The specifically enhanced cellular immune responses in Pacific oyster (Crassostrea gigas) against secondary challenge with Vibrio splendidus

Developmental and Comparative Immunology 45 (2014) 141–150

Contents lists available at ScienceDirect

Developmental and Comparative Immunology journal homepage: www.elsevier.com/locate/dci

The specifically enhanced cellular immune responses in Pacific oyster (Crassostrea gigas) against secondary challenge with Vibrio splendidus Tao Zhang a,b, Limei Qiu a, Zhibin Sun a,b, Lingling Wang a, Zhi Zhou a, Rui Liu a, Feng Yue a,b, Rui Sun a,b, Linsheng Song a,⇑ a b

Key Laboratory of Experimental Marine Biology, Institute of Oceanology, Chinese Academy of Sciences, Qingdao 266071, China University of Chinese Academy of Sciences, Beijing 100049, China

a r t i c l e

i n f o

Article history: Received 18 December 2013 Revised 26 February 2014 Accepted 28 February 2014 Available online 6 March 2014 Keywords: Crassostrea gigas Immune priming Phagocytosis Hemocytes regeneration Hemopoiesis

a b s t r a c t The increasing experimental evidences suggest that there are some forms of specific acquired immunity in invertebrates, but the underlying mechanism is not fully understood. In the present study, Pacific oyster (Crassostrea gigas) stimulated primarily by heat-killed Vibrio splendidus displayed stronger immune responses at cellular and molecular levels when they encountered the secondary challenge of live V. splendidus. The total hemocyte counts (THC) increased significantly after the primary stimulation of heat-killed V. splendidus, and it increased even higher (p < 0.01) and reached the peak earlier (at 6 h) after the secondary challenge with live V. splendidus compared with that of the primary stimulation. The number of new generated circulating hemocytes increased dramatically (p < 0.01) at 6 h after the pre-stimulated oysters received the secondary stimulation with live V. splendidus, and the phagocytic rate was also enhanced significantly (p < 0.01) at 12 h after the secondary stimulation. Meanwhile, the enhanced phagocytosis of hemocytes was highly specific for V. splendidus and they could distinguish Vibrio anguillarum, Vibrio coralliilyticus, Yarrowia lipolytica, and Micrococcus luteus efficiently. In addition, the mRNA expression of 12 candidate genes related to phagocytosis and hematopoiesis were also monitored, and the expression levels of CgIntegrin, CgPI3K (phosphatidylinositol 3-kinase), CgRho J, CgMAPKK (mitogen-activated protein kinase kinase), CgRab32, CgNADPH (nicotinamide adenine dinucleotide phosphate) oxidase, CgRunx1 and CgBMP7 (bone morphogenetic protein 7) in the hemocytes of pre-stimulated oysters after the secondary stimulation of V. splendidus were higher (p < 0.01) than that after the primary stimulation, but there was no statistically significant changes for the genes of CgPKC (protein kinase C), CgMyosin, CgActin, and CgGATA 3. These results collectively suggested that the primary stimulation of V. splendidus led to immune priming in oyster with specifically enhanced phagocytosis and rapidly promoted regeneration of circulating hemocytes when the primed oysters encountered the secondary challenge with V. splendidus. Ó 2014 Elsevier Ltd. All rights reserved.

1. Introduction Animals have developed canonical mechanisms to combat invading foreign particles, including innate (non-specific) immunity and adaptive (specific, acquired or memorial) immunity. Invertebrates, which lack the lymphocytes and immunoglobulin, have always been considered to possess only innate immune system (Turvey and Broide, 2010). However, recent experimental Abbreviations: PI3K, phosphatidylinositol 3-kinase; MAPKK, mitogen-activated protein kinase kinase; PKC, protein kinase C; NADPH, nicotinamide adenine dinucleotide phosphate; BMP, bone morphogenetic protein; EF, elongation factor. ⇑ Corresponding author. Tel.: +86 532 2898852; fax: +86 532 2898578. E-mail address: [email protected] (L. Song). http://dx.doi.org/10.1016/j.dci.2014.02.015 0145-305X/Ó 2014 Elsevier Ltd. All rights reserved.

evidences (Dong et al., 2006; Kurtz and Franz, 2003; Lemaitre et al., 1997; Little et al., 2003; Pham et al., 2007; Roth et al., 2010; Vierstraete et al., 2004; Wang et al., 2009; Witteveldt et al., 2004; Zhang et al., 2004), molecular evolutionary analysis (Flajnik and Du Pasquier, 2004; Kurtz, 2004; Ottaviani, 2011; Saha et al., 2010; Ziauddin and Schneider, 2012) and data from a new field of ecological immunology (Little and Kraaijeveld, 2004; Rolff and Siva-Jothy, 2003) suggest that the immune response of invertebrates also exhibit adaptive characteristics, described as immune priming. But the mechanisms underlying the specific protection of immune priming have not been well characterized. Invertebrate immune system, same as vertebrate immune system, is based on both cellular and humoral components. The

142

T. Zhang et al. / Developmental and Comparative Immunology 45 (2014) 141–150

cellular immune responses against an invasion of pathogen are generally immediate, while humoral responses seemingly emerge several hours after an infection (Rosales, 2011). Consequently, the circulating cells (coelomocytes or hemocytes) are considered to be the primary effector components in immune responses of invertebrates. These cells interact with numerous foreign particles, leading to the subsequent activation of cellular immune reactions such as phagocytosis, nodule formation, encapsulation, and cytotoxicity, etc. (Lackie, 1980). Phagocytosis is initially triggered to respond to invaders before nodule formation and encapsulation (Dunn, 1986), and it is fundamentally important to invertebrates’ survival. Recently, there are accumulating reports about the involvement of cellular immune responses during immune priming. Phagocytes were found to be the critical performers in the priming response of the primed Drosophila, and the enhanced phagocytosis was specific to kill the pathogen (Pham et al., 2007). The similar results have also been reported in woodlouse (Roth and Kurtz, 2009) and shrimp (Pope et al., 2011). In Mosquitoes Anopheles gambiae, the immune priming aroused quantitative and qualitative differentiation of hemocytes and circulating granulocytes to mediate the enhanced antiplasmodial immunity. The proliferation and differentiation of hemocytes was suspected to be necessary to initiate the innate immune memory (Rodrigues et al., 2010). It has been suggested that the cellular immune response might be one of the most important immune parameters in invertebrate immune priming (Pham et al., 2007; Pope et al., 2011; Roth and Kurtz, 2009). But the detailed mechanism of specific cellular immunity in immune priming is still far from well understood. The phylum Mollusca is one of the largest and most various groups in the invertebrate animals and some of them are important fishery and aquaculture species. In recent decades, the mechanisms of molluscan immune defense have been investigated for their important position in evolution, and some sporadic phenomena of immune priming have also been observed. In scallop Chlamys farreri, a short-term immersion with V. anguillarum aroused the scallops with enhanced phagocytosis and acid phosphatase activity against the secondary challenge with V. anguillarum (Cong et al., 2008). In addition, C-lectins might be involved in the immune priming of scallop (Wang et al., 2013). In Pacific oyster Crassostrea gigas, Poly I:C can induce a protective antiviral immune priming response against the secondary challenge with Ostreid herpesvirus (Green and Montagnani, 2013). Recently, the whole genome sequence of Pacific oyster was released (Zhang et al., 2012), and it provided a golden opportunity to expound molecular mechanisms of molluscan immunity including the underlying mechanisms of immune priming in marine invertebrates. In the present study, the Pacific oysters were immunized with heat-killed Vibrio splendidus in the primary stimulation and then challenged with live V. splendidus for the secondary stimulation. The cellular responses, including the changes of total hemocyte counts (THC), regeneration of circulating hemocytes and the ability of phagocytosis were measured to investigate whether heat-killed V. splendidus could arouse immune priming in oyster. Meanwhile, the expression level of some important genes involved in phagocytosis and hemopoiesis were also monitored to find out the underlying mechanisms of immune response elicited by the primary and secondary stimulations of V. splendidus.

