet glycoprotein receptor as an inherited risk factor for coronary thrombosis. N Engl J Med 1996;334:1090–4. 10. Marian AJ, Brugada R, Kleiman NS. Platelet glycoprotein IIIa PlA polymorphism and myocardial infarction. N Engl J Med 1996;335: 1071–2. 11. Carter AM, Ossei-Gerning N. Platelet glycoprotein IIIa PlA polymorphism and myocardial infarction. N Engl J Med 1996;335:1072–3. 12. Higgins M, Province M, Heiss G, Eckfeldt J, Ellison RC, Folsom A, Rao DC, Sprafka JM, Williams R for the NHLBI Family Heart Study Investigators. The NHLBI Family Heart Study: objectives and design. Am J Epidemiol 1996; 143(12):1219–28. 13. Djaffar I, Caen JP, Rosa JP. A large alteration in the human platelet glycoprotein IIIa (integrin beta 3) gene associated with Glanzmann’s thrombasthenia. Hum Mol Genetics 1993;2: 2183–5. 14. Pober M, Kyrle PA, Panzer S. Genotyping provides a reliable tool for the determination of the platelet antigen system HPA-1 in Glanzmann’s thrombasthenia. Br J Haematol 1993; 85:112–5.
BRIEF COMMUNICATION
Lack of Association between Platelet Glycoprotein IIb/IIIa Receptor PlA Polymorphism and Coronary Artery Disease or Carotid Intima-Media Thickness Uttam C. Garg1, Donna K. Arnett2, Aaron R. Folsom2, Michael A. Province3, Roger R. Williams4 and John H. Eckfeldt1 Department of Laboratory Medicine and Pathology, School of Medicine; 2Division of Epidemiology, School of Public Health, University of Minnesota, Minneapolis, Minnesota; 3Division of Biostatistics, School of Medicine, Washington University, St. Louis, Missouri; 4Cardiovascular Genetics, University of Utah, Salt Lake City, Utah. 1
(Received 30 August 1997 by Editor S. Niewiarowski; revised/accepted 11 November 1997)
Key Words: Platelet receptors; IIb/IIIa polymorphism; Carotid intima-media thickness; Coronary heart disease
P
latelet aggregation plays an important role in the pathogenesis of atherosclerosis, thrombosis, and acute coronary syndromes [1]. The platelet glycoprotein IIb/IIIa receptor is a pivotal mediator of platelet aggregation [2]; fibrinogen and von Willebrand factor bind to the glycoprotein IIb/IIIa receptor on the platelet surface [3–5], forming bridges between adjacent platelets, facilitating platelet aggregation. Alterations in the glycoprotein IIb/IIIa receptor change the affinity of this receptor for fibrinogen. Inhibitors of the glycoprotein IIb/IIIa receptor which bind to the receptor and block the binding of fibrinogen are used in patients undergoing coronary angioplasty and those with unstable angina and acute myocardial infarction [6–8]. A polymorphism of the glycoprotein IIIa gene (PlA2) was recently characterized. A strong association between the polymorphism PlA2 (substitution of cytosine for thymidine at position 1565 in exon 2) and coronary thrombosis in kindreds with a high prevalence of premature myocardial infarction was recently reported [9]. In another study of 180 paCorresponding author: Dr. Donna Arnett, Division of Epidemiology, University of Minnesota, 1300 South Second Street, Suite 300, Minneapolis, MN. Fax: 612-624-0315; E-mail: ,arnett@epivax. epi.umn.edu..
tients with angiographically documented coronary artery disease (104 also with myocardial infarction) no association of the PlA2 polymorphism and myocardial infarction was found [10]. A third study found a trend toward a higher prevalence of PlA2 polymorphism in patients with a history of myocardial infarction, although this trend was not statistically significant [11]. To further evaluate the importance of this polymorphism, we examined the relationship of the PlA2 polymorphism with earlyonset coronary heart disease and ultrasound measures of carotid intima-media thickness in a population-based sample of adults, enriched with families with early-onset coronary heart disease.
