- Email: [email protected]
Sensitive detection of cancer gene based on a nicking-mediated RCA of circular DNA nanomachine
Accepted Manuscript Title: Sensitive detection of cancer gene based on a nicking-mediated RCA of circular DNA nanomachine Authors: Zheng-Yong Wang, Feng Li, Yan Zhang, Hui Zhao, Huo Xu, Zai-Sheng Wu, Jian-Xin Lyu, Zhi-Fa Shen PII: DOI: Reference:
S0925-4005(17)30881-X http://dx.doi.org/doi:10.1016/j.snb.2017.05.061 SNB 22345
To appear in:
Sensors and Actuators B
Received date: Revised date: Accepted date:
10-1-2017 8-5-2017 13-5-2017
Please cite this article as: Zheng-Yong Wang, Feng Li, Yan Zhang, Hui Zhao, Huo Xu, Zai-Sheng Wu, Jian-Xin Lyu, Zhi-Fa Shen, Sensitive detection of cancer gene based on a nicking-mediated RCA of circular DNA nanomachine, Sensors and Actuators B: Chemicalhttp://dx.doi.org/10.1016/j.snb.2017.05.061 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
Sensitive
detection
of
cancer
gene
based
on
a
nicking-mediated RCA of circular DNA nanomachine
Zheng-Yong Wang,a,1 Feng Li,a,b,1 Yan Zhang,a Hui Zhao,a,b Huo Xu,b Zai-Sheng Wu,*b Jian-Xin Lyu,*a, c and Zhi-Fa Shen*a
a
Key Laboratory of Laboratory Medicine, Ministry of Education of China, Zhejiang Provincial
Key Laboratory of Medicine Genetics, School of Laboratory Medicine and Life Sciences, Institute of Functional Nucleic Acids and Personalized Cancer Theranostics, Wenzhou Medical University, Wenzhou, 325035, China. b
Cancer Metastasis Alert and Prevention Center, Fujian Provincial Key Laboratory of Cancer
Metastasis Chemoprevention and Chemotherapy, Pharmaceutical Photocatalysis of State Key Laboratory of Photocatalysis on Energy and Environment, College of Chemistry, Fuzhou University, Fuzhou, 350002, China. c Department
of Laboratory Medicine, People's Hospital of Hangzhou Medical College. Hangzhou,
Zhejiang 310053, China
*Corresponding Author: Phone: 086-577-8668-9653. Email: [email protected] (Z.S. Wu), [email protected] (Z.F. Shen); [email protected] (J.X. Lyu)
1The
first two authors contributed equally to this work.
1
Highlights
A DNA nanomachine was developed by inserting molecular beacon into a padlock probe
RCA and SDA were integrated into a circular padlock-based DNA nanomachine
Two types of nicked fragments flow out from CMB-PP nanomachine and amplify signal
The newly-proposed strategy can detect cancer genes with high sensitivity and selectivity
Abstract We propose a DNA nanomachine (simplified as MB-PP) by inserting molecular beacon into a padlock probe for the sensitive and specific detection of K-ras gene mutation. In the presence of target DNA, MB-PP is able to be cyclized by ligase because its two ends are pulled together by target species. In this case, rolling circle amplification (RCA) occurs via the extension of primer by polymerase on cyclized MB-PP (CMB-PP), and thus two complete binding sites of nicking endonuclease are obtained due to the formation of RCA product/CMB-PP duplex. Naturally, a steady stream of two types of nicked fragments flow out from continuous rolling CMB-PP nanomachine after introduction of nickase, one of which can in turn triggers strand-displacement amplification (SDA), leading to the dramatic accumulation of nicked fragments. As a result, even in the presence of a trace amount of wild target DNA, the fluorescence intensity will substantially increase. Utilizing this DNA 2
machine, the K-ras gene can be detected down to 50 pM with the linear response range from 50 pM to 10 nM. Moreover, the point mutation existing in the codon 12 of K-ras can be easily distinguished from the wild type.
Keywords: molecular beacon-embedded padlock probe (MB-PP); K-ras gene; nicking-mediated
rolling
circle
amplification
(N-RCA);
strand-displacement
amplification (SDA).
1. Introduction Over the last decades, along with the completion of the draft human genome sequence and rapid development of systematic resequencing of cancer genomes, large numbers of cancer-related genes have been discovered. Many cancer-related genes are associated closely with the occurrence, invasion, metastasis and prognosis of cancer[1, 2]. In recent years, various nucleic acid testing methods have been proposed, among which DNA machine has attracted increasing attention in biosensing and clinical diagnosis research[3-5]. DNA machine design is often based on specific base-pairing and predictable assembly of DNA molecules. When binding to stimuli, DNA machine undergoes conformational changes that could automatically trigger signaling cascades[6, 7]. Compared with traditional nucleic acid testing technology, such as polymerase chain reaction (PCR) which needs expensive thermal cyclers[8, 9], DNA machine possesses some remarkable advantages, such as simple operation, automatic 3
detection and high specificity[10, 11]. Although some ingenious DNA machines have been already designed, their application in detecting actual samples remains great challenge due to poor sensitivity and/or specificity[12, 13]. So, developing new convenient and reliable DNA machine is still necessary and urgent. The members of the ras family (H-ras, K-ras and N-ras) are the most common genes associated with the initiation and progression of cancer. K-ras mutations have been frequently detected in colorectal cancer, lung carcinomas (mostly non-small-cell lung cancer (NSCLC) ) and pancreatic carcinomas[14, 15]. Among the mutation types of K-ras gene, mutations in codon 12 are the most common form[1, 16]. As mutations in codon 12 of K-ras gene often lead to drug-resistance and worse prognosis in clinical treatment[17, 18], it would be of great significance to develop highly sensitive and specific DNA machine for convenient and accurate mutation detection with potential applications in the personalized medicine and targeting therapy to tumors. In this contribution, a DNA nanomachine, molecular beacon-embedded padlock probe (MB-PP) was developed, which not only executes signal amplification of wild target DNA, but also accurately distinguishes point mutations in codon 12 of K-ras gene. By extending common MB from two ends, the MB-PP was designed to have a stem-loop structure (labeled with a fluorophore and a quencher group) and two arms to simultaneously hybridize with target DNA. Specifically, the two arms of the MB-PP become juxtaposed by hybridization with a wild target DNA, forming a nick site-contained sandwich structure. After the resulting nick is sealed by DNA ligase, a circular MB-PP (CMB-PP), namely circular DNA nanomachine, is obtained. Upon 4
addition of polymerization primer and polymerase, this molecular nanomahine can implement rolling circle amplification (RCA), producing a complementary single-stranded DNA product. Hybridization between polymerization product and CMB-PP causes the formation of DNA duplex containing two nicking sites at two different positions. In this case, the synergistic effect of nickase and polymerase can be achieved, leading to unique strand displacement amplification that occurs on a circular DNA template. Some displaced nicked polymerization products directly open the hairpin structure of MB region in CMB-PP responsible for the generation of fluorescence signal and the others initiate the classic stranded-displacement amplification on a linear DNA template. As a result, besides direct increase in the fluorescence signal, polymerization products
complementary to
MB were
dramatically accumulated, leading to a remarkably enhanced fluorescence signal. Utilizing the proposed DNA nanomachine, the target gene can be detected down to 0.05 nM, and the point mutations are specifically recognized. In the text, DNA probe design, working principle and characterization of DNA nanomachine is detailedly discussed. 2. Experimental section 2.1. Materials and chemicals All oligonucleotides are listed in Table 1 and Table S1, and they were obtained via commercial synthesis by Sangon Biological Engineering Technology & Services Co., Ltd., (Shanghai, China). These oligonucleotides were prepared with PAGE purification, except that the labeled MB-PP was purified using HPLC. DNA stock 5
solutions were prepared by dissolving in TE buffer (10 mM Tris, 1 mM EDTA, pH7.6) and stored at 4 °C refrigerator prior to use. The Klenow Fragment (3'→5' exo-) polymerase, Nt. BbvCI nicking endonuclease and Taq DNA Ligase were purchased from New England Biolabs (Beijing, China). The mixture of deoxynucleotide triphosphates (dNTPs) was supplied by Dingguo Changsheng Biotechnology Co., Ltd (Beijing, China). The healthy human serum used in the interference experiments was obtained from the first affiliated hospital of Wenzhou medical university in China. All other chemical reagents were of analytical grade and used without further purification. Ultrapure water obtained through a Milli-Q Direct water purification system (USA) (resistance > 18 MΩ. cm) was used to prepare all aqueous solutions throughout the experiments. Preferred position for Table 1 2.2. The detection of target K-ras gene A 1.5 μL droplet of 10 μM MB-PP, 1.5 μL of wild target DNA at certain concentration, 1 μL of 10×Taq DNA Ligase Reaction Buffer (200 mM Tris-HCl, 250 mM Potassium Acetate, 100 mM Magnesium Acetate, 10 mM NAD 1, 100 mM DTT, 1% Triton® X-100, pH 7.6) and 5.5 μL of ddH2O were added into an Eppendorf tube and annealed at 90 °C for 5 min, followed by incubation at 50 °C for 1 h. After addition of 0.5 μL of 40 U/μL Taq DNA Ligase, the resulting solution was incubated at 50 °C for another 1 h and then allowed to cool down to room temperature. Subsequently, for the RCA and nicking reaction, 31.5 μL of ddH2O, 1.5 μL of 10 μM primer solution, 1 μL of 10 mM dNTPs, 5 μL of 10×NEBuffer 2.1 (500 mM NaCl, 100 mM Tris-HCl, 100 6
mM MgCl2, 1 mg/ml BSA, pH 7.9), 0.5 μL of 5 U/μL Klenow Fragment (3'→5' exo-) polymerase and 0.5 μL of 10 U/μL Nt. BbvCI nicking endonuclease were injected, followed by incubation at 37 °C for 1 h. Finally, the enzymatic reaction was terminated by cooling on ice for 10 min[5]. Before collecting fluorescence spectrum, 150 μL of cold 1×NEBuffer 2.1 was added and thoroughly mixed. All the detection experiments were carried out according to the same procedure unless specified otherwise. The concentration of target DNA mentioned in the text was that in 50 μL reaction volume. 2.3. Fluorescence measurement. The fluorescence spectra were collected by a Hitachi F-7000 (Hitachi, Ltd., Japan) fluorescence spectrometer with xenon short-arc lamp controlled by FL Solution software. The instrument parameters were set as follows: excitation wavelength, 492 nm; emission spectrum was collected from 500 to 600 nm; scan speed, 240 nm/min; excitation slit, 5 nm; emission slit, 5 nm; PMT Voltage, 600 V; response time, 0.5 s. The fluorescence intensity at 518 nm was used to evaluate the assay capability of DNA nanomachine. 3. Results and discussion. 3.1. Design of DNA nanomachine Rolling circle amplification (RCA) and circular strand-displacement amplification (SDA) are two classical signal amplification strategies based on isothermal polymerization[19-21], and RCA is suitable for distinguishing single nucleotide polymorphisms (SNPs) and point mutation in target gene with high-fidelity DNA 7