2. Materials and methods 2.1. Oysters Pacific oysters C. gigas, about 2 years old, were obtained from National oceanographic Center, Qingdao, China. Animals were

cultured in tanks with continuously oxygenated, filtered seawater at 20 °C for 1 week before processing. 2.2. Bacteria and experimental stimulation Vibrio splendidus, isolated from lesion-like niduses of moribund scallop Patinopecten yessoensis (Liu et al., 2013), was applied as stimuli agent in this study. The bacteria was cultured in 2116E media at 18 °C for 24 h, and harvested by centrifuged at 4000g, 25 °C for 10 min. Then it was washed and re-suspended in filtersterilized (0.22 lm pore size) sea water (FSSW) and adjusted to the final concentration of 2  108 CFU mL1. The oysters were stimulated by heat-killed or live V. splendidus according to the previous description (Labreuche et al., 2006) with minor modification. A narrowed notch was sawed in the closed side of the oyster shell, adjacent to the adductor muscle, and then the oysters were acclimated for 1 week to be available for the following experimental stimulation. One hundred and twenty oysters were equally divided into two subgroups designed as FSSW (received an injection of 100 lL FSSW containing 50 mM BrdU) and HK-Vs (received an injection of 100 lL heat-killed V. splendidus containing 50 mM BrdU). Two hundred and forty oysters were employed and divided equally into four different subgroups designed as FSSW + FSSW, FSSW + Vs, HK-Vs + FSSW, HK-Vs + Vs, meaning that oysters received an 100 lL injection (containing 50 mM BrdU) with FSSW or heat-killed V. splendidus for the primary stimulation at 0 h and an 100 lL injection (containing 50 mM BrdU) with FSSW or live V. splendidus (containing 50 mM BrdU) for the secondary stimulation at 168 h. The oysters in blank and control groups did not receive the injection of BrdU. All the animals were returned to seawater tanks and maintained under static conditions after handling. 2.3. Hemocytes collection Hemolymph samples were randomly collected at time points of 0, 6, 9, 12, 24 and 48 h after the first and secondary stimulations from each subgroup to examine the hemocyte cellular parameters. Five hundred microliter hemolymph of each oyster was aseptically withdrawn from the posterior adductor muscle sinus using a 23gauge needle attached to a 2-mL syringe containing 1 mL antiaggregant solution (0.5% g mL1 EDTA in PBS). The hemolymph from three oysters were pooled together (about 4.5 mL) as one sample, and three samples (including nine oysters) were collected for each sampling points. Each sample was mixed in 10 mL tubes held on ice to minimize cell clumping, and then divided into three aliquots. One aliquot was used for quantifying THC, another was used for measuring regeneration of circulating hemocytes and the ability of phagocytosis, and the last one for analyzing gene expression by real-time PCR. 2.4. Total hemocyte counts (THC) Three hundred microliter of each hemolymph sample was fixed by adding 100 lL absolute formaldehyde, and 10 lL of the mixture was placed in a hemocytometer to measure the THC using a microscope (Olympus BX51, Tokyo, Japan). 2.5. BrdU incorporation assay Five hundred microliter of each hemolymph sample was centrifuged at 800g, 4 °C for 10 min, and the pellet of hemocytes was resuspended in 1 mL FSSW. The suspension was used for hemocytes regeneration analysis based on the method described in a previous report (Sun et al., 2012). A drop of hemocytes of each sample was deposited on a clean glass slide treated with poly-L-lysine and kept in a wet chamber at room temperature for 1 h. After hemocytes set-

143

T. Zhang et al. / Developmental and Comparative Immunology 45 (2014) 141–150

tled in monolayers on slides, the liquid was sipped up using a filter paper, and the slides were washed three times in FSSW and fixed in acetone for 20 min before being stored at 20 °C until use. The fixed slides were covered with 0.5% Triton X-100 (in 0.1 mol L1 PBS), kept at 4 °C for 20 min, washed with PBS, incubated with 2 M HCl (in 0.1 mol L1 PBS) containing pepsin (0.2 mg mL1, Solarbio) at 37 °C for 30 min, and followed by rinsing with PBS. Subsequently, the slides were pre-incubated with 1% BSA (in 0.1 mol L1 PBS) at 37 °C for 1 h and then incubated with rat anti-BrdU antibodies (1:1000 dilution in 1% BSA, Abcam) at 37 °C for another 2 h. After wash, the slides were incubated with Daylight 488 coupled mouse anti-rat IgG (1:1000 dilution in 1% BSA, Abcam) at 37 °C for 1 h and counterstained with 1 mg mL DAPI (in 0.1 mol L1 PBS, Beyotime, China). At least 500 hemocytes on each slide were counted under a fluorescence microscope (Zeiss, Germany) and the ratio between BrdU positive cells and total cells was calculated. 2.6. Phagocytosis assay V. splendidus, Vibrio anguillarum, Vibrio coralliilyticus, Yarrowia lipolytica, and Micrococcus luteus were cultured overnight with constant agitation, respectively. After treated with absolute formaldehyde for 10 min, the microorganisms were washed with 0.1 M NaHCO3 (pH 9.0), and then incubated with NaHCO3 containing 1 mg mL1 FITC (Sigma) at room temperature with gentle stirring overnight. The FITC-labeled microorganisms were rinsed with PBS until the supernatant was free of visible FITC, and all the suspensions were adjusted to the final concentration of 2  108 cells mL1 for later use. The phagocytosis assay was conducted by using the method modified from a previous report (Wu et al., 2007). In brief, oyster hemocytes were diluted in FSSW to a final concentration of 2  106 cells mL1 and incubated with the same volume of FITC-labeled microorganisms at room temperature for 30 min. Fifty microliter cell suspension was smeared onto a glass slide treated with poly-L-lysine and the slides were incubated in a wet chamber to allow the hemocytes to adhere at 25 °C for 30 min. After the slides were washed three times in FSSW and fixed in 10% formalin for 10 min, the hemocytes were counterstained by 0.01% Evan’s blue for 10 min and the fluorescence of non-phagocytosed microorganisms was quenched with 2 mg mL1 trypan blue solution (Sigma, USA) for 30 min. The slides were then counterstained with 1 mg mL1 DAPI (in 0.1 M PBS, Beyotime, China). After three time washings with FSSW, the slides were covered by microscope cover glasses with 50% glycerin and examined under a fluorescence microscope (Zeiss, Germany). The phagocytic rate (PR) was calculated by the percentage of cells with phagocytic microorganisms relative to the total number of cells. The phagocytic index (PI), the average number of microorganisms per phagocyte, was counted according to the formula (Pope et al., 2011): Phagocytic Index for microorganism A = (total microorganisms A phagocytized)/(cells phagocytic for microorganism A).