1. Materials and Methods 1.1. Selection of Study Subjects and Examination Methods Data for this study were collected as part of the NHLBI Family Heart Study (FHS). FHS was designed to investigate genetic and non-genetic determinants of coronary heart disease (CHD), atherosclerosis, and cardiovascular risk factors [12]. A subset of 1292 adults (n5515 families) was sampled from the FHS population and included (1) sibships in which at least two of the siblings were CHDaffected full siblings; (2) sibships in which at least one sibling was above the 90th percentile of the
0049-3848/98 $19.00 1 .00 1998 Elsevier Science Ltd. Printed in the USA. All rights reserved. PII S0049-3848(97)00295-8
86
U.C. Garg et al./Thrombosis Research 89 (1998) 85–89
distribution of carotid artery intima-media thickness; (3) sibships with at least two full siblings and at least one of the siblings at or above the age-sex specific 80th percentile of the Individual Risk Score (a score derived for each individual using sex-specific proportional hazards models to predict ageof-onset of CHD, based on carotid artery intimamedia thickness, lipids, body mass index, blood pressure, hypertension, diabetes, and a family CHD history score); and (4) randomly selected, unrelated subjects.
1.2. Physiologic Measurements Blood pressure measurements were taken with a random zero sphygmomanometer. Body mass index was calculated as weight (kg) divided by height (m2). Smoking status was based on self-report. LDL and HDL cholesterol and fibrinogen were measured using standard techniques. Carotid B-mode ultrasound examinations were performed with a Biosound 2000IIsa using a common scanning protocol; readings were conducted by trained and certified readers at a central reading center. Measurements of intima-media thickness were derived in the far wall of three segments of the right and left extracranial carotid arteries: (1) the common carotid artery (one centimeter proximal to the dilatation of the carotid bulb); (2) the bifurcation (the one centimeter segment proximal to the flow divider); and (3) the internal carotid artery (the one centimeter segment in the internal branch distal to the flow divider). Eleven contiguous measurements (one millimeter each) were attempted in each of the six segments, and the overall average value of the mean wall thickness at the six segments combined was calculated and used in the analysis. CHD was defined by a stringent validation system using medical records; CHD was defined by hospital discharge diagnoses of myocardial infarction and/or revascularization procedure (angioplasty or coronary artery bypass grafting) during the hospitalization. These CHD events occurred prior to entry into the Family Heart Study. Early-onset CHD was used in analysis, and was defined by age of onset before age 55 years in men or 65 years in women.
1.3. PlA Genotyping PlA genotyping was done as described by Weiss et al. [9]. A 266-bp DNA fragment containing exon 2
was amplified by polymerase chain reaction (PCR) using sense primer (59TTCTGATTGCTGGACTTCTCTT39) and antisense primer (59TCTCTCCCCATGGCAAAGAGT39). The primers used were synthesized on a DNA synthesizer (Model ABI 394, Applied Biosystems, Inc., Foster City, CA) by the Microchemical Facility at the University of Minnesota and purified by HPLC. PCR reactions were carried out with approximately 50 ng of genomic DNA and 2.5 units of AmpliTaq DNA polymerase (Perkin-Elmer Cetus, Norwalk, CT) in a volume of 50 ml, containing 1 ml of dimethylsulfoxide, 10 mmol/L Tris (pH 8.3), 1.5 mmol/L MgCl2, 50 mmol/L KCl, 0.2 mmol/L of all four deoxynucleoside triphosphates and 0.2 mmol/L of each primer. After denaturation for 3 minutes at 958C, the temperature was cycled 30 times (958C, 1 minute; 608C, 1 minute; and 728C, 2 minutes) followed by extension at 728C for 5 minutes to amplify the target DNA (Ericomp Twin Blocke System, Easy Cyclere Series, Ericomp Inc., San Diego, CA). To verify amplification, the PCR products were electrophoresed on a 2% low melting point agarose gel (NuSieve GTG; FMC Bioproducts) containing ethidium bromide. To distinguish PlA1 from PlA2, the PCR product was digested with MspI restriction enzyme according to the manufacturer’s (Gibco Life Sciences) instructions. A new restriction site is generated as the result of the PlA2 polymorphism [9]. Restriction digest products were separated on 12% polyacrylamide gels. After electrophoresis, the polyacrylamide gels were fixed with 10% ethanol/0.5% acetic acid, stained with 0.1% AgN03, and developed with 1.5% NaOH, 0.01% NaBH4, and 0.15% formaldehyde.