ligase and padlock probe[22, 23]. However, conventional RCA has a limited amplification efficiency that has been proven insufficient for many applications[24]. Although a reverse primer improves the amplification efficiency to some extent, hyperbranched RCA method always brings about some nonspecific amplification artifacts. SDA is an easy controlled amplification strategy based on cyclical nucleic acid strand-displacement polymerization (CNDP) by introducing a recognition site of nickase, which is often adopted to develop sensitive biosensing system[7, 25]. In the current contribution, RCA and SDA were further improved by developing a circular padlock-based DNA nanomachine. To construct a unique DNA nanomachine, we proposed a molecular beacon-embedded padlock probe (MB-PP). Its sequence and functional fragments are described in Table 1. Essentially, the MB-PP is designed by extending a common molecular beacon from its two ends, which has a stem-loop structure labeled with a fluorophore and a quencher at different positions. Two 15 base fragments at the 5' end and 3' end of MB-PP can simultaneously hybridize with target gene in a head-to-tail fashion. Two recognition sites of nickase are located in the flanks of the stem-loop structure, while the binding region of polymerization primer is inserted between the stem-loop structure and the recognition site of nickase closed to 5' end. The operation principle of DNA nanomachine is illustrated in scheme 1. Due to the formation of hairpin structure, the chemically labeled fluorophore and quencher are brought into close proximity to each other, and no obvious fluorescence emission can be detected. In the presence of wild type K-ras gene, the 5' end and 3' end of 8
MB-PP are brought together, followed by cyclization by ligase using target gene as the template. When the primer is added, RCA occurs on cyclized MB-PP (CMB-PP), generating two complete nickase recognition site contained in double-stranded polymerization product/CMB-PP. In this case, Nt. BbvCI can bind and cleave the polymerization product. Because new polymerization can take place at the nick and displace
the
downstream
of
nicked
DNA
fragment,
polymerization/nicking/displacement repeatedly proceeds, producing two types of nicked fragments: nicked fragment 1 and nicked fragment 2. A description of image is that a steady stream of two different types of nicked fragments flow out from continuously rolling CMB-PP-based nanomachine. Apparently, RCA described is mediated by nicking reaction and thus called nicking-mediated rolling circle amplification (simplified as N-RCA). Meanwhile, from another perspective, SDA is designed to occur on a circular DNA template. Thus, this reaction stage, the first amplification, is also called circular strand-displacement amplification (abbreviated as C-SDA). Namely, essentially, N-RCA is C-SDA. Because nicked fragment 2 can directly hybridize with the stem-loop structure of MB-PP and restore the pre-quenched fluorescence of FAM, the fluorescence signal can be generated and substantially enhanced at the first amplification stage. At the second amplification stage, nicked fragment 1 can amplify the signal upon target DNA in a different manner. Specifically, nicked fragment 1 can hybridize with the 3' end of linear (L) MB-PP and serve as polymerization primer that is extended by polymerase on LMB-PP template. As a result, besides generation of higher 9
fluorescence signal by opening more hairpin structures of MB parts, the extended nicked fragment 1 is nicked again by Nt. BbvCI at two positions because of the formation of new nickase recognition sites in polymerization product/linear MB-PP duplex. This makes the polymerization, nicking and displacement alternatively occur on a linear MB-PP, achieving common SDA (called L-SDA, where “L” indicates the linear template) effect responsible for the second accumulation of nicked fragment 2. Clearly, nicked fragment 1 and nicked fragment 2 can amplify the fluorescence signal in closely related but different fashions. In contrast, in the absence of K-ras gene, the cyclization of MB-PP is incapable of accomplishing during ligation reaction. Thus, subsequent RCA and SDA could not be initiated and no detectable signal is observed. In the presence of mutant target DNA, CMB-PP almost is not generated because the existence of mismatched base pair makes the sealing of nick junction difficulty. Accordingly, the fluorescence signal induced by mutant target DNAs is lower than wild type gene. Preferred position for Scheme 1 3.2. Feasibility of DNA nanomachine for target gene detection To verify the feasibility of the proposed DNA nanomachine-based sensing system for the detection of target K-ras gene, several comparative experiments were carried out in the initial stage. As shown in Figure 1A, an extremely low fluorescence emission is detected at 518 nm for the MB-PP (line a). This should be attributed to the effect of FRET between fluorophore and quencher group that are brought into close proximity to each other by the stem of MB-PP. Wild target DNA hybridization cannot cause any 10
fluorescent increase (line b). It is reasonable if a fact is taken into account that, unlike the traditional MB, the stem-loop structure of the MB-PP is not opened by wild target DNA because the target gene hybridizes with the two arms of MB-PP rather than the loop section. The obvious difference between lines c and d indicates the fluorescence signal of ligase/polymerase-based sensing system upon target gene. In the presence of nickase in sensing system, although the background fluorescence slightly increases as shown in line e, a dramatic increment in fluorescence intensity can be induced by wild target DNA (line f), proving the capability of SDA to amplify the optical signal. Experiments a, b, c, d, e and f may be divided into three groups of sensing systems: system I (non-amplification system), system II (RCA-based amplification) and system III (proposed amplification system). The data used for more accurate evaluation of sensing capability are shown in Figure 1B, where signal-to-noise ratio (SNR) and the difference in fluorescence peak between target sample and blank are estimated from fluorescence spectra of Figure 1A. One can note that no any fluorescence increase is detected in sensing system I, moderate increase in fluorescence intensity is observed in system II and the highest fluorescence response is offered by system III. Preferred position for Figure 1 3.3. Optimization of polymerization/nicking time The temperature adopted for enzymatic reactions was basically consistent with that recommended by the supplier, while the incubation time for RCA and SDA was optimized to improve the detection capability of DNA nanomachine. As shown in Figure 2, the value of signal-to-background ratio increases with increasing enzymatic 11
time and then reaches the maximum value of more than 5.5 after 60 min. If the enzymatic amplification is prolonged, the response signal decreases rather than increases. This is because the longer incubation time makes the background fluorescence increase. Since the highest signal-to-background ratio is offered, the polymerization/nicking time of 60 min is chosen in subsequent experiments. Preferred position for Figure 2 3.4. Nicked fragments-medicated signal amplification In order to prove that two nicked fragments, nicked fragment 1 (NF1) and nicked fragment 2 (NF2), produced during the operation of DNA nanomachine play crucial roles in the signal amplification, identical nicked fragments synthesized commercially were used to induce the fluorescence signal instead of wild target DNA. The detection experiments were carried out under the identical conditions described in experimental section, except that one of nicked fragments was used instead of target DNA. As shown in Figure S1, line a exhibits very low fluorescence emission because the fluorophore and quencher were kept in close proximity by the hairpin structure of MB-PP. In the presence of NF2 (line b), the fluorescence intensity substantially increases, which is consistent with our expectation that NF2 can hybridize with the stem-loop region of MB-PP, making the fluorophore away from the quencher. The highest fluorescence signal is seen in line c, which is very reasonable because NF1 initiates the L-SDA in the presence of polymerase and nickase although NF1 cannot directly open the stem-loop structure of MB-PP. In this case, a large numbers of NF2 can be generated, and more MB-PPs are opened. These measured data demonstrate 12
that the two types of nicked fragments are essential for amplification detection of wild target DNA. In this section, it should be noted that the NF1 concentration involved is the same as NF2, permitting direct comparison of the recorded fluorescence responses. On the other hand, the concentration of two nicked fragments is much lower than MB-PP, so that the L-SDA-induced signal amplification upon NF1 is easily detected. 3.5. Capability of MB-PP-based nanomachine to sense K-ras target Sensitivity is a crucial property of biosensing system because highly sensitive detection is necessary for various practical applications, especially in early-stage diagnosis of cancer. To evaluate the sensing capacity of MB-PP-based DNA nanomachine, we carried out a series of detection experiments at different concentrations of wild target DNA ranging from 0 to 25 nM, and the collected fluorescence spectra are presented in Figure 3. As depicted in Figure 3A, a monotonic increase in the fluorescence intensity is observed when increasing the wild target DNA concentration, and no obvious fluorescence change is detected when the wild target DNA concentration is more than 25 nM. The Inset displays the fluorescence spectra of sensing system in the low concentration range of wild target DNA from 0 to 0.5 nM. The wild target DNA at 0.05 nM could induce a detectable fluorescence increase compared with the blank. Thus, 0.05 nM is defined as the detection limit. The linear relationship between wild target DNA concentration and the fluorescence peak is depicted in Figure 3B. With the wild target DNA concentration increase, the fluorescence intensity rapidly increases, and then tends to stabilize at 25 nM. The 13
linear regression equation is F=88.74+146.74sqrt(C) with a correction coefficient of 0.9887 (R2), where the F and C indicate the fluorescence intensity and wild target DNA concentration, respectively. Moreover, the average relative standard deviation estimated from all datum points is below 5.0%, indicating a desirable reproducibility of the gene detection. Preferred position for Figure 3 3.6. Specificity of DNA nanomachine toward target gene Mutation in codon 12 is the most common type of K-ras gene mutation, which is associated with the prognosis of colorectal and lung cancers[26]. This point mutation was chosen as the model mutation to evaluate the assay specificity. Mutant target DNA 1, mutant target DNA 2 and mutant target DNA 3 have the similar base sequence to wild target DNA, except the second base of codon 12 was substituted by C, A and T, respectively. Under identical experimental conditions, the fluorescence response induced by the three mutant target DNAs and wild target DNA was detected. As shown in Figure 4A, when the fluorescence response induced by wild target DNA is defined as 100%, the relative fluorescence intensity upon MT1, MT2 and MT3 are 66%, 70% and 53%, respectively. These data indicate that this proposed DNA nanomachine can exactly distinguish the point mutation in target gene of interest. However, the specificity of our proposed detection system was less-than-brilliant compared with some published works that the padlock probe was involved [23, 27]. According to literature reports [13, 28], Taq DNA Ligase exhibits significantly greater discrimination against single base mismatches on the 3’-side of the nick in 14