Table 1 Primers used for qRT-PCR of C. gigas phagocytosis and hemopoiesis-related genes. Category

Gene name

Phagocytosis-related Receptor Integrin Signaling pathway

PI3K Rho J MAPKK PKC

Cytoskeletal proteins

Myosin

Actin Phagosome

Rab 32

Essential enzyme

NADPH oxidase

Primer sequence (50 –30 ) Forward: CCTCGTAAAGAGCAGGGATG Reverse: CCATTGAGTTTGAGAGGTCCAT Forward: TTGAGAAGTGGTCCAACGG Reverse: TCTTCAGATGTGAGAGTTTTAGTGG Forward: AGACCTGTATGCTGATGACG Reverse: TCATAAGCGTCGTTTCTACC Forward: CCTCCTACCCTACCCAAAGA Reverse: ATAGTCCGCTAGTTCACCCTG Forward: GTGCTACTGGACCACGAAGG Reverse: TCCACGCTGAAATCATAATCC Forward: AAACGAAGTCCAAAGCCAC Reverse: ATCCTCCTTGTCAATGAAACC Forward: TCTCACCCTCAAGTACCCCA Reverse: TCAGTCAGGAGGACGGGAT Forward: AGGTCAGGAGAGGTTCGGTA Reverse: CACAAGGAACGGGACTGC Forward: GATGCCAGGAAAGCGTCAA Reverse: GCACTGCGTGTTCCGTCTC

Hemopoiesis-related Transcription factor GATA 3 Runx 1 Growth factor

BMP 7

Forward: CCCACCAAACCTGAACGCTAT Reverse: ACGATGAGGGCATGGATGAC Forward: GTCTCCGCTGGAAACGATG Reverse: GTCACTTTGATGGCTTTCTGG Forward: TCTGGGCTGGAATGACTG Reverse: GAACGCAACAAGGTTTAGG

Internal control EF 1

Forward: AGTCACCAAGGCTGCACAGAAAG Reverse: TCCGACGTATTTCTTTGCGATGT

as an internal control. The SYBR Green real-time PCR assay was carried out in an ABI PRISM 7300 Sequence Detection System (Applied Biosystems) according to the manual. The relative expression of genes was analyzed by the 2DDCT method (Livak and Schmittgen, 2001). All the data were given in terms of relative mRNA expressed as mean ± SD (N = 4). 2.8. Statistical analysis All data were graphed and analyzed using Origin 8.1 (OriginLab, Northampton, MA, USA) and Statistical Package for Social Sciences (SPSS) 16.0. Significant differences between treatments for each assay were tested by one-way analysis of variance (ANOVA). If significant differences were indicated at the 0.05 level, then a post hoc multiple-comparisons (Tukey’s) test was used to examine significant differences among treatments using SPSS. Differences were deemed significant at p < 0.05. Data with different letter (a, b, c etc.) significantly differ (p < 0.05) among different elapsed time periods.

2.7. Gene expression analysis

3. Results

The hemocytes were pelleted by centrifugations the hemolymph at 800g for 10 min and resuspended in 1 ml TRIzol reagent (Invitrogen, America). Total RNA was isolated according to the Invitrogen supplier’s instructions. The first-strand cDNA synthesis was carried out based on Promega M-MLV RT Usage information (Promega, America). cDNA mix was diluted 1:50 and stored at 80 °C for the subsequent fluorescent real-time PCR. The mRNA expression of 12 genes (Table 1) participating in the process of phagocytosis or hemopoiesis (hemocytes regeneration) were measured by SYBR Green fluorescent quantitative real-time PCR. Amplification of a housekeeping oyster gene EF 1 cDNA was used

3.1. The significantly increased THC after the secondary challenge with live V. splendidus After the primary stimulation, THC in inactivated V. splendidus stimulation subgroup was significantly higher (ANOVA, p < 0.01) than that in FSSW subgroup at 6, 9 and 12 h and peaked at 9 and 12 h (Fig. 1). Afterwards, THC declined gradually from 24 to 48 h, and recovered to the original level at the seventh day (168 h) without statistical differences among the four subgroups. After the secondary challenge with live V. splendidus, the same increase of THC was observed in FSSW + Vs subgroup. While in HK-Vs + Vs sub-

144

T. Zhang et al. / Developmental and Comparative Immunology 45 (2014) 141–150

Fig. 1. Effects of V. splendidus on THC of C. gigas oyster. The THC of oysters were collected 0, 6, 9, 12, 24 and 48 h after primary stimulation of heat-killed V. splendidus and secondary challenge with live V. splendidus. Vertical bars represented the mean ± SD (N = 3). The different letters (a, b, c etc.) indicated significant differences (p < 0.05, ANOVA).