1.4. Statistical Analysis Differences in frequencies and means of study variables by the presence/absence of the mutation were tested using chi-square and t-test statistics. To test the association of the presence/absence of the mutation with intima-media thickness and early-onset CHD, analysis of covariance and logistic regression models were used. Models were adjusted for factors possibly associated with IMT/CHD and the Pl IIb/IIIa mutation (sex, smoking, systolic blood pressure, fibrinogen, and LDL and HDL cholesterol concentrations). Late-onset CHD cases were classified as “non-cases” for this report; however,
U.C. Garg et al./Thrombosis Research 89 (1998) 85–89
Table 1. Frequencies for glycoprotein IIIa receptor (PlA) genotypes Genotype PlA2/PlA2 PlA1/PlA2 PlA1/PlA1 a
Number of subjects
Observed (%)
Expected (%)a
37 361 894
2.9 27.9 69.2
3.6 30.8 65.6
Based on Hardy-Weinberg equilibrium.
analyses either excluding or reclassifying them as CHD cases yielded results of similar magnitude. A bootstrap procedure was used to correct the standard errors in the statistical tests performed. The bootstrap randomly selects one individual per family and models over 300 replications, thereby eliminating the familial correlations inherent in the data. All analyses were conducted using the Statistical Analysis System (SAS) version 6.11.
2. Results and Discussion The formation of platelet aggregates requires the binding of fibrinogen and von Willebrand factor to the glycoprotein IIb/IIIa receptor on platelet surfaces [2–5]. Antibodies directed against the IIb/ IIIa glycoprotein receptor reduce ischemic complications of coronary angioplasty and athrectomy, showing the importance of this receptor in platelet aggregation [6,7]. A polymorphism which alters the receptor structure may change the affinity of the receptor to fibrinogen and von Willebrand factor, thereby increasing or decreasing platelet aggregation. Indeed, Glanzmann thrombasthenia, an autosomal recessive disorder characterized by severe mucocutaneous bleeding, results from mutations in the glycoprotein IIb/IIIa genes. Because platelets are unable to bind to fibrinogen, a plug cannot be formed at the site of injury [13,14]. It is conceivable that there may be mutations in the glycoprotein IIb/IIIa receptor which increase the affinity of this receptor for fibrinogen, leading to a hypercoagulable state. Recently, conflicting results have been reported on the association between polymorphism PlA2 of the gene encoding glycoprotein IIIa and coronary artery disease. Reasons for these discrepancies may be related to differences in study populations, coronary heart disease case definitions, or inadequate
87
sample sizes. We studied the association of the PlA2 polymorphism with prevalent early-onset CHD and carotid intima-media thickness in a large sample of adults recruited as part of the NHLBI Family Heart Study [12]. Table 1 shows the glycoprotein IIIa genotype frequencies at the PlA locus for all subjects studied. There is excellent agreement between the observed and expected (based on Hardy-Weinberg equilibrium) frequencies providing the allelic frequencies of PlA1 and PlA2 of 0.81 and 0.19, respectively. The allelic frequencies observed in our population are comparable with the frequencies observed in other studies; however, our PlA2 allele frequency was lower than that observed in cases (23% PlA2 frequency), and higher in controls (10% PlA2 frequency) of the Weiss et al. study [9]. Table 2 shows the characteristics of the study subjects with respect to the presence or