Molecular characterization and pathogenicity of Streptococcus agalactiae serotypes Ia ST7 and III ST283 isolated from cultured red hybrid tilapia in Malaysia

Aquaculture 515 (2020) 734543

Contents lists available at ScienceDirect

Aquaculture journal homepage: www.elsevier.com/locate/aquaculture

Molecular characterization and pathogenicity of Streptococcus agalactiae serotypes Ia ST7 and III ST283 isolated from cultured red hybrid tilapia in Malaysia

T

R. Syuhadaa, M. Zamri-Saadb,i, M.Y. Ina-Salwanyc,i, M. Mustafaa, N.N. Nasruddind, M.N.M. Desae, S.A. Nordinf, T. Barkhamg,h, M.N.A. Amala,i,∗ a

Department of Biology, Faculty of Science, Universiti Putra Malaysia, 43400 UPM Serdang, Selangor, Malaysia Department of Veterinary Laboratory Diagnosis, Faculty of Veterinary Medicine, Universiti Putra Malaysia, 43400 UPM Serdang, Selangor, Malaysia Department of Aquaculture, Faculty of Agriculture, Universiti Putra Malaysia, 43400 UPM Serdang, Selangor, Malaysia d Centre for Craniofacial Diagnostics and Biosciences, Faculty of Dentistry, Universiti Kebangsaan Malaysia, Jalan Raja Muda Abdul Aziz, 50300 Kuala Lumpur, Malaysia e Department of Biomedical Sciences, Faculty of Medicine and Health Sciences, Universiti Putra Malaysia, 43400 UPM Serdang, Selangor, Malaysia f Department of Medical Microbiology and Parasitology, Faculty of Medicine and Health Sciences, Universiti Putra Malaysia, 43400 UPM Serdang, Selangor, Malaysia g Department of Microbiology and Immunology, Yong Loo Lin School of Medicine, National University of Singapore, 117545, Singapore h Department of Laboratory Medicine, Tan Tock Seng Hospital, 308433, Singapore i Laboratory of Marine Biotechnology, Institute of Bioscience, Universiti Putra Malaysia, 43400 UPM Serdang, Selangor, Malaysia b c

ARTICLE INFO

ABSTRACT

Keywords: Streptococcus agalactiae Molecular serotyping Sequence typing Virulence gene Pathogenicity

Streptococcus agalactiae is one of the most important pathogens infecting tilapia worldwide. In this study, we determined the serotype, sequence type (ST), virulence gene profile and pathogenicity of S. agalactiae isolated from cultured fish. A collection of 256 S. agalactiae that were previously isolated from outbreaks of streptococcosis in red hybrid tilapia in Peninsular Malaysia were studied. The genotype and ST of the isolates were determined by molecular serotyping of the capsular polysaccharide (cps) gene clusters, and multi-locus sequence typing (MLST). The virulence gene profiles were constructed using m-PCR for 14 standard virulence genes with published primers. Two serotypes, with different associated STs, were identified in this study: serotypes Ia ST7 and III ST283. Serotype Ia ST7 lacks lmb, scpB, pavA, fbsB, cyl, bca, cspA and bac genes, which were present in serotype III ST283. The LD50–240h of S. agalactiae in red hybrid tilapia for serotypes Ia ST7 and III ST283 were 8.7 × 103 CFU/mL and 6.3 × 103 CFU/mL, respectively. The histopathological findings were consistent with meningitis, necrosis of hepatocytes, coagulative tubular necrosis and hypocellular of the spleen. Histopathological scores revealed significant differences (p < 0.05) between the two serotypes in all lesions in the brain, liver (except hepato-necrosis) and spleen, but not the kidney. This study revealed that S. agalactiae serotypes Ia ST7 and III ST283 currently exist in cultured tilapia in Malaysia. This molecular epidemiology study could be useful for the future development of cross protective vaccines against streptococcosis in the region.

1. Introduction Tilapia (Oreochromis spp.) is the second highest harvested freshwater fish in Malaysia, with a total production of 31,544 metric tons (MT) in 2017. However, the wholesale value of tilapia is highest at RM 291 million, indicating that tilapia farming is an important industry in this country. Recent statistics show that tilapia production is mainly from freshwater ponds (16,747 MT), followed by freshwater cages (6,077 MT) and ex-mining pools (4,929 MT). Production of tilapia is

∗

predicted to further increase in the near future, due to commercialization of the industry (AFS, 2018). Streptococcus agalactiae (Group B Streptococcus; GBS) is widely known to infect humans, mammalia and fishes (Delannoy et al., 2013; Tavares et al., 2018). Moreover, S. agalactiae infection in cultured fishes, including various species of tilapia, has been reported worldwide, leading to significant economic losses to the aquaculture industry (Zamri-Saad et al., 2014). Streptococcus agalactiae has also been reported in various tilapia producing countries in Southeast Asia, in-

Corresponding author. at: Department of Biology, Faculty of Science, Universiti Putra Malaysia, 43400 UPM Serdang, Selangor, Malaysia. E-mail address: [email protected] (M.N.A. Amal).

https://doi.org/10.1016/j.aquaculture.2019.734543 Received 17 July 2019; Received in revised form 10 September 2019; Accepted 25 September 2019 Available online 14 October 2019 0044-8486/ © 2019 Elsevier B.V. All rights reserved.

Aquaculture 515 (2020) 734543

R. Syuhada, et al.

cluding Thailand, Indonesia, Vietnam and Malaysia, negatively affecting the industry (Anshary et al., 2014; Kayansamruaj et al., 2014, 2018; Ismail et al., 2016). Molecular serotyping of S. agalactiae is determined by capsular polysaccharide (cps) gene typing and multi-locus sequence typing (MLST) (Kannika et al., 2017; Barkham et al., 2019). So far, S. agalactiae has been classified into 10 different capsular serotypes. They include Ia, Ib, and II to IX, and each serotype was thought to possess significant virulent capability (Imperi et al., 2010). On the other hand, MLST revealed that S. agalactiae consists of 1,349 sequence types (ST) around the world (PubMLST, 2019), while the STs found in S. agalactiae isolated from fishes include ST7, ST260, ST261, ST283, ST491 and ST500 (Delannoy et al., 2013; Kayansamruaj et al., 2018). Moreover, Lin et al. (2011) showed that the virulence gene profiles of S. agalactiae could be determined by genotypic characterization based on 14 virulence genes found in human isolates, and the profiles could be categorized under three virulence gene categories, which are the adhesins, invasins and immune-evasins. The molecular epidemiology of S. agalactiae from aquaculture in Malaysia has not been explored with recent methods. In this study, we determine the cps gene serotyping, MLST, virulence genes profiling and pathogenicity of different strains of S. agalactiae isolated from cultured red hybrid tilapia (Oreochromis niloticus × O. mossambicus). We believe that understanding these aspects will help in the control and prevention of streptococcosis in aquaculture in this country. In this first report on the molecular epidemiology of S. agalactiae from cultured fish in this country, we show that GBS are limited to serotypes Ia ST7, and III ST283.