group treated twice with V. splendidus, the amount of hemocytes reached peak early at 6 h and THC was higher than that of all the other subgroups (ANOVA, p < 0.01) (Fig. 1). 3.2. The accelerated regeneration of circulating hemocytes after the secondary challenge with live V. splendidus The regenerated hemocytes could be labeled by incorporation of BrdU, and displayed green immunofluorescence (Fig. 2A). No significant difference was observed in the number of BrdU positive cells from 6 to 12 h after the primary stimulation between HK-Vs and FSSW subgroup. A slightly increased number of the circulating hemocytes occurred at 24 h in HK-Vs subgroup (Fig. 2B). After the secondary challenge with live V. splendidus, the new generated circulating hemocytes increased dramatically in HK-Vs + Vs subgroup at 6 h, and the number of labeled cells was about 4 times higher than that in the other three subgroups (ANOVA, p < 0.01). Subsequently it was temporary down-regulated of Brdu positive cells at 9 h post-infection due to the apoptosis aroused by host-pathogen immune response. Ultimately the counts of total hemocytes and new generated hemocytes returned to normal levels at 12 h post injection of secondary V. splendidus, probably indicating that total hemocyte counts always trend to a constant by hematopoiesis and apoptosis for homeostasis (Fig. 2B). 3.3. The specifically enhanced phagocytic activity of hemocytes after the secondary challenge with live V. splendidus The phagocytic activities including phagocytic rate (PR) and phagocytic index (PI) were determined by counting FITC labeled V. splendidus phagocytized in the cytoplasm of the hemocytes (Fig. 3A). After primary stimulation of heat-killed V. splendidus, the PR of hemocytes in HK-Vs subgroup continuously increased from 9 to 12 h and peaked at 9 and 12 h, then it dropped at 48 h and recovered to the original level after 7 days (Fig. 3B). After sec-

ondary challenge with live V. splendidus, the PRs of hemocytes were both obviously increased in FSSW + Vs and HK-Vs + Vs subgroup from 6 to 12 h, but PR in HK-Vs + Vs subgroup treated twice with V. splendidus was 1.13-fold higher (ANOVA, p < 0.01) than that of FSSW + Vs subgroup at 12 h (Fig. 3B). No significant difference was observed at other time-points between FSSW + Vs and HKVs + Vs subgroups, and there was no statistical difference in hemocyte phagocytic index among four subgroups at all time-points. (ANOVA, p > 0.05) (Fig. 3C). To confirm whether the enhanced phagocytic activity of hemocytes in HK-Vs + Vs subgroup was specific for V. splendidus, other four microorganisms were employed to examine the phagocytic activity of hemocytes of oysters at 12 h after the secondary challenge with live V. splendidus. After the secondary stimulation with live V. splendidus, the PRs of hemocytes in FSSW + Vs subgroup against V. coralliilyticus, Y. lipolytica and M. luteus did not change significantly compared to that of FSSW + FSSW, but the rate of V. anguillarum phagocytized was significantly enhanced (ANOVA, p < 0.05). However, the secondary challenge of V. splendidus didn’t arouse enhanced phagocytic activity against the four microorganisms in HK-Vs + Vs subgroup compared to FSSW + Vs subgroup. (Fig. 3D). Collectively, the results indicated that the enhanced phagocytosis of oyster hemocytes was specific against V. splendidus and it could discriminate various microoganisms after secondary challenge with V. splendidus.

3.4. The alternations of mRNA levels of phagocytosis and hemopoiesis associated genes after the secondary challenge with live V. splendidus Nine candidate genes involved in the process of phagocytosis and three genes participating in hemopoiesis were selected by referring to the mammalian and insect (Table 1). In addition, the transcriptome data analysis of oyster immune priming (unpublished data) was also referred to choice these genes as indicators. Their expressions after secondary challenge with live V. splendidus

T. Zhang et al. / Developmental and Comparative Immunology 45 (2014) 141–150

145

Fig. 2. The number of new generated circulating hemocytes of oysters at 6, 9, 12, 24 and 48 h following the stimulations. (A) Immunofluorescent staining for circulating hemocytes of oyster upon DAPI staining of nucleic acids (blue) and the second antibody used for BrdU labeled by Daylight 488 (green) under a fluorescence microscope (Zeiss, Germany). As the negative control, the blank group was without BrdU injection. The white arrows indicated BrdU-positive hemocytes observed in the same area. (B) The significant differences of circulating BrdU-positive hemocytes after primary stimulation of heat-killed V. splendidus and secondary challenge with live V. splendidus (mean ± SD; N = 3; the letters (a, b, c etc.) presented significant differences p < 0.05, ANOVA.). (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

were examined by Real-time PCR to investigate the possible mechanism of the specifically enhanced cellular immune responses. The expression levels of eight genes in HK-Vs + Vs subgroup were higher than that in the FSSW + Vs subgroup. Among them, the relative mRNA levels of CgIntegrin (Fig. 4A), CgPI3K (Fig. 4B), CgRho J (Fig. 4C), CgRab 32 (Fig. 4H), CgNADPH oxidase (Fig. 4I) and CgBMP 7 (Fig. 4L) increased significantly and peeked at 6 h in HK-Vs + Vs subgroup) compared with the FSSW + Vs subgroup (ANOVA, p < 0.01). It was 6 h earlier than that in the FSSW + Vs subgroup after the primary stimulation of V. splendidus which reached the peak at 12 h. The expression of CgMAPKK did not change significantly after the primary stimulation of V. splendidus, while its expression was significantly up-regulated at 12 h (13.69-fold, AN-

OVA, p < 0.01) after the secondary challenge of V. splendidus (Fig. 4 D). The expression of CgRunx 1 increased apparently after stimulation, and its expression level in HK-Vs + Vs subgroup was higher (ANOVA, p < 0.01) than that in FSSW + Vs subgroup at both 6 and 12 h (Fig. 4K). Although the primary stimulation of heat-killed V. splendidus aroused significantly high expressions of CgPKC (Fig. 4E) and CgMyosin (Fig. 4F) at 6 h (ANOVA, p < 0.01), their expressions in HK-Vs + Vs subgroup dramatically declined at 6 h after the secondary challenge of V. splendidus. The up-regulations of CgActin (Fig. 4G) and CgGATA 3 (Fig. 4J) were observed in FSSW + Vs and HK-Vs + Vs subgroups compared to the corresponding FSSW + FSSW and HK-VS + FSSW subgroups, but there was no statistically significant difference between the two subgroups.

146

T. Zhang et al. / Developmental and Comparative Immunology 45 (2014) 141–150

4. Discussion

Fig. 3. Effects of V. splendidus on hemocyte phagocytic activity of C. gigas oyster. (A) The FITC labeled V. splendidus (green) phagocytized by Evan’s blue-stained hemocytes (red) with DAPI staining of nucleic acids (blue) was clearly observed under the Zeiss Laser-Scanning Confocal Microscopy System LSM 710 (Zeiss, Jena, Germany). (B) The phagocytic rate and (C) phagocytic index in response to the primary stimulation of heat-killed V. splendidus and secondary challenge with live V. splendidus. (D) The comparison of hemocyte PR between V. splendidus and Vibrio anguillarum, Vibrio coralliilyticus, Yarrowia lipolytica, and Micrococcus luteus at 12 h after the secondary challenge with live V. splendidus. (the letters (a, b, c etc.) presented significant differences p < 0.05, ANOVA; mean ± SD; N = 3). (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

