- Email: [email protected]
MiR-141-3p regulates proliferation and senescence of stem cells from apical papilla by targeting YAP
Experimental Cell Research 383 (2019) 111562
Contents lists available at ScienceDirect
Experimental Cell Research journal homepage: www.elsevier.com/locate/yexcr
MiR-141-3p regulates proliferation and senescence of stem cells from apical papilla by targeting YAP
T
Zehan Lia,b, Xingyun Gea,b, Jiamin Lua,b, Minxia Biana,b, Na Lia,b, Xiao Wua,b, Yuzhi Lia,b, ⁎ ⁎⁎ Ming Yana,b, , Jinhua Yub, a b
Key Laboratory of Oral Diseases of Jiangsu Province and Stomatological Institute of Nanjing Medical University, 140 Hanzhong Road, Nanjing, Jiangsu, 210029, China Endodontic Department, School of Stomatology, Nanjing Medical University, 136 Hanzhong Road, Nanjing, Jiangsu, 210029, China
A R T I C LE I N FO
A B S T R A C T
Keywords: Stem cells miR-141-3p YAP Proliferation Senescence
Biological phenotypes of mesenchymal stem cells (MSCs) are regulated by a series of biochemical elements, including microRNAs, hormones and growth factors. Our previous study illustrated a significant role of miR-1413p during the osteogenic differentiation of stem cells from apical papilla (SCAPs). Nevertheless, the functions of miR-141-3p in regulating the proliferative ability and senescence of SCAPs have not been determined. This study identified that overexpression of miR-141-3p inhibited the proliferative ability of SCAPs. Meanwhile, the senescence of SCAPs was ahead of time. Conversely, transfection of miR-141-3p inhibitor promoted the proliferative ability of SCAPs and delayed their senescence. Yes-associated protein (YAP) was predicted as the downstream target gene of miR-141-3p by online softwares (miRDB, miRTarBase, miRWalk, and TargetScan), and was further verified by dual-luciferase reporter gene assay. Additionally, knockdown of YAP inhibited the proliferation and accelerated the senescence of SCAPs. Collectively, these findings proposed a novel direction that miR-141-3p impeded proliferative ability and promoted senescence of SCAPs through post-transcriptionally downregulating YAP.
1. Introduction Bone formation is a complex developmental process involving multiple factors. Functional bone reconstruction is an extremely process for most patients with bone loss caused by fracture or bony defects [1]. Nowadays, autogenous bone grafts, xenografts, and allografts are the preferred therapeutic approaches for bone loss. However, they are limited by many complications, including infection, donor morbidity and immune rejection [2]. Recently, MSCs-based tissue engineering has been considered as a promising technique to bone defect treatment [3,4]. MSCs are a kind of multiply potential stem cells undergoing in vitro osteogenic, adipogenic, and neural differentiation under specific inducive conditions [5]. However, the traditional isolation method of MSCs from bone marrow is invasive to donors and complicated. Among multiple types of MSCs, SCAPs, which are isolated from an extracted tooth, exhibit a great privilege [6]. It has been reported that SCAPs are easily accessible and hardly induce immunological rejection reactions
[7]. Moreover, SCAPs have shown the strongest capabilities for proliferative capacity and osteogenic differentiation among dental-derived stem cells, indicating that SCAPs could be an optimal cell source for bone repair [8,9]. To stabilize and accelerate the process of SCAPsmediated bone regeneration, microarrays containing microRNAs and growth factors in aid of maintaining self-renewal, improving proliferation and committed differentiation abilities of SCAPs are identified [10–12]. Cellular senescence is a physiological process occurring with time passes, and the precise mechanism underlying senescence is unclear [13]. As stem cells become senescent, in vivo proliferative capacity, differentiation potential and self-renewal gradually attenuate [14,15]. These disadvantages markedly limit the application of stem cell-based therapy and thus lead to failure in the tissue regenerative engineering [16]. Hence, uncovering the regulatory mechanism of SCAPs senescence is urgently required for bone tissue regeneration engineering. MicroRNAs (miRNAs) are a type of short-chain, noncoding endogenous RNA, which exert post-transcription regulatory function by
⁎ Corresponding author. Lecturer Key Laboratory of Oral Diseases of Jiangsu Province School of Stomatology, Nanjing Medical University 136 Hanzhong Road, Nanjing, Jiangsu, 210029, China. ⁎⁎ Corresponding author. Key Laboratory of Oral Diseases of Jiangsu Province, School of Stomatology, Nanjing Medical University, 136 Hanzhong Road, Nanjing, Jiangsu, 210029, China. E-mail addresses: [email protected] (M. Yan), [email protected] (J. Yu).
https://doi.org/10.1016/j.yexcr.2019.111562 Received 2 July 2019; Received in revised form 14 August 2019; Accepted 17 August 2019 Available online 19 August 2019 0014-4827/ © 2019 Elsevier Inc. All rights reserved.
Experimental Cell Research 383 (2019) 111562
Z. Li, et al.
2.4. Western blot
binding to the 3′-UTR mRNAs [17,18]. Increasing evidences have indicated that miRNAs extensively participate in many physical performances of MSCs, including proliferation, senescence and differentiation. For example, miR-31a-5p acts as a key regulator during the senescence and osteogenesis of bone marrow microenvironment [19]. Chang et al. found that miR-195-5p negatively mediates the osteogenesis in periodontal ligament cells by directly targeting bone morphogenetic protein receptor-1A (BMPR1A) [20]. In addition, Sun et al. illustrated that miR-140-5p inhibits the proliferative ability and differentiation of dental pulp stem cells by downregulating toll-like receptor 4 (TLR-4) [21]. Our previous study reported that silence of miR-141-3p could promote the osteogenic differentiation of SCAPs. Furthermore, recent studies have shown the critical role of miR-141-3p in growth and senescence of some cell lineages [22–24]. However, the underlying function of miR-141-3p in the growth and senescence of SCAPs and the potential mechanism remain elusive. In this paper, miR-141-3p mimics and inhibitor were constructed to up-regulate and down-regulate miR-141-3p in SCAPs, respectively. Our results demonstrated that miR-141-3p could inhibit the proliferative ability and promote senescence of SCAPs. Down-regulated YAP in SCAPs presented a similar trend to that of miR-141-3p over-expression. The interaction between miR-141-3p and YAP was further verified by Western blot, qRT-PCR and dual-luciferase reporter gene assay.
SCAPs were lysed in radio immunoprecipitation assay buffer and quantified with a bicinchoninic acid kit (Beyotime). Proteins were loaded on 10% SDS-polyacrylamide gel electrophoresis and transferred to PVDF membranes (Millipore, USA). After blockage of non-specific antigens in 5% nonfat milk for 2 h, membranes were subjected to incubation with primary antibodies against P16 (#80772, Cell Signaling Technology, USA), P21 (#2947), P53 (#2527), YAP (#14074) and GAPDH (Protein Tech Group, Chicago, USA) at 4 °C overnight. After TBST washing for three times, they were subjected to incubation with secondary antibody for 1 h at RT. After TBST wash for three times, grey values were detected by chemiluminescent horseradish peroxidase substrate (Millipore). 2.5. QRT-PCR SCAPs were lysed for extracting RNAs using Trizol (Invitrogen, USA), and the RNA was subjected to reverse transcription with specific primers using a PrimeScript RT reagent kit (TaKaRa, Otsu, Japan). Quantitative reverse transcriptase PCR (qRT-PCR) was performed using the ChamQ™ SYBR Green quantitative PCR Master Mix (Vazyme, Nanjing, China). GAPDH and U6 were used as the internal normalized controls for mRNA and miRNAs, respectively. After detecting on the ABI 7300 real-time PCR system, relative level of target gene was calculated by the 2-△△Ct method using the Bulge-Loop miRNA qPCR Primer kits (RiboBio). The primers used in this study were synthesized by Sangon Biotech manufacturer (Shanghai, China) and their sequences were depicted in Table 1.
2. Materials and methods 2.1. Cell culture This experiment was approved by the Ethical Committee of Stomatological School of Nanjing Medical University. SCAPs were isolated and cultured as we previously described [25]. In brief, third molars with immature roots obtained from informed consents from 17 to 20-year-old donors were collected in Jiangsu Provincial Stomatological Hospital. PBS was used to flush the teeth carefully for three times. The dental apical papillae were softly separated, cut and digested in a mixed solution concluding 3 mg/mL type I collagenase (Sigma, St Louis, MO, USA) and 4 mg/mL trypsin (Gibco, Life Technologies, USA) at room temperature (RT) for 1 h. The dissolved tissues were then gently plated in 60 mm culture dishes supplemented with α-MEM containing 10% fetal bovine serum, 100 g/mL streptomycin and 100 U/mL penicillin (Gibco, Life Technologies) in a 5% CO2 incubator at 37 °C. The medium was changed once for the first 24 h, and 2 days interval thereafter. SCAPs were passaged using 0.25% trypsin at the ratio of 1:3 until 80% confluence. The third-to-fifth generation SCAPs were harvested for following experiments.
2.6. Immunofluorescence staining Immunocytochemistry staining assay was conducted as previously reported [26]. Briefly, transfected cells were fixed in 4% paraformaldehyde for 30 min and then washed with PBS for three times. Subsequently, cells were permeabilized with 0.1% Triton X-100 (Beyotime) for 10 min, blocked with goat serum at 37 °C for 2 h and then subjected to incubation of primary antibodies against P21 and YAP at 4 °C overnight. After that, the cells were immunoblotted with relevant fluorescein secondary antibodies (ZSGB-BIO, Beijing, China) at 37 °C, in dark for 1 h. Cell nuclei were counterstained with DAPI and fluorescence images were captured using an inverted fluorescence microscopy (Olympus, Shanghai, China). 2.7. Senescence associated beta galactosidase staining (SA-β-Gal)
2.2. Flow cytometry
SA-β-Gal staining kit (#9860, Cell Signaling Technology) was utilized to assess the SA-β-Gal activity of SCAPs. Briefly, SCAPs were washed with PBS, fixed with fixative solution at RT for 15 min, washed with PBS twice and stained with SA-β-Gal staining solution at 37 °C without CO2 for 24 h. After PBS wash, the number of blue-labeled cells was calculated in at least 3 randomly selected fields per sample, and the
To identify the purity of isolated SCAPs, flow cytometry assay was performed to detect cell phenotypic markers. SCAPs were harvested and digested using trypsin (Beyotime, Haimen, China) and resuspended in 0.01 mol/L PBS twice. Then, cells were incubated with the primary antibodies (CD105, CD90, CD73, CD29, CD34, CD45) at 4 °C, in dark for 1 h. Subsequently, the labeled cells were washed twice with PBS and examined with a flow cytometer (BD Biosciences, USA).