2.3. Multi-locus sequence typing MLST was conducted on a random selection of 8 of the 28 isolates (29%) and 50 of the 228 isolates (22%) of S. agalactiae serotypes Ia and III, respectively, as described previously (Jones et al., 2003) (Appendix 5). The amplification conditions were as follows: (i) denaturation step at 94 °C for 1 min, (ii) annealing at 55 °C for 45 s for 30 cycles; (iii) extension at 72 °C for 1 min. The amplified PCR products were visualized on 2% agarose gel using a gel documentation system (Syngene). The amplicons of MLST were then subjected to sequencing (FirstBase), aligned using codon code aligner software and later subjected to PubMLST software to determine the exact match against the chosen loci: combinations of allelic profiles determined the ST of each sample (https://pubmlst.org/). 2.4. Virulence genes profiling All 256 isolates of S. agalactiae were also categorized genotypically, based on the 14 standard virulence genes found in human isolates; the fbsA (the fibrinogen-binding protein FbsA), fbsB (the fibrinogen-binding protein FbsB), pavA (a fibrinogen-binding protein), scpB (C5a peptidase), lmb (laminin-binding protein), cylE (β-hemolysin/cytolysin), cfb (CAMP factor), spb1 (haemolysin III), hylB (hyaluronate lyase), rib (the surface protein rib), bca (C-α protein), bac (C-β protein), cspA (the serine protease cspA), and pbp1A/ponA (penicillin-binding protein 1A) (Lin et al., 2011). Multiplex PCR was conducted using specific primers, following three sets of multiplex PCR assays except for the spb1 gene (Kannika et al., 2017, Appendix 6). 25 μL reaction mixtures were prepared, containing 100 ng of bacterial genomic DNA, 10 mM of each primer (FirstBase), 5 μL of 5× Dream Taq buffer (plus 3 μL MgCl2) (Promega), 1 μL of dNTPs (Promega), 0.1U of DreamTaq polymerase (Promega) and nuclease free water. The amplifications were performed on a thermal cycler (Takara). The amplified PCR products were visualized on 2% agarose gel using gel documentation system (Syngene). The results on the presence of the bands from specific genes in each set of multiplex were recorded.

2. Materials and methods 2.1. Bacterial strains and DNA extraction A total of 256 isolates of S. agalactiae that were obtained and identified from diseased red hybrid tilapias in previous studies were used (Amal et al., 2010a, 2010b, 2013, Appendix 1 and 2). The bacterial stocks were thawed and cultured onto trypticase soy agar (TSA) (Merck, NJ, USA) with 5% horse blood (BA), and incubated for 24 h at 30 °C to obtain pure colonies. The bacterial genomic DNA was then extracted using Wizard Genomic DNA Purification Kit (Promega, WI, USA) according to the manufacturer's instructions.

2.5. Pathogenicity trials Pathogenicity was measured by experimentally challenging red hybrid tilapia with representatives of S. agalactiae serotypes Ia ST7, and III ST283. The two selected isolates were TPK for serotype Ia ST7 and TPE for III ST283. Previously, TPK and TPE were isolated from red hybrid tilapias that showed either softening of the brain with accumulation of fluid, and hemorrhage of internal organs such as liver, kidney and spleen, indicating Streptococcus infection. The selected isolates were cultured onto BA and incubated at 30 °C for 24 h. After pure colonies were observed, a fresh bacterial culture was prepared by inoculating 10 bacterial colonies into trypticase soy broth (TSA; Merck) and cultured in orbital incubator at 30 °C for 24 h with 160 rpm (Infors, Bottmingen, Switzerland). Both S. agalactiae serotypes Ia ST7 and III ST283 were then undergone 10-fold serial dilutions to determine the bacterial concentrations (CFU/mL). A total of 240 red hybrid tilapias with an average weight of ± 50 g and ± 8 cm length were acclimatized for 14 days prior to the bacterial challenge study. Then, 10 fish were randomly screened for bacteria from liver, kidney and brain, to ensure that the fish were free from S. agalactiae and other pathogens. All fish were fed commercial feed during the entire acclimatization and experimental periods, while water qualities were monitored daily. There were three groups of challenge treatments (103, 105 and 107 CFU/mL for each of S. agalactiae serotypes Ia ST7 and III ST283) and a control group. Each group consisted of 30 fish, kept in triplicate with 10 fish/aquarium of 120 L and supplied with continuous aeration.

2.2. Singleplex PCR serotyping based on cps gene cluster Molecular typing of S. agalactiae was conducted using singleplex PCR that detected the cps gene clusters. Singleplex PCR was conducted using several specific primers with some modifications (Imperi et al., 2010) (Appendix 3). In this study, two serotypes that are common in southeast Asia region were expected, serotypes Ia and III. For negative control, cross identification using several possible specific primers for serotype Ib was conducted to ensure the sensitivity and efficacy of the primers. The remaining primers were also used to test for other possible serotypes (II to IX) (Appendix 4). The singleplex PCR for determination of the cps gene cluster was conducted using 100 ng of bacterial genomic DNA as template. The PCR reaction was composed of GoTaq® Green Master Mix (Promega) and 10 mM of each specific primer (FirstBase, Kuala Lumpur, Malaysia). The amplifications were performed in a thermal cycler (Takara, Shiga, Japan). The amplification conditions consisted of two steps of annealing as follows: (i) denaturation step at 94 °C for 5 min, (ii) annealing at 95 °C for 1 min; 54 °C and 56 °C for 1 min and 72 °C for 2 min for 25 cycles; (iii) extension at 72 °C for 10 min. The amplified PCR products were visualized on 2% agarose gel using a gel documentation system (Syngen, Cambridge, UK).

