- Email: [email protected]
Up-regulation of immunoglobulin G gene expression in the hippocampus of rats subjected to acute immobilization stress
Journal of Neuroimmunology 258 (2013) 1–9
Contents lists available at SciVerse ScienceDirect
Journal of Neuroimmunology journal homepage: www.elsevier.com/locate/jneuroim
Up-regulation of immunoglobulin G gene expression in the hippocampus of rats subjected to acute immobilization stress☆ Sheng Wang a, b, 1, Guowei Huang a, 1, Yun Wang a, Tao Huang a, Shuiqin Lin a, Jiang Gu a,⁎ a b
Provincial Key Laboratory of Infectious Diseases and Immunopathology, Department of Pathology and Pathophysiology, Shantou University Medical College, Shantou, Guangdong, China Mental Health Center of Shantou University Medical College, Shantou, Guangdong, China
a r t i c l e
i n f o
Article history: Received 8 November 2012 Received in revised form 11 February 2013 Accepted 12 February 2013 Keywords: Hippocampus Acute stress Immunoglobulin G Laser microdissection Western blot Real-time RT-PCR
a b s t r a c t Immunoglobulin G (IgG) is thought to be produced by matured B lymphocytes, however, it was recently found to be synthesized in neurons of the brain, especially showing higher expression level in the hippocampus. To study the possible effects of IgG in the hippocampus, we examined IgG protein and mRNA expressions in rat hippocampal neurons with immunohistochemistry, immunofluorescence, in situ hybridization and laser microdissection-assisted RT-PCR. Increased IgG expressions at both protein and mRNA levels were detected in the hippocampus of an acute immobilization stress model of rat. No change was observed in the cortex or the thalamus. Furthermore, the microtubule-associated protein 2 (MAP2) and β III tubulin proteins did not show significant changes. Based on these findings, we hypothesize that hippocampal IgG may play a key role in adverse circumstances such as stress. The finding of increased IgG expression in the hippocampus following stress may also provide possibilities for developing antidepressant medication. © 2013 Elsevier B.V. All rights reserved.
1. Introduction Marked changes in metabolism and pathological consequences have been reported in the hippocampus under acute stress, which has immediate and lasting impact on the psychological and cognitive functions of the brain (McEwen, 1999; Hauser et al., 2008). It has been documented that IgG is a neuroprotective agent (Lapointe et al., 2004; Hulse et al., 2008). IgG is also known to have therapeutic effects in many neurological diseases, such as epilepsy, stroke and multiple sclerosis (van Engelen et al., 1994; Dalakas, 2004; Arumugam et al., 2007). Administration of intravenous immunoglobulin (IVIG) has down-regulatory effects on IL-1β (Aukrust et al., 1999). Several investigators have found that the brain expresses immunoglobulin G, and the dentate gyrus showed the most IgG immunoreactivity with immunohistochemistry (Huang et al., 2008). Therefore, the current study was undertaken to test the hypothesis that in rats there is
☆ Grant sponsor: National Nature Science Foundation of China. Grant number: Nos. 81030033, 81102280, 30971150, 81001199, and 30950110335. ⁎ Corresponding author at: Provincial Key Laboratory, Department of Pathology and Pathophysiology, Shantou University Medical College, 22 Xinling Road, Shantou, Guangdong 515041, China. Tel.: +86 18688002602; fax: +86 754 8895 0293. E-mail addresses: [email protected] (S. Wang), [email protected] (G. Huang), [email protected] (Y. Wang), [email protected] (T. Huang), [email protected] (S. Lin), [email protected] (J. Gu). 1 The first two authors contributed equally to this work. 0165-5728/$ – see front matter © 2013 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.jneuroim.2013.02.003
a correlation between stress and brain IgG expression. We present evidence to prove this hypothesis and to elucidate the possible molecular and cellular mechanisms of IgG production in the brain under acute stress condition.
2. Materials and methods 2.1. Animals Adult male Sprague Dawley rats (300–350 g) were obtained from the Animal Center of Shantou University Medical College and housed three per cage in clear polycarbonate cages with wood chip bedding. All animals were maintained on a 12 h light–dark cycle (lights on at 8:00 AM) and the temperature was kept at 21 ± 2 °C with food and water provided ad libitum. Care and use of the animals were approved by the Animal Care and Use Committee of Shantou University Medical College.
2.2. IgG gene expression in hippocampus of rats 2.2.1. Tissue preparation Animals were anesthetized with isoflurane (5%) and perfused intracardially with 4% paraformaldehyde in phosphate buffered saline (PBS, pH 7.4). The brains were postfixed in the same fixative overnight at 4 °C, rinsed in PBS, embedded in paraffin, and cut into 3 μm-thick serial sections.
