The effects of Aeromonas hydrophila infection on oxidative stress, nonspecific immunity, autophagy, and apoptosis in the common carp

Developmental and Comparative Immunology 105 (2020) 103587

Contents lists available at ScienceDirect

Developmental and Comparative Immunology journal homepage: www.elsevier.com/locate/devcompimm

The effects of Aeromonas hydrophila infection on oxidative stress, nonspecific immunity, autophagy, and apoptosis in the common carp

T

Jianjun Chena, Nana Liua, Huajie Zhanga, Yidi Zhaoa, Xianglin Caob,∗ a b

College of Life Science, Henan Normal University, Xinxiang, 453007, People's Republic of China College of Fisheries, Henan Normal University, Xinxiang, 453007, People's Republic of China

A B S T R A C T

Although the toxicity of Aeromonas hydrophila infection to common carp has been characterized, the mechanisms underlying this toxicity have not been fully explored. The present study assessed the effects of A. hydrophila infection on oxidative stress, nonspecific immunity, autophagy, and apoptosis in the common carp (Cyprinus carpio). We measured the effects of 7.55 × 105 CFU/mL and 4.87 × 107 CFU/mL A. hydrophila on carp after 1, 3, 5, and 7 d of infection. GSH and SOD activity levels in the serum, liver, intestine, and gills generally increased during the early stage of infection, but significantly decreased (P < 0.05) on the seventh day. In addition, MDA levels were significantly increased throughout the infection period. The activity levels of ACP, AKP, and LZM in the liver and intestine increased on the first day after infection, then decreased on the fifth and seventh days. The mRNA expressions levels of the autophagy-associated genes atg12, atg5, LC3-II, and BECN1 in the liver, kidney, and brain substantially increased on the third day after infection (P < 0.05), while mTOR was significantly downregulated on the first and third days (P < 0.05). Western blot analysis indicated that the ratio of LC3B-ǁ/LC3B-ǀ significantly increased (P < 0.05) on days 3 and 5 post infection. Furthermore, the apoptosis-related gene Bcl-2 was significantly (P < 0.05) upregulated in the liver, kidney, and brain of the treatment group on the first and third days, while caspase3 was significantly downregulated (P < 0.05). In conclusion, our results demonstrate that A. hydrophila infection causes oxidative stress, stimulates nonspecific immune reactions, and results in autophagy in the common carp, possibly initiating apoptosis in the late stage of infection. The results of this study provide new insights into the mechanism of A. hydrophila infection in carp.

1. Introduction The common carp (Cyprinus carpio) is one of the most important cyprinid species, accounting for 10% of freshwater aquaculture production worldwide (Xu et al., 2014). However, extensive aquaculture practices subject fish to environmental stress, increasing the susceptibility these to various pathogens (Giri et al., 2015). One of the most common bacterial pathogens in freshwater aquaculture is Aeromonas spp., which severely reduce carp production (Wang et al., 2015). Aeromonas species are gram-negative, facultative anaerobes that are ubiquitous in natural ecosystems (e.g., freshwater rivers and coastal areas), as well as in tap water (Yang et al., 2019). These species are conditional pathogens and may cause human-fish-beast co-infections (Nielsen et al., 2001). In particular, A. hydrophila is one of the main pathogens causing fulminant infectious diseases in aquaculture species, including freshwater species. With the exception of chronic infections, which are characterized by acute or subacute infection, A. hydrophila infections are characterized by sepsis, with systemic hemorrhage as the main feature. The rates of A. hydrophila infection and mortality are extremely high, leading to substantial economic losses for the aquaculture industry and severely restricting the healthy development of the

various fisheries (Zhang et al., 2018). In fish, A. hydrophila infections may increase the intracellular generation of reactive oxygen species (ROS) and free radicals and/or may alter antioxidant defense mechanisms, causing oxidative stress and potentially leading to the oxidative damage of cellular macromolecules (Monserrat et al., 2007). Similar to other vertebrates, fish attempt to minimize oxidative damage via the antioxidant defense system (Geng et al., 2019). Therefore, antioxidant enzyme activity levels reflect the antioxidant status of an organism and thus may be utilized as a biomarker of oxidative stress (Fridovich, 1995). Apoptosis, also known as programmed cell death, plays a critical role in tissue development and maintenance of homeostasis in multicellular organisms (Rathmell and Thompson, 2002). Apoptosis occurs as two distinct pathways, namely, caspase-dependent and -independent. Caspases are members of a family of cysteine proteases that normally exist in the latent or pro-caspase form. Apoptosis is also involved in the interaction between host cells and bacterial pathogens as a number of bacterial pathogens appear to be capable of manipulating host cell apoptotic pathways (Chaitali et al., 2012). It has been suggested that apoptosis helps the host to combat pathogens without eliciting inflammatory reactions (Grassme et al., 2001). It has been

∗

Corresponding author. E-mail addresses: [email protected] (J. Chen), [email protected] (N. Liu), [email protected] (H. Zhang), [email protected] (Y. Zhao), [email protected] (X. Cao). https://doi.org/10.1016/j.dci.2019.103587 Received 5 September 2019; Received in revised form 18 December 2019; Accepted 18 December 2019 Available online 23 December 2019 0145-305X/ © 2019 Elsevier Ltd. All rights reserved.

Developmental and Comparative Immunology 105 (2020) 103587

J. Chen, et al.

reported that A. hydrophila induces apoptosis in fish as well as in mammalian cells but the exact mechanisms are not very clear. Autophagy is an evolutionarily conserved pathway that eliminates redundant or damaged organelles, long-lived proteins, and other cellular components. In eukaryotic cells, this pathway operates in addition to another major cellular degradation process, the ubiquitin proteasomal system (Qin et al., 2016). There is increasing evidence that autophagy can be stimulated in response to nutrient deprivation, oxidative stress, DNA damage, damaged organelles, or intracellular pathogens (Chen et al., 2015). To date, more than 30 autophagy-related (atg) genes have been identified as required for autophagy and related pathways (Mizushima, 2010). During autophagosome formation, microtubule-associated protein light chain 3 (LC3) is lipidated; this LC3phospholipid conjugate (LC3-II) is localized on autophagosomes and autolysosomes (Tanida et al., 2005). Consequently, the abundance of LC3B-II, or the ratio of LC3B-II abundance to LC3B–I abundance, is generally considered an indicator of autophagy (Klionsky et al., 2008). Autophagy plays an essential role in differentiation and development, as well as in the cellular response to stress (Mizushima et al., 2008). However, little is known about the effects of A. hydrophila on autophagy in the common carp. The present study conducted enzyme activity assays, quantitative real-time polymerase chain reactions (qRT-PCRs), and western blotting (WB) to explore the hepatotoxicity mechanisms induced by A. hydrophila in the common carp. Oxidative stress, autophagy, and apoptosis were investigated. The results of this study will provide a better understanding of the risks posed by A. hydrophila to the common carp.