2

Aquaculture 515 (2020) 734543

R. Syuhada, et al.

A total of 50 μL of S. agalactiae serotype Ia ST7 was injected intraperitoneally (IP) into each of the fish of group 1. The same volume of S. agalactiae serotype III ST283 inoculum was similarly injected into each of the fish in group 2, while the control group 3 was similarly injected with 50 μL of sterile TSB. The clinical signs, gross lesions and mortality of fish were observed at 0, 6, 12, 24, 48, 72, 96, 120, 144, 168 and 240 h post infection (hpi). Samples of liver, kidney, eye, spleen and brain of the dead fish were collected for isolation of S. agalactiae. The lethal dose concentrations (LD50–240h) of S. agalactiae serotypes Ia ST7 and III ST283 were determined at 240 hpi (Ramakrishnan, 2016). 2.6. Histopathological assessment Samples of brain, kidney, liver and spleen of freshly dead fish were fixed in 10% buffered formalin (Sigma-Aldrich, MO, USA) for at least 24 h, embedded in paraffin, sectioned at 4 μm thick and stained with hematoxylin and eosin. The sections were examined under light microscopy for histological lesions. The severity of histopathological changes was scored based on the scoring system of Abdullah et al. (2013). The lesions were semi-quantitatively scored as none (0), mild (1), moderate (2) and severe (3). The lesions for the brain included congestion of blood vessel, meningitis and degenerated neurons. For kidney, the lesions included tubular necrosis, coagulative necrosis, glomerulus shrinkage and bacterial load. In liver included congestion of blood vessel, necrosis of the hepatocytes, infarction and inflammation in blood vessel, while the splenic lesions included necrosis, infarction, presence of melano-macrophage center (MMC), and hypocellularity.

Fig. 2. Amplification of MLST housekeeping genes for Streptococcus agalactiae using seven pair of primers. Lane M is the 1 kb DNA ladder; Lane 1 to 7 are the band size for adhP, pheS, atr, glnA, sdhA, glck, and tkt gene, respectively.

the identification. Serotype Ia was indicated by the presence of cpsL (688 bp) and cpsG (272 bp), while serotype III by cpsL (688 bp) and cpsG (352 bp) (Fig. 1). Serotypes Ia and III shared the presence of the cpsL gene. No other serotype was detected in this study. 3.2. MLST of Streptococcus agalactiae Following MLST, all seven targeted genes were amplified in both serotypes using different primers (Fig. 2). Based on the analyses of sequence and allelic profiles in the S. agalactiae MLST database, isolate TPK (serotype Ia) belonged to ST7 with allelic combination of 10, 1, 2, 1, 3, 2, 2, while isolate TPE (serotype III) belonged to ST283 with allelic combination of 9, 5, 7, 1, 3, 3, 2. The MLST assays also showed that all (100%) of the randomly selected 8 and 50 isolates of S. agalactiae serotype Ia and III were represented by ST7 and ST283 only, respectively.

2.7. Statistical analysis The mean of histopathological scorings in selected organs of the fish were compared using independent t-test (SPSS, IBM Corporation). The results were considered significant at p < 0.05.

3.3. Virulence genes profiling of Streptococcus agalactiae

3. Results

The virulence gene profiles were categorized into two groups, where groups 1 and 2 were made up of serotypes Ia and III, respectively (Fig. 3). The two groups shared six genes, which were fbsA, rib, cfb, hylB, spb1 and pbp1A/ponA, while group 2 (serotype III) contained five more virulence genes than group 1 (serotype Ia), which were lmb, fbsB, cyl, bca and cspA. Both groups lack three virulence genes, which were scpB, pavA and bac. The gel electrophoresis for the 14 standard virulence genes are shown in Fig. 4.

3.1. Singleplex PCR From the 256 isolates that were identified as S. agalactiae, 228 (89%) isolates were identified as serotype III, while the remaining 28 (11%) were identified as serotype Ia. Determination of serotype Ib was performed on all isolates as negative control to ensure the accuracy of

3.4. Pathogenicity of Streptococcus agalactiae in red hybrid tilapia Following intraperitoneal challenge, the respective S. agalactiae was successfully isolated from the dead fish of the respective group. The mean ± SD of water quality indicators during the challenge period were as follows; temperature (28.80 ± 0.80 °C), pH (7.3 ± 0.9), dissolved oxygen (5.69 ± 0.50 mg/L), and ammonia (0.03 ± 0.02 mg/ L). The mortality rates following IP challenge with S. agalactiae serotype Ia ST7 and III ST283 are shown in Table 1. No mortality was recorded in the control group. After challenge with serotype Ia ST7, mortality was only recorded at 6 hpi among fish that were exposed to the highest concentration, while fish challenged with serotype III ST283 showed mortality following exposure to all bacterial concentrations. High mortalities were recorded between 12 and 120 hpi following challenge with both serotypes. However, both serotypes recorded highest mortality at 24 hpi with 14 and 13 deaths, respectively. The mortalities started to decrease between 48 hpi and 72 hpi but increased slightly at 96 hpi for serotype Ia ST7, and at 120 hpi for serotype III

Fig. 1. Amplification of cps genes of Streptococcus agalactiae using two pair of primers. Lane M1 and M2 are the DNA ladder of 1 kb and 100 bp; Lane 1 and 2 are the band size for serotype Ia (272 bp and 688 bp); Lane 3 and 4 are the band size for serotype III (352 bp and 688 bp). 3

Aquaculture 515 (2020) 734543

R. Syuhada, et al.

Fig. 3. The virulence gene profiles of Streptococcus agalactiae serotypes Ia and III isolated from red hybrid tilapia group based on adhesion, invasion and immune evasion function. (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)

ST283. There was no more mortality after 144 hpi in fish challenged with serotype III ST283, but for serotype Ia ST7, the mortality remained until 240 hpi. The LD50–240h of S. agalactiae serotypes Ia ST7 and III ST283 in red hybrid tilapia was determined at 8.7 × 103 CFU/mL and 6.3 × 103 CFU/mL, respectively.