absence of PlA2 polymorphism. There were no significant differences in any of the variables by genotype; however, LDL cholesterol and current smoking were slightly higher in the subjects with PlA2 polymorphism. Of particular relevance given the relationship of the glycoprotein IIb/IIIa receptor and fibrinogen, no difference in fibrinogen levels were found in those with and without the mutation. The presence of the PlA2 polymorphism was not associated with carotid intima-media thickness before or after adjustment for fibrinogen, smoking and LDL cholesterol (Figure 1). Early-onset CHD prevalence did not differ by the presence/absence of the PlA2 polymorphism (see Table 1). There were 51 cases (12.7% prevalence) of early-onset CHD in those with the PlA2 polymorphism compared to 124 cases (13.9% prevalence) in those who were PlA2 homozygotes. After adjusting for fibrinogen alone, early-onset CHD cases were 40% more likely to have the PlA2 polymorphism present, (odds ratio 1.4, 95% confidence interval 4.0–5.6). Additional adjustment for smoking and LDL cholesterol did not materially alter the results (odds ratio 1.8, 95% confidence interval 0.4–7.9) (Table 3). In summary, this is, to our knowledge, the first report of the relationship between the PlA2 polymorphism and ultrasound measured carotid atherosclerosis. The data indicate no association between PlA2 polymorphism and carotid intima-media thickness. In addition, we found a non-significant
88
U.C. Garg et al./Thrombosis Research 89 (1998) 85–89
Table 2. Number of study subjects, frequencies of male gender, smoking and coronary heart disease, and means (standard deviations) of blood pressure, lipids, fibrinogen, body mass index, and intima-media thickness by glycoprotein receptor polymorphism genotypes, and p-values of tests for differences by glycoprotein receptor IIIa genotypes Variable Number Age (years) Male (%) Current smoking (%) Systolic BP (mm Hg) HDL cholesterol (mg/dL) LDL cholesterol (mg/dL) Fibrinogen (mg/dL) Body mass index (kg/m2) Intima-media thickness (mm) Coronary heart disease (%)
PlA1/PlA21PlA2/PlA2 398 55.6 49.0 17.8 119.9 47.3 132.9 323.0 28.5 0.802 12.7
association of the PlA2 polymorphism with earlyonset CHD, similar to Cartet et al. [11] but unlike Weiss et al. [9]. The later study showed a strong association between PlA2 polymorphism and acute coronary thrombosis in general, and in particular in patients with myocardial infarction before the age of 60 years. These discrepancies could reflect different methods used in selection of study subjects and/or the definition of coronary heart disease cases. For example, we used a hospital record vali-
(11.9)
(18.5) (14.0) (36.8) (77.9) (5.7) (0.264)
PlA1/PlA1 894 55.6 46.3 14.0 119.6 48.3 128.8 325.4 28.5 0.811 13.9
(11.1)
(18.6) (15.6) (34.7) (78.7) (5.7) (0.287)
p-value 0.92 0.37 0.07 0.78 0.21 0.06 0.62 0.94 0.61 0.55
dation of myocardial infarction and/or coronary revascularization procedure, while Weiss used hospital admissions for myocardial infarction or unstable angina. Of particular concern in the Weiss study was the low PlA2 allele frequency in the control patients; patients were selected from admissions to general medicine and intensive care services of the hospital. It is possible that the PlA2 allele frequency in this patient series does not reflect that of the source population that generated the cases. Our
Fig. 1. Mean carotid intima-media thickness and 95% confidence interval by platelet receptor IIIa genotype, after adjusting for fibrinogen, and fibrinogen, smoking and LDL cholesterol.