2.3. Experimental design 2.3.1. Acute toxicity test Fish were randomly divided into six groups (30 fish/group). The control group was injected with normal saline solution (0.86%). The treatment groups were injected with suspensions of A. hydrophila (4.61 × 106, 1.84 × 107, 7.37 × 107, 2.95 × 108, and 1.18 × 109 CFU/mL). The acute challenge was performed by intraperitoneally injecting each fish with 0.8 mL of solution. Each treatment was performed on three parallel replicates. Experiments were conducted in compliance with standard ethical guidelines. Mortality rates in each group over the subsequent 4 d were recorded. The semi-lethal concentration of the tested bacteria for carp was determined using the modified Köhler method: lgLC50 = Xm-I (Ʃp0.5), where m is the base-10 logarithm of the lethal concentration, i is the logarithmic difference between the total mortality of each pair of adjacent treatment groups, Xm is the logarithm of the maximum treatment concentration, n is the number of fish in each group, and p is the death rate (expressed as a decimal). The non-toxic concentration was calculated as Sc = LC50(48h) × 0.3/[LC50(24h)/LC50(48h)]2. 2.3.2. Challenge treatment and sampling Healthy fish were divided into three groups (n = 3 tanks/group, 30 fish/tank). Each fish was intraperitoneally injected with 0.8 mL of solution: the control group was injected with normal saline solution (0.86%), while the treatment groups (C1 and C2) were injected with suspensions of A. hydrophila (7.55 × 105 CFU/mL and 4.87 × 107 CFU/ mL, respectively). Six fishes were randomly selected from the tank at each sampling. Cardiac blood samples, as well as samples of the liver, kidney, intestine, gill, spleen, brain, and other tissues, were collected at 1 d, 3 d, 5 d, and 7 d post-injection. The samples were stored at −80 °C until analysis. All experiments were performed in triplicate.

2. Materials and methods 2.1. Screening and identification A diseased fish was obtained from the aquatic product base of Henan Normal University (Xinxiang, Henan, China). The liver, kidney, spleen, intestine, gill, and other tissues were extracted from the fish, ground, diluted, and coated on an LB solid medium plate. The coated plate was inverted and placed in an incubator at 37 °C for 24 h. After incubation, colonies were selected for purification based on size, shape, and color. Some selected colonies were transferred to 30% glycerol and stored at −80 °C. Bacterial genomic DNA was extracted from the remaining selected colonies, amplified using universal bacterial primers, and sent to the company for sequencing. Sequencing results were searched against NCBI GenBank to identify homologous nucleotide sequences. A phylogenetic tree based on the identified sequences was constructed using MEGA 6.

2.4. Antioxidant capacity The activity levels of superoxide dismutase (SOD) and micro-reduced glutathione (GSH), as well as malonaldehyde (MDA) content were measured in the serum, liver, intestine, and gill samples from each fish using commercially available standard kits (Nanjing Jiancheng Bioengineering Co. Ltd., China), following the manufacturer's instructions as modified by Ma et al. (2014). 2.5. Determination of the non-specific immune indexes The activity levels of acid phosphatase (ACP), alkaline phosphatase (AKP), and lysozyme in the serum, liver, intestine, and gill samples from each fish were determined using commercially available standard kits (Nanjing Jiancheng Bioengineering Co. Ltd., China), following the manufacturer's instructions as modified by Ma et al. (2014).

2.2. Experimental fish The common carp used in this study (mean body length, 10.57 ± 1 cm; mean body weight, 90.68 ± 10 g) were purchased from the aquaculture base in Xingyang City, Henan Province, China. Carp were maintained in laboratory tanks filled with dechlorinated tap water (CaCO3: 230 mg/L, Ca: 42.5 ± 1.2 mg/L) under continuous aeration; tanks were kept at 20 ± 1 °C, with a dissolved oxygen concentration of > 7 mg/L, a pH of 7.4 ± 0.2, and a photoperiod of 16 h light and 8 h dark. Fish were fed commercial fish food once daily until apparent satiation. Carp were allowed to acclimate to laboratory conditions for 7 d. No mortalities were observed in the control group or in any of the treatment groups. The fish were handled according to the guidelines in the China Law for Animal Health Protection and Instructions for Granting Permits for Animal Experimentation for Scientific Purposes [Ethics Approval No. SCXK (YU) 2005–0001].

2.6. Gene expression analysis Total RNA was extracted from the carp tissues using NanoMag Animal and Fish RNA Isolation Kits (Shannuo Scientific Company, China). First-strand cDNA synthesis was conducted using Prime Script reverse transcriptase (Takara, Japan), following the manufacturer's instructions. Each quantitative real-time PCR (qPCR) was performed in a total volume of 10 μL, which contained 5 μL of SYBR Green supermix, 0.5 μL of the cDNA template, 4.1 μL of RNase/DNase-free water, and 0.2 μL of each primer. The qPCR cycling conditions were as follows: denaturation at 95 °C for 60 s; 45 cycles of 95 °C for 15 s, 60 °C for 60 s, and 95 °C for 10 s; 65 °C for 60 s; 97 °C for 1 s, and 37 °C for 30 s. Fluorescence quantifications were performed at higher temperatures than required for the denaturation of the primer dimers. Gene expression was analyzed using the 2-ΔΔCT method, and 40 S was used as reference. The primer sequences used in qPCR analysis are shown in 2

Developmental and Comparative Immunology 105 (2020) 103587

J. Chen, et al.

3.2. Determination of the semi-lethal and safe concentrations

Table 1 Primers used in qRT-PCR in the present studyAll primers are designed with Primer 5.0 software and synthesized by Shanghai Sangon Bioengineering Company. Gene

Oligonucleotide sequence (5′→3′)

Accession number

Product size, bp

40 S

CCGTGGGTGACATCGTTACA TCAGGACATTGAACCTCACTGTCT ATTGGCGTTTTGTTTGATCTT TTTGAGTGCATCCGCCTCTTT ACAGTACAGTCACTCGCTCA AAAACACTCGAAAAGCACACC ATCAGGTCGGAGAGTATCGT GTTTTGTCTAGTTTCCCCGT GGAACAGCATCCAAGCAAGA TCAGAAATGGCGGTGGACA TCTGTTTGATATCATGTCTGG TAATTCTGGCACTCATTTTCT TGCGGAGTATGTGGAGTT CATCTCTTTGGTCTCTCTCTGG ATGTGCGTGGAAAGCGTCAAC AAAGGCTCCGATGGTCACTCC TCGCAGGACAGGCATGAAC CACTAACGAAGCACAGCGG