3.6. Histopathological assessment The brains of fish infected with both serotypes showed congestion of blood vessels, slight meningitis with occasional generated red neurons, with the exception of congested meninges which was only observed in S. agalactiae serotype Ia ST7 (Fig. 6). The livers were congested with focal necrosis of hepatocytes, infarction, presence of thrombus, as well as infiltration of inflammatory cell at the central vein (Fig. 7). The kidneys showed tubular and coagulative necrosis with eosinophilic cytoplasm and lysis of the cytoplasm (Fig. 8). Bacterial colonies were clearly observed, which was absent following infection by serotype III ST283. The spleens showed cellular necrosis, infarction, production of melano-macrophage center (MMC), and hypocellularity (Fig. 9). Fish infected with S. agalactiae serotype Ia ST7 scored at least mild for all types of lesions (Table 2). However, fish challenged with serotype III ST283 occasionally showed normal score, such as congestion at meningeal layer, bacterial load in kidney, as well as infarction and inflammation in blood vessel in the liver. All the selected lesion scores in brain, spleen and liver showed significant differences (p < 0.05) between fish infected with S. agalactiae serotypes Ia ST7 and III ST283, with the exception of hepato-necrosis lesion in the liver. However, there was no significant difference (p > 0.05) between all lesions for the fish infected by S. agalactiae serotypes Ia ST7 and III ST283 in kidney.

3.5. Clinical signs and gross lesions Following infection with either serotypes of S. agalactiae, infected fish showed lethargy, erratic swimming patterns, corneal opacity, hemorrhage at the operculum area, fin rot, inflammation at the base of the anal fin and the caudal peduncle area, and abdominal distention (Fig. 5). After infection with serotype Ia ST7, clinical signs started with eye opacity and hemorrhage near the anus. The infected fish also showed hemorrhage at the anal fin, the caudal peduncle area, and an enlarged gall bladder leading to abdominal distention. Occasionally, the liver appeared pale. Infection by S. agalactiae serotype III ST283 involved the liver, spleen and intestine. The liver showed hemorrhages, and appeared pale with green patches. Moreover, hemorrhage of intestinal area with accumulation of fluid was also observed.

Fig. 4. Amplification of 14 standard virulence genes of Streptococcus agalactiae for (a) serotype Ia and (b) serotype III. Set 1 to set 3 referred to a different set of multiplex PCR, and set 4 was singleplex PCR analysed independently. The bands obtained showing expected band size as stated in the diagram. M lane is the molecular marker of 1 kb DNA ladder.

4

Aquaculture 515 (2020) 734543

R. Syuhada, et al.

Table 1 Mortality patterns of red hybrid tilapias following intraperitoneal challenges with Streptococcus agalactiae serotype Ia ST7, and serotype III ST283. Concentration (CFU/mL)

Time (h post infection)

Mortality information

6

12

24

48

72

96

120

144

168

240

Sample (No.)

Survived (No.)

Died (No.)

Mortality (%)

Serotype Ia ST7 Control 8.7 × 103 8.7 × 105 8.7 × 107 TOTAL

0 0 0 1

0 0 0 1

0 5 3 6

0 1 5 2

0 3 2 2

0 5 2 1

0 1 3 3

0 0 0 1

0 1 2 0

0 0 1 1

30 30 30 30 120

30 14 13 12 69

0 16 17 18 51

0.0 53.3 56.7 60.0 42.5

Serotype III ST283 Control 6.3 × 103 6.3 × 105 6.3 × 107 TOTAL

0 2 1 2

0 0 1 3

0 3 2 8

0 4 1 7

0 2 4 0

0 1 3 3

0 2 4 2

0 1 0 0

0 0 0 0

0 0 0 0

30 30 30 30 120

30 15 14 5 64

0 15 16 25 56

0.0 50.0 53.3 83.3 46.7

4. Discussion

gene serotyping revealed that only serotypes Ia and III of S. agalactiae were identified from a total of 256 isolates of S. agalactiae. This study also revealed that S. agalactiae serotype III was the dominant serotype in tilapia farming in this country. Thailand, Vietnam, China and Brazil

Streptococcus agalactiae is an important pathogen in wild and cultured tilapia in Malaysia (Zamri-Saad et al., 2014). In this study, cps

Fig. 5. Clinical signs and gross lesions of Streptococcus agalactiae serotypes Ia ST7 and III ST283 infection in red hybrid tilapias. (a) Eye opacity (arrow), (b) hemorrhage around the operculum area (star), (c) fin rot (arrow), (d) inflammation at the base of anal fin and caudal peduncle area (star), and (e) abdominal distension (star) were mostly observed in the fish infected by both serotypes. Fish infected with serotype Ia ST7 also showed, (f) swollen gall bladder (star) and the white patch of the liver (arrow) and, (g) generalized pale liver (star). (h) Infected fish with serotype III ST283 showed pale liver (star), and hemorrhage of intestinal area with accumulation of fluid in abdominal cavity (arrow). (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)

5

Aquaculture 515 (2020) 734543

R. Syuhada, et al.

Fig. 6. Brain of red hybrid tilapia infected by Streptococcus agalactiae serotype Ia ST7 (a–d) and serotype III ST283 (e–f). (a) Congestion of blood vessel in the stratum peri-ventricular region (arrow); (b) thickening of meningeal layer due to infiltration of heterophils (arrow); (c) congestion of blood vessel in meningeal layer (arrow); (d) presence of degenerated neuron at the stratum marginale line (arrows); (e) presence of degenerated neurons in the inner region (arrows); (f) mild thickening of meningeal layer due to infiltration of heterophils (arrow). (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)

Fig. 7. Liver of red hybrid tilapia infected by Streptococcus agalactiae serotype Ia ST7 showing (a) vacuolation of hepatocytes at surrounding area of central vein (star); (b) presence of thrombus and inflammatory cell at the portal triad of the liver; (c) presence of inflammatory cells at the lumen of the vein (arrows). Fish infected by S. agalactiae serotype III ST283 shows, (d) extensive necrosis of the hepatocytes; (e) small hemorrhages in sinusoids (arrows) and; (d) inflammation at the central vein (arrow). (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)

6

Aquaculture 515 (2020) 734543

R. Syuhada, et al.

Fig. 8. Kidney of red hybrid tilapia infected by Streptococcus agalactiae serotype Ia ST7 (a–d) and III ST283 (e–f). (a) Tubular and coagulative necrosis with eosinophilic cytoplasm (star); (b) generalized necrosis; (c) generalized moderate coagulative necrosis with eosinophilic cytoplasm; (d) bacterial load with glomerulus and tubular necrosis (star); (e) generalized necrosis; (f) coagulative tubular necrosis with eosinophilic cytoplasm. (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)

reported similar serotypes (Li et al., 2014; Chideroli et al., 2017; Kannika et al., 2017; Kayansamruaj et al., 2018; Leal et al., 2019). However, disease in cultured tilapia in Brazil was mostly due to S. agalactiae serotype Ib (Godoy et al., 2013). Interestingly, serotypes Ia,