Table 1 Sense and antisense primers for real-time reverse transcription polymerase chain reaction.
2.3. Cell transfection MiR-141-3p mimics, mimics control (NC), inhibitor, inhibitor control (iNC), and YAP small interfering RNAs (siRNAs) were constructed by Ribobio corporation. The siRNA sequences of YAP were as follows: si-YAP1: 5′-CCACCAAGCTAGATAAAGA-3′, si-YAP2: 5′-GAGATGGAAT GAACATAGA-3′, si-YAP3: 5′-GTAGCCAGTTACCAACACT-3’. SCAPs at approximately 70% confluence were infected using riboFECTTM CP kit (RiboBio, Guangzhou, China).
Genes
Primers
Sequences (5′-3′)
P16
Forward Reverse Forward Reverse Forward Reverse Forward Reverse
CCCCGATTGAAAGAACCAGAGAG TACGGTAGTGGGGGAAGGCATA AGCGACCTTCCTCATCCACC AAGACAACTACTCCCAGCCCCATA AGCTTTGAGGTGCGTGTTTGTG TCTCCATCCAGTGGTTTCTTCTTTG TCTCCTCTGACTTCAACAGCGACA CCCTGTTGCTGTAGCCAAATTCGT
P21 P53 GAPDH
2
Experimental Cell Research 383 (2019) 111562
Z. Li, et al.
Fig. 1. Phenotype identification of SCAPs. (A) The morphology of SCAPs, left: primary culture, right: third-generation SCAPs. (B) Flow cytometry analysis showed that SCAPs were positive for CD29, CD73, CD90 and CD105, and negative for CD34 and CD45. (C) Immunofluorescence assay revealed that cultured SCAPs were positive for STRO-1 (scale bar = 200 μm).
3
Experimental Cell Research 383 (2019) 111562
Z. Li, et al.
Fig. 2. MiR-141-3p inhibits proliferation of SCAPs. (A) Transfection efficacy of miR-141-3p was confirmed by quantitative RT-PCR analysis. (B) Cell proliferation capability influenced by miR-141-3p was detected at 450 nm with CCK-8. upper: overexpression of miR-141-3p inhibited proliferation of SCAPs; bottom: knockdown of miR-141-3p promoted SCAPs proliferation. (C) Detection of cell cycle distribution by flow cytometry. MiR-141-3p decreased the proliferation ability of SCAPs. (D) EdU-positive SCAPs influenced by miR-141-3p were detected by EdU kit (scale bar = 200 μm). EdU (red), Hoechst333 (blue). Data are presented as mean ± SD; *P < 0.05 and **P < 0.01. EdU: 5-ethynyl-2-deoxyuridine; NC: mimics negative control; iNC: inhibitor negative control.
2.9. Dual-luciferase reporter gene assay
counts were quantified as a percentage of positive cells.
HEK293T cells were seeded in 96-well plates with 5 × 103/well. After 24 h, a mixture of Firefly Luciferase (800 ng) reporter vector and Renilla Luciferase (5 ng) reporter vector (wild- or mutant-type plasmid) (GeneChem, Shanghai, China) and 50 nM miR-141-3p mimics or normal control were co-transfected into cells. 48 h later, the DualLuciferase Reporter Assay System (Promega, Madison, USA) was used to detect the luciferase activity.
2.8. Cell counting kit‐8 (CCK‐8) and 5‐ethynyl‐2‐deoxyuridine (EdU) assay CCK-8 and EdU assay were conducted to examine the proliferative ability of SCAPs. For CCK-8 assay, SCAPs were plated into 96-well culture plates with 2 × 103 cells per well. 10 μl of CCK-8 reagent (Vazyme) was added to each well and incubated at 37 °C for about 2 h. The OD values were detected by a microplate reader (Bio-Tek, Vermont, USA) at 450 nm wavelength. For EdU incorporation assay, SCAPs were incubated with 50 mM EdU (Ribobio) for 2 h. After fixation with 4% paraformaldehyde for 20 min at RT, SCAPs were treated with 2 mg/ml glycine for 10 min and washed with PBS. Subsequently, cells were permeated with 0.5% Triton X-100 and incubated with 1 × Apollo solution at RT, in dark for 30 min. Then, SCAPs were incubated with 100 ml of 1 × Hoechst-33342 solution in dark at RT for 30 min 3 randomly selected fields per group were captured by a fluorescence microscope.
2.10. Statistical analysis Statistical Package for Social Sciences (SPSS) software (version 16.0) was utilized for data processing. Statistical significances were analyzed by one-way analysis of variance and Student's t-test (twotailed). P < 0.05 considered as statistically significant. Data were expressed as mean ± SD. *p < 0.05, **p < 0.01.
4
Experimental Cell Research 383 (2019) 111562
Z. Li, et al.
Fig. 3. MiR-141-3p promotes senescence of SCAPs. (A) Expression levels of senescence-related proteins (P53, P21 and P16) influenced by miR-141-3p were detected by Western blot analysis. GAPDH was used as the reference protein. (B) The mRNA levels of senescence-related genes (P53, P21 and P16) influenced by miR-141-3p were detected by qRT-PCR. GAPDH was used as the reference gene. (C) Senescence associated beta galactosidase staining showed higher senescence cells rate after overexpression of miR-141-3p than NC group. Knockdown of miR-141-3p showed lower senescence cells rate compared with iNC group (Scale Bar = 200 μm). (D) Immunofluorescence assay revealed that the expression of P21 in SCAPs overexpressing miR-141-3p was significantly up-regulated (Scale Bar = 20 μm). P21 (red), DAPI (blue). NC: mimics negative control; iNC: inhibitor negative control.
identify the characteristics of cultured cells, flow cytometry assay was conducted to detect their phenotypes. The results suggested that the isolated SCAPs were negative for CD34, CD45, but positive for CD29, CD73, CD90, and CD105 (Fig. 1C). Meanwhile, immunofluorescence staining revealed positive expression of STRO-1 in SCAPs (Fig. 1D). The above results demonstrated the successful isolation of SCAPs and confirmed their purity.
3. Results 3.1. Phenotype identification of SCAPs SCAPs were successfully isolated from apical papilla tissues of the collected third molars. They were in fibroblast- or spindle-like morphology observed under a light microscope (Fig. 1A and B). To further 5
Experimental Cell Research 383 (2019) 111562
Z. Li, et al.
Fig. 4. Target gene prediction of miR-141-3p and biological characteristics analysis. (A) Venn diagram showed number of miR-141-3p target genes predicted by performing miRDB, miRTarBase, miRWalk, and TargetScan algorithms. (B) GO annotation of 1017 target genes. Top 30 of GO enrichment were shown here. GO: domains directly related with reproduction. (C) Target genes were enriched in cell cycle and regulation of Hippo signaling pathway. (D) The binding sequences of miR-141-3p on YAP 3′ UTR were predicted by TargetScan software. The red letters represent the binding sequences of miR-141-3p. UTR: untranslated region.
effect of miR-141-3p on SCAPs senescence (Fig. 3D). Collectively, these results indicated that miR-141-3p could inhibit proliferative ability and promote senescence of SCAPs.
3.2. MiR-141-3p suppresses proliferative ability and promotes senescence of SCAPs To detect the biological influences of miR-141-3p on proliferative ability and senescence of SCAPs, miR-141-3p mimics and inhibitor were constructed, and their transfection efficacies were shown in Fig. 2A. CCK-8 results suggested that the OD value decreased in SCAPs transfected with miR-141-3p mimics relative to NC (P < 0.05). Meanwhile, increased OD value was observed in SCAPs transfected with miR-1413p inhibitor compared with those in iNC group (P < 0.01, Fig. 2B). Cell cycle progression was analyzed by flow cytometry. It is revealed that the proliferation index (PI = G2M + S) decreased in SCAPs overexpressing miR-141-3p compared with those in NC group, and increased PI was obtained in SCAPs with miR-141-3p knockdown relative to iNC group (Fig. 2C, P < 0.05). Furthermore, the number of EdUpositive cells was detected. Quantities of EdU-positive cells in miR-1413p overexpression group were obviously reduced compared with NC group under the same field, while an opposite trend was observed after miR-141-3p downregulation (Fig. 2D and E, P < 0.05). In addition, expression levels of senescence-related genes were detected. Both protein and mRNA levels of P53, P21 and P16 were significantly upregulated after transfection of miR-141-3p mimics (Fig. 3A and B, P < 0.05 and P < 0.01, respectively). Silence of miR-141-3p markedly down-regulated their levels (Fig. 3A and B). SA-β-Gal staining is an effective approach for detecting senescent cells. The data showed that up-regulated miR-141-3p accelerated cellular senescence and downregulation of miR-141-3p achieved the opposite trends (Fig. 3C). Immunofluorescent staining results further demonstrated the promotive
3.3. Bioinformatic analysis on the target gene of miR-141-3p To elucidate the regulatory mechanism of miR-141-3p during proliferation and senescence processes in SCAPs, bioinformatic analyses using miRDB, miRTarBase, miRWalk, and TargetScan algorithms were performed. As shown in Fig. 4A, 7718 potential target genes of miR141-3p were predicted in the above 4 databases. Among them, 39 of the 7718 target genes were in common. Moreover, results of GO annotation and KEGG pathway analysis suggested that these 7718 target genes are involved in a variety of cellular pathways, such as the hippo signaling pathway (Fig. 4B and C). As a key downstream element of the hippo signaling pathway, YAP has been reported to modulate proliferation, senescence and differentiation in multicellular lineages [27–29]. Interestingly, YAP was the common target gene of miR-141-3p in the 4 databases prediction. 3′UTR sequences of YAP containing the binding sites of miR-141-3p were shown in Fig. 3D, and the complementary region was also highly conserved among these different species. 3.4. YAP is the downstream target of miR-141-3p To validate the role of miR-141-3p to regulate the proliferative ability and senescence in SCAPs by targeting YAP, a luciferase reporter vector of the YAP 3′UTR sequence containing the target sites of miR141-3p was constructed (Fig. 5A). 293T cells were co-transfected with 6
Experimental Cell Research 383 (2019) 111562
Z. Li, et al.
Fig. 5. YAP is a direct target of miR-141-3p. (A) The mutant YAP-3′-UTR reporter plasmid (MUT-YAP) was constructed. (B) Luciferase reporter assays in 293T illustrated that miR-141-3p could bind with YAP. (C) (D) (E) Western blot and qRT-PCR analyses were performed to determine the protein and mRNA levels of YAP in SCAPs 48 h after transfection with miR-141-3p mimics, inhibitor, or matched controls. *P < 0.05 and **P < 0.01. (F) Immunofluorescence assay revealed that the expression of YAP in SCAPs overexpressing miR-141-3p was significantly down-regulated (Scale Bar = 20 μm). YAP (green), DAPI (blue).