XM_019078334

69

XM_019082404. 1 XM_019125508. 1 XM_019092629. 1 NM199604.1

141

XM_019068185. 1 XM_019108641. 1 KJ174686

102

XM_019110173. 1

159

ATG5 ATG12 ATG16L LC3-ǁ BECN1 mTOR Bcl-2 Caspase3

Over the 4 days following injection, mortalities in each group were recorded (Table 2A). The semi-lethal and non-toxic concentrations of A. hydrophila over different time periods in carp were calculated using the modified kohler method (Table 2B). 3.3. Antioxidant enzyme activity An obvious antioxidant response was observed in the serum samples of A. hydrophila-treated carp as compared with those of the controls (Fig. 2A). In the infected carp, GSH activity peaked on the first day postinfection, and SOD activity peaked on the third day. However, the activity levels of both of these enzymes decreased remarkably on the seventh day post-infection (P < 0.05), with activity levels in groups injected with higher bacterial concentrations generally lower than activity levels in groups injected with lower bacterial concentrations. In addition, MDA levels in the treatment groups were similar to those in the controls on the first day post-infection, but increased substantially with respect to the controls on the third, fifth, and seventh day postinfection (P < 0.05); MDA levels in the treatment groups peaked on the seventh day post-infection. The levels of GSH, SOD, and MDA in the liver of common carp are summarized in Fig. 2B. With prolongation of infection time, GSH and SOD were initially upregulated and subsequently downregulated in a dose-dependent manner. Levels of both enzymes peaked on the third day of infection, but decreased to the lowest point on the seventh day. In contrast to the previous two indicators, MDA content significantly increased compared to the control group as infection time increased. In addition, levels of MDA in the high concentration group were generally higher than those in the low concentration group (P < 0.05). GSH, SOD, and MDA levels in the carp intestine at 1, 3, 5, and 7 d post A. hydrophila infection largely differed from controls at all time points, with the exception of MDA at 1 d post infection and MDA, SOD, and GSH at 3 d post-infection (Fig. 3A). GSH and SOD activity levels in the group injected with 4.87 × 107 CFU/mL were markedly higher than those of the control group on the first day of infection (P < 0.05); the activity levels of these enzymes decreased significantly on the fifth and seventh days of infection (P < 0.05). MDA levels generally increased throughout the duration of the infection, and significantly differed between the control and treatment groups on the fifth and seventh days post infection (P < 0.05). Similarly, GSH and SOD activity levels fluctuated in the gills throughout the experiment (Fig. 3B). For example, the activity levels of both enzymes peaked on the third day of infection and were lowest on the seventh day. MDA content continuously increased throughout the infection and markedly differed from the control on the fifth and seventh day post infection (P < 0.05).

111 267 219

240 237

Table 1.

2.7. WB The livers were collected and lysed using RIPA lysis buffer, supplemented with complete EDTA-free protease inhibitor cocktail tablets. The total protein concentration in each liver lysate was determined using the Bradford protein assay (Bio-Rad). Protein samples were separated using 12% SDS-PAGE, and were electrophoretically transferred to 0.22-mm PVDF membranes using electroblotting (Bio-Rad). The PVDF membranes were blocked in PBST buffer (1 g Na2HPO4·12H20, 7.6 g NaCl, 0.36 g KH2PO4, and 100 μl Tween-20, pH 7.4) with 5% (w/ v) nonfat dry milk for 4 h at room temperature, and then incubated with the appropriate primary antibodies overnight at 4 °C. The antibodies used for the WBs were the anti-rabbit LC3B polyclonal antibody and the anti-GAPDH mAb antibody; both antibodies were diluted 1:500. After overnight incubation, membranes were incubated at room temperature for 1 h with 1:1000 dilutions of secondary antibodies [horseradish peroxidase (HRP)-conjugated goat anti-rabbit (for LC3B) or anti-mouse (for GAPDH)]. Finally, signals were detected using an ECL kit (Roche), following the manufacturer's instructions.

2.8. Statistical analyses

3.4. Non-specific immune enzyme activity

Data were expressed as mean ± standard deviation. Statistical analyses were performed with SPSS 13.0 (SPSS Inc.). All data were analyzed using one-way analyses of variance (ANOVAs) and post hoc pairwise comparisons among all groups were performed using Duncan's tests (p < 0.05).

To assess the degree of toxicity of A. hydrophila infection in carp, we measured the activity levels of ACP, AKP, and LZM. There were no significant differences in serum ACP activity levels between the A. hydrophila-treated fish and the controls, but serum AKP activity decreased significantly (P < 0.05) at 1 d post A. hydrophila infection (Fig. 4A). LZM activity in the 4.87 × 107 CFU/mL group increased substantially with respect to the control on day 3 post infection (P < 0.05), but significantly decreased with respect to the control on day 7 (P < 0.05). Liver ACP activity levels markedly changed in the 4.87 × 107 CFU/ mL group]compared to the control (Fig. 4B). For example, liver ACP activity levels significantly increased at 1 and 3 d post A. hydrophila infection (P < 0.05), but significantly decreased at 5 and 7 d (P < 0.05). Similarly, LZM activity increased at 1 and 3 d post infection, and decreased at 5 and 7 d post infection. Additionally, AKP activity peaked on the first day post infection in the high concentration

3. Results 3.1. Screening and homology analyses Based on the homologous nucleotide sequences identified in GenBank, the screened bacteria were identified as A. hydrophila and Pseudomonas putida. To determine the relationship of these sequences and those from other bacteria, we constructed a phylogenetic tree using MEGA 6 (Fig. 1, in which TZNEF represents A. hydrophila and TZNET represents P. putida). 3

Developmental and Comparative Immunology 105 (2020) 103587

J. Chen, et al.

Fig. 1. Phylogenetic reconstruction using the nucleotide sequence of the bacterium. Table 2 Mortality rate of six groups of fish were measured within four days (A) and semi-lethal concentrations at different times and safe concentrations (B). A

Physiological saline 4.61 × 106 1.84 × 107 7.37 × 107 2.95 × 108 1.18 × 109

12h

24h

48h

72h

96h

0 0 3 7 12 15

0 2 5 11 18 22

0 4 9 16 23 28

0 7 13 19 27 30

0 9 16 22 30 30

B LC50(CFU/mL)

SC(CFU/mL)

12h

24h

48h

72h

96h

4.3 × 108

1.58 × 108

5.94 × 107

2.86 × 107

8.21 × 106

2.51 × 105

Fig. 2. The activities of microreduced glutathione (GSH), superoxide dismutase (SOD), malondialdehyde (MDA) in serum (A) and liver (B) of common carp after 1 d, 3 d, 5 d, 7 d of A. hydrophila infection. The experiment was performed in triplicate, and the data are shown as the mean ± SD. Asterisks denote a response that is significantly different from the control (*p < 0.05, **p < 0.01). Pr = protein.

4

Developmental and Comparative Immunology 105 (2020) 103587

J. Chen, et al.

Fig. 3. The activities of microreduced glutathione (GSH), superoxide dismutase (SOD), malondialdehyde (MDA) in the intestines (A) and gills (B) of common carp after 1 d, 3 d, 5 d, and 7 d of A. hydrophila infection. The experiment was performed in triplicate, and the data are shown as the mean ± SD. Asterisks denote a response that is significantly different from the control (*p < 0.05, **p < 0.01). Pr = protein.

those of the control groups at 7 d post infection. In contrast, AKP activity levels initially increased (at 1 and 3 d post infection) and subsequently decreased (and 5 and 7 d post infection). Moreover, AKP activity levels in the 4.87 × 107 CFU/mL group were markedly lower than those of the control group at 7 d post infection.

group, and AKP activity levels significantly differed between the treatment group and the control at 5 and 7 d post infection (P < 0.05). Compared to the control, ACP, AKP, and LZM levels in the intestines of the treatment groups significantly increased at 1 d post A. hydrophila infection (P < 0.05). However, the activity levels of these enzymes significantly decreased at 5 and 7 days post infection (P < 0.05), except for the ACP levels in the 7.55 × 105 CFU/mL group on the fifth day of infection (Fig. 5A). There were no significant differences in the activity levels of ACP, AKP, and LZM between the A. hydrophila-treated groups and the control group at 3 d post infection. The activity levels of ACP and LZM in the fish gill were similar after infection (Fig. 5B). For example, the activity levels of these enzymes did not substantially differ between the control and treatment groups at 1 and 5 d post infection. However, ACP and LZM activity levels in the A. hydrophila-treated groups were generally higher than those of the control groups at 3 d post infection, and were substantially lower than