comparison with those on the 5’-side of the nick. To improve the detection specificity, three imaginary target DNAs were synthesized to have the base mismatch each at the 3’ end of MB-PP probe. Under the identical conditions, the detection experiments were performed, and the results are described in Figure 4B. One can see that the relative fluorescence intensities induced by MT4, MT5 and MT6 are 5%, 36% and 12%, respectively, demonstrating the significantly improved specificity. Preferred position for Figure 4 3.7. The detection of p53 gene Many cancers usually are polygenic diseases, suggesting that variant risk alleles are responsible for the complex diseases[29], and thus one mutated gene detection is not enough to take conclusion. Another molecular beacon-embedded padlock probe (MB-PP-p53) was designed for the detection of p53 gene according to the same strategy. The p53 gene is closely related to the occurrence of cancer. The information on probe sequences is listed in Table S1. The feasibility is shown in Figure S2. As expected, the proposed MB-PP-p53-based sensing system can efficiently amplify the target p53 gene with satisfactory SNR (signal-to-noise ratio). At the same time, the assay specificity is desirable as shown in Figure S3. The relative fluorescence intensities corresponding to MT1-p53, MT2-p53 and MT3-p53 are 15.4%, 4.7% and 2.3% respectively. For genetic studies or molecular diagnosis, the sequencing method provides reliable large-scale DNA sequencing but has the disadvantages of sample-hungry, high operational cost and a long turnaround time depending on the size and 15
complexity of the gene [30-32]. As a potential alternative, the proposed sensing system can be used to detect cancer genes in an isothermal fashion, which greatly favours the point-of-care diagnosis. However, the intrinsic drawback of this new method is that one type of MB-PP probe can only be used to detect a specific disease-related gene. In future, the isothermal amplification might have a promising application for low-resource setting area or for some common disease screening. 3.8. Interference Study To confirm potential practical application of the MB-PP-based nanomachine for the target gene detection, the comparative experiments were conducted in the healthy human serum, which contains a variety of enzymes and other complex interference. Target DNA-contained sample serum (1% or 5%, v/v) sample was prepared, and the detection experiments were conducted according to the standard procedure. As shown in Figure 5 (K-ras gene) and Figure S4 (p53 gene), comparing with the sample without human serum, 1% or 5% diluted human serum does not cause an obvious change in the fluorescence intensity, demonstrating that the newly-proposed sensing strategy is effectively impervious to the complex media. Preferred position for Figure 5
Conclusion In the present study, a circular DNA nanomachine has been developed via designing a MB-embedded padlock probe (MB-PP), which can be used to sensitively detect the cancer-related genes (K-ras gene and p53 gene) and to specifically distinguish the 16
point mutation in target DNAs. Via introducing two nickase binding sites into padlock probe, the powerful RCA and SDA can be easily integrated into a sensing system, achieving double amplification effect: N-RCA (C-SDA) and L-SDA. As far as we know, N-RCA and C-SDA are two completely new concepts directed toward the signal amplification, and there has been no report on similar sensing systems. The full name of N-RCA is nicking-mediated rolling circle amplification, while C-SDA is circular strand-displacement amplification indicating the SDA occurs on a circular DNA template. As its name implies, circular DNA nanomachine has several unique features different from the previous RCA and SDA strategies: (1) no long ssDNA products composed of thousands of tandemly repeated DNA-sequence units even if RCA is involved. This is because the single stranded polymerization product can be nicked before being displaced since the nickase binding sites are introduced to padlock probe; (2) the optimum use of nicked fragments. Because the C-SDA involved in the first amplification stage occurs on a circular DNA template, both the upstream and downstream of the nick can be extended by polymerase; (3) synergistic effect of N-RCA (or C-SDA) and L-SDA. Except the primer, only one MB-PP is involved in DNA nanomachine-based sensing system, and two closely related polymerization products are generated from different amplification processes. Thus, RCA and SDA should be able to promote each other. Additionally, there are other advantages, such as simple design, easy operation, isothermal reaction, homogeneous detection and satisfactory sensing performance. This circular DNA nanomachine offers an insight into the design of efficient signal transduction platforms to rapidly, 17
sensitively and specifically detect point mutations in target gene and holds the potential application in early clinical diagnosis and personalized medicine. Acknowledgments This work was supported by National Natural Science Foundation of China (NSFC) (grant NO: 21275002), Zhejiang Province Natural Science Foundation of China (LY16C07002) and Independent Research Project of State Key Laboratory of Photocatalysis on Energy and Environment (NO. 2014CO1).
18
References
[1] Y. Pylayeva-Gupta, E. Grabocka, D. Bar-Sagi, RAS oncogenes: weaving a tumorigenic web, Nature Reviews Cancer, 11(2011) 761-74. [2] C. Whibley, P.D. Pharoah, M. Hollstein, p53 polymorphisms: cancer implications, Nature reviews Cancer, 9(2009) 95-107. [3] Y. Weizmann, M.K. Beissenhirtz, Z. Cheglakov, R. Nowarski, M. Kotler, I. Willner, A virus spotlighted by an autonomous DNA machine, Angew Chem Int Ed Engl, 45(2006) 7384-8. [4] Y. Wen, Y. Xu, X. Mao, Y. Wei, H. Song, N. Chen, et al., DNAzyme-based rolling-circle amplification DNA machine for ultrasensitive analysis of microRNA in Drosophila larva, Anal Chem, 84(2012) 7664-9. [5] J. Xu, Z.S. Wu, W. Shen, H. Xu, H. Li, L. Jia, Cascade DNA nanomachine and exponential amplification biosensing, Biosensors & bioelectronics, 73(2015) 19-25. [6] R. Fu, T. Li, S.S. Lee, H.G. Park, DNAzyme molecular beacon probes for target-induced signal-amplifying colorimetric detection of nucleic acids, Anal Chem, 83(2011) 494-500. [7] S.J. Xie, H. Zhou, D. Liu, G.L. Shen, R. Yu, Z.S. Wu, In situ amplification signaling-based autonomous aptameric machine for the sensitive fluorescence detection of cocaine, Biosensors & bioelectronics, 44(2013) 95-100. [8] H. Zaaijer, H. Cuypers, H. Reesink, I. Winkel, P. Lelie, G. Gerken, Reliability of polymerase chain reaction for detection of hepatitis C virus, The Lancet, 341(1993) 722-4. [9] B.J. Hindson, K.D. Ness, D.A. Masquelier, P. Belgrader, N.J. Heredia, A.J. Makarewicz, et al., High-throughput droplet digital PCR system for absolute quantitation of DNA copy number, Analytical chemistry, 83(2011) 8604-10. [10] J. Xu, H. Dong, W. Shen, S. He, H. Li, Y. Lu, et al., New molecular beacon for p53 gene point mutation and significant potential in serving as the polymerization primer, Biosens Bioelectron, 66(2015) 504-11. [11] Q. Zhang, F. Chen, F. Xu, Y. Zhao, C. Fan, Target-triggered three-way junction structure and polymerase/nicking enzyme synergetic isothermal quadratic DNA machine for highly specific, one-step, and rapid microRNA detection at attomolar level, Analytical chemistry, 86(2014) 8098-105. [12] F. Dahl, J. Banér, M. Gullberg, M. Mendel-Hartvig, U. Landegren, M. Nilsson, Circle-to-circle amplification for precise and sensitive DNA analysis, Proceedings of the National Academy of Sciences of the United States of America, 101(2004) 4548-53. [13] A.F. Faruqi, S. Hosono, M.D. Driscoll, F.B. Dean, O. Alsmadi, R. Bandaru, et al., High-throughput genotyping of single nucleotide polymorphisms with rolling circle amplification, BMC genomics, 2(2001) 4. [14] H. Kiaris, D.A. Spandidos, Mutations of ras genes in human tumours (Review), International journal of oncology, 7(1995) 413-22. [15] D. Li, K. Xie, R. Wolff, J.L. Abbruzzese, Pancreatic cancer, The Lancet, 363(2004) 1049-57. [16] J.L. Bos, Ras oncogenes in human cancer: a review, Cancer research, 49(1989) 4682-9. [17] F. Di Fiore, F. Blanchard, F. Charbonnier, F. Le Pessot, A. Lamy, M.P. Galais, et al., Clinical relevance of KRAS mutation detection in metastatic colorectal cancer treated by Cetuximab plus chemotherapy, British journal of cancer, 96(2007) 1166-9. [18] C.S. Karapetis, S. Khambata-Ford, D.J. Jonker, C.J. O'Callaghan, D. Tu, N.C. Tebbutt, et al., K-ras 19
mutations and benefit from cetuximab in advanced colorectal cancer, The New England journal of medicine, 359(2008) 1757-65. [19] J.G. Paez, M. Lin, R. Beroukhim, J.C. Lee, X. Zhao, D.J. Richter, et al., Genome coverage and sequence fidelity of phi29 polymerase-based multiple strand displacement whole genome amplification, Nucleic Acids Res, 32(2004) e71. [20] Q. Guo, X. Yang, K. Wang, W. Tan, W. Li, H. Tang, et al., Sensitive fluorescence detection of nucleic acids based on isothermal circular strand-displacement polymerization reaction, Nucleic Acids Res, 37(2009) e20. [21] Z. Lin, W. Yang, G. Zhang, Q. Liu, B. Qiu, Z. Cai, et al., An ultrasensitive colorimeter assay strategy for p53 mutation assisted by nicking endonuclease signal amplification, Chem Commun (Camb), 47(2011) 9069-71. [22] J. Pickering, A. Bamford, V. Godbole, J. Briggs, G. Scozzafava, P. Roe, et al., Integration of DNA ligation and rolling circle amplification for the homogeneous, end-point detection of single nucleotide polymorphisms, Nucleic acids research, 30(2002) e60-e. [23] J. Li, T. Deng, X. Chu, R. Yang, J. Jiang, G. Shen, et al., Rolling circle amplification combined with gold nanoparticle aggregates for highly sensitive identification of single-nucleotide polymorphisms, Anal Chem, 82(2010) 2811-6. [24] X. Zhu, C. Feng, B. Zhang, H. Tong, T. Gao, G. Li, A netlike rolling circle nucleic acid amplification technique, Analyst, 140(2015) 74-8. [25] F. Wang, J. Elbaz, R. Orbach, N. Magen, I. Willner, Amplified Analysis of DNA by the Autonomous Assembly of Polymers Consisting of DNAzyme Wires, Journal of the American Chemical Society, 133(2011) 17149-51. [26] T. Takayama, K. Miyanishi, T. Hayashi, Y. Sato, Y. Niitsu, Colorectal cancer: genetics of development and metastasis, Journal of gastroenterology, 41(2006) 185-92. [27] S. Zhang, Z. Wu, G. Shen, R. Yu, A label-free strategy for SNP detection with high fidelity and sensitivity based on ligation-rolling circle amplification and intercalating of methylene blue, Biosensors & bioelectronics, 24(2009) 3201-7. [28] J. Luo, D.E. Bergstrom, F. Barany, Improving the fidelity of Thermus thermophilus DNA ligase, Nucleic Acids Res, 24(1996) 3071-8. [29] P. Kraft, D.J. Hunter, Genetic risk prediction--are we there yet?, New Engl J Med, 360(2009) 1701-3. [30] W. Zhang, H. Cui, L.J.C. Wong, Application of Next Generation Sequencing to Molecular Diagnosis of Inherited Diseases: Springer Berlin Heidelberg; 2012. [31] R. Nielsen, J.S. Paul, A. Albrechtsen, Y.S. Song, Genotype and SNP calling from next-generation sequencing data, Nature Reviews Genetics, 12(2011) 443-51. [32] M. Baker, MicroRNA profiling: separating signal from noise, Nat Methods, 7(2010) 687.