2
S. Wang et al. / Journal of Neuroimmunology 258 (2013) 1–9
2.2.2. Immunohistochemistry Immunohistochemistry was performed as described previously (Niu et al., 2010). Briefly, deparaffinized and rehydrated tissue sections were incubated with 3% hydrogen peroxide for 10 min to block the intrinsic peroxidase. Antigen retrieval was performed by heating the slides in an autoclave at 120 °C for 3 min in 0.01 M citric acid buffer (pH 6.0). Sections were then washed with PBS, and incubated overnight at 4 °C with polyclonal rabbit anti-rat IgG antibody (1:100; Abcam, Cambridge, UK), mouse monoclonal anti-NeuN antibody (1:200; Chemicon, Billerica, MA USA) and mouse monoclonal anti-glial fibrillary acidic protein (GFAP) antibody (1:200; Cell Signaling Technology, Danvers, MA USA). Following rinsing in PBS, sections were incubated with horseradish peroxidase (HRP)-conjugated goat anti-rabbit or goat anti-mouse IgG (1:200, Zymed Laboratories, CA USA) for 30 min at 37 °C and the reaction was detected with diaminobenzidine tetrahydrochloride (DAB) (Dako, Carpinteria CA, USA). All sections were counterstained with hematoxylin. PBS was used in place of the primary antibody as a negative control. 2.2.3. Specificity of anti rat IgG antibody The specificity of anti rat IgG antibody was examined by preabsorption test as previously reported (Matsui et al., 1994). Deparaffinized and rehydrated tissue sections were incubated with 3% hydrogen peroxide for 10 min to block the intrinsic peroxidase. Antigen retrieval was performed by heating the slides in an autoclave at 120 °C for 3 min in 0.01 M citric acid buffer (pH 6.0). Sections were then washed with PBS, and incubated (overnight at 4 °C) in polyclonal rabbit anti-rat IgG antibody (1:100; Abcam, Cambridge, UK) with rat IgG (31933, Thermo Scientific Pierce Biotech, Illinois, USA) in a concentration of 0.02, 0.05, 0.1, 0.2 mg/ml. PBS was used for the control sections. Following rinsing in PBS, sections were incubated with horseradish peroxidase (HRP)-conjugated goat anti-rabbit or goat anti-mouse IgG (1:200, Zymed Laboratories, CA USA) for 30 min at room temperature, and the stains were developed with 3-Amino-9Ethylcarbazole (AEC). 2.2.4. Double immunofluorescence For double-label immunofluorescence experiments, sections were fixed in 4% (wt./vol.) PBS-buffered paraformaldehyde, then blocked for 1 h in PBS containing 10% donkey serum. To examine the relationship between IgG and neurons, the sections were reacted with a mixture of FITC-labeled goat anti-rat IgG antibody and mouse monoclonal anti-NeuN antibody followed by donkey anti-mouse IgG secondary antibody conjugated with NL557 which gives a red fluorescence. To examine the relationship between IgG and glial cells, the sections were reacted with a mixture of FITC-labeled goat anti-rat IgG antibody and mouse monoclonal anti-GFAP antibody followed by donkey anti-mouse IgG-NL557. PBS instead of primary antibody was used as a negative control. The nuclei were stained with 4', 6-diamidino-2-phenylindole (DAPI) (Vectashield, vector laboratories, Burlingame, CA USA). Images were captured using a confocal microscope (Olympus FV1000, Japan). 2.2.5. In situ hybridization In situ hybridization was performed as described previously (Chen et al., 2009) with modifications. 2.2.5.1. cRNA probe synthesis. Rat spleen was collected and washed with 0.01 M PBS. Total RNA was extracted with Trizol (Invitrogen, CA USA), and reverse transcription of total RNA was performed with random primers using an FSK-100 RT kit (Toyobo, Osaka Japan) according to the manufacturer's instructions. PCR primers used for amplifying the constant region of the IgG1 heavy chain (IgG2a) is shown as follows: Forward primer: 5′-TGGAAGTCCACACAGCTCAG-3′ and reverse primer: 5′-TCTGGGGGATAGAAGCCTTT-3′. The expected 282 bp PCR product was subcloned into the pGM-T vector and the identity of the plasmid was confirmed by DNA sequencing. The plasmid was linearized
with NcoI or SalI and transcripted with T7 or Sp6 RNA polymerase to generate antisense or sense probes, respectively, in the presence of digoxigenin-labeled rUTP (Roche, Rotkreuz Switzerland). 2.2.5.2. In situ hybridization. Deparaffinized, dehydrated tissue sections (3 μm) were immersed in 0.1% diethylpyrocarbonate (DEPC) for 1 h, and heated to 95 °C in a microwave oven in 0.01 M DEPC-treated citrate buffer (pH 6.0) for 12 min. Slides were cooled to room temperature, immersed in 0.2 M HCl for 20 min, washed with DEPC-treated PBS, and treated with 0.3% Triton X-100 in DEPC-treated PBS for 10 min and 10 μg/ml proteinase K treated slides at 37 °C for 20 min. The tissue sections were fixed in 4% paraformaldehyde for 10 min, and hybridized overnight at 45 °C with the rat IgG2a RNA probe in a hybridization solution. After hybridization, sections were washed in 2 × SSC + 50% formamide for 30 min and 2 × SSC twice for 15 min (37 °C), then incubated with alkaline phosphatase-conjugated antidigoxigenin antibody (1:500; Roche). 