3.5. Gene expression 3.5.1. Effects on autophagy The effects of A. hydrophila on the mRNA expression of atg12, atg5, atg16L, BECN1, LC3-ǁ, and mTOR were assessed in the liver, kidney, and brain of the common carp (Figs. S1–S3). The expression levels of these autophagy-associated genes markedly changed in the A. hydrophila-treated carp livers as compared to the controls (Fig. S1). For example, atg12 was significantly upregulated in the 4.87 × 107 CFU/mL group at 1 d post infection and in all treatment groups at 3 d post

Fig. 4. The activity of acid phosphatase (ACP), alkaline phosphatase (AKP), lysozyme (LZM) in the serum (A) and liver (B) of common carp after 1 d, 3 d, 5 d, 7 d of A. hydrophila infection. The experiment was performed in triplicate, and the data are shown as the mean ± SD. Asterisks denote a response that is significantly different from the control (*p < 0.05, **p < 0.01). Pr = protein. 5

Developmental and Comparative Immunology 105 (2020) 103587

J. Chen, et al.

Fig. 5. The activity of acid phosphatase (ACP), alkaline phosphatase (AKP), lysozyme (LZM) in the intestines (A) and gills (B) of common carp after 1 d, 3 d, 5 d, 7 d of A. hydrophila infection. The experiment was performed in triplicate, and the data are shown as the mean ± SD. Asterisks denote a response that is significantly different from the control (*p < 0.05, **p < 0.01). Pr = protein.

3.6. WB of LC3B in the liver

infection (P < 0.05). Atg5 and atg16L were also significantly upregulated on the third day of infection in the 4.87 × 107 CFU/mL group and on the fifth day of infection in the 7.55 × 105 CFU/mL group (P < 0.05). In addition, LC3-ǁ was substantially upregulated on the third and fifth day post infection in the treatment and 7.55 × 105 CFU/ mL groups, respectively (P < 0.05). BECN1 was strongly upregulated in the high-concentration group compared with the control group (P < 0.05), while mTOR was significantly downregulated in the A. hydrophila-treated groups with respect to the controls during the early stages of infection (days 1 and 3 post infection; P < 0.05). Compared to the control, atg12, atg5, atg16L, LC3-ǁ, and BECN1 were generally upregulated in the kidneys of the treatment groups after 1 and 3 d of A. hydrophila infection (Fig. S2), except for atg5 in the 4.87 × 107 CFU/mL group on the first day post infection. However, these genes were generally downregulated at 7 d post infection. In contrast, mTOR was significantly downregulated in the treated groups at 1 and 3 days post infection (P < 0.05), but was generally upregulated during the late stage of infection (7 d). Expression levels of atg12, atg5, atg16L, LC3-ǁ, and BECN1 in the brains of the fish treated with a high concentration of A. hydrophila significantly increased 1 d post infection and significantly increased in the brains of all treated fish 3 d post infection (P < 0.05), except for BECN1 expression in the 7.55 × 105 CFU/mL group at 3 d post infection (Fig. S3). However, the expression of the mTOR gene was downregulated.

We investigated whether A. hydrophila caused autophagy in the common carp by assessing the expression level of LC3B, a marker of autophagy proteins. WBs showed that the LC3B-ǁ/LC3B-ǀ ratio in the liver increased in the 4.87 × 107 CFU/mL group on the third and fifth day post infection, suggesting that autophagic activity increased after A. hydrophila infection (Fig. S5). 4. Discussion In the present study, the common carp was used as an in vivo model to assess the developmental toxicity of A. hydrophila. It is known that oxidative stress induces autophagy under certain conditions such as ischemia and reperfusion (Matsui et al., 2007). The conditions that regulate autophagic process are also associated with changes in the production of reactive oxygen species (ROS) in cells (Lee et al., 2012). Indeed, two ancient processes, autophagy and innate immunity, may operate together through a shared signaling pathway (Xu et al., 2007). The immune system utilizes the autophagic degradation of cytoplasmic material to regulate adaptive immunity (Schmid and Münz, 2007). Several studies have demonstrated that autophagy may occurs in the same cell as, and often precede, apoptosis (Wirawan et al., 2010). Therefore, we investigated the oxidative stress, nonspecific immune, autophagic, and apoptotic responses of the common carp to A. hydrophila infection. In the fish body, there are both antibacterial molecules to combat against invading molecules as well self-defense antioxidant molecules to maintain the internal homeostasis. The end products of different antibacterial molecules are mainly ROS, which play crucial role in host defense but excessive production can cause host cell damage or stress (Arun et al., 2018). Notably, the oxidative stress response, which plays key roles in the stress response pathways, responds to environmental chemicals and cellular reactions capable of ROS production (Simmons et al., 2009). Thus, this anticipated damage is countered by production of different antioxidants (Arun et al., 2018). The activity levels of antioxidant enzymes are sensitive indicators of increased oxidative stress (Wang et al., 2013). Among various antioxidants, superoxide dismutase is the major enzyme and major antioxidant defense involved in the conversion of superoxide radicals into hydrogen peroxide and molecular oxygen (Arun et al., 2018). GSH is an important antioxidant, the

3.5.2. Effects on apoptosis To assess how A. hydrophila infection affected apoptosis in carp, we measured the levels of Bcl-2 and caspase3. Bcl-2 expression in the liver and kidney was significantly upregulated at 1 d post infection in the low-concentration group and at 3 d post infection in the high-concentration group (P < 0.05; Fig. S4). Bcl-2 expression in the brain also significantly increased in the treated groups on the third day of infection (P < 0.05). Caspase3 was significantly downregulated with respect to the controls during the early stages of A. hydrophila infection (days 1 and 3; P < 0.05). Caspase3 expression levels in the treated groups did not significantly differ from those of the controls during the late stages of infection (days 5 and 7), but caspase3 expression levels were upregulated.