20
Zheng-Yong Wang earned bachelor of medicine from Mudanjiang Medical University in 2014. Now he is a master degree candidate majoring in Clinical Laboratory Diagnostics in Wenzhou Medical University. His current field of interest includes DNA based biosensor and detection of cancer related gene point mutation.
Feng Li obtained his master and bachelor degree majoring in biology from Wenzhou Medical University and Dalian University in 2016 and 2013 respectively. Now he is a research assistant in college of chemistry of Fuzhou University. His research interests include biosensor and nanomaterial.
Yan Zhang obtained his bachelor degree from Huazhong University of Science and Technology in 2014. Now he is a master degree candidate majoring in biology in Wenzhou medical University. His current field of interest is biosensor and DNA nanomachine.
Hui Zhao received her bachelor of medicine from Taishan Medical University in 2014. Now she is a master degree candidate majoring in Clinical Laboratory Laboratory Diagnostics in Wenzhou Medical University. her current field of interest includes DNA based biosensor and nanomaterial.
Huo Xu received the B. Sc. Degree from the college of chemistry and chemical engineering, Fuzhou University in 2013. He is currently a Doctor Degree student of 21
pharmaceutical analysis in cancer metastasis alert and prevention institute, Fuzhou University. He has 4 publications in SCI journals and 3 abstracts in national and international meetings. His research interest includes chemical sensor and biosensor, diagnosis and treatment of malignant tumor and functional nucleic acids.
Zai-Sheng Wu received the degree of Doctor of Science in Analytical Chemistry from Hunan University in 2008. During 2010-2014, he was a post-doctoral fellow of Faculty of Health Sciences in McMaster University. Now he is a distinguished professor in College of Chemistry of Fuzhou University supported by the Recruitment Program of Global Experts for Young Professionals and Minjiang Scholars program of Fujian Province. His research focuses on nucleic acid nanostructrues, functional nucleic acids, chemical and bio-sensing, pharmaceutical analysis, diagnosis and treatment of malignant tumor. He has published over 70 scientific papers. He was a lead guest editor in Journal of Analytical Methods in Chemistry and Journal of Nucleic Acids.
ZhiFa Shen received Ph.D. in Biochemistry at University of Montreal under the supervision of Dr. Pascal Chartrand in 2010. He then did his postdoctoral research with Dr. Shyam Sharan at NCI/NIH, USA. In 2011, he had his second PDF in McMaster University under the supervision of Dr. Yingfu Li. Currently he is a professor in the School of laboratory medicine and life sciences, Wenzhou Medical University. His research focuses on functional nucleic acid research, molecular 22
mechanism on liver cancer metastasis and its target treatment.
Jian-Xin Lyu received doctor degree majoring in surgery from Central South University in 2009. Now he is distinguished professor in college of laboratory medicine and life Sciences of Wenzhou Medical University. His research interest includes the molecular mechanism of the development of mitochondrial disease, the pathogenesis of metabolic disorders, molecular biomarkers for diagnosis of disease and microbial sensor.
23
Figure 1. Verification of the feasibility of MB-PP-based nanomachine for target gene detection. (A) Fluorescence emission spectra of samples: (a) MB-PP; (b) MB-PP + target; (c) MB-PP + primer + ligase + polymerase; (d) MB-PP + primer + target + ligase + polymerase; (e) MB-PP + primer + ligase + polymerase + nickase; (f) MB-PP + primer + target + ligase + polymerase + nickase. (B) Accurate evaluation of fluorescence response of different assay systems: (I) MB-PP; (II) MB-PP + primer + ligase + polymerase; (III) MB-PP + primer + ligase + polymerase + nickase. F and F0 indicate the fluorescence intensity at 518nm in the presence and absence of target DNA, respectively. All the samples were prepared according to the standard procedure in the experimental section. The used concentrations of MB-PP and primer are 300 nM, and target DNA is 25 nM.
24
Figure 2. Incubation time for target gene detection using MB-PP nanomachine. The corresponding signal-to-background ratio is calculated by F/F0, where F and F0 represent the fluorescence peak in the presence or absence of target DNA, respectively. The concentration of target DNA is 25 nM, and the error bars indicate the standard deviation (S.D.) of three independent measurements.
25
Figure 3. The dynamic relationship between fluorescence intensity and wild-type K-ras gene concentration. (A) Fluorescence emission spectra of MB-PP sensing system in the presence of target DNA at various concentrations. Inset: The fluorescence spectra in the low target concentration range from 0 to 0.5 nM. (B) The linear relationship between target concentration and fluorescence signal. F and C represent the fluorescence peak at 518 nm and target DNA concentration, respectively. The sqrt(C) in the formula means the square root of target concentration. The error bars indicate the standard deviation calculated from three parallel measurements for each concentration.
26
Figure 4. Detection specificity of the MB-PP nanomachine. The relative fluorescence intensity induced by wild target DNA (WT) and mutant target DNAs (MT), including MT1, MT2 and MT3 (A), in which the mismatched base is located at the 5'-end of the nick of MB-PP probe; MT4, MT5 and MT6 (B), in which the mismatched base is located at the 3'-end of the nick. Relative fluorescence intensity was estimated from the formula of (Fm-F0)/(Ft-F0) ×100%, where Fm, F0 and Ft represent the fluorescence peak values of MTs, blank and WT, respectively. The target concentration used is 25 nM and the standard deviation is calculated from three independent measurements.
27
Figure 5. The detection of K-ras gene in human serum. Compared to the blank, the relative fluorescence intensities induced by target DNA in the diluted 1% and 5% serum are 96.1% and 101.1%, respectively. The fluorescence intensity induced by target solution without serum is defined as 100%. The concentration of target K-ras gene involved was 25 nM, and the data are collected from three independent measurements.
28
Scheme 1. Illustration of the detection of K-ras gene based on ligation-mediated rolling-circle amplification (RCA) and cyclical strand-displacement amplification (C-SDA). Two experimental steps are involved: (a) Upon hybridization with wild K-ras gene, the linear MB-PP is placed in an intramolecular end-to-end fashion with a nick, and then the nick is sealed by Taq DNA Ligase, thus generating a cyclized MB-PP (CMB-PP); (b) in the presence of the primer and polymerase, RCA reaction is triggered. Subsequent reaction process is divided into five stages: the enzymatic product is cleaved into two nicked fragments by the Nt. BbvCI nicking endonuclease: ① the nicked fragment 1 and ④ nicked fragment 2; ③ nicked fragment 1 can hybridize with linear MB-PP and serve as polymerization primer, triggering C-SDA and producing a large amount of nicked fragment 2; ⑤ the nicked fragment 2 originating from ③ and ④ can unfold the hairpin structure of linear MB-PP, restoring the pre-quenched fluorescence. 29
Table 1 Oligonucleotide sequences designed in the current study.a Note
sequence (5´3´)
Molecular beacon-embedded padlock probe (MB-PP)
p-CCAGCTCCAACTACCGCTGAGGTACTGACt (DABCYL) GCGT AGCATTACGTAACAGCTACGCt (FAM) GCTGAGGCTCTTGCCTA CGCCA
Wild target DNA (WT) Mutant target DNA 1 (MT1) Mutant target DNA 2 (MT2) Mutant target DNA 3 (MT3) Mutant target DNA 4 (MT4) Mutant target DNA 5 (MT5) Mutant target DNA 6 (MT6)
TGTGGTAGTTGGAGCTGGTGGCGTAGGCAAGAGTGC TGTGGTAGTTGGAGCTGcTGGCGTAGGCAAGAGTGC TGTGGTAGTTGGAGCTGaTGGCGTAGGCAAGAGTGC TGTGGTAGTTGGAGCTGtTGGCGTAGGCAAGAGTGC TGTGGTAGTTGGAGCTGGaGGCGTAGGCAAGAGTGC TGTGGTAGTTGGAGCTGGcGGCGTAGGCAAGAGTGC TGTGGTAGTTGGAGCTGGgGGCGTAGGCAAGAGTGC
Primer
TTGTCAGTACC
Nicked fragment 1 (NF1) Nicked fragment 2 (NF2)
TCAGCGGTAGTTGGAGCTGGTGGCGTAGGCAAGAGCC TCAGCAGCGTAGCTGTTACGTAATGCTACGCAGTCAGTACC
a
For MB-PP, ‘p’ represents a phosphate group at 5´ end, DABCYL and FAM were
attached onto the corresponding lowercase ‘t’ bases, and its bold section can hybridize with the bold region of target DNA in an end-to-end fashion; the intramolecular hybridization of two italicized fragments generates a stem-loop structure in the middle of MB-PP. The fragment with gray background is the primer binding site, while the boxed areas are two nickase binding site. Mutant target DNAs have the identical sequence with the Wild target DNA, except a point mutation indicated by lowercase. Nicked fragments were commercially synthesized, which have the same sequence as the DNA fragments produced from MB-PP-based SDA involved during the signal amplification process.