5-Bromo-4-chloro-3-indolyl phosphate and nitro-blue-tetrazolium (NBT, Sigma) were used for color development. For controls, slides were incubated with the corresponding sense probe. 2.2.6. Combination of in situ hybridization with immunohistochemistry To demonstrate cell types that contain IgG mRNA, immunostaining with specific cell markers was performed after in situ hybridization using a previously described protocol (Newton et al., 2002). To use this method, sections were first processed through the in situ hybridization procedures as above. After color reaction, the sections were incubated with primary antibodies (mouse anti-rat NeuN or mouse anti-rat GFAP) diluted in blocking solution over night at 4 °C with gentle shaking. After washing three times in PBS, the tissue sections were incubated in horseradish peroxidase (HRP)-labeled secondary antibodies diluted in blocking buffer for 1 h. Following by three 5-min washes in PBS, the sections stains were developed with 3-Amino-9-Ethylcarbazole (AEC). For controls, slides were incubated with the corresponding sense probe. 2.2.7. Laser microdissection assisted RT-PCR Animals were perfused with PBS (pH 7.4). Brains were snap-frozen in liquid nitrogen. Ten micrometer thick sections were cut coronally and mounted onto membrane slides (Leica Microsystems, Germany). Samples were fixed with 95% ethanol for 20 s, stained with 4% cresyl violet (dissolved in 75% ethanol, Sigma) for 10 s, and then rinsed three times with 100% ethanol and twice with xylene. Approximately 15 neurons of dentate gyrus were captured by laser microdissection with a Leica microdissection System (LMD 7000) and placed in 10 μl of DNase I buffer + 3% NP-40 (Invitrogen, CA, USA), then incubated at 42 °C for 20 min. The mixture was treated with DNase I, followed by reverse transcription with a Superscript III First Strand Kit (Invitrogen, CA, USA). An initial PCR amplification was immediately performed using the following protocol: denaturation at 95 °C for 30 s, annealing at 60 °C for 30 s, and extension at 72 °C for 1 min (30 cycles). The first round PCR mixture was used in the second amplification step in a nested PCR protocol, under the same condition as for the first round PCR. To demonstrate that IgG mRNA is from hippocampal neurons, and not from other cell types, several cell markers were employed. They included CD19 for B lymphocyte, CD34 for vascular endothelial cell, CD38 for plasma cells, CD68 for macrophages, neuron-specific enolase (NSE) for neurons, myelin basic protein (MBP) for oligodendrocyte, GFAP for astrocytes, and ionized calcium-binding adaptor molecule 1 (IBA-1) for microglia. Total RNA was extracted from brain and spleen tissues. Brain RNA was used as positive controls for MBP, GFAP, and IBA-1. Spleen RNA was used as positive controls for CD19, CD34, CD38, and CD68. Water was used as a negative control. PCR amplification conditions were denaturation at 95 °C for 30 s, annealing at 60 °C for 30 s and extension at 72 °C for 30 s for 40 cycles (see Table 1 for PCR primer sequences).
S. Wang et al. / Journal of Neuroimmunology 258 (2013) 1–9
3
Table 1 Laser microdissection assisted single cell RT-PCR primer sequences. Gene name
Accession no
Primer sequence (5′ to 3′)
NSE
AF019973
IgG
BC088240
MBP
AF439750
GFAP
L27219
IBA-1
D82069
CD19
BC090026
CD34
EU448293
CD38
NM013127
CD68
NM001031638
GAPDH
AF106860
TGGGGACAAACAGCGTTACTTAGGC TTGAGCAATGTGGCGATAGAGGGGC AGGCTTCTATCCCCCAGACATTTAT AGACTCTTCTCAGTATGGTGGTTGT ATGGCATCACAGAAGAGACC CATGGGAGATCCAGAGCGGC AGATCCGAGAAACCAGCCTG CCTTAATGACCTCGCCATCC GGCAATGGAGATATCGATAT AGAATCATTCTCAAGATGGC AGAGGGGAGGAAGAAGGAGATAAAC CAGAGTAAGATGGGGTTCTCGGGAC AAATGTTCAGGAATCCGAGGAGTGC CTCAGTCTCCTCCTTTTTACACAGT CTCAGTGAGCCATTTTAC TCACACATTAAGTCTACATG CAAGCATAGTTCTTTCTCCAGCAAT CCTACAGAGTGGACTGGAGCAAATG AACGACCCCTTCATTGAC CCACGACATACTCAGCAC
Primers location
Amplicon length (bp)
221–476
255
1152–1364
212
1–466
466
1162–1266
104
436–618
174
229–414
195
529–668
139
653–922
269
815–1067
252
943–1136
193
Fig. 1. Immunohistochemistry and in situ hybridization show that hippocampal neurons express IgG protein and mRNA. a–c are serial sections and d–f are series sections. a: Immunostaining with goat anti-rat IgG antibody; b: With mouse anti-rat NeuN antibody; c: With mouse anti-rat GFAP antibody. a–c show that IgG was present in the cytoplasm of neurons (arrows) but not glial cells (arrow). d: In situ hybridization of IgG with an anti-sense probe; e: Immunostaining of IgG with goat anti-rat NeuN antibody; f: In situ hybridization with a sense probe. d–f show that IgG mRNA was present in the cytoplasm of neurons (arrows). f shows that sense probe gave negative results ensuring specificity of the reaction shown in d. g and h are series sections across the whole brain of rat showing that IgG has the highest concentration in the hippocampus.