III and V from humans and cows were reported to be able to infect and cause disease in tilapia in China (Chen et al., 2015). Moreover, S. agalactiae serotype III which isolated from red hybrid tilapias were found identical with the strain that caused disease in human in Fig. 9. Spleen of red hybrid tilapia infected by Streptococcus agalactiae serotype Ia ST7 (a–b) and III ST283 (c–d). (a) The straight line divides the condition of normal and infarcted area of the spleen; (b) presence of hypocellular area due to the lack of oxygen supply (arrow); (c) presence of hypocellular area (arrow); (d) hyperactive production of melanomacrophage center (arrow). (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)

7

Aquaculture 515 (2020) 734543

R. Syuhada, et al.

agalactiae serotype III ST283 infection in tilapia, which causes significant economic losses to their aquaculture industry (Kayansamruaj et al., 2018). The LD50–240h of S. agalactiae serotype Ia ST7 and III ST283 was determined at 8.7 × 103 CFU/mL and 6.3 × 103 CFU/mL, respectively. The low value of LD50 indicates that both serotypes were virulent, but serotype III ST283 might be more slightly virulent. As comparison, a study by Suwannasang et al. (2014) revealed that the LD50 of S. agalactiae serotype Ia and III infection toward Nile tilapia (O. niloticus) was 1.58 × 106 CFU/fish and 2.10 × 108 CFU/fish, respectively. Furthermore, the mortality observed in the present study for both serotypes was as early as 6 hpi. However, mortality among infected S. agalactiae serotype Ia ST7 was observed only at the highest concentration, while S. agalactiae serotype III ST283 involved all bacterial concentrations, again indicating that S. agalactiae serotype III ST283 could be more slightly virulent. In this study, the clinical signs and gross lesions following S. agalactiae infection in fish were similar as reported before (Azad et al., 2012; Li et al., 2014; Pradeep et al., 2016). In general, the clinical signs, gross and histopathological changes manifested by both serotypes were generally similar, and these aspects could not be used to differentiate between the serotypes. In fact, the cumulative mortality between both serotypes were mostly similar, but the histological lesions were significantly more severe in serotype Ia ST7 compared to III ST283. In this study, both serotypes might have quite similar of invasion and immuneevasion functions. However, as serotype III ST283 has more identified adherence genes, it could possibly easier to adhere the host than serotype Ia ST7. Thus, infection by serotype III ST283 could lead to acute infection that contributes to less histological lesions as most of the fish die-off before the development of the lesion, while serotype Ia ST7 revealed less ability to adhere to the host, tend to manifest less acute infection resulting in more severe lesion in the fish tissue (Zamri-Saad et al., 2010). Moreover, the different in mortality patterns between red hybrid tilapias infected by serotypes Ia ST7 and III ST283 also supported these findings.

Table 2 Histological scoring of selected organs following infection with Streptococcus agalactiae serotypes Ia ST7 and III ST283. Organs

Brain

Kidney

Liver

Spleen

Lesions

Congestion of blood vessel* Meningitis* Red neuron* Congestion at meningeal layer* Tubular necrosis Coagulative necrosis Glomerulus shrinkage Bacterial load Congestion of blood vessel* Hepatonecrotic Infarction* Inflammation in blood vessel* Necrosis* Infarction* Presence of melanomacrophage center (MMC)* Hypocellular*

Bacterial type Serotype Ia ST7

Serotype III ST283

1.0 1.0 2.0 2.0 2.0 2.0 2.3 2.0 1.0 2.0 2.0 3.0 3.0 2.0 2.0

2.0 2.0 1.0 0.0 2.0 2.0 1.4 0.0 2.0 1.0 0.0 0.0 1.0 1.0 1.0

± ± ± ± ± ± ± ± ± ± ± ± ± ± ±

0.0 0.3 0.0 0.0 0.2 0.2 0.7 0.8 0.0 0.3 0.0 0.0 0.0 0.0 0.3

1.0 ± 0.3

± ± ± ± ± ± ± ± ± ± ± ± ± ± ±

0.3 0.0 0.0 0.0 0.0 0.0 0.5 0.0 0.7 0.2 0.0 0.0 0.0 0.0 0.0

1.0 ± 0.0

Data are shown as mean ± SE. 0 = normal; 1 = mild; 2 = moderate; 3 = severe, * = indicate significantly different in terms of histopathological scoring between the two different serotypes. n = 5 for each serotype.

Singapore, possibly due to cross-host pathogenicity of the GBS strains (Barkham et al., 2019). Adhesin genes promote the adherence of GBS to the host epithelial cell (Schubert et al., 2004). The present study showed that serotype III has the highest number of adhesion genes (cyl, fbsB, fbsA and lmb), while serotype Ia has only the fbsA adhesion gene. Therefore, serotype III is believed to possess higher capability to adhere to the host cell compared to serotype Ia. Serotype Ia in this study possessed four out of five invasion-related genes, which were spb1, hylB, cfb and rib, while serotype III contained all of the five invasion-related genes. Moreover, serotype III only showed one additional immune-evasion related gene, cspA, compared to serotype Ia. Therefore, the invasion and immuneevasion functions of both S. agalactiae serotypes Ia and III isolates from this study could possibly be quite similar. Streptococcus agalactiae serotypes Ia ST7 and III ST283, which were identified in this study, were the common STs related to epidemiological studies and disease outbreaks in fish (Evans et al., 2008; Delannoy et al., 2013; Chen et al., 2015; Kayansamruaj et al., 2014, 2018; Chau et al., 2017; Leal et al., 2019). MLST data for S. agalactiae from fish in Malaysia is still lacking, as it is for S. agalactiae from humans and other animals. There have been a few reports of S. agalactiae serotype Ia and III in Malaysia, but the STs were not identified, and they were not from aquaculture: they were clinical cases of pregnant, non-pregnant and neonatal infections (Eskandarian et al., 2015; Suhaimi et al., 2017). A study has shown that S. agalactiae serotype Ia ST7 causes large-scale outbreaks in tilapia cultured in China, and the pathogen was categorized as a highly virulent strain, which leads to meningoencephalitis (Liu et al., 2013). On the other hand, Thailand has reported the case of S.