30
S0925-4005(17)30881-X http://dx.doi.org/doi:10.1016/j.snb.2017.05.061 SNB 22345
To appear in:
Sensors and Actuators B
Received date: Revised date: Accepted date:
10-1-2017 8-5-2017 13-5-2017
Please cite this article as: Zheng-Yong Wang, Feng Li, Yan Zhang, Hui Zhao, Huo Xu, Zai-Sheng Wu, Jian-Xin Lyu, Zhi-Fa Shen, Sensitive detection of cancer gene based on a nicking-mediated RCA of circular DNA nanomachine, Sensors and Actuators B: Chemicalhttp://dx.doi.org/10.1016/j.snb.2017.05.061 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
Sensitive
detection
of
cancer
gene
based
on
a
nicking-mediated RCA of circular DNA nanomachine
Zheng-Yong Wang,a,1 Feng Li,a,b,1 Yan Zhang,a Hui Zhao,a,b Huo Xu,b Zai-Sheng Wu,*b Jian-Xin Lyu,*a, c and Zhi-Fa Shen*a
a
Key Laboratory of Laboratory Medicine, Ministry of Education of China, Zhejiang Provincial
Key Laboratory of Medicine Genetics, School of Laboratory Medicine and Life Sciences, Institute of Functional Nucleic Acids and Personalized Cancer Theranostics, Wenzhou Medical University, Wenzhou, 325035, China. b
Cancer Metastasis Alert and Prevention Center, Fujian Provincial Key Laboratory of Cancer
Metastasis Chemoprevention and Chemotherapy, Pharmaceutical Photocatalysis of State Key Laboratory of Photocatalysis on Energy and Environment, College of Chemistry, Fuzhou University, Fuzhou, 350002, China. c Department
of Laboratory Medicine, People's Hospital of Hangzhou Medical College. Hangzhou,
Zhejiang 310053, China
*Corresponding Author: Phone: 086-577-8668-9653. Email: [email protected] (Z.S. Wu), [email protected] (Z.F. Shen); [email protected] (J.X. Lyu)
1The
first two authors contributed equally to this work.
1
Highlights
A DNA nanomachine was developed by inserting molecular beacon into a padlock probe
RCA and SDA were integrated into a circular padlock-based DNA nanomachine
Two types of nicked fragments flow out from CMB-PP nanomachine and amplify signal
The newly-proposed strategy can detect cancer genes with high sensitivity and selectivity
Abstract We propose a DNA nanomachine (simplified as MB-PP) by inserting molecular beacon into a padlock probe for the sensitive and specific detection of K-ras gene mutation. In the presence of target DNA, MB-PP is able to be cyclized by ligase because its two ends are pulled together by target species. In this case, rolling circle amplification (RCA) occurs via the extension of primer by polymerase on cyclized MB-PP (CMB-PP), and thus two complete binding sites of nicking endonuclease are obtained due to the formation of RCA product/CMB-PP duplex. Naturally, a steady stream of two types of nicked fragments flow out from continuous rolling CMB-PP nanomachine after introduction of nickase, one of which can in turn triggers strand-displacement amplification (SDA), leading to the dramatic accumulation of nicked fragments. As a result, even in the presence of a trace amount of wild target DNA, the fluorescence intensity will substantially increase. Utilizing this DNA 2
machine, the K-ras gene can be detected down to 50 pM with the linear response range from 50 pM to 10 nM. Moreover, the point mutation existing in the codon 12 of K-ras can be easily distinguished from the wild type.
Keywords: molecular beacon-embedded padlock probe (MB-PP); K-ras gene; nicking-mediated
rolling
circle
amplification
(N-RCA);
strand-displacement
amplification (SDA).
1. Introduction Over the last decades, along with the completion of the draft human genome sequence and rapid development of systematic resequencing of cancer genomes, large numbers of cancer-related genes have been discovered. Many cancer-related genes are associated closely with the occurrence, invasion, metastasis and prognosis of cancer[1, 2]. In recent years, various nucleic acid testing methods have been proposed, among which DNA machine has attracted increasing attention in biosensing and clinical diagnosis research[3-5]. DNA machine design is often based on specific base-pairing and predictable assembly of DNA molecules. When binding to stimuli, DNA machine undergoes conformational changes that could automatically trigger signaling cascades[6, 7]. Compared with traditional nucleic acid testing technology, such as polymerase chain reaction (PCR) which needs expensive thermal cyclers[8, 9], DNA machine possesses some remarkable advantages, such as simple operation, automatic 3
detection and high specificity[10, 11]. Although some ingenious DNA machines have been already designed, their application in detecting actual samples remains great challenge due to poor sensitivity and/or specificity[12, 13]. So, developing new convenient and reliable DNA machine is still necessary and urgent. The members of the ras family (H-ras, K-ras and N-ras) are the most common genes associated with the initiation and progression of cancer. K-ras mutations have been frequently detected in colorectal cancer, lung carcinomas (mostly non-small-cell lung cancer (NSCLC) ) and pancreatic carcinomas[14, 15]. Among the mutation types of K-ras gene, mutations in codon 12 are the most common form[1, 16]. As mutations in codon 12 of K-ras gene often lead to drug-resistance and worse prognosis in clinical treatment[17, 18], it would be of great significance to develop highly sensitive and specific DNA machine for convenient and accurate mutation detection with potential applications in the personalized medicine and targeting therapy to tumors. In this contribution, a DNA nanomachine, molecular beacon-embedded padlock probe (MB-PP) was developed, which not only executes signal amplification of wild target DNA, but also accurately distinguishes point mutations in codon 12 of K-ras gene. By extending common MB from two ends, the MB-PP was designed to have a stem-loop structure (labeled with a fluorophore and a quencher group) and two arms to simultaneously hybridize with target DNA. Specifically, the two arms of the MB-PP become juxtaposed by hybridization with a wild target DNA, forming a nick site-contained sandwich structure. After the resulting nick is sealed by DNA ligase, a circular MB-PP (CMB-PP), namely circular DNA nanomachine, is obtained. Upon 4
addition of polymerization primer and polymerase, this molecular nanomahine can implement rolling circle amplification (RCA), producing a complementary single-stranded DNA product. Hybridization between polymerization product and CMB-PP causes the formation of DNA duplex containing two nicking sites at two different positions. In this case, the synergistic effect of nickase and polymerase can be achieved, leading to unique strand displacement amplification that occurs on a circular DNA template. Some displaced nicked polymerization products directly open the hairpin structure of MB region in CMB-PP responsible for the generation of fluorescence signal and the others initiate the classic stranded-displacement amplification on a linear DNA template. As a result, besides direct increase in the fluorescence signal, polymerization products
complementary to
MB were
dramatically accumulated, leading to a remarkably enhanced fluorescence signal. Utilizing the proposed DNA nanomachine, the target gene can be detected down to 0.05 nM, and the point mutations are specifically recognized. In the text, DNA probe design, working principle and characterization of DNA nanomachine is detailedly discussed. 2. Experimental section 2.1. Materials and chemicals All oligonucleotides are listed in Table 1 and Table S1, and they were obtained via commercial synthesis by Sangon Biological Engineering Technology & Services Co., Ltd., (Shanghai, China). These oligonucleotides were prepared with PAGE purification, except that the labeled MB-PP was purified using HPLC. DNA stock 5
solutions were prepared by dissolving in TE buffer (10 mM Tris, 1 mM EDTA, pH7.6) and stored at 4 °C refrigerator prior to use. The Klenow Fragment (3'→5' exo-) polymerase, Nt. BbvCI nicking endonuclease and Taq DNA Ligase were purchased from New England Biolabs (Beijing, China). The mixture of deoxynucleotide triphosphates (dNTPs) was supplied by Dingguo Changsheng Biotechnology Co., Ltd (Beijing, China). The healthy human serum used in the interference experiments was obtained from the first affiliated hospital of Wenzhou medical university in China. All other chemical reagents were of analytical grade and used without further purification. Ultrapure water obtained through a Milli-Q Direct water purification system (USA) (resistance > 18 MΩ. cm) was used to prepare all aqueous solutions throughout the experiments. Preferred position for Table 1 2.2. The detection of target K-ras gene A 1.5 μL droplet of 10 μM MB-PP, 1.5 μL of wild target DNA at certain concentration, 1 μL of 10×Taq DNA Ligase Reaction Buffer (200 mM Tris-HCl, 250 mM Potassium Acetate, 100 mM Magnesium Acetate, 10 mM NAD 1, 100 mM DTT, 1% Triton® X-100, pH 7.6) and 5.5 μL of ddH2O were added into an Eppendorf tube and annealed at 90 °C for 5 min, followed by incubation at 50 °C for 1 h. After addition of 0.5 μL of 40 U/μL Taq DNA Ligase, the resulting solution was incubated at 50 °C for another 1 h and then allowed to cool down to room temperature. Subsequently, for the RCA and nicking reaction, 31.5 μL of ddH2O, 1.5 μL of 10 μM primer solution, 1 μL of 10 mM dNTPs, 5 μL of 10×NEBuffer 2.1 (500 mM NaCl, 100 mM Tris-HCl, 100 6
mM MgCl2, 1 mg/ml BSA, pH 7.9), 0.5 μL of 5 U/μL Klenow Fragment (3'→5' exo-) polymerase and 0.5 μL of 10 U/μL Nt. BbvCI nicking endonuclease were injected, followed by incubation at 37 °C for 1 h. Finally, the enzymatic reaction was terminated by cooling on ice for 10 min[5]. Before collecting fluorescence spectrum, 150 μL of cold 1×NEBuffer 2.1 was added and thoroughly mixed. All the detection experiments were carried out according to the same procedure unless specified otherwise. The concentration of target DNA mentioned in the text was that in 50 μL reaction volume. 2.3. Fluorescence measurement. The fluorescence spectra were collected by a Hitachi F-7000 (Hitachi, Ltd., Japan) fluorescence spectrometer with xenon short-arc lamp controlled by FL Solution software. The instrument parameters were set as follows: excitation wavelength, 492 nm; emission spectrum was collected from 500 to 600 nm; scan speed, 240 nm/min; excitation slit, 5 nm; emission slit, 5 nm; PMT Voltage, 600 V; response time, 0.5 s. The fluorescence intensity at 518 nm was used to evaluate the assay capability of DNA nanomachine. 3. Results and discussion. 3.1. Design of DNA nanomachine Rolling circle amplification (RCA) and circular strand-displacement amplification (SDA) are two classical signal amplification strategies based on isothermal polymerization[19-21], and RCA is suitable for distinguishing single nucleotide polymorphisms (SNPs) and point mutation in target gene with high-fidelity DNA 7