4
S. Wang et al. / Journal of Neuroimmunology 258 (2013) 1–9
2.3. Stress paradigm and detection of IgG expression in various regions of the brain
and the hippocampus, cortex and thalamus were dissected and collected on ice immediately.
The effect of stress on IgG expression in the rat brain was examined at the hippocampus, cortex and thalamus of an acute immobilization stress model. Numbers of animals were the following: stress group (n = 18), control (n = 18). For setting up this stress model, rats were individually restrained for 2 h with a nylon mesh as described previously with minor modifications (Popa et al., 2008). Animals were subsequently killed by rapid decapitation at 2 h after onset of stress. Control rats were decapitated immediately after removal from their cages (total time lapse from removal to decapitation was 1–3 min),
2.3.1. Neuron collection The brains were processed using a standardized procedure to avoid serum IgG (Brewer and Torricelli, 2007). In brief, the hippocampi, cortex and thalamus were collected, minced into 1–2 mm 3 and digested with papain (Worthington NJ, USA) at 30 U/ml for 30 min at 37 °C, then triturated with fire-polished 0.9 in. pasteur pipettes (Fisher Scientific, USA) to a single cell suspension. The neurons were collected by density gradient separation (OptiPrep density 1.32, Denmark, Axis
Fig. 2. Immunofluorescent staining revealed IgG protein (goat anti-rat IgG-FITC antibody, green; b, f) colocalization with neural marker NeuN (mouse anti-rat NeuN antibody, red; a) in the rat hippocampus; GFAP positive cells (mouse anti-rat GFAP antibody, red; e) contain no IgG protein. Nucleus is indicated in blue (stained with DAPI; c, g), overlap staining is in purple in the merged images (d, h). Scale bars: 10 μm.
S. Wang et al. / Journal of Neuroimmunology 258 (2013) 1–9
shield) in cell suspension in a centrifuge at 1900 rpm at 4 °C for 15 min. The collected neurons were used in subsequent experiments. 2.3.2. Western blot analysis 2.3.2.1. IgG expression level. Western blot analysis was performed on the proteins extracted from the hippocampus, cortex and thalamus of rat brains under stress or control rat brains as described previously
5
with modifications (Wang et al., 2009). To characterize changes in IgG protein expression levels in the acute stress group and the control group, collected neurons of each rat were homogenized with cell lysis buffer (CST, Danvers MA, USA) containing Protease Inhibitor Cocktail (Roche complete, EDTA-free Protease Inhibitor, Indianapolis, USA). Homogenates were centrifuged for 10 min (14,000 g at 4 °C), and 30 μg supernatant protein was loaded onto a pre-cast 4–12% Bis-Tris mini-gel (Invitrogen, CA, USA). After electrophoresis, proteins
Fig. 3. Immunohistochemical detection of NeuN protein or GFAP protein expression in the hippocampus combined with IgG mRNA expression by in situ hybridization. NeuN monoclonal antibody is showed positive signals in the AEC-stained cells (c). Combined in situ hybridization and immunohistochemistry for IgG mRNA and NeuN expressions in positive cells showed that marked neurons were expressed IgG mRNA and IgG protein (b, d) at the same cells. Scale bars, 10 μm. Immunohistochemical detection of GFAP protein expression in the hippocampus combined with IgG mRNA expression by in situ hybridization. GFAP monoclonal antibody showed positive signals in the AEC-stained cells (g). Combined in situ hybridization and immunohistochemistry, GFAP positive cells showed marked glias, and did not express IgG mRNA and IgG protein (f, h). Scale bars: 10 μm.