6

Developmental and Comparative Immunology 105 (2020) 103587

J. Chen, et al.

Studies have shown that A. hydrophila-induced ER-stress leads to calpain-2-mediated activation of caspase-12 and the production of superoxide ions. The redox environment primsd the NF-kB-iNOS/NO axis, initiating cGMP/PKG-mediated caspase-8 activation. Mitochondrial dysfunction due to [ER] Ca2+ uptake activates caspase-9. The two initiator caspases crosstalk via Bid prompting caspase-3-mediated PARP cleavage and HKM apoptosis (Chaitali et al., 2014). Therefore, the sequential activation of casp3 plays a central role in the execution-phase of cell apoptosis (Alnemri et al., 1996). In the infected carp, the mRNA expression levels of caspase 3 in the liver, kidney, and brain were significantly lower than those in the control group (P < 0.05). In addition, on the fifth and seventh day after infection, caspase3 in the 4.87 × 107 CFU/mL group was generally upregulated with respect to the 7.55 × 105 CFU/mL group. Thus, our results indicated that A. hydrophila had a certain inhibitory effect on developmental toxicity in carp. Several studies have demonstrated that autophagy occurs in the same cell with, and often precedes, apoptosis (Wirawan et al., 2010). There are some cells in which apoptosis is not easily activated or is even absent, in which case excessive stress results in death via autophagic cell death (Yang et al., 2018). When apoptosis is not an effective or an available pathway, autophagy may be utilized the most common mode of cell death (Zakeri et al., 2008). The occurrence of autophagy depends on the involvement of a series of autophagy-related proteins. At least 37 ATG proteins have been identified in mammalian cells to date, and the ubiquitination pathway (atg12-atg5-atg16 L) plays an important role in the formation of autophagosomes. These proteins are involved in the initiation, nucleation, extension, closure, maturation, and degradation of autophagosomes (Mathieu et al., 2018). The autophagy protein atg5, which is relatively well conserved across most eukaryotes, plays an important role in the formation of autophagic vacuoles (Beth and Daniel, 2004). Using yeast as a model, it was shown that, in the early stage of autophagosome formation, the complex formed by atg12-atg5atg16L binds to its outer membrane. This promotes the extension and expansion of autophagosome, gradually causing the autophagosome to develop from a vesicle-like cup-like structure to a semi-annular structure (Chen et al., 2014). However, the combination of atg5 complex and the autophagic vesicle membrane also promotes the recruitment of LC3 to the autophagic vesicles (Malhotra et al., 2015). The orientation of the atg5 complex on the membrane determines the direction of the film, which extends toward the back of the atg5 complex. Just before or after the autophagic vacuole of the bilayer membrane structure forms a circular closed structure, the atg5 complex is detached from the membrane, leaving only the membrane-bound form of LC3-II located on the autophagic membrane. Therefore, the amount of LC3-II is proportional to the number of autophagic vacuoles. When autophagy occurs in mammalian cells, cellular LC3 content, as well as the rate of LC3-I to LC3-II conversion, significantly increases (Lin et al., 2014). Therefore, one can conveniently ascertain whether autophagy has been induced or inhibited by measuring changes in cellular LC3-II content (Klionsky et al., 2016). In the common carp, the mRNA expression of LC3-II in the treatment group significantly increased in the liver, kidney, and brain on the third day as compared to the control group (P < 0.05). In addition, LC3-II mRNA expression in the 4.87 × 107 CFU/mL group generally increased compared with the 7.55 × 105 CFU/mL group. The beclin1 gene, also known as BECN1, is a homolog of yeast atg6 and a specific gene involved in autophagy in mammals. Several studies have shown that BECN1 is not only involved in the formation of autophagosomes, but also plays an important role in tumor genesis and development by regulating autophagic activity (Aita et al., 1999; Liang et al., 1999). In the present study, BECN1 expression was significantly upregulated in the liver and brain in the high concentration group on the first and third day post infection (P < 0.05). mTOR, a serine/threonine kinase, is a master regulator of the cellular metabolism. mTOR plays a crucial role in the regulation of autophagy. Amino acids are key regulators of mTORC1 activation (Jewell

content of which could reflect the antioxidant potential of the organelle (Geng et al., 2019). Increased levels of ROS might be eliminated by the activities of SOD and GSH (Valavanidis et al., 2006). Moreover, elevated levels of ROS are the main factor leading to lipid peroxidation, and increases in lipid peroxidation indicate that the reactive species produced under exogenous stress have not been effectively eliminated by antioxidant enzymes (Dogan et al., 2011). Levels of MDA, which is the product of lipid peroxidation, can thus reflect the severity of cellular injury due to free radical attack (Draper and Hadley, 1990). Here, in response to oxidative stress, we found that oxidative damage was induced. Levels of GSH and SOD in the serum, liver, intestine, and gills were generally increased in the early stage of infection, but decreased significantly on the seventh day post infection. In contrast to the control group, MDA was significantly elevated on the fifth and seventh days of infection across all treatment groups (P < 0.05). A previous study showed that MDA content increased and antioxidant enzyme activity decreased in embryos exposed to 5.04 mg/L difenoconazole (Mu et al., 2015). Our results, in combination with this previous study, suggested that the oxidative stress response failed to maintain homeostasis. In contrast to other higher vertebrates, the nonspecific immune system is vitally important for disease resistance in teleost fish (Chen et al., 2017). The non-specific immune system of fish consists of fixed and mobile cells, as well as a wide range of defense molecules such as lysozyme, acid phosphatase, and alkaline phosphatase (Wang et al., 2018). It has been documented that environmental stress can lead to the turbulence of ACP and AKP activities, which are usually associated with immune status and utilized as indicators of fish health (Gill et al., 1992; Jyothi and Narayan, 2000; Tahmasebi-Kohyani et al., 2012). ACP and AKP are involved in a series of physiological metabolic activities such as molecule permeability, growth and cell differentiation, and the digestion, absorption, and transport of some phosphides and other nutrients. These enzymes not only effectively detoxify pollutants and toxicants invading crustaceans, but also play a positive role in the immune system as parts of the lysosomal enzyme, which is important for crustacean growth and survival (Mazorra et al., 2002). Consistent with the description, ACP and AKP activity levels in the liver and intestine increased on the first day of infection in the common carp. LZM, a key defense molecule in the innate immune system, plays a crucial role in regulating the protective reaction to exogenous pathogen infection (Ma et al., 2018). LZM destroys and eliminates invading xenobiotics by forming a hydrolytic enzyme system (Mukherjee et al., 2016). Sieroslawska et al. suggested that LZM plays a major role in the defense against pathogens and oxidative stress, and it has been used indicator for the detection of environmental pollutants (Sieroslawska et al., 2012). It mainly stems from neutrophils, monocytes, and macrophages, and acts as the first line of defense in the immune system (Chen et al., 2017). Studies have shown that in freshwater fish exposed to crowding stress, LZM activity decreased significantly, and the fish were more sensitive to pathogens, in comparison to the control group (Wang et al., 2004). Furthermore, ACP, AKP, and LZM activity levels in the liver, intestine, and gill of the A. hydrophila–treated common carp were significantly lower than levels in the control group on the seventh day post infection. These findings suggest that A. hydrophila infection might disrupt the innate immunity in the common carp. When stress response is thwarted, cells sustain substantial damage and undergo apoptosis or necrosis (Simmons et al., 2009). Apoptosis results from the action of a genetically encoded suicide program, which triggers a series of characteristic morphological and biochemical changes (Susin et al., 1997). Studies have shown that the Bcl-2 gene is an important regulator of cell apoptosis (Ola et al., 2011). Bcl-2 and related antiapoptotic proteins appear to act in part by dimerizing with a proapoptotic molecule (e.g., Bax) and interfering with the apoptosis induced by Bax (Oltvai and Korsmeyer, 1994; Srivastava et al., 1998). Here, the mRNA expression of Bcl-2 was significantly upregulated in the livers, kidneys, and brains of the treatment groups on the first and third day post infection, in comparison to the control group (P < 0.05). 7

Developmental and Comparative Immunology 105 (2020) 103587

J. Chen, et al.

et al., 2013; Bar-Peled and Sabatini, 2014). Furthermore, most, if not all, of the conditions that induce autophagy (e.g., reduced nutrients, growth factor deprivation, and low cellular energy levels) have been shown to inhibit mTOR activity. This suggests a tight, inverse coupling of autophagy induction and mTOR activation (Kim and Guan, 2015). Here, mTOR mRNA expression levels in the liver, kidney, and brain of the treatment group significantly decreased on the first and third days of post infection (P < 0.05), and there were certain differences between the treatment groups. Our results demonstrated A. hydrophila infection in the common carp induces autophagy. Thus, autophagic cell death may have been initiated when apoptosis is inhibited.