5. Conclusion In conclusion, this study revealed that S. agalactiae serotypes Ia ST7 and III ST283 currently exist in cultured fish in Malaysia. Serotype Ia ST7 lacks the lmb, scpB, pavA, fbsB, cyl, bca, cspA and bac genes, as compared to serotype III ST283. In general, both serotypes showed similar clinical signs, gross lesions and histopathological changes, but serotype III ST283 appeared to be slightly more virulent in red hybrid tilapia. Therefore, serotype III ST283 tends to produce acute infection, while serotype Ia ST7 resulted in less acute infection. This molecular epidemiology study could be useful for the future control and prevention of the disease, which may depend on the development of cross protection vaccines against streptococcosis. Acknowledgements This work was financially supported by the Universiti Putra Malaysia Grant (GP-IPS/2018/9619100).

Appendix A. Supplementary data Supplementary data to this article can be found online at https://doi.org/10.1016/j.aquaculture.2019.734543.

8

Aquaculture 515 (2020) 734543

R. Syuhada, et al.

Appendix 1. Geographical origins of the Streptocococus agalactiae isolates used in this study.

Appendix 2. Sampling sites, years of isolation, and detected serotypes of Streptococcus agalactiae base on year. State and location of sampling sites

Terengganu Kenyir Lake Kuala Kejir Pantai Ali Beladau Selat Beladau Kepong Kedah Jitra Kodiang Pedu Lake Selangor Semenyih

Isolate number/year

Detected serotypes base on year (2006, 2007, 2008, 2018)

2006

2007

2008

2018

Ia

– – – – –

26 2 12 15 6

7 – 3 9 6

– – – – –

( ( ( ( (

– 1 –

1 2 19

6 – 121

– – –

(-,-,-,-) (-,-,-,-) ( - , 9 , 12 , - )

(-,1,6,-) (1,2,-,-) ( - , 10 , 109 , - )

–

–

–

20

(-,-,-,-)

( - , - , - , 20 )

-

, , , , ,

3,-,-) 1,-,-) 2,1,-) -,-,-) -,-,-)

III ( ( ( ( (

-

, , , , ,

23 , 7 , - ) 1,-,-) 10 , 2 , - ) 15 , 9 , - ) 6,6,-)

Appendix 3. Specific names of primers and sequences used in this study (Imperi et al., 2010). No.

Primer name

1 2 3 4 5 6 7 8 9 10

cpsL-F cpsL-R cpsG-F cpsG-R cpsG-2-3-6-R cpsJ-8-F cpsJ-8-R cpsJ-2-4-F cpsJ-2-R cpsJ-4-R

Sequence 5’ → 3’ CAATCCTAAGTATTTTCGGTTCATT TAGGAACATGTTCATTAACATAGC ACATGAACAGCAGTTCAACCGT ATGCTCTCCAAACTGTTCTTGT TCCATCTACATCTTCAATCCAAGC TATTTGGGAGGTAATCAAGAGACA GTTTGGAGCATTCAAGATAACTCT CATTTATTGATTCAGACGATTACATTGA CCTCTTTCTCTAAAATATTCCAACC CCTCAGGATATTTACGAATTCTGTA

9

Possible serotype/s identified Ia, Ib, II-IX Ia, Ib, II-IX Ia, Ib, II-IX Ia III Ib, II,IV,VIII Ib, II,IV,VIII Ib, II,IV,VIII Ib, II,IV,VIII Ib, II,IV,VIII

Aquaculture 515 (2020) 734543

R. Syuhada, et al. 11 12 13 14 15 16 17 18 19

cpsJ-Ib-F cpsJ-Ib-R cpsI-Ia-6-7-F cpsI-6-R cpsI-7-R cpsN-5-F cpsN-5-R cpsI-7-9-F cpsI-9-R

GCAATTCTTAACAGAATATTCAGTTG GCGTTTCTTTATCACATACTCTTG GAATTGATAACTTTTGTGGATTGCGATGA CAATTCTGTCGGACTATCCTGATG TGTCGCTTCCACACTGAGTGTTGA ATGCAACCAAGTGATTATCATGTA CTCTTCACTCTTTAGTGTAGGTAT CTGTAATTGGAGGAATGTGGATCG AATCATCTTCATAATTTATCTCCCATT

Ib, II,IV,VIII Ib, II,IV,VIII VI, VII, IX VI, VII, IX VI, VII, IX V V VI, VII, IX VI, VII, IX

Appendix 4. Flowchart showing singleplex PCR serotyping methods used in this study.

Appendix 5. Oligonucleotide primers used for group B Streptococcus in MLST (Jones et al., 2003). Primer name

adhP pheS Atr glnA sdhA Glck Tkt

Function

Amplification Amplification Amplification Amplification Amplification Amplification Amplification

Primer sequence

Size (bp)

(5’→ 3’) forward

(5’→ 3’) reverse

GTTGGTCATGGTGAAGCACT GATTAAGGAGTAGTGGCACG CGATTCTCTCAGCTTTGTTA CCGGCTACAGATGAACAATT AGAGCAAGCTAATAGCCAAC CTCGGAGGAACGACCATTAA CCAGGCTTTGATTTAGTTGA

ACTGTACCTCCAGCACGAAC TTGAGATCGCCCATTGAAAT AAGAAATCTCTTGTGCGGAT CTGATAATTGCCATTCCACG ATATCAGCAGCAACAAGTGC CTTGTAACAGTATCACCGTT AATAGCTTGTTGGCTTGAAA

672 723 627 589 646 607 859

Appendix 6. Multiplex PCR based on 14 virulence genes found in GBS that had been isolated from humans (Kannika et al., 2017). Set

Primer name

Primers (5’→3’)

Size (bp)

Condition

Set 1 5 genes

cspA-F cspa-R pav-F pav-R cylE-F cylE-R hylB-F hylB-R lmb-F lmb-R fbsB-F fbsB-R scpB-F scpB-R bca-F bca-R pbp1A/ponA-F pbp1A/ponA-R bac-F bac-R