6
S. Wang et al. / Journal of Neuroimmunology 258 (2013) 1–9
were electroblotted on polyvinylidene difluoride membrane (Roche) and then blocked with a PBS-Tween 20 solution containing 5% nonfatty dry milk (Bio-Rad) for 1 h at room temperature. The membranes were then incubated with primary goat anti-rat IgG antibody (1:2000, Minneapolis, R&D), and followed by a secondary horseradish peroxidase-conjugated rabbit anti-goat IgG (1:20,000, Zymed, South San Francisco, CA, USA). The appropriate membranes were stripped using a stripping solution and incubated with mouse monoclonal anti-β actin antibody (1:2000, Santa Cruz, CA, USA) and then incubated with goat anti-mouse conjugated HRP secondary antibody (1:20,000, Santa Cruz, CA, USA). The immunoreactive bands were developed using chemiluminescence signal (Thermo ECL, Rockford IL) and then quantitated using the FluorChem Q System (San Jose, CA USA). The relative intensity of bands was analyzed using the Image J software (version 1.43, NIH, Bethesda, Maryland, USA). 2.3.2.2. Neural protein expression in stress. Western blot was used to analyze neural protein express levels of hippocampal neurons. The blotted membrane was incubated with rabbit anti-microtubule-associated protein 2 antibody (1:2000, MAP2, CST, Danvers, MA, USA) or mouse anti-neuron specific beta III tubulin antibody (1:1000, Santa Cruz, CA, USA) to determine protein expression.
2.4. Real-time RT-PCR and analysis of IgG expression Total RNA from collected neurons in rats under acute stress and controls was extracted with Trizol (Invitrogen, CA, USA), and treated with DNase I (Invitrogen, CA, USA) for 10 min. Reverse transcription of total RNA was performed using a ReverTraAce qPCR RT kit (FSQ-101, Toyobo) following the manufacturer's instructions. The primers of real-time PCR used for targeted gene amplifying are as follows: IgG 2a region of IgG heavy chain: 5′-CTACAAGAACACTCCA CCTACGATG-3′(forward); 5′-CACAGAGAAAGGTGGTAGAGGTAGG-3′ (reverse) and GAPDH: 5′-TGCACCACCAACTGCTTAGC-3′ (forward), 5′-GGCATGGACTGTGGTCATGA-3′ (reverse). The PCR reactions yielded a 242-bp fragment for IgG, and an 86-bp fragment for GAPDH. Real-time PCR was performed with a real-time RT-PCR kit (DRR041, Takara) following the manufacturer's instructions. Specificity of the primers was further confirmed with agarose gel electrophoresis and melting point analysis of the amplicons generated. PCR conditions were as follows: denaturation at 95 °C for 5 s, annealing at 60 °C for 30 s, and extension at 72 °C for 30 s for 45 cycles. Reactions were performed using the ABI Prism 7000 Sequence Detection system (Applied Biosystems). Q-RT-PCR data was obtained in the form of threshold (Ct) values. The mean Ct from the triplicates
Fig. 4. Data from laser microdissection assisted RT-PCR (LCM). (a) 63× before LCM; (b) 63× after LCM. Scale bars: 25 μm; (c) The PCR products for primers with 1% gel electrophoresis detection.
S. Wang et al. / Journal of Neuroimmunology 258 (2013) 1–9
of target and reference genes and the delta Ct between acute stress group and control group were analyzed and then the changes of IgG mRNA expression level in hippocampus were determined according to the 2 −ΔΔCT method. 2.5. Statistics Statistical comparisons were made using Student' t-test. Data were presented as mean ± SEM. p b 0.05 was considered statistically significant. 3. Results 3.1. IgG expression in rat hippocampus Positive staining for IgG (Fig. 1a) was observed in the cytoplasm of neuron that was identified with neuronal marker NeuN (Fig. 1b). Positive staining for GFAP was detected in glial cells (Fig. 1c). No IgG positive signal was found in GFAP positive cells on serial sections. In the pre-absorption test study, IgG positive cells were gradually decreased in intensity in parallel with increased concentrations of IgG (Supplementary Fig. 1a, b, c, d). In situ hybridization detected positive signals of IgG mRNA (Fig. 1d) in the same neurons containing IgG protein immunoreactivity of rat hippocampus (Fig. 1e). Complete view of the cross sections found the highest IgG immunoreactivity in the hippocampus (Fig. 1g, h). Immunofluorescence showed that IgG positive signals (Fig. 2b, f) were mainly colocalized in the cytoplasm of neurons identified by the neuronal marker, NeuN (red, Fig. 2a). There was no IgG signal in GFAP positive cells (red, Fig. 2e). Further, immunohistochemistry detection with antibodies to different markers for neurons (Fig. 3a, c) or glial cells (Fig. 3e, g) was
7