The controversy about the immunological memory in invertebrates has continued for many years, and several reports have suggested that invertebrates may possess some forms of immune memory, usually described as specific immune priming (Sadd and Schmid-Hempel, 2006) or immune priming (Moret, 2006). Most of the reports are focused on the phenomena of immune priming, such as increased survival or enhanced cellular and humoral immune responses (Rowley and Pope, 2012). But the detailed mechanisms of immune priming at molecular and cellular level are still not well understood. In the present study, the cellular and molecular responses against the primary and secondary stimulations of V. splendidus were investigated in Pacific oyster in order to find the possible mechanism of immune priming. The primary stimulation with heat-inactivated V. splendidus could arouse stronger immune responses of oyster when they encountered the secondary challenge of V. splendidus at the cellular and molecular levels, leading to the significant increase of THC, rapid regeneration of circulating hemocytes, specifically enhanced phagocytosis and high expressions of some important genes related to phagocytosis and hemopoiesis. Traditionally, functional immune adaptation is broadly defined as an immune response differing from a primary and secondary challenge. It was audaciously inferred that the primary stimulation of V. splendidus consequentially aroused persistent alterations in the oyster immune system, leading to immune priming and ultimately inducing the faster and stronger immune response against the secondary challenge of V. splendidus. The circulating hemocytes represent the primary effector components and play exceedingly important roles in immune responses. The concentration of these cells in the haemolymph, usually described as total hemocyte count (THC), always varies when the host encounters different pathogens in invertebrates (Comesana et al., 2012). In mosquitoes Anopheles gambiae, immune priming didn’t arouse significant difference in total number of hemocytes, but it gave rise to more circulating granulocytes by accelerating the differentiation of prohemocyte precursors. Accordingly, it was thought that quantitative and qualitative differentiation of hemocytes was a necessary process to endow immune memory in mosquitoes (Rodrigues et al., 2010). In the present study, the heat-killed V. splendidus aroused a gradual increase of THC and the primed oysters displayed significantly higher THC at 6 h and peaked earlier than non-immuned oysters after the secondary challenge with live V. splendidus, and the THC recovered to the original level after 9 h post-infection, suggesting that the primed oyster responded faster and more strongly in the transient increase of THC than the unprimed group. Similarly, the acute increase of THC or a certain hemocytes sub-population has been reported in other mollusks after challenge (Parisi et al., 2008). It is reported that in vertebrate, the transient increase of THC might be result from the rapid regeneration of hemocytes via hematopoiesis. However, in invertebrate, variations of hemocytes concentration may result either from a hematopoietic process, or from hemocytes mobilization from surrounding tissues into the circulatory system that would change the number of circulating hemocytes in response to host-pathogen interactions. The phenomenon, mobilization and migration of resident hemocytes from tissues into the hemolymph, also called hemocytosis, is suspected to be linked with the structure of the circulatory compartment in bivalves (Labreuche et al., 2006). It was inferred from the present results that immune priming could trigger the increase of oyster hemocytes against reinfection of V. splendidus, and further investigations are needed to clarify the potential mechanism (i.e. hematopoiesis vs. hemocytosis) contributed to the noticed changes.

T. Zhang et al. / Developmental and Comparative Immunology 45 (2014) 141–150

147

Fig. 4. Relative expression of phagocytosis and hemopoiesis-related genes. The mRNA expressions of (A) CgIntegrin, (B) CgPI3K, (C) CgRho J, (D) CgMAPKK, (E) CgPKC, (F) CgMyosin, (G) CgActin, (H) CgRab 32, (I) CgNADPH oxidase, (J) CgGATA 3, (K) CgRunx 1 and (L) CgBMP 7 were measured in oysters collected 0, 6, 12 h following the secondary challenge with live V. splendidus. Significant differences comparison of the level of mRNA was performed by ANOVA (mean ± SD, N = 4; the letters (a, b, c etc.) presented significant differences, p < 0.05).

148

T. Zhang et al. / Developmental and Comparative Immunology 45 (2014) 141–150

The blood cells (hemocytes in oyster) always regenerate through the proliferation and differentiation of hematopoietic tissue or stem cells in many organisms (Weissman, 2000). The circulating hemocytes of invertebrates are essential for immune responses and the new generated circulating hemocytes are continually produced and released from hematopoietic tissues (Söderhäll et al., 2003). Thus, hematopoiesis is a crucial and vital process for the immune response against infection in invertebrate animals. In Anopheles gambiae, transfer of hemolymph from the primed mosquitoes increased the relative abundance of circulating granulocytes in the recipients. It was proposed that some soluble hemocyte differentiation factor in the hemolymph from primed mosquitoes could induce hemocytes proliferation and differentiation of recipients (Rodrigues et al., 2010). In the present study, the number of new generated circulating hemocytes was monitored after primary and secondary stimulations of V. splendidus. The new generated circulating hemocytes in the oysters immunized by heat-killed V. splendidus increased dramatically at 6 h after the secondary challenge of V. splendidus. Vertebrate immune memory mainly relys on clonal expansion of memory cells which remain quiescent for a long time before they are reactivated following secondary challenge. So far, there have been no reports about the discovery of similar cells with memory functions in invertebrate immune priming. The analogous phenomenon of abundant cell proliferation by hemopoiesis in oyster aroused a great interest for us to take a fresh look at immune priming. It was speculated that the immunization by V. splendidus in oyster induced hemopoiesis to generate some specific cells or molecules. When the immunized oyster encountered the V. splendidus once again, those cells or molecules would trigger tremendously hemocytes proliferation, resulting in the stronger and faster immune responses. Phagocytosis is fundamentally important for the survival of invertebrates and it is initially triggered to respond against the invaded pathogen. In innate immunity, phagocytosis is an indispensable mechanism to eliminate the invading microorganisms by cells recognization, binding and ingesting relatively large particles. It includes the process of phagocytic receptors recognition, and the signaling pathways activation leading to the dramatic changes in the dynamics of the plasma membrane and the cytoskeleton (Rosales, 2011). Phagocytosis was thought to be related with immune priming and usually considered as the vital cellular immune parameter. It was reported that the phagocytosis of hemocytes significantly increased against the reinfection of pathogens and the increased phagocytic responses have features of specificity to recognize the same pathogen in the immune priming of Drosophila (Pham et al., 2007), woodlouse (Roth and Kurtz, 2009), shrimp (Litopenaeus vannamei) (Pope et al., 2011) and American lobster (Mori and Stewart, 2006). When the phagocytosis was blocked by injection of polysterene beads before or after the primary primed infection of Streptococcus pneumoniae, the protective effect of immune priming disappeared in Drosophila, and phagocytosis was therefore considered to be the critical performer in the priming response (Pham et al., 2007). In the present study, the primary stimulation with heat-killed V. splendidus also significantly enhanced the phagocytic rate of hemocytes in oysters at 12 h after they encountered the secondary challenge with live V. splendidus. The enhanced phagocytosis effect was observed later than the increase of the regenerated hemocytes and THC appeared in the primed group. It was suspected that the lagging increase in phagocytic rate is due to that it will take some time for regenerated hemocytes to approach and recognize the V. Splendidus. In addition, the enhanced phagocytosis displayed high specificity to distinguish the V. splendidus from V. anguillarum, V. coralliilyticus, Y. lipolytica and M. luteus. It indicated that the oyster immunized by heat-killed V. splendidus could induce stronger phagocytosis and the enhanced phgocytic re-