CTGCTAAAGCACACCTAAAC ATCAGTAGTGGTTCCTTTCC TACTACCAAGAGAAGGCTGA GGAGAGACGAGCTTTAGAGT GTACATTAGGTGCCTTTGG TACTCAGCCTTTCTCCATC TCTATGCTGACGGTTCTTAC GAGGTCTAAGTTTCGCTCTT TCAGTTAGTTGCTCTGCTTC CTTTATGACCCACATACCTG CACTCGATAACACTGTGGAT CTGGAACTGTTTCTGTCTTG ACAACGGAAGGCGCTACTGTTC ACCTGGTGTTTGACCTGAACTA TAACAGTTATGATACTTCACAGAC ACGACTTTCTTCCGTCCACTTAGG AGGGGTAGTAGCATTACCAT CAACTATATGACTGGGATCG CTCCAAGCTCTCACTCATAG GAAACATCTGCCACTGATAC

971

(i) 95 °C, 5 min (ii) 95 °C, 30 s 47 °C, 30 s 72 °C, 30 s 38 cycles (iii) 72 °C, 10 min

Set 2 3 genes

Set 3 5 genes

10

729 564 323 152 936 255 535 939 750

(i) 95 °C, 5 min (ii) 95 °C, 30 s 45 °C, 30 s 72 °C, 30 s 38 cycles (iii) 72 °C, 10 min (i) 95 °C, 5 min (ii) 95 °C, 30 s 47 °C, 30 s

Aquaculture 515 (2020) 734543

R. Syuhada, et al.

Set 4 1 gene

cfb-F cfb-R rib-F rib-R fbsA-F fbsA-R spb1-F

GGATTCAACTGAACTCCAAC GACAACTCCACAAGTGGTAA GGGGTTACACAAGGTAATCT TCCACTTAGGATCGTTTG AACCGCAGCGACTTGTTA AAACAAGAGCCAAGTAGGTC CTGCTCCAAGCATAATGCTT

600 425

72 °C, 30 s 38 cycles (iii) 72 °C, 10 min

278 648

(i) 95 °C, 5 min (ii) 95 °C, 30 s 48 °C, 30 s 72 °C, 30 s 35 cycles (iii) 72 °C, 10 min

tilapia, Oreochromis niloticus × O. mossambicus. Aquacult. Rep. 4, 57–65. Jones, N.J.F., Bohnsack, S., Takahashi, K.A., Oliver, M.S., Chan, F., Kunst, F., Glaser, P., Rusniok, C., Crook, D.W., Harding, R.M., Bisharat, N., Spratt, B.G., 2003. Multilocus sequence typing system for Group B Streptococcus. J. Clin. Microbiol. 41, 2530–2536. Kannika, K., Pisuttharachai, D., Srisapoome, P., Wongtavatchai, J., Kondo, H., Hirono, I., Unajak, S., Areechon, N., 2017. Molecular serotyping, virulence gene profiling and pathogenicity of Streptococcus agalactiae isolated from tilapia farms in Thailand by multiplex PCR. J. Appl. Microbiol. 122, 1497–1507. Kayansamruaj, P., Pirarat, N., Katagiri, T., Hirono, I., Rodkhum, C., 2014. Molecular characterization and virulence gene profiling of pathogenic Streptococcus agalactiae populations from tilapia (Oreochromis sp.) farms in Thailand. J. Vet. Diagn. Investig. 26 (4), 488–495. Kayansamruaj, P., Soontara, C., Unajak, S., Dong, H.T., Rodkhum, C., Kondo, H., Hirono, I., Areechon, N., 2018. Comparative genomics inferred two distinct populations of piscine pathogenic Streptococcus agalactiae, serotype Ia ST7 and serotype III ST283, in Thailand and Vietnam. Genomics. https://doi.org/10.1016/j.ygeno.2018.11.016. Leal, C.A., Queiroz, G.A., Pereira, F.L., Tavares, G.C., Figueiredo, H.C., 2019. Streptococcus agalactiae sequence type 283 in farmed fish, Brazil. Emerg. Infect. Dis. 25 (4), 776. Li, Y.W., Liu, L., Huang, P.R., Fang, W., Luo, Z.P., Peng, H.L., Wang, Y.X., Li, A.X., 2014. Chronic streptococcosis in Nile tilapia, Oreochromis niloticus (L.), caused by Streptococcus agalactiae. J. Fish Dis. 37, 757–763. Lin, F.P., Lan, R., Sintchenko, V., Gillbert, G.L., Kong, F., Enrico, C., 2011. Computational bacterial genome-wide analysis of phylogenetic profiles reveals potential virulence genes of Streptococcus agalactiae. PLoS One 6 (4), e17964. Liu, G., Zhang, W., Lu, C., 2013. Comparative genomics analysis of Streptococcus agalactiae reveals that isolates from cultured tilapia in China are closely related to human strain A909. BMC Genomics 14, 775. Pradeep, P.J., Suebsing, R., Sirthammajak, S., Kampeera, J., Jitrakorn, S., et al., 2016. Evidence of vertical transmission and tissue tropism of streptococcosis from naturally infected red tilapia (Oreochromis spp.). Aquacult. Rep. 3, 58–66. PubMLST, 2019. Database: Streptococcus Agalactiae (Group B Streptococcus). Retrieved on 15 May 12019, from. https://pubmlst.org/sagalactiae/. Ramakrishnan, M.A., 2016. Determination of 50% endpoint titer using a simple formula. World J. Virol. 5 (2), 85–86. Schubert, A., Zakikhany, K., Pietrocola, G., Meinke, A., Speziale, P., Eikmanns, B.J., Reinscheid, D.J., 2004. The fibrinogen receptor FbsA promotes adherence of Streptococcus agalactiae to human epithelial cells. Infect. Immun. 72 (11), 6197–6205. Suhaimi, M.E.S., Desa, M.N.M., Eskandarian, N., Pillay, S.G., Ismail, Z., Neela, V.K., Masri, S.N., Nordin, S.A., 2017. Characterization of Group B Streptococcus infection based on the demographic, serotype, antimicrobial susceptibility and genotypes of selected isolates from sterile and non-sterile isolation sites in three major hospitals in Malaysia. J. Infect. Public Health. 10, 14–21. Suwannasang, A., Dangwetngam, M., Issaro, A., Phromkunthong, W., Suanyuk, N., 2014. Pathological manifestations and immune responses of serotypes Ia and III Streptococcus agalactiae infections in Nile tilapia (Oreochromis niloticus). Songklanakarin J. Sci. Technol. 36 (5), 499–506. Tavares, G.C., de Queiroz, G.A., Assis, G.B.N., Leibowitz, M.P., Teixeira, J.P., Figueiredo, H.C.P., Leal, C.A.G., 2018. Disease outbreaks in farmed Amazon catfish (Leiarius marmoratus x Pseudoplatystoma corruscans) caused by Streptococcus agalactiae, S. iniae, and S. dysgalactiae. Aquaculture 495, 384–392. Zamri-Saad, M., Amal, M.N.A., Siti-Zahrah, A., 2010. Pathological changes in red hybrid tilapias (Oreochromis spp.) naturally infected by Streptococcus agalactiae. J. Comp. Pathol. 143, 227–229. Zamri-Saad, M., Amal, M.N.A., Siti-Zahrah, A., Zulkafli, A.R., 2014. Control and prevention of streptococcosis in cultured tilapia in Malaysia: a review. Pertanika J. Trop. Agric. Sci. 37 (4), 389–410.