combined with in situ hybridization (Fig. 3b, d, f, h). Data showed that IgG mRNA was found only in neurons but not in other all types in hippocampus (Fig. 3d, h). The results of laser microdissection assisted-RT-PCR showed that mRNAs of both IgG and NSE were detected in the same neuronal cells (Fig. 4). RT-PCR for CD19, CD34, CD38, CD68, MBP, GFAP, or IBA-1 was negative, indicating that IgG mRNA was not present in cell types other than neurons. The results suggest that IgG synthesis had taken place only in neurons of the hippocampus. 3.2. Immobilization stress increased hippocampal IgG levels, but did not change the IgG levels in the cortex and thalamus Rats exposed to immobilization showed a significant increase in both IgG mRNA and IgG protein. IgG protein levels in acute immobilization stress group were increased by about 29-fold from that of the control group (Fig. 5a; t (17) = −16.451, p b 0.01). Express level of the neural protein (Fig. 5b), MAP2 and βIII tubulin were not changed (p > 0.05; n = 6). IgG expression in other regions (such as the cortex and thalamus) of rat brain was also investigated (Fig. 5c; p > 0.05; n = 6), and there was no change of IgG expression observed (p > 0.05; n = 6). IgG mRNA levels of the rat hippocampus from acute stress group detected with real-time RT-PCR was on average 3.4-fold higher than that in the control group (Fig. 6; t (12) = 2.201, p b 0.05). 4. Discussion Three major findings emerged from the present study: (1) IgG protein immunoreactivity and mRNA were found in neurons of the rat hippocampus, where IgG appeared to be more abundant than other regions of the brain; (2) Rats exposed to acute immobilization stress had increased level of IgG in hippocampus but not in other areas;
Fig. 5. Influence of acute immobilization stress on the expression of protein in the hippocampus of rats. a. Hippocampal IgG protein levels were increased in rats exposed to acute immobilization stress compared to non-treated rats; the results are presented as percent of control and are the mean ± SEM (n = 18). *p b 0.01 in comparison to control (Student's t-test). b. Protein levels of hippocampal neural MAP 2 and beta III tubulin were not change in rats exposed to acute immobilization stress compared to non-treated rats (*p > 0.05). c. IgG protein levels in the cortex and thalamus were not changed in rats exposed to acute immobilization stress compared to non-treated rats (*p > 0.05).
8
S. Wang et al. / Journal of Neuroimmunology 258 (2013) 1–9
Fig. 6. Relative IgG mRNA expression level in acute stress group and control. The results are presented as percent of control and are the mean + SEM (n = 12). *p b 0.01 in comparison to control (Student's t-test).
(3) IgG as a neuronal protein has its own expression pattern under stress. These results suggest that IgG production in the hippocampus may be related to acute stress. The data of immunohistochemistry, immunofluorescence and in situ hybridization shown in Figs. 1, 2, 3 highlight two important points. First, IgG protein immunoreactivity is most abundant in dentate gyrus, CA1 and CA3 areas, in concordance with a previous report (Huang et al., 2008). Second, IgG protein and its mRNA were found in neurons but not in other cell types in the hippocampus, which raises the possibility of potential relevance of IgG to hippocampal activity. Dysfunction of hippocampus was shown to result in neuropsychological diseases including major depression and bipolar disorders (Sapolsky, 1996). It was also confirmed that a single stressful event could mediate long term neuronal plasticity (Kaufer et al., 1998). Moreover, IgG protein in the hippocampus is associated with psychosis (Goldsmith, 2002). Although neuronal IgG expression has been previously described (Huang et al., 2008; Chen et al., 2009), the mechanism and significance of IgG activity in response to stress are still unknown. We employed an acute immobilization stress model of rat to explore the possible action of IgG in hippocampus. Study at both mRNA and protein levels of hippocampal IgG unveiled a marked increase of IgG in response to stress. Several possibilities exist that may explain the up-regulation of IgG expression in the hippocampus. One possible mechanism is that IgG up-regulation may have a self-protective effect. In a mouse stroke model, intravenously administered IgG protected neurons from the negative effects of ischemia and reperfusion injury through clearance of complement components (Arumugam et al., 2007). Using rat hippocampal slice and microglial cultures, nonspecific monomeric IgG at physiological concentration was found to provide neuroprotection through enhancement of microglial recycling endocytosis and release of TNF-α following binding to FcγRs (Hulse et al., 2008). In a separate study, we found that neutralizing endogenous IgG of cultured hippocampal neurons with polyclonal IgG antibody increased neuron death (unpublished data). This indicates that there might be an interaction between IgG production and neuron survival in the hippocampus. Together with previous reports, IgG might play a protective role in the hippocampus under stress. Another possible mechanism for the involvement of hippocampal IgG in acute stress is deactivating microglia. Our previous study showed that neurons and microglia express FcRn receptors for IgG (Niu et al., 2010). Data from other teams showed that microglia were involved in stress status (Haleem, 1996; Nair and Bonneau, 2006). It has also been reported that exogenous IgG could evoke neuroprotection via microglial recycling endocytosis (Frank et al., 2007; Hulse et al., 2008). The relation of hippocampal IgG and FcRn expressed by microglia calls further investigation. In summary, the results of this study demonstrated that endogenous IgG could be up-regulated in hippocampal neurons under acute stress, and this change was not found in other regions. Based on this