ligase and padlock probe[22, 23]. However, conventional RCA has a limited amplification efficiency that has been proven insufficient for many applications[24]. Although a reverse primer improves the amplification efficiency to some extent, hyperbranched RCA method always brings about some nonspecific amplification artifacts. SDA is an easy controlled amplification strategy based on cyclical nucleic acid strand-displacement polymerization (CNDP) by introducing a recognition site of nickase, which is often adopted to develop sensitive biosensing system[7, 25]. In the current contribution, RCA and SDA were further improved by developing a circular padlock-based DNA nanomachine. To construct a unique DNA nanomachine, we proposed a molecular beacon-embedded padlock probe (MB-PP). Its sequence and functional fragments are described in Table 1. Essentially, the MB-PP is designed by extending a common molecular beacon from its two ends, which has a stem-loop structure labeled with a fluorophore and a quencher at different positions. Two 15 base fragments at the 5' end and 3' end of MB-PP can simultaneously hybridize with target gene in a head-to-tail fashion. Two recognition sites of nickase are located in the flanks of the stem-loop structure, while the binding region of polymerization primer is inserted between the stem-loop structure and the recognition site of nickase closed to 5' end. The operation principle of DNA nanomachine is illustrated in scheme 1. Due to the formation of hairpin structure, the chemically labeled fluorophore and quencher are brought into close proximity to each other, and no obvious fluorescence emission can be detected. In the presence of wild type K-ras gene, the 5' end and 3' end of 8
MB-PP are brought together, followed by cyclization by ligase using target gene as the template. When the primer is added, RCA occurs on cyclized MB-PP (CMB-PP), generating two complete nickase recognition site contained in double-stranded polymerization product/CMB-PP. In this case, Nt. BbvCI can bind and cleave the polymerization product. Because new polymerization can take place at the nick and displace
the
downstream
of
nicked
DNA
fragment,
polymerization/nicking/displacement repeatedly proceeds, producing two types of nicked fragments: nicked fragment 1 and nicked fragment 2. A description of image is that a steady stream of two different types of nicked fragments flow out from continuously rolling CMB-PP-based nanomachine. Apparently, RCA described is mediated by nicking reaction and thus called nicking-mediated rolling circle amplification (simplified as N-RCA). Meanwhile, from another perspective, SDA is designed to occur on a circular DNA template. Thus, this reaction stage, the first amplification, is also called circular strand-displacement amplification (abbreviated as C-SDA). Namely, essentially, N-RCA is C-SDA. Because nicked fragment 2 can directly hybridize with the stem-loop structure of MB-PP and restore the pre-quenched fluorescence of FAM, the fluorescence signal can be generated and substantially enhanced at the first amplification stage. At the second amplification stage, nicked fragment 1 can amplify the signal upon target DNA in a different manner. Specifically, nicked fragment 1 can hybridize with the 3' end of linear (L) MB-PP and serve as polymerization primer that is extended by polymerase on LMB-PP template. As a result, besides generation of higher 9
fluorescence signal by opening more hairpin structures of MB parts, the extended nicked fragment 1 is nicked again by Nt. BbvCI at two positions because of the formation of new nickase recognition sites in polymerization product/linear MB-PP duplex. This makes the polymerization, nicking and displacement alternatively occur on a linear MB-PP, achieving common SDA (called L-SDA, where “L” indicates the linear template) effect responsible for the second accumulation of nicked fragment 2. Clearly, nicked fragment 1 and nicked fragment 2 can amplify the fluorescence signal in closely related but different fashions. In contrast, in the absence of K-ras gene, the cyclization of MB-PP is incapable of accomplishing during ligation reaction. Thus, subsequent RCA and SDA could not be initiated and no detectable signal is observed. In the presence of mutant target DNA, CMB-PP almost is not generated because the existence of mismatched base pair makes the sealing of nick junction difficulty. Accordingly, the fluorescence signal induced by mutant target DNAs is lower than wild type gene. Preferred position for Scheme 1 3.2. Feasibility of DNA nanomachine for target gene detection To verify the feasibility of the proposed DNA nanomachine-based sensing system for the detection of target K-ras gene, several comparative experiments were carried out in the initial stage. As shown in Figure 1A, an extremely low fluorescence emission is detected at 518 nm for the MB-PP (line a). This should be attributed to the effect of FRET between fluorophore and quencher group that are brought into close proximity to each other by the stem of MB-PP. Wild target DNA hybridization cannot cause any 10
fluorescent increase (line b). It is reasonable if a fact is taken into account that, unlike the traditional MB, the stem-loop structure of the MB-PP is not opened by wild target DNA because the target gene hybridizes with the two arms of MB-PP rather than the loop section. The obvious difference between lines c and d indicates the fluorescence signal of ligase/polymerase-based sensing system upon target gene. In the presence of nickase in sensing system, although the background fluorescence slightly increases as shown in line e, a dramatic increment in fluorescence intensity can be induced by wild target DNA (line f), proving the capability of SDA to amplify the optical signal. Experiments a, b, c, d, e and f may be divided into three groups of sensing systems: system I (non-amplification system), system II (RCA-based amplification) and system III (proposed amplification system). The data used for more accurate evaluation of sensing capability are shown in Figure 1B, where signal-to-noise ratio (SNR) and the difference in fluorescence peak between target sample and blank are estimated from fluorescence spectra of Figure 1A. One can note that no any fluorescence increase is detected in sensing system I, moderate increase in fluorescence intensity is observed in system II and the highest fluorescence response is offered by system III. Preferred position for Figure 1 3.3. Optimization of polymerization/nicking time The temperature adopted for enzymatic reactions was basically consistent with that recommended by the supplier, while the incubation time for RCA and SDA was optimized to improve the detection capability of DNA nanomachine. As shown in Figure 2, the value of signal-to-background ratio increases with increasing enzymatic 11
time and then reaches the maximum value of more than 5.5 after 60 min. If the enzymatic amplification is prolonged, the response signal decreases rather than increases. This is because the longer incubation time makes the background fluorescence increase. Since the highest signal-to-background ratio is offered, the polymerization/nicking time of 60 min is chosen in subsequent experiments. Preferred position for Figure 2 3.4. Nicked fragments-medicated signal amplification In order to prove that two nicked fragments, nicked fragment 1 (NF1) and nicked fragment 2 (NF2), produced during the operation of DNA nanomachine play crucial roles in the signal amplification, identical nicked fragments synthesized commercially were used to induce the fluorescence signal instead of wild target DNA. The detection experiments were carried out under the identical conditions described in experimental section, except that one of nicked fragments was used instead of target DNA. As shown in Figure S1, line a exhibits very low fluorescence emission because the fluorophore and quencher were kept in close proximity by the hairpin structure of MB-PP. In the presence of NF2 (line b), the fluorescence intensity substantially increases, which is consistent with our expectation that NF2 can hybridize with the stem-loop region of MB-PP, making the fluorophore away from the quencher. The highest fluorescence signal is seen in line c, which is very reasonable because NF1 initiates the L-SDA in the presence of polymerase and nickase although NF1 cannot directly open the stem-loop structure of MB-PP. In this case, a large numbers of NF2 can be generated, and more MB-PPs are opened. These measured data demonstrate 12
that the two types of nicked fragments are essential for amplification detection of wild target DNA. In this section, it should be noted that the NF1 concentration involved is the same as NF2, permitting direct comparison of the recorded fluorescence responses. On the other hand, the concentration of two nicked fragments is much lower than MB-PP, so that the L-SDA-induced signal amplification upon NF1 is easily detected. 3.5. Capability of MB-PP-based nanomachine to sense K-ras target Sensitivity is a crucial property of biosensing system because highly sensitive detection is necessary for various practical applications, especially in early-stage diagnosis of cancer. To evaluate the sensing capacity of MB-PP-based DNA nanomachine, we carried out a series of detection experiments at different concentrations of wild target DNA ranging from 0 to 25 nM, and the collected fluorescence spectra are presented in Figure 3. As depicted in Figure 3A, a monotonic increase in the fluorescence intensity is observed when increasing the wild target DNA concentration, and no obvious fluorescence change is detected when the wild target DNA concentration is more than 25 nM. The Inset displays the fluorescence spectra of sensing system in the low concentration range of wild target DNA from 0 to 0.5 nM. The wild target DNA at 0.05 nM could induce a detectable fluorescence increase compared with the blank. Thus, 0.05 nM is defined as the detection limit. The linear relationship between wild target DNA concentration and the fluorescence peak is depicted in Figure 3B. With the wild target DNA concentration increase, the fluorescence intensity rapidly increases, and then tends to stabilize at 25 nM. The 13
linear regression equation is F=88.74+146.74sqrt(C) with a correction coefficient of 0.9887 (R2), where the F and C indicate the fluorescence intensity and wild target DNA concentration, respectively. Moreover, the average relative standard deviation estimated from all datum points is below 5.0%, indicating a desirable reproducibility of the gene detection. Preferred position for Figure 3 3.6. Specificity of DNA nanomachine toward target gene Mutation in codon 12 is the most common type of K-ras gene mutation, which is associated with the prognosis of colorectal and lung cancers[26]. This point mutation was chosen as the model mutation to evaluate the assay specificity. Mutant target DNA 1, mutant target DNA 2 and mutant target DNA 3 have the similar base sequence to wild target DNA, except the second base of codon 12 was substituted by C, A and T, respectively. Under identical experimental conditions, the fluorescence response induced by the three mutant target DNAs and wild target DNA was detected. As shown in Figure 4A, when the fluorescence response induced by wild target DNA is defined as 100%, the relative fluorescence intensity upon MT1, MT2 and MT3 are 66%, 70% and 53%, respectively. These data indicate that this proposed DNA nanomachine can exactly distinguish the point mutation in target gene of interest. However, the specificity of our proposed detection system was less-than-brilliant compared with some published works that the padlock probe was involved [23, 27]. According to literature reports [13, 28], Taq DNA Ligase exhibits significantly greater discrimination against single base mismatches on the 3’-side of the nick in 14