sponses was highly specific to recognize and kill V. splendidus more efficiently. In the current study, the expressions of nine putative genes involved in the process of phagocytosis were measured to provide insight into the molecular mechanisms of immune priming in the Pacific oyster. Among them, the relative expression levels of CgIntegrin, CgPI3K, CgRho J, CgMAPKK, CgRab 32, and CgNADPH oxidase increased significantly after secondary challenge with V. splendidus compared with the primary stimulation of heat-killed V. splendidus. As well, almost all of genes with a higher expression level in hemocytes of primed oyster had been up-regulated before 12 h. This could partly explain why the increase of phagocytic rate was visible at 12 h post challenge. However, the secondary challenge with V. splendidus did not arouse significant changes in expression levels of CgPKC, CgMyosin, and CgActin in the primed oyster hemocytes. In many invertebrates, the infection of pathogens always induces an increased expression and multimerization or combinations of recognition receptors (Schulenburg et al., 2007). It has been reported that the phagocytosis of hemocytes in the primed insects was elevated when they encountered the homologous pathogen by enhancing the generation of receptors (Rowley and Powell, 2007). In Pacific oyster, integrin serving as a receptor for Cg-EcSOD was proved to be involved in hemocyte phagocytosis against pathogen V. splendidus (Duperthuy et al., 2011; Terahara et al., 2006). In the present study, the up-regulated expression of receptor CgIntegrin occurred earlier and which was even higher in primed oyster hemocytes following the secondary challenge with V. splendidus than that induced by the primary stimulation. It suggested that the biosynthesis of integrin in the primed oyster hemocytes might be improved to mediate a faster and more specific phagocytic response to eliminate the V. splendidus. However, the main signaling pathways downstream following the recognition of V. splendidus by integrin in oyster are still not clear. In mammal, it has been well described that integrin activates cytoplasmic tyrosine kinases and stimulates the intracellular signaling pathways to initiate the actin based cytoskeletal rearrangement and NADPH oxidase activation, eventually resulting in activation of phagocyte effectors. There are three main signaling pathways mediated by integrin in phagocytosis including phospholipase C (PLC) pathway, which induces PKC activation; PI3K pathway, which leads to activation of the Rho family of small GTPases, and MAPK cascades induced by Ras GTPase (Berton and Lowell, 1999). In the present study, the expression of some important genes involved in integrin signaling pathways, including PI3K (Ireton et al., 1996), Rho (Hall, 1998), MAPKK (Raeder et al., 1999) and PKC (Allen and Aderem, 1996; Walker et al., 2010), some cytoskeletal proteins implicated in phagosome maturation such as myosin (Mansfield et al., 2000), actin (Via et al., 1997), and Rab (Stendahl et al., 1980; Ye et al., 2012), and the essential enzyme NADPH oxidase (DeLeo et al., 1999) was surveyed by quantitative real-time PCR. The mRNA expression levels of CgPI3K, CgRho J, CgMAPKK and CgRab 32, which were considered as signaling pathway components reference to other animals, were enhanced significantly in primed oyster hemocytes at 6 h and/or 12 h following the secondary challenge with V. splendidus. It was suggested that the primed oysters could specifically and selectively up-regulate the expression of these genes to activate PI3K signaling pathway and MAPK cascades and mount an effective immune response against the reinfection of V. Splendidus. While the expression of CgPKC did not change significantly after the secondary challenge with V. splendidus, suggesting that PI3K signaling pathway might not respond against the secondary infection of V. Splendidus. In addition, the phagocytic rates of invertebrate hemocytes were also observed to be heightened by proliferation of hemocytes upon secondary exposure to pathogen (Rowley and Powell, 2007). The phagocytic index exhibited phagocytic ability of phagocyte,

T. Zhang et al. / Developmental and Comparative Immunology 45 (2014) 141–150

which was calculated by the average number of microorganisms phagocytized per phagocyte, and it depended on the phagocytic receptor (Wright et al., 1983). In the present study, although there was no statistical difference in the phagocytic index in primed group compared to the unprimed group, the phagocytic rate, the expression of receptor CgIntegrin and amount of hemocytes were all increased in primed group. It was suspected that the primed oysters might not rely on the up-regulated expression of phagocytic receptor from a single hemocytes to improve phagocytic ability, but depend on the accelerating hemocytes proliferation to increase the receptor CgIntegrin and phagocytic ability. The proliferation of invertebrates circulating hemocytes is usually based on hematopoiesis which is a complex process involving many cytokines, transcription factors, morphogens and some key signaling pathways. Some intrinsic transcription factors (such as Scl, GATA and Runx 1 et al.) and extrinsic regulators (morphogens such as FGF, Hh and BMPs) are reported to be related to the hematopoietic process (Kaimakis et al., 2013). In the present study, the relative expression levels of Runx 1 and BMP 7 probably involved in the hemopoiesis referring to the mammalian and insect (Crozatier and Meister, 2007; Grassinger et al., 2007; Miranda-Saavedra and Göttgens, 2008) was elevated at 6 h after the secondary challenge with V. splendidus in primed oyster hemocytes. It was inferred that the oyster immunized by heat-killed V. splendidus might commence hemocytes proliferation by selectively up-regulating the hematopoietic relative genes CgRunx 1 and CgBMP 7 after the secondary challenge, leading to rapid receptor recognition and strong phagocytic responses against the infection of V. splendidus. As a conclusion, immune priming was confirmed to exist in the Pacific oyster, and the primary stimulation of heat-killed V. splendidus aroused the increase in total number and rapid regeneration of circulating hemocytes, and specifically enhanced phagocytosis against the secondary challenge with V. splendidus. The immune priming may be dependent on the highly expressed integrin and rapid hemopoiesis, which would enable oyster to eliminate the re-emerging infectious V. Splendidus more quickly, specifically and selectively. Although it may not be sufficient to address immune priming, the present study would provide further insights into the important roles of the phagocytosis and hemopoiesis in the generation of immune priming in invertebrates and evolution of immune memory. Acknowledgements The authors are grateful to all the laboratory members for the technical advice and helpful discussion. This research was supported by a Grant (No. 30925028) from National Science Foundation of China, and National Basic Research Program of China (973 Program, No. 2010CB126404), and a Grant from Shandong Provincial Natural Science Foundation (No. JQ201110). References Allen, L., Aderem, A., 1996. Molecular definition of distinct cytoskeletal structures involved in complement-and Fc receptor-mediated phagocytosis in macrophages. J. Exp. Med. 184, 627–637. Berton, G., Lowell, C.A., 1999. Integrin signalling in neutrophils and macrophages. Cell. Signal. 11, 621–635. Comesana, P., Casas, S.M., Cao, A., Abollo, E., Arzul, I., Morga, B., Villalba, A., 2012. Comparison of haemocytic parameters among flat oyster Ostrea edulis stocks with different susceptibility to bonamiosis and the Pacific oyster Crassostrea gigas. J. Invert. Pathol. 109, 274–286. Cong, M., Song, L., Wang, L., Zhao, J., Qiu, L., Li, L., Zhang, H., 2008. The enhanced immune protection of Zhikong scallop Chlamys farreri on the secondary encounter with Listonella anguillarum. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 151, 191–196. Crozatier, M., Meister, M., 2007. Drosophila haematopoiesis. Cell. Microbiol. 9, 1117–1126. DeLeo, F.R., Allen, L.-A.H., Apicella, M., Nauseef, W.M., 1999. NADPH oxidase activation and assembly during phagocytosis. J. Immunol. 163, 6732–6740.