study we also confirmed that the up-regulation of hippocampal IgG is a major phenomenon when subject to acute stress. These findings gave a clue to possible actions of neuron-produced IgG in stress responses, adding an important element in neuronal-immune crosstalk. As IgG is the principal molecule of the immune system acting as antibodies and receptors mediating many immune functions, its expression in central neurons and increase under acute stress imply a significant mechanism of neuroimmunology of the brain. Therefore, IgG might be involved in the regulation of neuronal response to stress and could provide a new dimension for developing novel antidepressant medications. Supplementary data to this article can be found online at http:// dx.doi.org/10.1016/j.jneuroim.2013.02.003. Conflict of interest statement All authors declare that there is no conflict of interest. Author contributions S.W. and G.W.H. conducted the experiments and performed the analysis. T.H. participated in IHC. All authors contributed to discussions of the data and to writing of the paper. J.G. supervised the design, performance, analysis of the experiments and writing of the manuscript. Acknowledgments This work was supported by grants from the National Nature Science Foundation of China (No. 81030033, 30971150 to J.G.; No. 81102280 to S.W.) and the Natural Science Foundation of Guangdong Province (No. 8451503102001823). References Arumugam, T.V., Tang, S.C., Lathia, J.D., Cheng, A., Mughal, M.R., Chigurupati, S., Magnus, T., Chan, S.L., Jo, D.G., Ouyang, X., Fairlie, D.P., Granger, D.N., Vortmeyer, A., Basta, M., Mattson, M.P., 2007. Intravenous immunoglobulin (IVIG) protects the brain against experimental stroke by preventing complement-mediated neuronal cell death. Proc. Natl. Acad. Sci. 104, 14104–14109. Aukrust, P., Müller, F., Svenson, M., Nordøy, I., Bendtzen, K., Frøland, S.S., 1999. Administration of intravenous immunoglobulin (IVIG) in vivo-down-regulatory effects on the IL-1 system. Clin. Exp. Immunol. 115, 136–143. Brewer, G., Torricelli, J., 2007. Isolation and culture of adult neurons and neurospheres. Nat. Protoc. 2, 1490–1498. Chen, Z., Qiu, X., Gu, J., 2009. Immunoglobulin expression in non-lymphoid lineage and neoplastic cells. Am. J. Pathol. 174, 1139–1148. Dalakas, M.C., 2004. Inhibiting leukocyte recruitment to the brain by IVIg: is it relevant to the treatment of demyelinating CNS disorders? Brain 127, 2569–2571. Frank, M.G., Baratta, M.V., Sprunger, D.B., Watkins, L.R., Maier, S.F., 2007. Microglia serve as a neuroimmune substrate for stress-induced potentiation of CNS proinflammatory cytokine responses. Brain Behav. Immun. 21, 47–59. Goldsmith, S.K., 2002. Haloperidol reduces IgG immunoreactivity in the rat brain. Int. J. Neuropsychopharmacol. 5, 309–313. Haleem, D.J., 1996. Adaptation to repeated restraint stress in rats: failure of ethanoltreated rats to adapt in the stress schedule. Alcohol Alcohol. 31, 471–477. Hauser, S.L., Waubant, E., Arnold, D.L., Vollmer, T., Antel, J., Fox, R.J., Bar-Or, A., Panzara, M., Sarkar, N., Agarwal, S., Langer-Gould, A., Smith, C.H., 2008. B-cell depletion with rituximab in relapsing-remitting multiple sclerosis. N. Engl. J. Med. 358, 676–688. Huang, J., Sun, X., Mao, Y., Zhu, X., Zhang, P., Zhang, L., Du, J., Qiu, X., 2008. Expression of immunoglobulin gene with classical V-(D)-J rearrangement in mouse brain neurons. Int. J. Biochem. Cell Biol. 40, 1604–1615. Hulse, R., Swenson, W., Kunkler, P., White, D., Kraig, R., 2008. Monomeric IgG is neuroprotective via enhancing microglial recycling endocytosis and TNF-{alpha}. J. Neurosci. 28, 12199–12211. Kaufer, D., Friedman, A., Seidman, S., Soreq, H., 1998. Acute stress facilitates longlasting changes in cholinergic gene expression. Nature 393, 373–377. Lapointe, B., Herx, L., Gill, V., Metz, L., Kubes, P., 2004. IVIg therapy in brain inflammation: etiology-dependent differential effects on leucocyte recruitment. Brain 127, 2649–2656. Matsui, J., Fujimiya, M., Matsui, S., Amakata, Y., Renda, T., Kimura, H., Maeda, T., 1994. Transient expression of [D-Ala2] deltorphin I-like immunoreactivity in prenatal rat small intestine. J. Histochem. Cytochem. 42, 1377–1381. McEwen, B., 1999. Stress and hippocampal plasticity. Annu. Rev. Neurosci. 22, 105–122.