comparison with those on the 5’-side of the nick. To improve the detection specificity, three imaginary target DNAs were synthesized to have the base mismatch each at the 3’ end of MB-PP probe. Under the identical conditions, the detection experiments were performed, and the results are described in Figure 4B. One can see that the relative fluorescence intensities induced by MT4, MT5 and MT6 are 5%, 36% and 12%, respectively, demonstrating the significantly improved specificity. Preferred position for Figure 4 3.7. The detection of p53 gene Many cancers usually are polygenic diseases, suggesting that variant risk alleles are responsible for the complex diseases[29], and thus one mutated gene detection is not enough to take conclusion. Another molecular beacon-embedded padlock probe (MB-PP-p53) was designed for the detection of p53 gene according to the same strategy. The p53 gene is closely related to the occurrence of cancer. The information on probe sequences is listed in Table S1. The feasibility is shown in Figure S2. As expected, the proposed MB-PP-p53-based sensing system can efficiently amplify the target p53 gene with satisfactory SNR (signal-to-noise ratio). At the same time, the assay specificity is desirable as shown in Figure S3. The relative fluorescence intensities corresponding to MT1-p53, MT2-p53 and MT3-p53 are 15.4%, 4.7% and 2.3% respectively. For genetic studies or molecular diagnosis, the sequencing method provides reliable large-scale DNA sequencing but has the disadvantages of sample-hungry, high operational cost and a long turnaround time depending on the size and 15
complexity of the gene [30-32]. As a potential alternative, the proposed sensing system can be used to detect cancer genes in an isothermal fashion, which greatly favours the point-of-care diagnosis. However, the intrinsic drawback of this new method is that one type of MB-PP probe can only be used to detect a specific disease-related gene. In future, the isothermal amplification might have a promising application for low-resource setting area or for some common disease screening. 3.8. Interference Study To confirm potential practical application of the MB-PP-based nanomachine for the target gene detection, the comparative experiments were conducted in the healthy human serum, which contains a variety of enzymes and other complex interference. Target DNA-contained sample serum (1% or 5%, v/v) sample was prepared, and the detection experiments were conducted according to the standard procedure. As shown in Figure 5 (K-ras gene) and Figure S4 (p53 gene), comparing with the sample without human serum, 1% or 5% diluted human serum does not cause an obvious change in the fluorescence intensity, demonstrating that the newly-proposed sensing strategy is effectively impervious to the complex media. Preferred position for Figure 5
Conclusion In the present study, a circular DNA nanomachine has been developed via designing a MB-embedded padlock probe (MB-PP), which can be used to sensitively detect the cancer-related genes (K-ras gene and p53 gene) and to specifically distinguish the 16
point mutation in target DNAs. Via introducing two nickase binding sites into padlock probe, the powerful RCA and SDA can be easily integrated into a sensing system, achieving double amplification effect: N-RCA (C-SDA) and L-SDA. As far as we know, N-RCA and C-SDA are two completely new concepts directed toward the signal amplification, and there has been no report on similar sensing systems. The full name of N-RCA is nicking-mediated rolling circle amplification, while C-SDA is circular strand-displacement amplification indicating the SDA occurs on a circular DNA template. As its name implies, circular DNA nanomachine has several unique features different from the previous RCA and SDA strategies: (1) no long ssDNA products composed of thousands of tandemly repeated DNA-sequence units even if RCA is involved. This is because the single stranded polymerization product can be nicked before being displaced since the nickase binding sites are introduced to padlock probe; (2) the optimum use of nicked fragments. Because the C-SDA involved in the first amplification stage occurs on a circular DNA template, both the upstream and downstream of the nick can be extended by polymerase; (3) synergistic effect of N-RCA (or C-SDA) and L-SDA. Except the primer, only one MB-PP is involved in DNA nanomachine-based sensing system, and two closely related polymerization products are generated from different amplification processes. Thus, RCA and SDA should be able to promote each other. Additionally, there are other advantages, such as simple design, easy operation, isothermal reaction, homogeneous detection and satisfactory sensing performance. This circular DNA nanomachine offers an insight into the design of efficient signal transduction platforms to rapidly, 17
sensitively and specifically detect point mutations in target gene and holds the potential application in early clinical diagnosis and personalized medicine. Acknowledgments This work was supported by National Natural Science Foundation of China (NSFC) (grant NO: 21275002), Zhejiang Province Natural Science Foundation of China (LY16C07002) and Independent Research Project of State Key Laboratory of Photocatalysis on Energy and Environment (NO. 2014CO1).
18
References
[1] Y. Pylayeva-Gupta, E. Grabocka, D. Bar-Sagi, RAS oncogenes: weaving a tumorigenic web, Nature Reviews Cancer, 11(2011) 761-74. [2] C. Whibley, P.D. Pharoah, M. Hollstein, p53 polymorphisms: cancer implications, Nature reviews Cancer, 9(2009) 95-107. [3] Y. Weizmann, M.K. Beissenhirtz, Z. Cheglakov, R. Nowarski, M. Kotler, I. Willner, A virus spotlighted by an autonomous DNA machine, Angew Chem Int Ed Engl, 45(2006) 7384-8. [4] Y. Wen, Y. Xu, X. Mao, Y. Wei, H. Song, N. Chen, et al., DNAzyme-based rolling-circle amplification DNA machine for ultrasensitive analysis of microRNA in Drosophila larva, Anal Chem, 84(2012) 7664-9. [5] J. Xu, Z.S. Wu, W. Shen, H. Xu, H. Li, L. Jia, Cascade DNA nanomachine and exponential amplification biosensing, Biosensors & bioelectronics, 73(2015) 19-25. [6] R. Fu, T. Li, S.S. Lee, H.G. Park, DNAzyme molecular beacon probes for target-induced signal-amplifying colorimetric detection of nucleic acids, Anal Chem, 83(2011) 494-500. [7] S.J. Xie, H. Zhou, D. Liu, G.L. Shen, R. Yu, Z.S. Wu, In situ amplification signaling-based autonomous aptameric machine for the sensitive fluorescence detection of cocaine, Biosensors & bioelectronics, 44(2013) 95-100. [8] H. Zaaijer, H. Cuypers, H. Reesink, I. Winkel, P. Lelie, G. Gerken, Reliability of polymerase chain reaction for detection of hepatitis C virus, The Lancet, 341(1993) 722-4. [9] B.J. Hindson, K.D. Ness, D.A. Masquelier, P. Belgrader, N.J. Heredia, A.J. Makarewicz, et al., High-throughput droplet digital PCR system for absolute quantitation of DNA copy number, Analytical chemistry, 83(2011) 8604-10. [10] J. Xu, H. Dong, W. Shen, S. He, H. Li, Y. Lu, et al., New molecular beacon for p53 gene point mutation and significant potential in serving as the polymerization primer, Biosens Bioelectron, 66(2015) 504-11. [11] Q. Zhang, F. Chen, F. Xu, Y. Zhao, C. Fan, Target-triggered three-way junction structure and polymerase/nicking enzyme synergetic isothermal quadratic DNA machine for highly specific, one-step, and rapid microRNA detection at attomolar level, Analytical chemistry, 86(2014) 8098-105. [12] F. Dahl, J. Banér, M. Gullberg, M. Mendel-Hartvig, U. Landegren, M. Nilsson, Circle-to-circle amplification for precise and sensitive DNA analysis, Proceedings of the National Academy of Sciences of the United States of America, 101(2004) 4548-53. [13] A.F. Faruqi, S. Hosono, M.D. Driscoll, F.B. Dean, O. Alsmadi, R. Bandaru, et al., High-throughput genotyping of single nucleotide polymorphisms with rolling circle amplification, BMC genomics, 2(2001) 4. [14] H. Kiaris, D.A. Spandidos, Mutations of ras genes in human tumours (Review), International journal of oncology, 7(1995) 413-22. [15] D. Li, K. Xie, R. Wolff, J.L. Abbruzzese, Pancreatic cancer, The Lancet, 363(2004) 1049-57. [16] J.L. Bos, Ras oncogenes in human cancer: a review, Cancer research, 49(1989) 4682-9. [17] F. Di Fiore, F. Blanchard, F. Charbonnier, F. Le Pessot, A. Lamy, M.P. Galais, et al., Clinical relevance of KRAS mutation detection in metastatic colorectal cancer treated by Cetuximab plus chemotherapy, British journal of cancer, 96(2007) 1166-9. [18] C.S. Karapetis, S. Khambata-Ford, D.J. Jonker, C.J. O'Callaghan, D. Tu, N.C. Tebbutt, et al., K-ras 19
mutations and benefit from cetuximab in advanced colorectal cancer, The New England journal of medicine, 359(2008) 1757-65. [19] J.G. Paez, M. Lin, R. Beroukhim, J.C. Lee, X. Zhao, D.J. Richter, et al., Genome coverage and sequence fidelity of phi29 polymerase-based multiple strand displacement whole genome amplification, Nucleic Acids Res, 32(2004) e71. [20] Q. Guo, X. Yang, K. Wang, W. Tan, W. Li, H. Tang, et al., Sensitive fluorescence detection of nucleic acids based on isothermal circular strand-displacement polymerization reaction, Nucleic Acids Res, 37(2009) e20. [21] Z. Lin, W. Yang, G. Zhang, Q. Liu, B. Qiu, Z. Cai, et al., An ultrasensitive colorimeter assay strategy for p53 mutation assisted by nicking endonuclease signal amplification, Chem Commun (Camb), 47(2011) 9069-71. [22] J. Pickering, A. Bamford, V. Godbole, J. Briggs, G. Scozzafava, P. Roe, et al., Integration of DNA ligation and rolling circle amplification for the homogeneous, end-point detection of single nucleotide polymorphisms, Nucleic acids research, 30(2002) e60-e. [23] J. Li, T. Deng, X. Chu, R. Yang, J. Jiang, G. Shen, et al., Rolling circle amplification combined with gold nanoparticle aggregates for highly sensitive identification of single-nucleotide polymorphisms, Anal Chem, 82(2010) 2811-6. [24] X. Zhu, C. Feng, B. Zhang, H. Tong, T. Gao, G. Li, A netlike rolling circle nucleic acid amplification technique, Analyst, 140(2015) 74-8. [25] F. Wang, J. Elbaz, R. Orbach, N. Magen, I. Willner, Amplified Analysis of DNA by the Autonomous Assembly of Polymers Consisting of DNAzyme Wires, Journal of the American Chemical Society, 133(2011) 17149-51. [26] T. Takayama, K. Miyanishi, T. Hayashi, Y. Sato, Y. Niitsu, Colorectal cancer: genetics of development and metastasis, Journal of gastroenterology, 41(2006) 185-92. [27] S. Zhang, Z. Wu, G. Shen, R. Yu, A label-free strategy for SNP detection with high fidelity and sensitivity based on ligation-rolling circle amplification and intercalating of methylene blue, Biosensors & bioelectronics, 24(2009) 3201-7. [28] J. Luo, D.E. Bergstrom, F. Barany, Improving the fidelity of Thermus thermophilus DNA ligase, Nucleic Acids Res, 24(1996) 3071-8. [29] P. Kraft, D.J. Hunter, Genetic risk prediction--are we there yet?, New Engl J Med, 360(2009) 1701-3. [30] W. Zhang, H. Cui, L.J.C. Wong, Application of Next Generation Sequencing to Molecular Diagnosis of Inherited Diseases: Springer Berlin Heidelberg; 2012. [31] R. Nielsen, J.S. Paul, A. Albrechtsen, Y.S. Song, Genotype and SNP calling from next-generation sequencing data, Nature Reviews Genetics, 12(2011) 443-51. [32] M. Baker, MicroRNA profiling: separating signal from noise, Nat Methods, 7(2010) 687.