P < 0.01, respectively). The mRNA level of YAP was accordingly changed as that of its protein level (Fig. 5E, P < 0.05). Immunofluorescence staining revealed that overexpression of miR-141-3p in SCAPs inhibited the level of YAP (Fig. 5F). Collectively, YAP may function as a downstream gene of miR-141-3p in SCAPs.
wild-type/mutant-type vector and miR-141-3p mimics/NC, respectively. Luciferase activity did not change in mutant-type YAP group, but it was significantly reduced in wild-type group, validating that miR141-3p could bind with YAP in 293T (Fig. 5B, P < 0.05). Subsequently, the regulatory role of miR-141-3p in YAP was determined. Western blot analysis illustrated that transfection of miR-141-3p mimics down-regulated the protein level of YAP, and knockdown of miR141-3p yielded the opposite trend (Fig. 5C and D, P < 0.05 and 7
Experimental Cell Research 383 (2019) 111562
Z. Li, et al.
Fig. 6. Knockdown of YAP inhibited SCAPs proliferation. (A) (B) Western blot and qRT-PCR results showed transfection efficacies of si-YAP1 and si-YAP2. (C) The proliferation in SCAPs transfected with si-YAP1, si-YAP2 and control was assessed by CCK-8 assay. (D) Flow cytometry results found the PI value in SCAPs transfected with si-YAP1 or si-YAP2 was lower compared with those transfected with si-NC. (E) (F) EdU-positive ratio was lower in SCAPs transfected with si-YAP1 or si-YAP2 than those transfected with si-NC (scale bar = 200 μm). EdU (red), Hoechst333 (blue). Data are presented as mean ± SD; *P < 0.05 and **P < 0.01. EdU: 5ethynyl-2-deoxyuridine; NC: mimics negative control; iNC: inhibitor negative control.
we employed three siRNAs targeting YAP. As shown by Western blot and qRT-PCR analysis, transfection of si-YAP1 or si-YAP2 dramatically downregulated YAP for more than 90% of its primary level, while the inhibition efficiency of si-YAP3 was poor (Fig. 6A and B, P < 0.05 and P < 0.01, respectively). Hence, si-YAP1 and si-YAP2 were chosen for
3.5. Knockdown of YAP inhibits SCAPs proliferation and promotes senescence To specifically uncover the role of YAP in inhibiting proliferative ability and promoting senescence of SCAPs by targeting miR-141-3p, 8
Experimental Cell Research 383 (2019) 111562
Z. Li, et al.
Fig. 7. Knockdown of YAP induced cellular senescence. (A) (B) Senescence-related genes were up-regulated in SCAPs transfected with si-YAP1 or si-YAP2 compared with controls. (C) Senescence associated beta galactosidase staining showed higher senescence cell rate in SCAPs transfected with si-YAP1 or si-YAP2 relative to control. (D) Immunofluorescence assay revealed that P21 was up-regulated by transfection of si-YAP1 or si-YAP2 (Scale Bar = 20 μm). *P < 0.05 and **P < 0.01. P21 (red), YAP (green), DAPI (blue). 9
Experimental Cell Research 383 (2019) 111562
Z. Li, et al.
Interestingly, YAP is also one of the target genes of miR-141-3p predicted by the above four databases simultaneously. Moreover, the effects of YAP on proliferation and senescence has been reported in periodontal ligament stem cells (PDLSCs), another dental derived mesenchyme stem cells [39]. Down-regulation of YAP in PDLSCs suppresses the proliferation activity of PDLSCs and induces senescence ahead of time. Opposite results are found by overexpression of YAP in PDLSCs. In this study, the binding relationship between YAP and miR141-3p was confirmed. Next, Western blot and qRT-PCR results found that up-regulated miR-141-3p decreased YAP expression and downregulated miR-141-3p increased its expression. It is indicated that YAP was a direct target of miR-141-3p, could be regulated by miR-141-3p at both pre-transcription and post-transcription levels. In addition, silence of YAP attenuated the proliferation activity of SCAPs and induced senescence at the same time, demonstrating our hypothesis that miRNA141-3p overexpression inhibited proliferation activity and promoted senescence via targeting YAP. Taken together with the proliferative and anti-senescence roles of YAP in previous studies, it is suggested that the roles of YAP in dental-derived stem cells are generally conserved, implying the potential of YAP in tissue regeneration engineering. Collectively, inhibition of miR-141-3p in SCAPs could be considered to promote the proliferative potential by correcting its senescent status. However, other proteins targeted by miR-141-3p might influence its effect on proliferation and senescence of SCAPs. For better application of SCAPs in tissue engineering researches and clinical treatment, molecular mechanism underlying proliferation and senescence of SCAPs is required to be further investigated.
following experiments. CCK-8 results showed that the OD value decreased in SCAPs transfected with si-YAP1 or si-YAP2 compared with those transfected with si-NC at 48 h (Fig. 6C). Besides, PI value in SCAPs transfected with si-YAP1 or si-YAP2 was markedly reduced compared with control (Fig. 6D). The quantities of EdU-positive cells were also reduced after knockdown of YAP (Fig. 6E and F, P < 0.05). Furthermore, protein levels of P53, P21 and P16 were up-regulated after transfection of si-YAP1 or si-YAP2. Their mRNA levels were identically regulated by YAP (Fig. 7A and B, P < 0.05 and P < 0.01, respectively). Additionally, the number of SA-β-Gal-positive cells was elevated by transfection of si-YAP1 or si-YAP2 and this results were further demonstrated by performing immunofluorescence staining assay (Fig. 7C and D). All of these results indicated that knockdown of YAP inhibited proliferation and promoted senescence of SCAPs. 4. Discussion Benefit from the self-renewal capability, multilineage differentiation potential and readily accessible, SCAPs become more popular in bone tissue engineering and regeneration medicine. SCAPs-based stem cell transplantation therapy is promising in the treatment of bone defects, peripheral nerve injuries, ischemic diseases and autoimmune-related diseases [30–32]. SCAPs isolated from dental tissues are not enough for its studies or clinical application. Hence, in vitro cultivation of SCAPs to acquire enough amounts becomes necessary [33]. However, the proliferative progression of stem cells is accompanied by cellular senescence, resulting in impaired proliferative capability. Besides, the committed differentiation potential of senescent stem cells obviously declines. For example, Yi et al. demonstrated the impaired proliferative and osteogenesis capabilities in senescent dental pulp stem cells (DPSCs) [34]. Our previous study found that miRNA-141-3p can inhibit osteogenic differentiation in SCAPs. Nevertheless, the roles of miRNA141 in proliferation and senescence were not clear. As a member of the miR-200c/141 cluster, miR-141-3p could target several important genes involving in diverse cellular processes. Wei et al. identified that miR-141-3p inhibits proliferative potential and osteoblast differentiation of MSCs by negatively regulating cell division cycle 25A (CDC25A) expression [22]. Moreover, miR-141-3p induces senescence in human diploid fibroblasts by targeting BMI1 [23]. In this paper, gain- and loss-of function assays were conducted to explore the effects of miR-141-3p on SCAPs. We found that up-regulated miR-1413p remarkedly reduced proliferative capability of SCAPs, and downregulation of miR-141-3p achieved the opposite trend, suggesting that miR-141-3p was a negative regulator of SCAPs proliferation. Meanwhile, the protein and mRNA levels of three key senescence factors P16, P21 and P53 were up-regulated by overexpression of miR-141-3p, suggesting that miR-141-3p promoted SCAPs senescence in vitro. SA-βGal and immunofluorescence staining further confirmed this trend. Recent studies verified that the proliferative activity and potential of osteogenic differentiation of MSCs could be impaired by senescence [35,36]. Consistently, our experiment results showed that senescent SCAPs present impaired proliferation activity and osteogenic differentiation ability. To uncover the underlying mechanisms of miR-141-3p in regulating the proliferation and senescence of SCAPs, target genes of miR-141-3p were searched in miRTarBase, miRDB, miRWalk, and TargetScan databases. In GO annotation, these target genes are related to multiple processes, including cellular metabolism, nucleic acid binding and etc. KEGG pathway analysis further revealed the involvement of these target genes in many significant pathways, such as the Hippo signaling pathway. As a functionally and evolutionarily conserved pathway, the Hippo pathway has been identified to control organ size [37]. YAP is the core effector of Hippo and has a crucial effect on the proliferative potential and senescence of stem cells [27]. Because of its crucial role in cardiomyocyte proliferation, YAP has been well concerned recently [38].
Declaration of competing interest The authors declare no conflict of interest regarding the publication of this paper. Ethical disclosure The experimental procedures were approved by the Ethical Committee of Stomatological School of Nanjing Medical University and performed with the informed consent of the patients. Author contributions ZL performed the experiments, ZL, XG and JL analyzed the data. MY and JY designed the study. NL, MB, XW and YL wrote the manuscript. All authors reviewed and revised the manuscript. Acknowledgements This work was supported by National Natural Science Foundation of China (81600822, 81873707), Medical Talent Project of Jiangsu Province (ZDRCA2016086), the Priority Academic Program Development of Jiangsu Higher Education Institutions (PAPD, 201887), SuYan Research & Development Funds for Intelligent Health Science & Technology Innovation (NMU-SY201804) and Science and Technology Development Project of Jiangsu Province (BE2017731). References [1] S.L. Moradi, A. Golchin, Z. Hajishafieeha, M.M. Khani, A. Ardeshirylajimi, Bone tissue engineering: adult stem cells in combination with electrospun nanofibrous scaffolds, J. Cell. Physiol. 233 (2018) 6509–6522. [2] X. Lin, H. Yang, L. Wang, W. Li, S. Diao, J. Du, S. Wang, R. Dong, J. Li, Z. Fan, AP2a enhanced the osteogenic differentiation of mesenchymal stem cells by inhibiting the formation of YAP/RUNX2 complex and BARX1 transcription, Cell Prolif 52 (2019) e12522. [3] L. Sensebe, M. Gadelorge, S. Fleury-Cappellesso, Production of mesenchymal stromal/stem cells according to good manufacturing practices: a review, Stem Cell Res. Ther. 4 (2013) 66. [4] X. Zhang, J. Chen, A. Liu, X. Xu, M. Xue, J. Xu, Y. Yang, H. Qiu, F. Guo, Stable