Peroxidation. Methods Enzymol. 186, 421–431. https://doi.org/10.1016/00766879(90)86135-i. Fridovich, I., 1995. Superoxide radical and superoxide dismutases. Annu. Rev. Biochem. 64, 97–112. https://doi.org/10.1146/annurev.bi.64.070195.000525. Geng, R., Jia, Y., Chi, M., Wang, Z., Liu, H., Wang, W., 2019. RNase1 alleviates the Aeromonas hydrophila-induced oxidative stress in blunt snout bream. Dev. Comp. Immunol. 91, 8–16. https://doi.org/10.1016/j.dci.2018.09.018. Gill, T.S., Tewari, H., Pande, J., 1992. Short-and long-term effects of copper on the rosy barb (Puntius conchonius Ham.). Ecotoxicol. Environ. Saf. 23, 294–306. https://doi. org/10.1016/0147-6513(92)90079-I. Giri, Sib Sankar, Sen, Shib Sankar, Chi, Cheng, Kim, Hyoun Joong, Yun, Saekil, Park, Se Chang, V, Sukumaran, 2015. Effect of guava leaves on the growth performance and cytokine gene expression of Labeo rohita and its susceptibility to Aeromonas hydrophila infection. Fish Shellfish Immunol. 46, 217–224. https://doi.org/10.1016/j.fsi. 2015.05.051. Grassme, H., Jendrossek, V., Gulbins, E., 2001. Molecular mechanisms of bacteria induced apoptosis. Apoptosis 6, 441–445. https://doi.org/10.1023/A:1012485506972. Jewell, J.L., Russell, R.C., Guan, K.L., 2013. Amino acid signalling upstream of mTOR. Nat. Rev. Mol. Cell Biol. 14 (3), 133–139. https://doi.org/10.1038/nrm3522. Ma, Junguo, Yuanyuan, Li, Mengli, Wu, Can, Zhang, Yuqing, Che, Weiguo, Li, Xiaoyu, Li, 2018. Serum immune responses in common carp (Cyprinus carpio L.) to paraquat exposure: the traditional parameters and circulating microRNAs. Fish Shellfish Immunol. 76, 133–142. https://doi.org/10.1016/j.fsi.2018.02.046. Jyothi, B., Narayan, G., 2000. Pesticide induced alterations of non-protein nitrogenous constituents in the serum of a fresh water cat fish, Clarias batrachus (Linn.). Indian J. Exp. Biol. 38 (10), 1058–1061. http://nopr.niscair.res.in/handle/123456789/24116. Kim, Y.C., Guan, K.L., 2015. mTOR: a pharmacologic target for autophagy regulation. J. Clin. Investig. 125 (1), 25–32. https://doi.org/10.1172/JCI73939. Klionsky, D.J., Abeliovich, H., Agostinis, P., Agrawal, D.K., Aliev, G., Askew, D.S., 2008. Guidelines for the use and interpretation of assays for monitoring autophagy in higher eukaryotes. Autophagy 4, 151–175. https://doi.org/10.4161/auto.5338. Klionsky, D.J., Abdelmohsen, K., Abe, A., Abedin, M.J., Abeliovich, H., Acevedo Arozena, A., Adachi, H., Adams, C.M., Adams, P.D., Adeli, K., 2016. Guidelines for the Use and Interpretation of Assays for Monitoring Autophagy. Lee, J., Giordano, S., Zhang, J., 2012. Autophagy, mitochondria and oxidative stress: cross-talk and redox signalling. Biochem. J. 441 (2). https://doi.org/10.1042/ BJ20111451. 523-40. Qin, Lei, Xinyan, Wang, Shengnan, Zhang, Shiyu, Feng, Licheng, Yin, Hong, Zhou, 2016. Lipopolysaccharide-induced autophagy participates in the control of pro-inflflammatory cytokine release in grass carp head kidney Leukocytes. Fish & Shellfifish Immunology 59, 389–397. https://doi.org/10.1016/j.fsi.2016.11.010. Liang, X.H., Jackson, S., Seaman, M., Brown, K., Kempkes, B., Hibshoosh, H., Levine, B., 1999. Induction of autophagy and inhibition of tumorigenesis by beclin 1 [J]. Nature 402, 672–676. https://doi.org/10.1038/45257. Lin, H.H., Lin, S.M., Chung, Y., Vonderfecht, S., Camden, J.M., Flodby, P., Borok, Z., Limesand, K.H., Mizushima, N., Ann, D.K., 2014. Dynamic involvement of ATG5 in cellular stress responses[J]. Cell Death Dis. 5, e1478. https://doi.org/10.1038/cddis. 2014.428. Ma, J., Zhou, C., Li, Y., Li, X., 2014. Biochemical responses to the toxicity of the biocide abamectin on the freshwater snail Physa acuta. Ecotoxicol. Environ. Saf. 101, 31–35. https://doi.org/10.1016/j.ecoenv.2013.12.009. Malhotra, R., Warne, J.P., Salas, E., Xu, A.W., Debnath, J., 2015. Loss of ATG12, but not ATG5, in pro-opiomelanocortin neurons exacerbates diet-induced obesity[J]. Autophagy 11 (1), 145–154. https://doi.org/10.1080/15548627.2014.998917. Mathieu, P., Leeanna, E.H., Arnim, P., 2018. mTOR pathways in cancer and autophagy [J]. Cancers 10 (1), 18. https://doi.org/10.3390/cancers10010018. Matsui, Y., Takagi, H., Qu, X., Abdellatif, M., Sakoda, H., Asano, T., Beth, Levine, Junichi, Sadoshima, 2007. Distinct roles of autophagy in the heart during ischemia and reperfusion roles of AMPactivated protein kinase and beclin 1 in mediating autophagy. Circ. Res. 100, 914–922. https://doi.org/10.1161/01. Mazorra, M.T., Rubio, J.A., Blasco, J., 2002. Acid and alkaline phosphatase activities in the clam Scrobicularia plana: kinetic characteristics and effects of heavy metals. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 131 (2), 241–249. https://doi.org/ 10.1016/S1096-4959(01)00502-4. Mizushima, N., 2010. The role of the Atg1/ULK1 complex in autophagy regulation. Curr. Opin. Cell Biol. 22 (2), 132–139. https://doi.org/10.1016/j.ceb.2009.12.004. Mizushima, N., Levine, B., Cuervo, A.M., Klionsky, D.J., 2008. Autophagy fights disease through cellular self-digestion. Nature 451 (7182), 1069–1075. https://doi.org/10. 1038/nature06639. Monserrat, José M., Martínez, Pablo E., Geracitano, Laura A., Amado, Lílian Lund, Martinez, Camila, Martins, Gaspar, Lopes, Grasiela, Pinho, Leães, Chaves, Isabel Soares, Ferreira-Cravo, Marlize, Ventura-Lima, Juliane, Bianchini, Adalto, 2007. Pollution biomarkers in estuarine animals: critical review and new perspectives. Comp. Biochem. Physiol. C Toxicol. Pharmacol. 146, 221–234. https://doi.org/10. 1016/j.cbpc.2006.08.012. Mu, X.Y., Chai, T.T., Wang, K., Zhang, J., Zhu, L.J., Wang, C.J., Li, X.F., 2015. Occurrence and origin of sensitivity toward difenoconazole in zebrafish (Danio reio) during different life stages. Aquat. Toxicol. 160, 57–68. https://doi.org/10.1016/j.aquatox. 2015.01.001. Mukherjee, S., Ray, M., Ray, S., 2016. Shift in aggregation, ROS generation, antioxidative defense, lysozyme and acetylcholinesterase activities in the cells of an Indian freshwater sponge exposed to washing soda (sodium carbonate). Comp Biochem Phys C Toxicol Pharmacol 187, 19–31. https://doi.org/10.1016/j.cbpc.2016.05.001. Nielsen, M.E., Høi, L., Schmidt, A.S., Qian, D., Shimada, T., Shen, J.Y., Larsen, J.L., 2001. Is Aeromonas Hydrophila the Dominant Motile Aeromonas Species that Causes Disease Outbreaks in Aquaculture Production in the Zhejiang Province of China?, vol