20
Zheng-Yong Wang earned bachelor of medicine from Mudanjiang Medical University in 2014. Now he is a master degree candidate majoring in Clinical Laboratory Diagnostics in Wenzhou Medical University. His current field of interest includes DNA based biosensor and detection of cancer related gene point mutation.
Feng Li obtained his master and bachelor degree majoring in biology from Wenzhou Medical University and Dalian University in 2016 and 2013 respectively. Now he is a research assistant in college of chemistry of Fuzhou University. His research interests include biosensor and nanomaterial.
Yan Zhang obtained his bachelor degree from Huazhong University of Science and Technology in 2014. Now he is a master degree candidate majoring in biology in Wenzhou medical University. His current field of interest is biosensor and DNA nanomachine.
Hui Zhao received her bachelor of medicine from Taishan Medical University in 2014. Now she is a master degree candidate majoring in Clinical Laboratory Laboratory Diagnostics in Wenzhou Medical University. her current field of interest includes DNA based biosensor and nanomaterial.
Huo Xu received the B. Sc. Degree from the college of chemistry and chemical engineering, Fuzhou University in 2013. He is currently a Doctor Degree student of 21
pharmaceutical analysis in cancer metastasis alert and prevention institute, Fuzhou University. He has 4 publications in SCI journals and 3 abstracts in national and international meetings. His research interest includes chemical sensor and biosensor, diagnosis and treatment of malignant tumor and functional nucleic acids.
Zai-Sheng Wu received the degree of Doctor of Science in Analytical Chemistry from Hunan University in 2008. During 2010-2014, he was a post-doctoral fellow of Faculty of Health Sciences in McMaster University. Now he is a distinguished professor in College of Chemistry of Fuzhou University supported by the Recruitment Program of Global Experts for Young Professionals and Minjiang Scholars program of Fujian Province. His research focuses on nucleic acid nanostructrues, functional nucleic acids, chemical and bio-sensing, pharmaceutical analysis, diagnosis and treatment of malignant tumor. He has published over 70 scientific papers. He was a lead guest editor in Journal of Analytical Methods in Chemistry and Journal of Nucleic Acids.
ZhiFa Shen received Ph.D. in Biochemistry at University of Montreal under the supervision of Dr. Pascal Chartrand in 2010. He then did his postdoctoral research with Dr. Shyam Sharan at NCI/NIH, USA. In 2011, he had his second PDF in McMaster University under the supervision of Dr. Yingfu Li. Currently he is a professor in the School of laboratory medicine and life sciences, Wenzhou Medical University. His research focuses on functional nucleic acid research, molecular 22
mechanism on liver cancer metastasis and its target treatment.
Jian-Xin Lyu received doctor degree majoring in surgery from Central South University in 2009. Now he is distinguished professor in college of laboratory medicine and life Sciences of Wenzhou Medical University. His research interest includes the molecular mechanism of the development of mitochondrial disease, the pathogenesis of metabolic disorders, molecular biomarkers for diagnosis of disease and microbial sensor.
23
Figure 1. Verification of the feasibility of MB-PP-based nanomachine for target gene detection. (A) Fluorescence emission spectra of samples: (a) MB-PP; (b) MB-PP + target; (c) MB-PP + primer + ligase + polymerase; (d) MB-PP + primer + target + ligase + polymerase; (e) MB-PP + primer + ligase + polymerase + nickase; (f) MB-PP + primer + target + ligase + polymerase + nickase. (B) Accurate evaluation of fluorescence response of different assay systems: (I) MB-PP; (II) MB-PP + primer + ligase + polymerase; (III) MB-PP + primer + ligase + polymerase + nickase. F and F0 indicate the fluorescence intensity at 518nm in the presence and absence of target DNA, respectively. All the samples were prepared according to the standard procedure in the experimental section. The used concentrations of MB-PP and primer are 300 nM, and target DNA is 25 nM.
24
Figure 2. Incubation time for target gene detection using MB-PP nanomachine. The corresponding signal-to-background ratio is calculated by F/F0, where F and F0 represent the fluorescence peak in the presence or absence of target DNA, respectively. The concentration of target DNA is 25 nM, and the error bars indicate the standard deviation (S.D.) of three independent measurements.
25
Figure 3. The dynamic relationship between fluorescence intensity and wild-type K-ras gene concentration. (A) Fluorescence emission spectra of MB-PP sensing system in the presence of target DNA at various concentrations. Inset: The fluorescence spectra in the low target concentration range from 0 to 0.5 nM. (B) The linear relationship between target concentration and fluorescence signal. F and C represent the fluorescence peak at 518 nm and target DNA concentration, respectively. The sqrt(C) in the formula means the square root of target concentration. The error bars indicate the standard deviation calculated from three parallel measurements for each concentration.
26
Figure 4. Detection specificity of the MB-PP nanomachine. The relative fluorescence intensity induced by wild target DNA (WT) and mutant target DNAs (MT), including MT1, MT2 and MT3 (A), in which the mismatched base is located at the 5'-end of the nick of MB-PP probe; MT4, MT5 and MT6 (B), in which the mismatched base is located at the 3'-end of the nick. Relative fluorescence intensity was estimated from the formula of (Fm-F0)/(Ft-F0) ×100%, where Fm, F0 and Ft represent the fluorescence peak values of MTs, blank and WT, respectively. The target concentration used is 25 nM and the standard deviation is calculated from three independent measurements.
27
Figure 5. The detection of K-ras gene in human serum. Compared to the blank, the relative fluorescence intensities induced by target DNA in the diluted 1% and 5% serum are 96.1% and 101.1%, respectively. The fluorescence intensity induced by target solution without serum is defined as 100%. The concentration of target K-ras gene involved was 25 nM, and the data are collected from three independent measurements.
28
Scheme 1. Illustration of the detection of K-ras gene based on ligation-mediated rolling-circle amplification (RCA) and cyclical strand-displacement amplification (C-SDA). Two experimental steps are involved: (a) Upon hybridization with wild K-ras gene, the linear MB-PP is placed in an intramolecular end-to-end fashion with a nick, and then the nick is sealed by Taq DNA Ligase, thus generating a cyclized MB-PP (CMB-PP); (b) in the presence of the primer and polymerase, RCA reaction is triggered. Subsequent reaction process is divided into five stages: the enzymatic product is cleaved into two nicked fragments by the Nt. BbvCI nicking endonuclease: ① the nicked fragment 1 and ④ nicked fragment 2; ③ nicked fragment 1 can hybridize with linear MB-PP and serve as polymerization primer, triggering C-SDA and producing a large amount of nicked fragment 2; ⑤ the nicked fragment 2 originating from ③ and ④ can unfold the hairpin structure of linear MB-PP, restoring the pre-quenched fluorescence. 29
Table 1 Oligonucleotide sequences designed in the current study.a Note
sequence (5´3´)
Molecular beacon-embedded padlock probe (MB-PP)
p-CCAGCTCCAACTACCGCTGAGGTACTGACt (DABCYL) GCGT AGCATTACGTAACAGCTACGCt (FAM) GCTGAGGCTCTTGCCTA CGCCA
Wild target DNA (WT) Mutant target DNA 1 (MT1) Mutant target DNA 2 (MT2) Mutant target DNA 3 (MT3) Mutant target DNA 4 (MT4) Mutant target DNA 5 (MT5) Mutant target DNA 6 (MT6)
TGTGGTAGTTGGAGCTGGTGGCGTAGGCAAGAGTGC TGTGGTAGTTGGAGCTGcTGGCGTAGGCAAGAGTGC TGTGGTAGTTGGAGCTGaTGGCGTAGGCAAGAGTGC TGTGGTAGTTGGAGCTGtTGGCGTAGGCAAGAGTGC TGTGGTAGTTGGAGCTGGaGGCGTAGGCAAGAGTGC TGTGGTAGTTGGAGCTGGcGGCGTAGGCAAGAGTGC TGTGGTAGTTGGAGCTGGgGGCGTAGGCAAGAGTGC
Primer
TTGTCAGTACC
Nicked fragment 1 (NF1) Nicked fragment 2 (NF2)
TCAGCGGTAGTTGGAGCTGGTGGCGTAGGCAAGAGCC TCAGCAGCGTAGCTGTTACGTAATGCTACGCAGTCAGTACC
a
For MB-PP, ‘p’ represents a phosphate group at 5´ end, DABCYL and FAM were
attached onto the corresponding lowercase ‘t’ bases, and its bold section can hybridize with the bold region of target DNA in an end-to-end fashion; the intramolecular hybridization of two italicized fragments generates a stem-loop structure in the middle of MB-PP. The fragment with gray background is the primer binding site, while the boxed areas are two nickase binding site. Mutant target DNAs have the identical sequence with the Wild target DNA, except a point mutation indicated by lowercase. Nicked fragments were commercially synthesized, which have the same sequence as the DNA fragments produced from MB-PP-based SDA involved during the signal amplification process.
30