10
Experimental Cell Research 383 (2019) 111562
Z. Li, et al.
[5]
[6]
[7]
[8]
[9]
[10]
[11]
[12]
[13]
[14]
[15]
[16] [17]
[18]
[19]
[20]
[21]
J. Oral Sci. 125 (2017) 419–425. [22] W. Qiu, M. Kassem, miR-141-3p inhibits human stromal (mesenchymal) stem cell proliferation and differentiation, Biochim. Biophys. Acta 1843 (2014) 2114–2121. [23] M. Dimri, J.D. Carroll, J.H. Cho, G.P. Dimri, microRNA-141 regulates BMI1 expression and induces senescence in human diploid fibroblasts, Cell Cycle 12 (2013) 3537–3546. [24] Z.H. Long, Z.G. Bai, J.N. Song, Z. Zheng, J. Li, J. Zhang, J. Cai, H.W. Yao, J. Wang, Y.C. Yang, J. Yin, Z.T. Zhang, miR-141 inhibits proliferation and migration of colorectal cancer SW480 cells, Anticancer Res. 37 (2017) 4345–4352. [25] Y. Wang, Y. Lu, Z. Li, Y. Zhou, Y. Gu, X. Pang, J. Wu, R. Gobin, J. Yu, Oestrogen receptor alpha regulates the odonto/osteogenic differentiation of stem cells from apical papilla via ERK and JNK MAPK pathways, Cell Prolif (2018) e12485. [26] Y. Pan, Z. Li, Y. Wang, M. Yan, J. Wu, R.G. Beharee, J. Yu, Sodium fluoride regulates the osteo/odontogenic differentiation of stem cells from apical papilla by modulating autophagy, J. Cell. Physiol. 0021-9541(2019) 1097-4652. [27] Y. Wen, Y. Ji, Y. Zhang, B. Jiang, C. Tang, Q. Wang, X. Chen, L. Jia, W. Gu, X. Xu, Knockdown of yes-associated protein induces the apoptosis while inhibits the proliferation of human periodontal ligament stem cells through crosstalk between erk and Bcl-2 signaling pathways, Int. J. Med. Sci. 14 (2017) 1231–1240. [28] M. Cui, Z. Li, Downregulation of YAP inhibits proliferation and induces apoptosis in Eca-109 cells, Exp Ther Med 15 (2018) 1048–1052. [29] Y. He, H. Xu, Z. Xiang, H. Yu, L. Xu, Y. Guo, Y. Tian, R. Shu, X. Yang, C. Xue, M. Zhao, Y. He, X. Han, D. Bai, YAP regulates periodontal ligament cell differentiation into myofibroblast interacted with RhoA/ROCK pathway, J. Cell. Physiol. 234 (2019) 5086–5096. [30] C. Yang, X. Li, L. Sun, W. Guo, W. Tian, Potential of human dental stem cells in repairing the complete transection of rat spinal cord, J. Neural Eng. 14 (2017) 026005. [31] P. Hilkens, Y. Fanton, W. Martens, P. Gervois, T. Struys, C. Politis, I. Lambrichts, A. Bronckaers, Pro-angiogenic impact of dental stem cells in vitro and in vivo, Stem Cell Res. 12 (2014) 778–790. [32] G. Ding, Y. Liu, Y. An, C. Zhang, S. Shi, W. Wang, S. Wang, Suppression of T cell proliferation by root apical papilla stem cells in vitro, Cells Tissues Organs 191 (2010) 357–364. [33] V. Lertchirakarn, P. Aguilar, Effects of lipopolysaccharide on the proliferation and osteogenic differentiation of stem cells from the apical papilla, J. Endod. 43 (2017) 1835–1840. [34] Q. Yi, O. Liu, F. Yan, X. Lin, S. Diao, L. Wang, L. Jin, S. Wang, Y. Lu, Z. Fan, Analysis of senescence-related differentiation potentials and gene expression profiles in human dental pulp stem cells, Cells Tissues Organs 203 (2017) 1–11. [35] I. Iezzi, G. Cerqueni, C. Licini, G. Lucarini, M. Mattioli Belmonte, Dental pulp stem cells senescence and regenerative potential relationship, J. Cell. Physiol. 234 (2019) 7186–7197. [36] J. Oh, Y.D. Lee, A.J. Wagers, Stem cell aging: mechanisms, regulators and therapeutic opportunities, Nat. Med. 20 (2014) 870–880. [37] G. Halder, R.L. Johnson, Hippo signaling: growth control and beyond, Development 138 (2011) 9–22. [38] A. von Gise, Z. Lin, K. Schlegelmilch, L.B. Honor, G.M. Pan, J.N. Buck, Q. Ma, T. Ishiwata, B. Zhou, F.D. Camargo, W.T. Pu, YAP1, the nuclear target of Hippo signaling, stimulates heart growth through cardiomyocyte proliferation but not hypertrophy, Proc. Natl. Acad. Sci. U. S. A. 109 (2012) 2394–2399. [39] L. Jia, W. Gu, Y. Zhang, B. Jiang, X. Qiao, Y. Wen, Activated yes-associated protein accelerates cell cycle, inhibits apoptosis, and delays senescence in human periodontal ligament stem cells, Int. J. Med. Sci. 15 (2018) 1241–1250.
overexpression of p130/E2F4 affects the multipotential abilities of bone-marrowderived mesenchymal stem cells, J. Cell. Physiol. 233 (2018) 9739–9749. Q. Chen, P. Shou, C. Zheng, M. Jiang, G. Cao, Q. Yang, J. Cao, N. Xie, T. Velletri, X. Zhang, C. Xu, L. Zhang, H. Yang, J. Hou, Y. Wang, Y. Shi, Fate decision of mesenchymal stem cells: adipocytes or osteoblasts? Cell Death Differ. 23 (2016) 1128–1139. J. Liu, F. Yu, Y. Sun, B. Jiang, W. Zhang, J. Yang, G.T. Xu, A. Liang, S. Liu, Concise reviews: characteristics and potential applications of human dental tissue-derived mesenchymal stem cells, Stem Cells 33 (2015) 627–638. Z. Li, M. Yan, Y. Yu, Y. Wang, G. Lei, Y. Pan, N. Li, R. Gobin, J. Yu, LncRNA H19 promotes the committed differentiation of stem cells from apical papilla via miR141/SPAG9 pathway, Cell Death Dis. 10 (2019) 130. K. Chen, H. Xiong, Y. Huang, C. Liu, Comparative analysis of in vitro periodontal characteristics of stem cells from apical papilla (SCAP) and periodontal ligament stem cells (PDLSCs), Arch. Oral Biol. 58 (2013) 997–1006. A. Bakopoulou, G. Leyhausen, J. Volk, A. Tsiftsoglou, P. Garefis, P. Koidis, W. Geurtsen, Comparative analysis of in vitro osteo/odontogenic differentiation potential of human dental pulp stem cells (DPSCs) and stem cells from the apical papilla (SCAP), Arch. Oral Biol. 56 (2011) 709–721. S. Hong, W. Chen, B. Jiang, A comparative evaluation of concentrated growth factor and platelet-rich fibrin on the proliferation, migration, and differentiation of human stem cells of the apical papilla, J. Endod. 44 (2018) 977–983. S. Ma, G. Liu, L. Jin, X. Pang, Y. Wang, Z. Wang, Y. Yu, J. Yu, IGF-1/IGF-1R/hsa-let7c axis regulates the committed differentiation of stem cells from apical papilla, Sci. Rep. 6 (2016) 36922. F. Sun, M. Wan, X. Xu, B. Gao, Y. Zhou, J. Sun, L. Cheng, O.D. Klein, X. Zhou, L. Zheng, Crosstalk between miR-34a and notch signaling promotes differentiation in apical papilla stem cells (SCAPs), J. Dent. Res. 93 (2014) 589–595. J.C. Estrada, Y. Torres, A. Benguria, A. Dopazo, E. Roche, L. Carrera-Quintanar, R.A. Perez, J.A. Enriquez, R. Torres, J.C. Ramirez, E. Samper, A. Bernad, Human mesenchymal stem cell-replicative senescence and oxidative stress are closely linked to aneuploidy, Cell Death Dis. 4 (2013) e691. M.A. Szychlinska, M.J. Stoddart, U. D'Amora, L. Ambrosio, M. Alini, G. Musumeci, Mesenchymal stem cell-based cartilage regeneration approach and cell senescence: can we manipulate cell aging and function? Tissue Eng. B Rev. 23 (2017) 529–539. W. Xia, L. Zhuang, X. Deng, M. Hou, Long noncoding RNAp21 modulates cellular senescence via the Wnt/betacatenin signaling pathway in mesenchymal stem cells, Mol. Med. Rep. 16 (2017) 7039–7047. S. Gu, S. Ran, B. Liu, J. Liang, miR-152 induces human dental pulp stem cell senescence by inhibiting SIRT7 expression, FEBS Lett. 590 (2016) 1123–1131. H. Liu, Q. Sun, C. Wan, L. Li, L. Zhang, Z. Chen, MicroRNA-338-3p regulates osteogenic differentiation of mouse bone marrow stromal stem cells by targeting Runx2 and Fgfr2, J. Cell. Physiol. 229 (2014) 1494–1502. Y. Wang, X. Pang, J. Wu, L. Jin, Y. Yu, R. Gobin, J. Yu, MicroRNA hsa-let-7b suppresses the odonto/osteogenic differentiation capacity of stem cells from apical papilla by targeting MMP1, J. Cell. Biochem. 119 (2018) 6545–6554. R. Xu, X. Shen, Y. Si, Y. Fu, W. Zhu, T. Xiao, Z. Fu, P. Zhang, J. Cheng, H. Jiang, MicroRNA-31a-5p from aging BMSCs links bone formation and resorption in the aged bone marrow microenvironment, Aging Cell (2018) e12794. M. Chang, H. Lin, H. Fu, B. Wang, G. Han, M. Fan, MicroRNA-195-5p regulates osteogenic differentiation of periodontal ligament cells under mechanical loading, J. Cell. Physiol. 232 (2017) 3762–3774. D.G. Sun, B.C. Xin, D. Wu, L. Zhou, H.B. Wu, W. Gong, J. Lv, miR-140-5p-mediated regulation of the proliferation and differentiation of human dental pulp stem cells occurs through the lipopolysaccharide/toll-like receptor 4 signaling pathway, Eur.