5. Conclusion Overall, the results of this study clearly indicate that A. hydrophila infection is somewhat toxic to carp. Although stress responses such as oxidative stress were evoked, these responses failed to maintain cell homeostasis. A. hydrophila induced oxidative damage, nonspecific immune reactions, and autophagy in carp and might have caused apoptosis in the late stage of infection. The combined effects of these factors might lead to carp death. These findings provide insights into the mechanisms of A. hydrophila-induced toxicity in carp. Funding The Henan Provincial Key Scientific and Technological Project in China (no. 192102110195, 152102210081), Henan Normal University Ph.D. Startup Fund (no. qd17143) supported this study. Declaration of competing interest The authors have no conflicts of interest to declare. Appendix A. Supplementary data Supplementary data to this article can be found online at https:// doi.org/10.1016/j.dci.2019.103587. References Aita, V.M., Liang, X.H., Murty, V.V., Pincus, L.D., Yu, W.P., Cayanis, E., Kalachikov, S., Gilliam, T.C., Levine, B., 1999. Cloning and genomic organization of beclin 1, a candidate tumor suppressor gene on chromosome 17q21. Genomics 59 (1), 59–65. https://doi.org/10.1006/geno.1999.5851. Alnemri, E.S., Livingston, D.J., Nicholson, D.W., Salvesen, G., Thornberry, N.A., Wong, W.W., Yuan, J., 1996. Human ICE/CED-3 protease nomenclature. Cell 87 (2), 171. https://doi.org/10.1016/s0092-8674(00)81334-3. Bar-Peled, L., Sabatini, D.M., 2014. Regulation of mTORC1 by amino acids. Trends Cell Biol. 24 (7), 400–406. https://doi.org/10.1016/j.tcb.2014.03.003. Beth, Levine, Daniel J, Klionsky, 2004. Development by self-digestion: molecular mechanisms and biological functions of autophagy. Dev. Cell 6 (4), 463–477. https:// doi.org/10.1016/S1534-5807(04)00099-1. Chaitali, Banerjee, Ramansu, Goswami, Gaurav, Verma, Malabika, Datta, Shibnath, Mazumder, 2012. Aeromonas hydrophila induced head kidney macrophage apoptosis in Clarias batrachus involves the activation of calpain and is caspase-3 mediated. Dev. Comp. Immunol. 37, 323–333. https://doi.org/10.1016/j.dci.2012.02.005. Chaitali, Banerjee, Ambika, Singh, Taposh Kumar, Das, Rajagopal, Raman, Anju, Shrivastava, Shibnath, Mazumder, 2014. Ameliorating ER-stress attenuates Aeromonas hydrophila-induced mitochondrial dysfunctioning and caspase mediated HKM apoptosis in Clarias batrachus. Sci. Rep. 4, 5820. https://doi.org/10.1038/ srep05820. Chen, Z.H., Cao, J.F., Zhou, J.S., Liu, H., Che, L.Q., Mizumura, K., Li, W., Choi, A.M., Shen, H.H., 2014. Interaction of caveolin-1 with ATG12-ATG5 system suppresses autophagy in lung epithelial cells[J]. Am. J. Physiol. Lung Cell Mol. Physiol. 306 (11), L1016–L1025. https://doi.org/10.1152/ajplung.00268.2013. Chen, D., Zhang, Z., Yao, H., Liang, Y., Xing, H., Xu, S., 2015. Effects of atrazine and chlorpyrifos on oxidative stress-induced autophagy in the immune organs of common carp (Cyprinus carpio L.). Fish Shellfish Immunol. 44 (1), 12–20. https://doi.org/10. 1016/j.fsi.2015.01.014. Dogan, D., Can, C., Kocyigit, A., Dikilitas, M., Taskin, A., Bilinc, H., 2011. Dimethoateinduced oxidative stress and DNA damage in Oncorhynchus mykiss. Chemosphere 84 (1), 39–46. https://doi.org/10.1016/j.chemosphere.2011.02.087. Draper, H., Hadley, M., 1990. Malondialdehyde determination as index of lipid