149

Dong, Y., Taylor, H.E., Dimopoulos, G., 2006. AgDscam, a hypervariable immunoglobulin domain-containing receptor of the Anopheles gambiae innate immune system. PLoS. Biol. 4, e229. Dunn, P.E., 1986. Biochemical aspects of insect immunology. Annu. Rev. Entomol. 31, 321–339. Duperthuy, M., Schmitt, P., Garzón, E., Caro, A., Rosa, R.D., Le Roux, F., LautrédouAudouy, N., Got, P., Romestand, B., De Lorgeril, J., 2011. Use of OmpU porins for attachment and invasion of Crassostrea gigas immune cells by the oyster pathogen Vibrio splendidus. Proc. Natl. Acad. Sci. USA 108, 2993–2998. Flajnik, M.F., Du Pasquier, L., 2004. Evolution of innate and adaptive immunity: can we draw a line? Trends Immunol. 25, 640–644. Grassinger, J., Simon, M., Mueller, G., Drewel, D., Andreesen, R., Hennemann, B., 2007. Bone morphogenetic protein (BMP)-7 but not BMP-2 and BMP-4 improves maintenance of primitive peripheral blood-derived hematopoietic progenitor cells (HPC) cultured in serum-free medium supplemented with early acting cytokines. Cytokine 40, 165–171. Green, T.J., Montagnani, C., 2013. Poly I: C induces a protective antiviral immune response in the Pacific oyster (Crassostrea gigas) against subsequent challenge with Ostreid herpesvirus (OsHV-1 lvar). Fish Shellfish Immunol. 35, 382–388. Hall, A., 1998. Rho GTPases and the actin cytoskeleton. Science 279, 509–514. Ireton, K., Payrastre, B., Chap, H., Ogawa, W., Sakaue, H., Kasuga, M., Cossart, P., 1996. A role for phosphoinositide 3-kinase in bacterial invasion. Science 274, 780–782. Kaimakis, P., Crisan, M., Dzierzak, E., 2013. The biochemistry of hematopoietic stem cell development. Biochim. Biophys. Acta 1830, 2395–2403. Kurtz, J., 2004. Memory in the innate and adaptive immune systems. Microbes Infect. 6, 1410–1417. Kurtz, J., Franz, K., 2003. Innate defence: evidence for memory in invertebrate immunity. Nature 425, 37–38. Labreuche, Y., Lambert, C., Soudant, P., Boulo, V., Huvet, A., Nicolas, J.L., 2006. Cellular and molecular hemocyte responses of the Pacific oyster, Crassostrea gigas, following bacterial infection with Vibrio aestuarianus strain 01/32. Microbes Infect. 8, 2715–2724. Lackie, A.M., 1980. Invertebrate immunity. Parasitology 80, 393–412. Lemaitre, B., Reichhart, J.-M., Hoffmann, J.A., 1997. Drosophila host defense: differential induction of antimicrobial peptide genes after infection by various classes of microorganisms. Proc. Natl. Acad. Sci. USA 94, 14614–14619. Little, T.J., Kraaijeveld, A.R., 2004. Ecological and evolutionary implications of immunological priming in invertebrates. Trends Ecol. Evol. 19, 58–60. Little, T.J., O’Connor, B., Colegrave, N., Watt, K., Read, A.F., 2003. Maternal transfer of strain-specific immunity in an invertebrate. Curr. Biol. 13, 489–492. Liu, R., Qiu, L., Yu, Z., Zi, J., Yue, F., Wang, L., Zhang, H., Teng, W., Liu, X., Song, L., 2013. Identification and characterisation of pathogenic Vibrio splendidus from Yesso scallop (Patinopecten yessoensis) cultured in a low temperature environment. J. Invert. Pathol. 114, 144–150. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2DDCT method. Methods 25, 402–408. Mansfield, P.J., Shayman, J.A., Boxer, L.A., 2000. Regulation of polymorphonuclear leukocyte phagocytosis by myosin light chain kinase after activation of mitogen-activated protein kinase. Blood 95, 2407–2412. Miranda-Saavedra, D., Göttgens, B., 2008. Transcriptional regulatory networks in haematopoiesis. Curr. Opin. Genet. Dev. 18, 530–535. Moret, Y., 2006. ‘Trans-generational immune priming’: specific enhancement of the antimicrobial immune response in the mealworm beetle, Tenebrio molitor. Proc. R. Soc. B Biol. Sci. 273, 1399–1405. Mori, K., Stewart, J.E., 2006. Immunogen-dependent quantitative and qualitative differences in phagocytic responses of the circulating hemocytes of the lobster Homarus americanus. Dis. Aquat. Organ. 69, 197–203. Ottaviani, E., 2011. Is the distinction between innate and adaptive immunity in invertebrates still as clear-cut as thought? Ital. J. Zool. 78, 274–278. Parisi, M.-G., Li, H., Jouvet, L.B., Dyrynda, E.A., Parrinello, N., Cammarata, M., Roch, P., 2008. Differential involvement of mussel hemocyte sub-populations in the clearance of bacteria. Fish Shellfish Immunol. 25, 834–840. Pham, L.N., Dionne, M.S., Shirasu-Hiza, M., Schneider, D.S., 2007. A specific primed immune response in Drosophila is dependent on phagocytes. PLoS Pathog. 3, e26. Pope, E.C., Powell, A., Roberts, E.C., Shields, R.J., Wardle, R., Rowley, A.F., 2011. Enhanced cellular immunity in shrimp (Litopenaeus vannamei) after ‘vaccination’. PloS one 6, e20960. Raeder, E.M., Mansfield, P.J., Hinkovska-Galcheva, V., Shayman, J.A., Boxer, L.A., 1999. Syk activation initiates downstream signaling events during human polymorphonuclear leukocyte phagocytosis. J. Immunol. 163, 6785–6793. Rodrigues, J., Brayner, F.A., Alves, L.C., Dixit, R., Barillas-Mury, C., 2010. Hemocyte differentiation mediates innate immune memory in Anopheles gambiae mosquitoes. Sci. Signal. 329, 1353. Rolff, J., Siva-Jothy, M., 2003. Ecological immunology: an invertebrate perspective. Science 301, 472–475. Rosales, C., 2011. Phagocytosis, a cellular immune response in insects. Invert. Survival J. 8, 109–131. Roth, O., Joop, G., Eggert, H., Hilbert, J., Daniel, J., Schmid-Hempel, P., Kurtz, J., 2010. Paternally derived immune priming for offspring in the red flour beetle, Tribolium castaneum. J. Anim. Ecol. 79, 403–413. Roth, O., Kurtz, J., 2009. Phagocytosis mediates specificity in the immune defence of an invertebrate, the woodlouse Porcellio scaber (Crustacea: Isopoda). Dev. Comp. Immunol. 33, 1151–1155. Rowley, A.F., Pope, E.C., 2012. Vaccines and crustacean aquaculture—A mechanistic exploration. Aquaculture 334, 1–11.