11
Contents lists available at ScienceDirect
Experimental Cell Research journal homepage: www.elsevier.com/locate/yexcr
MiR-141-3p regulates proliferation and senescence of stem cells from apical papilla by targeting YAP
T
Zehan Lia,b, Xingyun Gea,b, Jiamin Lua,b, Minxia Biana,b, Na Lia,b, Xiao Wua,b, Yuzhi Lia,b, ⁎ ⁎⁎ Ming Yana,b, , Jinhua Yub, a b
Key Laboratory of Oral Diseases of Jiangsu Province and Stomatological Institute of Nanjing Medical University, 140 Hanzhong Road, Nanjing, Jiangsu, 210029, China Endodontic Department, School of Stomatology, Nanjing Medical University, 136 Hanzhong Road, Nanjing, Jiangsu, 210029, China
A R T I C LE I N FO
A B S T R A C T
Keywords: Stem cells miR-141-3p YAP Proliferation Senescence
Biological phenotypes of mesenchymal stem cells (MSCs) are regulated by a series of biochemical elements, including microRNAs, hormones and growth factors. Our previous study illustrated a significant role of miR-1413p during the osteogenic differentiation of stem cells from apical papilla (SCAPs). Nevertheless, the functions of miR-141-3p in regulating the proliferative ability and senescence of SCAPs have not been determined. This study identified that overexpression of miR-141-3p inhibited the proliferative ability of SCAPs. Meanwhile, the senescence of SCAPs was ahead of time. Conversely, transfection of miR-141-3p inhibitor promoted the proliferative ability of SCAPs and delayed their senescence. Yes-associated protein (YAP) was predicted as the downstream target gene of miR-141-3p by online softwares (miRDB, miRTarBase, miRWalk, and TargetScan), and was further verified by dual-luciferase reporter gene assay. Additionally, knockdown of YAP inhibited the proliferation and accelerated the senescence of SCAPs. Collectively, these findings proposed a novel direction that miR-141-3p impeded proliferative ability and promoted senescence of SCAPs through post-transcriptionally downregulating YAP.
1. Introduction Bone formation is a complex developmental process involving multiple factors. Functional bone reconstruction is an extremely process for most patients with bone loss caused by fracture or bony defects [1]. Nowadays, autogenous bone grafts, xenografts, and allografts are the preferred therapeutic approaches for bone loss. However, they are limited by many complications, including infection, donor morbidity and immune rejection [2]. Recently, MSCs-based tissue engineering has been considered as a promising technique to bone defect treatment [3,4]. MSCs are a kind of multiply potential stem cells undergoing in vitro osteogenic, adipogenic, and neural differentiation under specific inducive conditions [5]. However, the traditional isolation method of MSCs from bone marrow is invasive to donors and complicated. Among multiple types of MSCs, SCAPs, which are isolated from an extracted tooth, exhibit a great privilege [6]. It has been reported that SCAPs are easily accessible and hardly induce immunological rejection reactions
[7]. Moreover, SCAPs have shown the strongest capabilities for proliferative capacity and osteogenic differentiation among dental-derived stem cells, indicating that SCAPs could be an optimal cell source for bone repair [8,9]. To stabilize and accelerate the process of SCAPsmediated bone regeneration, microarrays containing microRNAs and growth factors in aid of maintaining self-renewal, improving proliferation and committed differentiation abilities of SCAPs are identified [10–12]. Cellular senescence is a physiological process occurring with time passes, and the precise mechanism underlying senescence is unclear [13]. As stem cells become senescent, in vivo proliferative capacity, differentiation potential and self-renewal gradually attenuate [14,15]. These disadvantages markedly limit the application of stem cell-based therapy and thus lead to failure in the tissue regenerative engineering [16]. Hence, uncovering the regulatory mechanism of SCAPs senescence is urgently required for bone tissue regeneration engineering. MicroRNAs (miRNAs) are a type of short-chain, noncoding endogenous RNA, which exert post-transcription regulatory function by
⁎ Corresponding author. Lecturer Key Laboratory of Oral Diseases of Jiangsu Province School of Stomatology, Nanjing Medical University 136 Hanzhong Road, Nanjing, Jiangsu, 210029, China. ⁎⁎ Corresponding author. Key Laboratory of Oral Diseases of Jiangsu Province, School of Stomatology, Nanjing Medical University, 136 Hanzhong Road, Nanjing, Jiangsu, 210029, China. E-mail addresses: [email protected] (M. Yan), [email protected] (J. Yu).
https://doi.org/10.1016/j.yexcr.2019.111562 Received 2 July 2019; Received in revised form 14 August 2019; Accepted 17 August 2019 Available online 19 August 2019 0014-4827/ © 2019 Elsevier Inc. All rights reserved.
Experimental Cell Research 383 (2019) 111562
Z. Li, et al.
2.4. Western blot
binding to the 3′-UTR mRNAs [17,18]. Increasing evidences have indicated that miRNAs extensively participate in many physical performances of MSCs, including proliferation, senescence and differentiation. For example, miR-31a-5p acts as a key regulator during the senescence and osteogenesis of bone marrow microenvironment [19]. Chang et al. found that miR-195-5p negatively mediates the osteogenesis in periodontal ligament cells by directly targeting bone morphogenetic protein receptor-1A (BMPR1A) [20]. In addition, Sun et al. illustrated that miR-140-5p inhibits the proliferative ability and differentiation of dental pulp stem cells by downregulating toll-like receptor 4 (TLR-4) [21]. Our previous study reported that silence of miR-141-3p could promote the osteogenic differentiation of SCAPs. Furthermore, recent studies have shown the critical role of miR-141-3p in growth and senescence of some cell lineages [22–24]. However, the underlying function of miR-141-3p in the growth and senescence of SCAPs and the potential mechanism remain elusive. In this paper, miR-141-3p mimics and inhibitor were constructed to up-regulate and down-regulate miR-141-3p in SCAPs, respectively. Our results demonstrated that miR-141-3p could inhibit the proliferative ability and promote senescence of SCAPs. Down-regulated YAP in SCAPs presented a similar trend to that of miR-141-3p over-expression. The interaction between miR-141-3p and YAP was further verified by Western blot, qRT-PCR and dual-luciferase reporter gene assay.
SCAPs were lysed in radio immunoprecipitation assay buffer and quantified with a bicinchoninic acid kit (Beyotime). Proteins were loaded on 10% SDS-polyacrylamide gel electrophoresis and transferred to PVDF membranes (Millipore, USA). After blockage of non-specific antigens in 5% nonfat milk for 2 h, membranes were subjected to incubation with primary antibodies against P16 (#80772, Cell Signaling Technology, USA), P21 (#2947), P53 (#2527), YAP (#14074) and GAPDH (Protein Tech Group, Chicago, USA) at 4 °C overnight. After TBST washing for three times, they were subjected to incubation with secondary antibody for 1 h at RT. After TBST wash for three times, grey values were detected by chemiluminescent horseradish peroxidase substrate (Millipore). 2.5. QRT-PCR SCAPs were lysed for extracting RNAs using Trizol (Invitrogen, USA), and the RNA was subjected to reverse transcription with specific primers using a PrimeScript RT reagent kit (TaKaRa, Otsu, Japan). Quantitative reverse transcriptase PCR (qRT-PCR) was performed using the ChamQ™ SYBR Green quantitative PCR Master Mix (Vazyme, Nanjing, China). GAPDH and U6 were used as the internal normalized controls for mRNA and miRNAs, respectively. After detecting on the ABI 7300 real-time PCR system, relative level of target gene was calculated by the 2-△△Ct method using the Bulge-Loop miRNA qPCR Primer kits (RiboBio). The primers used in this study were synthesized by Sangon Biotech manufacturer (Shanghai, China) and their sequences were depicted in Table 1.
2. Materials and methods 2.1. Cell culture This experiment was approved by the Ethical Committee of Stomatological School of Nanjing Medical University. SCAPs were isolated and cultured as we previously described [25]. In brief, third molars with immature roots obtained from informed consents from 17 to 20-year-old donors were collected in Jiangsu Provincial Stomatological Hospital. PBS was used to flush the teeth carefully for three times. The dental apical papillae were softly separated, cut and digested in a mixed solution concluding 3 mg/mL type I collagenase (Sigma, St Louis, MO, USA) and 4 mg/mL trypsin (Gibco, Life Technologies, USA) at room temperature (RT) for 1 h. The dissolved tissues were then gently plated in 60 mm culture dishes supplemented with α-MEM containing 10% fetal bovine serum, 100 g/mL streptomycin and 100 U/mL penicillin (Gibco, Life Technologies) in a 5% CO2 incubator at 37 °C. The medium was changed once for the first 24 h, and 2 days interval thereafter. SCAPs were passaged using 0.25% trypsin at the ratio of 1:3 until 80% confluence. The third-to-fifth generation SCAPs were harvested for following experiments.
2.6. Immunofluorescence staining Immunocytochemistry staining assay was conducted as previously reported [26]. Briefly, transfected cells were fixed in 4% paraformaldehyde for 30 min and then washed with PBS for three times. Subsequently, cells were permeabilized with 0.1% Triton X-100 (Beyotime) for 10 min, blocked with goat serum at 37 °C for 2 h and then subjected to incubation of primary antibodies against P21 and YAP at 4 °C overnight. After that, the cells were immunoblotted with relevant fluorescein secondary antibodies (ZSGB-BIO, Beijing, China) at 37 °C, in dark for 1 h. Cell nuclei were counterstained with DAPI and fluorescence images were captured using an inverted fluorescence microscopy (Olympus, Shanghai, China). 2.7. Senescence associated beta galactosidase staining (SA-β-Gal)
2.2. Flow cytometry
SA-β-Gal staining kit (#9860, Cell Signaling Technology) was utilized to assess the SA-β-Gal activity of SCAPs. Briefly, SCAPs were washed with PBS, fixed with fixative solution at RT for 15 min, washed with PBS twice and stained with SA-β-Gal staining solution at 37 °C without CO2 for 24 h. After PBS wash, the number of blue-labeled cells was calculated in at least 3 randomly selected fields per sample, and the
To identify the purity of isolated SCAPs, flow cytometry assay was performed to detect cell phenotypic markers. SCAPs were harvested and digested using trypsin (Beyotime, Haimen, China) and resuspended in 0.01 mol/L PBS twice. Then, cells were incubated with the primary antibodies (CD105, CD90, CD73, CD29, CD34, CD45) at 4 °C, in dark for 1 h. Subsequently, the labeled cells were washed twice with PBS and examined with a flow cytometer (BD Biosciences, USA).