U.C. Garg et al./Thrombosis Research 89 (1998) 85–89
Table 3. Logistic odds ratios and 95% confidence intervals for CHD in association with the presence/absence of the PlA2 polymorphism after adjustment for fibrinogen, and fibrinogen, smoking, and LDL cholesterol Adjusted for Fibrinogen only Fibrinogen, smoking, LDL cholesterol
Odds ratio
95% Confidence interval
1.4
0.4–5.6
1.8
0.4–7.9
sample was also much larger than that of Weiss. We studied a total of 1292 adults of which 175 had validated coronary heart disease, in comparison to Weiss’s 71 cases and 68 controls. The use of prevalent cases of CHD in our study may also have biased the observed risk estimate toward the null value since incident cases with the glycoprotein PlA2 mutation may have died prior to detection, however, the PlA2 allele frequency was just slightly lower in the overall FHS population than that of Weiss et al. cases (19% versus 23%, respectively).
References 1. Fuster V, Badimon L, Badimon JJ, Chesebro JH. The pathogenesis of coronary artery disease and the acute coronary syndromes. N Engl J Med 1992;326:310–8. 2. Lefkovits J, Plow EF, Topol EJ. Platelet glycoprotein IIb/IIIa receptors in cardiovascular medicine. N Engl J Med 1995;332:1553–9. 3. Hantgan RR, Hindriks G, Taylor RG, Sixma JJ, de Groot PG. Glycoprotein Ib, von Willebrand factor, and glycoprotein IIb:IIIa are involved in platelet adhesion to fibrin in flowing whole blood. Blood 1990;76:345–63. 4. Jang Y, Lincoff AM, Plow EF, Topol EJ. Cell adhesion molecules in coronary artery disease. J Am Coll Cardiol 1994;24:1591–601. 5. Parise LV, Steiner B, Nannizzi L, Criss AB, Phillips DR. Evidence for novel binding sites on the platelet glycoprotein IIb and IIIa subunits and immobilized fibrinogen. Biochemical J 1993;289:45–51.
89
6. The EPIC Investigators. Use of a monoclonal antibody directed against the platelet glycoprotein IIb/IIIa receptor in high risk coronary angioplasty. N Engl J Med 1994;330:956–61. 7. Lefkovits J, Ivanhoe RJ, Califf RM, Bergelson BA, Anderson KM, Stoner GL, Weisman HF, Topol EJ. Effects of platelet glycoprotein IIb/ IIIa receptor blockade by a chimeric monoclonal antibody (abciximab) on acute and sixmonth outcomes after percutaneous transluminal coronary angioplasty for acute myocardial infarction. EPIC investigators. Am J Cardiol 1996;77:1045–51. 8. Matsuno H, Stassen JM, Vermtlen J, Deckmyn H. Inhibition of integrin function by a cyclic RGD-containing peptide prevents neointima formation. Circulation 1994;90:2203–6. 9. Weiss EJ, Bray PF, Tayback M, Schulman SP, Kickler TS, Becker LC, Weiss JL, Gerstenblith G, Goldschmidt-Clermont PJ. A polymorphism of a platelet glycoprotein receptor as an inherited risk factor for coronary thrombosis. N Engl J Med 1996;334:1090–4. 10. Marian AJ, Brugada R, Kleiman NS. Platelet glycoprotein IIIa PlA polymorphism and myocardial infarction. N Engl J Med 1996;335: 1071–2. 11. Carter AM, Ossei-Gerning N. Platelet glycoprotein IIIa PlA polymorphism and myocardial infarction. N Engl J Med 1996;335:1072–3. 12. Higgins M, Province M, Heiss G, Eckfeldt J, Ellison RC, Folsom A, Rao DC, Sprafka JM, Williams R for the NHLBI Family Heart Study Investigators. The NHLBI Family Heart Study: objectives and design. Am J Epidemiol 1996; 143(12):1219–28. 13. Djaffar I, Caen JP, Rosa JP. A large alteration in the human platelet glycoprotein IIIa (integrin beta 3) gene associated with Glanzmann’s thrombasthenia. Hum Mol Genetics 1993;2: 2183–5. 14. Pober M, Kyrle PA, Panzer S. Genotyping provides a reliable tool for the determination of the platelet antigen system HPA-1 in Glanzmann’s thrombasthenia. Br J Haematol 1993; 85:112–5.