150

T. Zhang et al. / Developmental and Comparative Immunology 45 (2014) 141–150

Rowley, A.F., Powell, A., 2007. Invertebrate immune systems–specific, quasispecific, or nonspecific? J. Immunol. 179, 7209–7214. Söderhäll, I., Bangyeekhun, E., Mayo, S., Söderhäll, K., 2003. Hemocyte production and maturation in an invertebrate animal; proliferation and gene expression in hematopoietic stem cells of Pacifastacus leniusculus. Dev. Comp. Immunol. 27, 661–672. Sadd, B.M., Schmid-Hempel, P., 2006. Insect immunity shows specificity in protection upon secondary pathogen exposure. Curr. Biol. 16, 1206–1210. Saha, N.R., Smith, J., Amemiya, C.T., 2010. Evolution of adaptive immune recognition in jawless vertebrates. Semin. Immunol. 22, 25–33. Schulenburg, H., Boehnisch, C., Michiels, N.K., 2007. How do invertebrates generate a highly specific innate immune response? Mol. Immunol. 44, 3338–3344. Stendahl, O.I., Hartwig, J.H., Brotschi, E.A., Stossel, T.P., 1980. Distribution of actinbinding protein and myosin in macrophages during spreading and phagocytosis. J. Cell Biol. 84, 215–224. Sun, R., Qiu, L., Yue, F., Wang, L., Liu, R., Zhou, Z., Zhang, H., Song, L., 2012. Hemocytic immune responses triggered by CpG ODNs in Shrimp Litopenaeus vannamei. Fish Shellfish Immunol. 34, 38–45. Terahara, K., Takahashi, K.G., Nakamura, A., Osada, M., Yoda, M., Hiroi, T., Hirasawa, M., Mori, K., 2006. Differences in integrin-dependent phagocytosis among three hemocyte subpopulations of the Pacific oyster ‘‘Crassostrea gigas’’. Dev. Comp. Immunol. 30, 667–683. Turvey, S.E., Broide, D.H., 2010. Innate immunity. J. Allergy Clin. Immunol. 125, S24– S32. Via, L.E., Deretic, D., Ulmer, R.J., Hibler, N.S., Huber, L.A., Deretic, V., 1997. Arrest of mycobacterial phagosome maturation is caused by a block in vesicle fusion between stages controlled by rab5 and rab7. J. Biol. Chem. 272, 13326–13331. Vierstraete, E., Verleyen, P., Sas, F., Van den Bergh, G., De Loof, A., Arckens, L., Schoofs, L., 2004. The instantly released Drosophila immune proteome is infection-specific. Biochem. Biophys. Res. Commun. 317, 1052–1060. Walker, A.J., Lacchini, A.H., Sealey, K.L., Mackintosh, D., Davies, A.J., 2010. Spreading by snail (Lymnaea stagnalis) defence cells is regulated through integrated PKC, FAK and Src signalling. Cell Tissue Res. 341, 131–145.

Wang, G., Zhang, S., Wang, Z., 2009. Responses of alternative complement expression to challenge with different combinations of Vibrio anguillarum, Escherichia coli and Staphylococcus aureus: evidence for specific immune priming in amphioxus Branchiostoma belcheri. Fish Shellfish Immunol. 26, 33– 39. Wang, J., Wang, L., Yang, C., Jiang, Q., Zhang, H., Yue, F., Huang, M., Sun, Z., Song, L., 2013. The response of mRNA expression upon secondary challenge with Vibrio anguillarum suggests the involvement of C-lectins in the immune priming of scallop Chlamys farreri. Dev. Comp. Immunol. 40, 142–147. Weissman, I., 2000. Stem cells: units of development, review units of regeneration, and units in evolution. Cell 100, 157–168. Witteveldt, J., Cifuentes, C.C., Vlak, J.M., van Hulten, M.C., 2004. Protection of Penaeus monodon against white spot syndrome virus by oral vaccination. J. Virol. 78, 2057–2061. Wright, S.D., Rao, P.E., Van Voorhis, W.C., Craigmyle, L.S., Iida, K., Talle, M.A., Westberg, E.F., Goldstein, G., Silverstein, S.C., 1983. Identification of the C3bi receptor of human monocytes and macrophages by using monoclonal antibodies. Proc. Natl. Acad. Sci. USA 80, 5699–5703. Wu, W., Zong, R., Xu, J., Zhang, X., 2007. Antiviral phagocytosis is regulated by a novel Rab-dependent complex in shrimp Penaeus japonicus. J. Proteome Res. 7, 424–431. Ye, T., Tang, W., Zhang, X., 2012. Involvement of Rab6 in the regulation of phagocytosis against virus infection in invertebrates. J. Proteome Res. 11, 4834– 4846. Zhang, G., Fang, X., Guo, X., Li, L., Luo, R., Xu, F., Yang, P., Zhang, L., Wang, X., Qi, H., 2012. The oyster genome reveals stress adaptation and complexity of shell formation. Nature 490, 49–54. Zhang, S.-M., Adema, C.M., Kepler, T.B., Loker, E.S., 2004. Diversification of Ig superfamily genes in an invertebrate. Science 305, 251–254. Ziauddin, J., Schneider, D.S., 2012. Where does innate immunity stop and adaptive immunity begin? Cell Host Microbe 12, 394–395.