Table 1 Sense and antisense primers for real-time reverse transcription polymerase chain reaction.
2.3. Cell transfection MiR-141-3p mimics, mimics control (NC), inhibitor, inhibitor control (iNC), and YAP small interfering RNAs (siRNAs) were constructed by Ribobio corporation. The siRNA sequences of YAP were as follows: si-YAP1: 5′-CCACCAAGCTAGATAAAGA-3′, si-YAP2: 5′-GAGATGGAAT GAACATAGA-3′, si-YAP3: 5′-GTAGCCAGTTACCAACACT-3’. SCAPs at approximately 70% confluence were infected using riboFECTTM CP kit (RiboBio, Guangzhou, China).
Genes
Primers
Sequences (5′-3′)
P16
Forward Reverse Forward Reverse Forward Reverse Forward Reverse
CCCCGATTGAAAGAACCAGAGAG TACGGTAGTGGGGGAAGGCATA AGCGACCTTCCTCATCCACC AAGACAACTACTCCCAGCCCCATA AGCTTTGAGGTGCGTGTTTGTG TCTCCATCCAGTGGTTTCTTCTTTG TCTCCTCTGACTTCAACAGCGACA CCCTGTTGCTGTAGCCAAATTCGT
P21 P53 GAPDH
2
Experimental Cell Research 383 (2019) 111562
Z. Li, et al.
Fig. 1. Phenotype identification of SCAPs. (A) The morphology of SCAPs, left: primary culture, right: third-generation SCAPs. (B) Flow cytometry analysis showed that SCAPs were positive for CD29, CD73, CD90 and CD105, and negative for CD34 and CD45. (C) Immunofluorescence assay revealed that cultured SCAPs were positive for STRO-1 (scale bar = 200 μm).
3
Experimental Cell Research 383 (2019) 111562
Z. Li, et al.
Fig. 2. MiR-141-3p inhibits proliferation of SCAPs. (A) Transfection efficacy of miR-141-3p was confirmed by quantitative RT-PCR analysis. (B) Cell proliferation capability influenced by miR-141-3p was detected at 450 nm with CCK-8. upper: overexpression of miR-141-3p inhibited proliferation of SCAPs; bottom: knockdown of miR-141-3p promoted SCAPs proliferation. (C) Detection of cell cycle distribution by flow cytometry. MiR-141-3p decreased the proliferation ability of SCAPs. (D) EdU-positive SCAPs influenced by miR-141-3p were detected by EdU kit (scale bar = 200 μm). EdU (red), Hoechst333 (blue). Data are presented as mean ± SD; *P < 0.05 and **P < 0.01. EdU: 5-ethynyl-2-deoxyuridine; NC: mimics negative control; iNC: inhibitor negative control.
2.9. Dual-luciferase reporter gene assay
counts were quantified as a percentage of positive cells.
HEK293T cells were seeded in 96-well plates with 5 × 103/well. After 24 h, a mixture of Firefly Luciferase (800 ng) reporter vector and Renilla Luciferase (5 ng) reporter vector (wild- or mutant-type plasmid) (GeneChem, Shanghai, China) and 50 nM miR-141-3p mimics or normal control were co-transfected into cells. 48 h later, the DualLuciferase Reporter Assay System (Promega, Madison, USA) was used to detect the luciferase activity.
2.8. Cell counting kit‐8 (CCK‐8) and 5‐ethynyl‐2‐deoxyuridine (EdU) assay CCK-8 and EdU assay were conducted to examine the proliferative ability of SCAPs. For CCK-8 assay, SCAPs were plated into 96-well culture plates with 2 × 103 cells per well. 10 μl of CCK-8 reagent (Vazyme) was added to each well and incubated at 37 °C for about 2 h. The OD values were detected by a microplate reader (Bio-Tek, Vermont, USA) at 450 nm wavelength. For EdU incorporation assay, SCAPs were incubated with 50 mM EdU (Ribobio) for 2 h. After fixation with 4% paraformaldehyde for 20 min at RT, SCAPs were treated with 2 mg/ml glycine for 10 min and washed with PBS. Subsequently, cells were permeated with 0.5% Triton X-100 and incubated with 1 × Apollo solution at RT, in dark for 30 min. Then, SCAPs were incubated with 100 ml of 1 × Hoechst-33342 solution in dark at RT for 30 min 3 randomly selected fields per group were captured by a fluorescence microscope.
2.10. Statistical analysis Statistical Package for Social Sciences (SPSS) software (version 16.0) was utilized for data processing. Statistical significances were analyzed by one-way analysis of variance and Student's t-test (twotailed). P < 0.05 considered as statistically significant. Data were expressed as mean ± SD. *p < 0.05, **p < 0.01.
4
Experimental Cell Research 383 (2019) 111562
Z. Li, et al.
Fig. 3. MiR-141-3p promotes senescence of SCAPs. (A) Expression levels of senescence-related proteins (P53, P21 and P16) influenced by miR-141-3p were detected by Western blot analysis. GAPDH was used as the reference protein. (B) The mRNA levels of senescence-related genes (P53, P21 and P16) influenced by miR-141-3p were detected by qRT-PCR. GAPDH was used as the reference gene. (C) Senescence associated beta galactosidase staining showed higher senescence cells rate after overexpression of miR-141-3p than NC group. Knockdown of miR-141-3p showed lower senescence cells rate compared with iNC group (Scale Bar = 200 μm). (D) Immunofluorescence assay revealed that the expression of P21 in SCAPs overexpressing miR-141-3p was significantly up-regulated (Scale Bar = 20 μm). P21 (red), DAPI (blue). NC: mimics negative control; iNC: inhibitor negative control.
identify the characteristics of cultured cells, flow cytometry assay was conducted to detect their phenotypes. The results suggested that the isolated SCAPs were negative for CD34, CD45, but positive for CD29, CD73, CD90, and CD105 (Fig. 1C). Meanwhile, immunofluorescence staining revealed positive expression of STRO-1 in SCAPs (Fig. 1D). The above results demonstrated the successful isolation of SCAPs and confirmed their purity.
3. Results 3.1. Phenotype identification of SCAPs SCAPs were successfully isolated from apical papilla tissues of the collected third molars. They were in fibroblast- or spindle-like morphology observed under a light microscope (Fig. 1A and B). To further 5
Experimental Cell Research 383 (2019) 111562
Z. Li, et al.
Fig. 4. Target gene prediction of miR-141-3p and biological characteristics analysis. (A) Venn diagram showed number of miR-141-3p target genes predicted by performing miRDB, miRTarBase, miRWalk, and TargetScan algorithms. (B) GO annotation of 1017 target genes. Top 30 of GO enrichment were shown here. GO: domains directly related with reproduction. (C) Target genes were enriched in cell cycle and regulation of Hippo signaling pathway. (D) The binding sequences of miR-141-3p on YAP 3′ UTR were predicted by TargetScan software. The red letters represent the binding sequences of miR-141-3p. UTR: untranslated region.
effect of miR-141-3p on SCAPs senescence (Fig. 3D). Collectively, these results indicated that miR-141-3p could inhibit proliferative ability and promote senescence of SCAPs.
3.2. MiR-141-3p suppresses proliferative ability and promotes senescence of SCAPs To detect the biological influences of miR-141-3p on proliferative ability and senescence of SCAPs, miR-141-3p mimics and inhibitor were constructed, and their transfection efficacies were shown in Fig. 2A. CCK-8 results suggested that the OD value decreased in SCAPs transfected with miR-141-3p mimics relative to NC (P < 0.05). Meanwhile, increased OD value was observed in SCAPs transfected with miR-1413p inhibitor compared with those in iNC group (P < 0.01, Fig. 2B). Cell cycle progression was analyzed by flow cytometry. It is revealed that the proliferation index (PI = G2M + S) decreased in SCAPs overexpressing miR-141-3p compared with those in NC group, and increased PI was obtained in SCAPs with miR-141-3p knockdown relative to iNC group (Fig. 2C, P < 0.05). Furthermore, the number of EdUpositive cells was detected. Quantities of EdU-positive cells in miR-1413p overexpression group were obviously reduced compared with NC group under the same field, while an opposite trend was observed after miR-141-3p downregulation (Fig. 2D and E, P < 0.05). In addition, expression levels of senescence-related genes were detected. Both protein and mRNA levels of P53, P21 and P16 were significantly upregulated after transfection of miR-141-3p mimics (Fig. 3A and B, P < 0.05 and P < 0.01, respectively). Silence of miR-141-3p markedly down-regulated their levels (Fig. 3A and B). SA-β-Gal staining is an effective approach for detecting senescent cells. The data showed that up-regulated miR-141-3p accelerated cellular senescence and downregulation of miR-141-3p achieved the opposite trends (Fig. 3C). Immunofluorescent staining results further demonstrated the promotive
3.3. Bioinformatic analysis on the target gene of miR-141-3p To elucidate the regulatory mechanism of miR-141-3p during proliferation and senescence processes in SCAPs, bioinformatic analyses using miRDB, miRTarBase, miRWalk, and TargetScan algorithms were performed. As shown in Fig. 4A, 7718 potential target genes of miR141-3p were predicted in the above 4 databases. Among them, 39 of the 7718 target genes were in common. Moreover, results of GO annotation and KEGG pathway analysis suggested that these 7718 target genes are involved in a variety of cellular pathways, such as the hippo signaling pathway (Fig. 4B and C). As a key downstream element of the hippo signaling pathway, YAP has been reported to modulate proliferation, senescence and differentiation in multicellular lineages [27–29]. Interestingly, YAP was the common target gene of miR-141-3p in the 4 databases prediction. 3′UTR sequences of YAP containing the binding sites of miR-141-3p were shown in Fig. 3D, and the complementary region was also highly conserved among these different species. 3.4. YAP is the downstream target of miR-141-3p To validate the role of miR-141-3p to regulate the proliferative ability and senescence in SCAPs by targeting YAP, a luciferase reporter vector of the YAP 3′UTR sequence containing the target sites of miR141-3p was constructed (Fig. 5A). 293T cells were co-transfected with 6
Experimental Cell Research 383 (2019) 111562
Z. Li, et al.
Fig. 5. YAP is a direct target of miR-141-3p. (A) The mutant YAP-3′-UTR reporter plasmid (MUT-YAP) was constructed. (B) Luciferase reporter assays in 293T illustrated that miR-141-3p could bind with YAP. (C) (D) (E) Western blot and qRT-PCR analyses were performed to determine the protein and mRNA levels of YAP in SCAPs 48 h after transfection with miR-141-3p mimics, inhibitor, or matched controls. *P < 0.05 and **P < 0.01. (F) Immunofluorescence assay revealed that the expression of YAP in SCAPs overexpressing miR-141-3p was significantly down-regulated (Scale Bar = 20 μm). YAP (green), DAPI (blue).