References Abdullah, S., Omar, N., Yusoff, S.M., Obukwho, E.B., Nwunuji, T.P., Hanan, L., Samad, J., 2013. Clinicopathological features and immunohistochemical detection of antigens in acute experimental Streptococcus agalactiae infection in red tilapia (Oreochromis spp.). SpringerPlus 2, 86. AFS, 2018. Annual Fisheries Statistic. Department of Fisheries Malaysia, Ministry of Agriculture & Agro-Based Industry, Malaysia. Amal, M.N.A., Zamri-Saad, M., Siti-Zahrah, A., Zulkafli, A.R., Nur-Nazifah, M., 2013. Molecular characterization of Streptococcus agalactiae strains isolated from fishes in Malaysia. J. Appl. Microbiol. 115, 20–29. Amal, M.N.A., Zamri-Saad, M., Siti-Zahrah, A., Zulkafli, R., Misri, S., Nur-Nazifah, M., Shahidan, H., 2010a. Prevalence of Streptococcus agalactiae in tilapia kept in different water bodies. OJVR 11 (2), 153–162. Amal, M.N.A., Zamri-Saad, M., Zulkafli, A.R., Siti-Zahrah, A., Misri, S., Ramley, B., Shahidan, H., Sabri, M.Y., 2010b. Water thermocline confirms susceptibility of tilapia cultured in lakes to Streptococcus agalactiae. J. Anim. Vet. Adv. 9 (22), 2811–2817. Anshary, H., Kurniawan, R.A., Sriwulan, S., Ramli, R., Baxa, D.V., 2014. Isolation and molecular identification of the etiological agents of streptococcosis in Nile tilapia (Oreochromis niloticus) cultured in net cages in Lake Sentani, Papua, Indonesia. SpringerPlus 3, 627. Azad, I.S., Al-Marzouk, A., James, C.M., Almatar, S., A-Gharabally, H., Qasem, J.A., 2012. Outbreak of natural streptococcosis in hatchery produced silver pomfret (Pampus argenteus Euphrasen) larvae in Kuwait. Aquaculture 330–333, 15–20. Barkham, T., Zadoks, R.N., Amal, M.N.A., Baker, S., Bich, V.T.N., et al., 2019. One hypervirulent clone, sequence type 283, accounts for a large proportion of invasive Streptococcus agalactiae isolated from humans and diseased tilapia in Southeast Asia. PLoS Neglected Trop. Dis. 13 (6), e0007421. Chau, M.L., Chen, S.L., Yap, M., Hartantyo, S.H.P., Chiew, P.K.T., et al., 2017. Group B Streptococcus infections caused by improper sourcing and handling of fish for raw consumption, Singapore, 2015-2016. Emerg. Infect. Dis. 23 (12), 1982–1990. Chen, M., Wang, R., Luo, F., Huang, Y., Liang, W., Huang, T., Lei, A., Gan, X., Li, L., 2015. Streptococcus agalactiae isolates of serotypes Ia, III, and V from human and cow are able to infect tilapia. Vet. Microbiol. 180, 129–135. Chideroli, R.T., Amoroso, N., Mainardi, R.M., Suphoronski, S.A., Padua, S.B., et al., 2017. Emergence of a new multidrug-resistant and highly virulent serotype of Streptococcus agalactiae in fish farms from Brazil. Aquaculture 479, 45–51. Delannoy, C.M.J., Crumlish, M., Fontaine, M.C., Pollock, J., Foster, G., Dagleish, M.P., Turnbull, J.F., Zadoks, R.N., 2013. Human Streptococcus agalactiae strains in aquatic mammals and fish. BMC Microbiol. 13 (2013), 41. Eskandarian, N., Ismail, Z., Neela, V., Belkum, A.V., Desa, M.N.M., Nordin, S.A., 2015. Antimicrobial susceptibility profiles, serotype distribution and virulence determinants among invasive, non-invasive and colonizing Streptococcus agalactiae (group B Streptococcus) from Malaysian patients. Eur. J. Clin. Microbiol. Infect. Dis. 34 (3), 579–584. Evans, J.J., Bohnsack, J.F., Klesius, P.H., Whiting, A.A., Garcia, J.C., Shoemaker, C.A., Takahashi, S., 2008. Phylogenetic relationships among Streptococcus agalactiae isolated from piscine, dolphin, bovine and human sources: a dolphin and piscine lineage associated with a fish epidemic in Kuwait is also associated with human neonatal infections in Japan. J. Med. Microbiol. 57 (11), 1369–1376. Godoy, D.T., Carvalho-Castro, G.A., Leal, C.A., Pereira, U.P., Leite, R.C., Figueiredo, H.C., 2013. Genetic diversity and new genotyping scheme forfish pathogenic Streptococcus agalactiae. Lett. Appl. Microbiol. 57 (6), 476–483. Imperi, M., Pataracchia, M., Alfarone, G., Baldassarri, L., Orefici, G., Creti, R., 2010. A multiplex PCR assay for the direct identification of the capsular type (Ia to IX) of Streptococcus agalactiae. J. Microbiol. Methods 80, 212–214. Ismail, N.I.A., Amal, M.N.A., Shohaimi, S., Zamri-Saad, M., Siti-Zahrah, A., 2016. Associations of water quality and bacteria presence in cage cultured red hybrid

11