8

Developmental and Comparative Immunology 105 (2020) 103587

J. Chen, et al.

histopathological effects and response of biochemical markers in the spleens and head kidneys of common carp exposed to atrazine and chlorpyrifos. Food Chem. Toxicol. 62, 148–158. https://doi.org/10.1016/j.fct.2013.08.044. Wang, Jun-Li, Meng, Xiao-Lin, Lu, Rong-hua, Wu, Chun, Luo, Yan-Ting, Yan, Xiao, Li, Xue-Jun, Kong, Xiang-Hui, Nie, Guo-Xing, 2015. Effects of Rehmannia glutinosa on growth performance, immunological parameters and disease resistance to Aeromonas hydrophila in common carp (Cyprinus carpio L.). Aquaculture 435, 293–300. https:// doi.org/10.1016/j.aquaculture.2014.10.004. Wang, Lin, Li, Li, Jie, Chen, Dapeng, Li, Jie, Hou, Honghui, Guo, Jianzhong, Shen, 2018. Long-term crowding stress causes compromised nonspecific immunity and increases apoptosis of spleen in grass carp (Ctenopharyngodon idella). Fish Shellfish Immunol. 80, 540–545. https://doi.org/10.1016/j.fsi.2018.06.050. Wirawan, E., VandeWalle, L., Kersse, K., Cornelis, S., Claerhout, S., Vanoverberghe, I., Roelandt, R., De Rycke, R., Verspurten, J., Declercq, W., Agostinis, P., Vanden Berghe, T., Lippens, S., Vandenabeele, P., 2010. Caspase-mediated cleavage of Beclin1 inactivates Beclin-1-induced autophagy and enhance sapoptosis by promoting the release of proapoptotic factors from mitochondria. Cell Death Dis. 1–18. https://doi. org/10.1038/cddis.2009.16. Xu, Y., Jagannath, C., Liu, X.-D., Sharafkhaneh, A., Kolodziejska, K.E., Eissa, N.T., 2007. Tolllike receptor 4 is a sensor for autophagy associated with innate immunity. Immunity 27, 135–144. https://doi.org/10.1016/j.immuni.2007.05.022. Xu, P., Zhang, X., Wang, X., Li, J., Liu, G., Kuang, Y., Xu, J., Zheng, X., Ren, L., Wang, G., Zhang, Y., Huo, L., Zhao, Z., Cao, D., Lu, C., Li, C., Zhou, Y., Liu, Z., Fan, Z., Shan, G., Li, X., Wu, S., Song, L., Hou, G., Jiang, Y., Jeney, Z., Yu, D., Wang, L., Shao, C., Song, L., Sun, J., Ji, P., Wang, J., Li, Q., Xu, L., Sun, F., Feng, J., Wang, C., Wang, S., Wang, B., Li, Y., Zhu, Y., Xue, W., Zhao, L., Wang, J., Gu, Y., Lv, W., Wu, K., Xiao, J., Wu, J., Zhang, Z., Yu, J., Sun, X., 2014. Genome sequence and genetic diversity of the common carp, Cyprinus carpio. Nat. Genet. 46 (11), 1212–1219. https://doi.org/10. 1038/ng.3098. Zhang, Xueshu, Yubang, Shen, Xiaoyan, Xu, Meng, Zhang, Yulin, Bai, Yiheng, Miao, Yuan, Fang, Jiahua, Zhang, Rongquan, Wang, Jiale, Lia, 2018. Transcriptome analysis and histopathology of black carp (Mylopharyngodon piceus) spleen infected by Aeromonas hydrophila. Fish Shellfish Immunol. 83, 330–340. https://doi.org/10. 1016/j.fsi.2018.09.047. Yang, B., Dongxing, Z., Tonglei, W., Zhiqiang, Z., Sayed, H., Abbas, R., Nicola, S., Lei, Z., Guilian, Y., Chunfeng, W., Aidong, Q., Yuanhuan, K., Xiaofeng, S., 2019. Maltoporin (LamB protein) contributes to the virulence and adhesion of Aeromonas veronii TH0426. Jouranl of fish diseases 42, 379–389. https://doi.org/10.1111/jfd.12941. Yang, Yang, Fengshou, Dong, Xingang, Liu, Jun, Xu, Xiaohu, Wu, Wenxian, Liu, Yongquan, Zheng, 2018. Crosstalk of oxidative damage, apoptosis, and autophagy under endoplasmic reticulum (ER) stress involved in thifluzamide-induced liver damage in zebrafish (Danio rerio). Environ. Pollut. 243, 1904–1911. https://doi.org/ 10.1016/j.envpol.2018.09.041. Chen, Yanyan, Xianghu, Huang, Jianzhu, Wang, Chang, ling, 2017. Effect of pure microcystin-LR on activity and transcript level of immune-related enzymes in the white shrimp (Litopenaeus vannamei). Ecotoxicology 26, 702–710. https://doi.org/10. 1007/s10646-017-1802-7. Zakeri, Z., Melendez, A., Lockshin, R.A., 2008. Detection of autophagy in cell death. Methods Enzymol. 442, 289–306. https://doi.org/10.1016/S0076-6879(08)01415-8.

46. Inter-Research Science Publisher, pp. 23–29. https://doi.org/10.3354/ dao046023. Ola, M.S., Nawaz, M., Ahsan, H., 2011. Role of Bcl-2 family proteins and caspases in the regulation of apoptosis. Mol. Cell. Biochem. 351 (1–2), 41–58. https://doi.org/10. 1007/s11010-010-0709-x. Oltvai, Z.N., Korsmeyer, S.J., 1994. Checkpoints of dueling dimers foil death wishes. Cell 79 (2), 189–192. https://doi.org/10.1016/0092-8674(94)90188-0. Rathmell, J.C., Thompson, C.B., 2002. Pathways of apoptosis in lymphocyte development, homeostasis and disease. Cell 109, S97–S107. https://doi.org/10.1016/S00928674(02)00704-3. Schmid, D., Münz, C., 2007. Innate and adaptive immunity through autophagy. Immunity 27, 11–21. https://doi.org/10.1016/j.immuni.2007.07.004. Arun, Sharma, Paul, Anirban, Parida, Sonali, Pattanayak, Sabyasachi, Mohapatra, Amruta, Kumar, Pasim Rajesh, Sahoo, Manoj Kumar, Sundaray, Jitendra Kumar, Sahoo, Pramoda Kumar, 2018. Dynamics of expression of antibacterial and antioxidant defence genes in Indian major carp, Labeo rohita in response to Aeromonas hydrophila infection. Microb. Pathog. 125, 108–115. https://doi.org/10.1016/j. micpath.2018.09.007. Sieroslawska, A., Rymuszka, A., Velisek, J., Pawlik-Skowrońska, B., Svobodova, Z., Skowroński, T., 2012. Effects of microcystin-containing cyanobacterial extract on hematological and biochemical parameters of common carp (Cyprinus carpio L.). Fish Physiol. Biochem. 38, 1159–1167. https://doi.org/10.1007/s10695-011-9601-1. Simmons, S.O., Fan, C.Y., Ramabhadran, R., 2009. Cellular stress response pathway system as a sentinel ensemble in toxicological screening. Toxicol. Sci. 111 (2), 202–225. https://doi.org/10.1093/toxsci/kfp140. Srivastava, R.K., Srivastava, A.R., Korsmeyer, S.J., Nesterova, M., Cho-Chung, Y.S., Longo, D.L., 1998. Involvement of microtubules in the regulation of Bcl2 phosphorylation and apoptosis through cyclic AMP-dependent protein kinase. Mol. Cell. Biol. 18 (6), 3509–3517. https://doi.org/10.1128/mcb.18.6.3509. Susin, S.A., Zamzami, N., Castedo, M., Daugas, E., Wang, H.G., Geley, S., Fassy, F., Reed, J.C., Kroemer, G., 1997. The central execution of apoptosis: multiple connections between protease activation and mitochondria in Fas/APO-1/CD95- and ceramideinduced apoptosis. J. Exp. Med. 186 (1), 25–37. https://doi.org/10.1084/jem.186. 1.25. Tahmasebi-Kohyani, A., Keyvanshokooh, S., Nematollahi, A., Mahmoudi, N., PashaZanoosi, H., 2012. Effects of dietary nucleotides supplementation on rainbow trout (Oncorhynchus mykiss) performance and acute stress response. Fish Physiol. Biochem. 38, 431–440. https://doi.org/10.1007/s10695-011-9524-x. Tanida, I., Minematsu-Ikeguchi, N., Ueno, T., Kominami, E., 2005. Lysosomal turnover, but not a cellular level, of endogenous LC3 is a marker for autophagy. Autophagy 1 (2), 84–91. https://doi.org/10.4161/auto.1.2.1697. Valavanidis, A., Vlahogianni, T., Dassenakis, M., Scoullos, M., 2006. Molecular biomarkers of oxidative stress in aquatic organisms in relation to toxic environmental pollutants. Ecotoxicol. Environ. Saf. 64 (2), 178–189. https://doi.org/10.1016/j. ecoenv.2005.03.013. Wang, W.B., Wang, J.G., Li, A.H., Cai, T.Z., 2004. Changes of cortisol and lysozyme levels in Carassius auratus blood after crowding stress and the fish sensitivity to pathogen. J. Fish. Sci. China 11, 408–412. Wang, X., Xing, H., Jiang, Y., Wu, H., Sun, G., Xu, Q., 2013. Accumulation,

9