P < 0.01, respectively). The mRNA level of YAP was accordingly changed as that of its protein level (Fig. 5E, P < 0.05). Immunofluorescence staining revealed that overexpression of miR-141-3p in SCAPs inhibited the level of YAP (Fig. 5F). Collectively, YAP may function as a downstream gene of miR-141-3p in SCAPs.
wild-type/mutant-type vector and miR-141-3p mimics/NC, respectively. Luciferase activity did not change in mutant-type YAP group, but it was significantly reduced in wild-type group, validating that miR141-3p could bind with YAP in 293T (Fig. 5B, P < 0.05). Subsequently, the regulatory role of miR-141-3p in YAP was determined. Western blot analysis illustrated that transfection of miR-141-3p mimics down-regulated the protein level of YAP, and knockdown of miR141-3p yielded the opposite trend (Fig. 5C and D, P < 0.05 and 7
Experimental Cell Research 383 (2019) 111562
Z. Li, et al.
Fig. 6. Knockdown of YAP inhibited SCAPs proliferation. (A) (B) Western blot and qRT-PCR results showed transfection efficacies of si-YAP1 and si-YAP2. (C) The proliferation in SCAPs transfected with si-YAP1, si-YAP2 and control was assessed by CCK-8 assay. (D) Flow cytometry results found the PI value in SCAPs transfected with si-YAP1 or si-YAP2 was lower compared with those transfected with si-NC. (E) (F) EdU-positive ratio was lower in SCAPs transfected with si-YAP1 or si-YAP2 than those transfected with si-NC (scale bar = 200 μm). EdU (red), Hoechst333 (blue). Data are presented as mean ± SD; *P < 0.05 and **P < 0.01. EdU: 5ethynyl-2-deoxyuridine; NC: mimics negative control; iNC: inhibitor negative control.
we employed three siRNAs targeting YAP. As shown by Western blot and qRT-PCR analysis, transfection of si-YAP1 or si-YAP2 dramatically downregulated YAP for more than 90% of its primary level, while the inhibition efficiency of si-YAP3 was poor (Fig. 6A and B, P < 0.05 and P < 0.01, respectively). Hence, si-YAP1 and si-YAP2 were chosen for
3.5. Knockdown of YAP inhibits SCAPs proliferation and promotes senescence To specifically uncover the role of YAP in inhibiting proliferative ability and promoting senescence of SCAPs by targeting miR-141-3p, 8
Experimental Cell Research 383 (2019) 111562
Z. Li, et al.
Fig. 7. Knockdown of YAP induced cellular senescence. (A) (B) Senescence-related genes were up-regulated in SCAPs transfected with si-YAP1 or si-YAP2 compared with controls. (C) Senescence associated beta galactosidase staining showed higher senescence cell rate in SCAPs transfected with si-YAP1 or si-YAP2 relative to control. (D) Immunofluorescence assay revealed that P21 was up-regulated by transfection of si-YAP1 or si-YAP2 (Scale Bar = 20 μm). *P < 0.05 and **P < 0.01. P21 (red), YAP (green), DAPI (blue). 9
Experimental Cell Research 383 (2019) 111562
Z. Li, et al.
Interestingly, YAP is also one of the target genes of miR-141-3p predicted by the above four databases simultaneously. Moreover, the effects of YAP on proliferation and senescence has been reported in periodontal ligament stem cells (PDLSCs), another dental derived mesenchyme stem cells [39]. Down-regulation of YAP in PDLSCs suppresses the proliferation activity of PDLSCs and induces senescence ahead of time. Opposite results are found by overexpression of YAP in PDLSCs. In this study, the binding relationship between YAP and miR141-3p was confirmed. Next, Western blot and qRT-PCR results found that up-regulated miR-141-3p decreased YAP expression and downregulated miR-141-3p increased its expression. It is indicated that YAP was a direct target of miR-141-3p, could be regulated by miR-141-3p at both pre-transcription and post-transcription levels. In addition, silence of YAP attenuated the proliferation activity of SCAPs and induced senescence at the same time, demonstrating our hypothesis that miRNA141-3p overexpression inhibited proliferation activity and promoted senescence via targeting YAP. Taken together with the proliferative and anti-senescence roles of YAP in previous studies, it is suggested that the roles of YAP in dental-derived stem cells are generally conserved, implying the potential of YAP in tissue regeneration engineering. Collectively, inhibition of miR-141-3p in SCAPs could be considered to promote the proliferative potential by correcting its senescent status. However, other proteins targeted by miR-141-3p might influence its effect on proliferation and senescence of SCAPs. For better application of SCAPs in tissue engineering researches and clinical treatment, molecular mechanism underlying proliferation and senescence of SCAPs is required to be further investigated.
following experiments. CCK-8 results showed that the OD value decreased in SCAPs transfected with si-YAP1 or si-YAP2 compared with those transfected with si-NC at 48 h (Fig. 6C). Besides, PI value in SCAPs transfected with si-YAP1 or si-YAP2 was markedly reduced compared with control (Fig. 6D). The quantities of EdU-positive cells were also reduced after knockdown of YAP (Fig. 6E and F, P < 0.05). Furthermore, protein levels of P53, P21 and P16 were up-regulated after transfection of si-YAP1 or si-YAP2. Their mRNA levels were identically regulated by YAP (Fig. 7A and B, P < 0.05 and P < 0.01, respectively). Additionally, the number of SA-β-Gal-positive cells was elevated by transfection of si-YAP1 or si-YAP2 and this results were further demonstrated by performing immunofluorescence staining assay (Fig. 7C and D). All of these results indicated that knockdown of YAP inhibited proliferation and promoted senescence of SCAPs. 4. Discussion Benefit from the self-renewal capability, multilineage differentiation potential and readily accessible, SCAPs become more popular in bone tissue engineering and regeneration medicine. SCAPs-based stem cell transplantation therapy is promising in the treatment of bone defects, peripheral nerve injuries, ischemic diseases and autoimmune-related diseases [30–32]. SCAPs isolated from dental tissues are not enough for its studies or clinical application. Hence, in vitro cultivation of SCAPs to acquire enough amounts becomes necessary [33]. However, the proliferative progression of stem cells is accompanied by cellular senescence, resulting in impaired proliferative capability. Besides, the committed differentiation potential of senescent stem cells obviously declines. For example, Yi et al. demonstrated the impaired proliferative and osteogenesis capabilities in senescent dental pulp stem cells (DPSCs) [34]. Our previous study found that miRNA-141-3p can inhibit osteogenic differentiation in SCAPs. Nevertheless, the roles of miRNA141 in proliferation and senescence were not clear. As a member of the miR-200c/141 cluster, miR-141-3p could target several important genes involving in diverse cellular processes. Wei et al. identified that miR-141-3p inhibits proliferative potential and osteoblast differentiation of MSCs by negatively regulating cell division cycle 25A (CDC25A) expression [22]. Moreover, miR-141-3p induces senescence in human diploid fibroblasts by targeting BMI1 [23]. In this paper, gain- and loss-of function assays were conducted to explore the effects of miR-141-3p on SCAPs. We found that up-regulated miR-1413p remarkedly reduced proliferative capability of SCAPs, and downregulation of miR-141-3p achieved the opposite trend, suggesting that miR-141-3p was a negative regulator of SCAPs proliferation. Meanwhile, the protein and mRNA levels of three key senescence factors P16, P21 and P53 were up-regulated by overexpression of miR-141-3p, suggesting that miR-141-3p promoted SCAPs senescence in vitro. SA-βGal and immunofluorescence staining further confirmed this trend. Recent studies verified that the proliferative activity and potential of osteogenic differentiation of MSCs could be impaired by senescence [35,36]. Consistently, our experiment results showed that senescent SCAPs present impaired proliferation activity and osteogenic differentiation ability. To uncover the underlying mechanisms of miR-141-3p in regulating the proliferation and senescence of SCAPs, target genes of miR-141-3p were searched in miRTarBase, miRDB, miRWalk, and TargetScan databases. In GO annotation, these target genes are related to multiple processes, including cellular metabolism, nucleic acid binding and etc. KEGG pathway analysis further revealed the involvement of these target genes in many significant pathways, such as the Hippo signaling pathway. As a functionally and evolutionarily conserved pathway, the Hippo pathway has been identified to control organ size [37]. YAP is the core effector of Hippo and has a crucial effect on the proliferative potential and senescence of stem cells [27]. Because of its crucial role in cardiomyocyte proliferation, YAP has been well concerned recently [38].
Declaration of competing interest The authors declare no conflict of interest regarding the publication of this paper. Ethical disclosure The experimental procedures were approved by the Ethical Committee of Stomatological School of Nanjing Medical University and performed with the informed consent of the patients. Author contributions ZL performed the experiments, ZL, XG and JL analyzed the data. MY and JY designed the study. NL, MB, XW and YL wrote the manuscript. All authors reviewed and revised the manuscript. Acknowledgements This work was supported by National Natural Science Foundation of China (81600822, 81873707), Medical Talent Project of Jiangsu Province (ZDRCA2016086), the Priority Academic Program Development of Jiangsu Higher Education Institutions (PAPD, 201887), SuYan Research & Development Funds for Intelligent Health Science & Technology Innovation (NMU-SY201804) and Science and Technology Development Project of Jiangsu Province (BE2017731). References [1] S.L. Moradi, A. Golchin, Z. Hajishafieeha, M.M. Khani, A. Ardeshirylajimi, Bone tissue engineering: adult stem cells in combination with electrospun nanofibrous scaffolds, J. Cell. Physiol. 233 (2018) 6509–6522. [2] X. Lin, H. Yang, L. Wang, W. Li, S. Diao, J. Du, S. Wang, R. Dong, J. Li, Z. Fan, AP2a enhanced the osteogenic differentiation of mesenchymal stem cells by inhibiting the formation of YAP/RUNX2 complex and BARX1 transcription, Cell Prolif 52 (2019) e12522. [3] L. Sensebe, M. Gadelorge, S. Fleury-Cappellesso, Production of mesenchymal stromal/stem cells according to good manufacturing practices: a review, Stem Cell Res. Ther. 4 (2013) 66. [4] X. Zhang, J. Chen, A. Liu, X. Xu, M. Xue, J. Xu, Y. Yang, H. Qiu, F. Guo, Stable
10
Experimental Cell Research 383 (2019) 111562
Z. Li, et al.
[5]
[6]
[7]
[8]
[9]
[10]
[11]
[12]
[13]
[14]
[15]
[16] [17]
[18]
[19]
[20]
[21]
J. Oral Sci. 125 (2017) 419–425. [22] W. Qiu, M. Kassem, miR-141-3p inhibits human stromal (mesenchymal) stem cell proliferation and differentiation, Biochim. Biophys. Acta 1843 (2014) 2114–2121. [23] M. Dimri, J.D. Carroll, J.H. Cho, G.P. Dimri, microRNA-141 regulates BMI1 expression and induces senescence in human diploid fibroblasts, Cell Cycle 12 (2013) 3537–3546. [24] Z.H. Long, Z.G. Bai, J.N. Song, Z. Zheng, J. Li, J. Zhang, J. Cai, H.W. Yao, J. Wang, Y.C. Yang, J. Yin, Z.T. Zhang, miR-141 inhibits proliferation and migration of colorectal cancer SW480 cells, Anticancer Res. 37 (2017) 4345–4352. [25] Y. Wang, Y. Lu, Z. Li, Y. Zhou, Y. Gu, X. Pang, J. Wu, R. Gobin, J. Yu, Oestrogen receptor alpha regulates the odonto/osteogenic differentiation of stem cells from apical papilla via ERK and JNK MAPK pathways, Cell Prolif (2018) e12485. [26] Y. Pan, Z. Li, Y. Wang, M. Yan, J. Wu, R.G. Beharee, J. Yu, Sodium fluoride regulates the osteo/odontogenic differentiation of stem cells from apical papilla by modulating autophagy, J. Cell. Physiol. 0021-9541(2019) 1097-4652. [27] Y. Wen, Y. Ji, Y. Zhang, B. Jiang, C. Tang, Q. Wang, X. Chen, L. Jia, W. Gu, X. Xu, Knockdown of yes-associated protein induces the apoptosis while inhibits the proliferation of human periodontal ligament stem cells through crosstalk between erk and Bcl-2 signaling pathways, Int. J. Med. Sci. 14 (2017) 1231–1240. [28] M. Cui, Z. Li, Downregulation of YAP inhibits proliferation and induces apoptosis in Eca-109 cells, Exp Ther Med 15 (2018) 1048–1052. [29] Y. He, H. Xu, Z. Xiang, H. Yu, L. Xu, Y. Guo, Y. Tian, R. Shu, X. Yang, C. Xue, M. Zhao, Y. He, X. Han, D. Bai, YAP regulates periodontal ligament cell differentiation into myofibroblast interacted with RhoA/ROCK pathway, J. Cell. Physiol. 234 (2019) 5086–5096. [30] C. Yang, X. Li, L. Sun, W. Guo, W. Tian, Potential of human dental stem cells in repairing the complete transection of rat spinal cord, J. Neural Eng. 14 (2017) 026005. [31] P. Hilkens, Y. Fanton, W. Martens, P. Gervois, T. Struys, C. Politis, I. Lambrichts, A. Bronckaers, Pro-angiogenic impact of dental stem cells in vitro and in vivo, Stem Cell Res. 12 (2014) 778–790. [32] G. Ding, Y. Liu, Y. An, C. Zhang, S. Shi, W. Wang, S. Wang, Suppression of T cell proliferation by root apical papilla stem cells in vitro, Cells Tissues Organs 191 (2010) 357–364. [33] V. Lertchirakarn, P. Aguilar, Effects of lipopolysaccharide on the proliferation and osteogenic differentiation of stem cells from the apical papilla, J. Endod. 43 (2017) 1835–1840. [34] Q. Yi, O. Liu, F. Yan, X. Lin, S. Diao, L. Wang, L. Jin, S. Wang, Y. Lu, Z. Fan, Analysis of senescence-related differentiation potentials and gene expression profiles in human dental pulp stem cells, Cells Tissues Organs 203 (2017) 1–11. [35] I. Iezzi, G. Cerqueni, C. Licini, G. Lucarini, M. Mattioli Belmonte, Dental pulp stem cells senescence and regenerative potential relationship, J. Cell. Physiol. 234 (2019) 7186–7197. [36] J. Oh, Y.D. Lee, A.J. Wagers, Stem cell aging: mechanisms, regulators and therapeutic opportunities, Nat. Med. 20 (2014) 870–880. [37] G. Halder, R.L. Johnson, Hippo signaling: growth control and beyond, Development 138 (2011) 9–22. [38] A. von Gise, Z. Lin, K. Schlegelmilch, L.B. Honor, G.M. Pan, J.N. Buck, Q. Ma, T. Ishiwata, B. Zhou, F.D. Camargo, W.T. Pu, YAP1, the nuclear target of Hippo signaling, stimulates heart growth through cardiomyocyte proliferation but not hypertrophy, Proc. Natl. Acad. Sci. U. S. A. 109 (2012) 2394–2399. [39] L. Jia, W. Gu, Y. Zhang, B. Jiang, X. Qiao, Y. Wen, Activated yes-associated protein accelerates cell cycle, inhibits apoptosis, and delays senescence in human periodontal ligament stem cells, Int. J. Med. Sci. 15 (2018) 1241–1250.
overexpression of p130/E2F4 affects the multipotential abilities of bone-marrowderived mesenchymal stem cells, J. Cell. Physiol. 233 (2018) 9739–9749. Q. Chen, P. Shou, C. Zheng, M. Jiang, G. Cao, Q. Yang, J. Cao, N. Xie, T. Velletri, X. Zhang, C. Xu, L. Zhang, H. Yang, J. Hou, Y. Wang, Y. Shi, Fate decision of mesenchymal stem cells: adipocytes or osteoblasts? Cell Death Differ. 23 (2016) 1128–1139. J. Liu, F. Yu, Y. Sun, B. Jiang, W. Zhang, J. Yang, G.T. Xu, A. Liang, S. Liu, Concise reviews: characteristics and potential applications of human dental tissue-derived mesenchymal stem cells, Stem Cells 33 (2015) 627–638. Z. Li, M. Yan, Y. Yu, Y. Wang, G. Lei, Y. Pan, N. Li, R. Gobin, J. Yu, LncRNA H19 promotes the committed differentiation of stem cells from apical papilla via miR141/SPAG9 pathway, Cell Death Dis. 10 (2019) 130. K. Chen, H. Xiong, Y. Huang, C. Liu, Comparative analysis of in vitro periodontal characteristics of stem cells from apical papilla (SCAP) and periodontal ligament stem cells (PDLSCs), Arch. Oral Biol. 58 (2013) 997–1006. A. Bakopoulou, G. Leyhausen, J. Volk, A. Tsiftsoglou, P. Garefis, P. Koidis, W. Geurtsen, Comparative analysis of in vitro osteo/odontogenic differentiation potential of human dental pulp stem cells (DPSCs) and stem cells from the apical papilla (SCAP), Arch. Oral Biol. 56 (2011) 709–721. S. Hong, W. Chen, B. Jiang, A comparative evaluation of concentrated growth factor and platelet-rich fibrin on the proliferation, migration, and differentiation of human stem cells of the apical papilla, J. Endod. 44 (2018) 977–983. S. Ma, G. Liu, L. Jin, X. Pang, Y. Wang, Z. Wang, Y. Yu, J. Yu, IGF-1/IGF-1R/hsa-let7c axis regulates the committed differentiation of stem cells from apical papilla, Sci. Rep. 6 (2016) 36922. F. Sun, M. Wan, X. Xu, B. Gao, Y. Zhou, J. Sun, L. Cheng, O.D. Klein, X. Zhou, L. Zheng, Crosstalk between miR-34a and notch signaling promotes differentiation in apical papilla stem cells (SCAPs), J. Dent. Res. 93 (2014) 589–595. J.C. Estrada, Y. Torres, A. Benguria, A. Dopazo, E. Roche, L. Carrera-Quintanar, R.A. Perez, J.A. Enriquez, R. Torres, J.C. Ramirez, E. Samper, A. Bernad, Human mesenchymal stem cell-replicative senescence and oxidative stress are closely linked to aneuploidy, Cell Death Dis. 4 (2013) e691. M.A. Szychlinska, M.J. Stoddart, U. D'Amora, L. Ambrosio, M. Alini, G. Musumeci, Mesenchymal stem cell-based cartilage regeneration approach and cell senescence: can we manipulate cell aging and function? Tissue Eng. B Rev. 23 (2017) 529–539. W. Xia, L. Zhuang, X. Deng, M. Hou, Long noncoding RNAp21 modulates cellular senescence via the Wnt/betacatenin signaling pathway in mesenchymal stem cells, Mol. Med. Rep. 16 (2017) 7039–7047. S. Gu, S. Ran, B. Liu, J. Liang, miR-152 induces human dental pulp stem cell senescence by inhibiting SIRT7 expression, FEBS Lett. 590 (2016) 1123–1131. H. Liu, Q. Sun, C. Wan, L. Li, L. Zhang, Z. Chen, MicroRNA-338-3p regulates osteogenic differentiation of mouse bone marrow stromal stem cells by targeting Runx2 and Fgfr2, J. Cell. Physiol. 229 (2014) 1494–1502. Y. Wang, X. Pang, J. Wu, L. Jin, Y. Yu, R. Gobin, J. Yu, MicroRNA hsa-let-7b suppresses the odonto/osteogenic differentiation capacity of stem cells from apical papilla by targeting MMP1, J. Cell. Biochem. 119 (2018) 6545–6554. R. Xu, X. Shen, Y. Si, Y. Fu, W. Zhu, T. Xiao, Z. Fu, P. Zhang, J. Cheng, H. Jiang, MicroRNA-31a-5p from aging BMSCs links bone formation and resorption in the aged bone marrow microenvironment, Aging Cell (2018) e12794. M. Chang, H. Lin, H. Fu, B. Wang, G. Han, M. Fan, MicroRNA-195-5p regulates osteogenic differentiation of periodontal ligament cells under mechanical loading, J. Cell. Physiol. 232 (2017) 3762–3774. D.G. Sun, B.C. Xin, D. Wu, L. Zhou, H.B. Wu, W. Gong, J. Lv, miR-140-5p-mediated regulation of the proliferation and differentiation of human dental pulp stem cells occurs through the lipopolysaccharide/toll-like receptor 4 signaling pathway, Eur.
11