S. Wang et al. / Journal of Neuroimmunology 258 (2013) 1–9 Nair, A., Bonneau, R.H., 2006. Stress-induced elevation of glucocorticoids increases microglia proliferation through NMDA receptor activation. J. Neuroimmunol. 171, 72–85. Newton, S.S., Dow, A., Terwilliger, R., Duman, R., 2002. A simplified method for combined immunohistochemistry and in-situ hybridization in fresh-frozen, cryocut mouse brain sections. Brain Res. Protocol. 9, 214–219. Niu, N., Zhang, J., Guo, Y., Zhao, Y., Korteweg, C., Gu, J., 2010. Expression and distribution of immunoglobulin G and its receptors in the human nervous system. Int. J. Biochem. Cell Biol. 43, 556–563.
9
Popa, D., Lena, C., Alexandre, C., Adrien, J., 2008. Lasting syndrome of depression produced by reduction in serotonin uptake during postnatal development: evidence from sleep, stress, and behavior. J. Neurosci. 28, 3546–3554. Sapolsky, R.M., 1996. Why stress is bad for your brain. Science 273, 749–750. van Engelen, B.G., Renier, W.O., Weemaes, C.M., 1994. Immunoglobulin treatment in human and experimental epilepsy. J. Neurol. Neurosurg. Psychiatry 57, 72–75 (Suppl.). Wang, Y.J., Wang, X., Zhang, H., Zhou, L., Liu, S., Kolson, D.L., Li, S., Li, Y., Ho, W.Z., 2009. Expression and regulation of antiviral protein APOBEC3G in human neuronal cells. J. Neuroimmunol. 206, 14–21.
Contents lists available at SciVerse ScienceDirect
Journal of Neuroimmunology journal homepage: www.elsevier.com/locate/jneuroim
Up-regulation of immunoglobulin G gene expression in the hippocampus of rats subjected to acute immobilization stress☆ Sheng Wang a, b, 1, Guowei Huang a, 1, Yun Wang a, Tao Huang a, Shuiqin Lin a, Jiang Gu a,⁎ a b
Provincial Key Laboratory of Infectious Diseases and Immunopathology, Department of Pathology and Pathophysiology, Shantou University Medical College, Shantou, Guangdong, China Mental Health Center of Shantou University Medical College, Shantou, Guangdong, China
a r t i c l e
i n f o
Article history: Received 8 November 2012 Received in revised form 11 February 2013 Accepted 12 February 2013 Keywords: Hippocampus Acute stress Immunoglobulin G Laser microdissection Western blot Real-time RT-PCR
a b s t r a c t Immunoglobulin G (IgG) is thought to be produced by matured B lymphocytes, however, it was recently found to be synthesized in neurons of the brain, especially showing higher expression level in the hippocampus. To study the possible effects of IgG in the hippocampus, we examined IgG protein and mRNA expressions in rat hippocampal neurons with immunohistochemistry, immunofluorescence, in situ hybridization and laser microdissection-assisted RT-PCR. Increased IgG expressions at both protein and mRNA levels were detected in the hippocampus of an acute immobilization stress model of rat. No change was observed in the cortex or the thalamus. Furthermore, the microtubule-associated protein 2 (MAP2) and β III tubulin proteins did not show significant changes. Based on these findings, we hypothesize that hippocampal IgG may play a key role in adverse circumstances such as stress. The finding of increased IgG expression in the hippocampus following stress may also provide possibilities for developing antidepressant medication. © 2013 Elsevier B.V. All rights reserved.
1. Introduction Marked changes in metabolism and pathological consequences have been reported in the hippocampus under acute stress, which has immediate and lasting impact on the psychological and cognitive functions of the brain (McEwen, 1999; Hauser et al., 2008). It has been documented that IgG is a neuroprotective agent (Lapointe et al., 2004; Hulse et al., 2008). IgG is also known to have therapeutic effects in many neurological diseases, such as epilepsy, stroke and multiple sclerosis (van Engelen et al., 1994; Dalakas, 2004; Arumugam et al., 2007). Administration of intravenous immunoglobulin (IVIG) has down-regulatory effects on IL-1β (Aukrust et al., 1999). Several investigators have found that the brain expresses immunoglobulin G, and the dentate gyrus showed the most IgG immunoreactivity with immunohistochemistry (Huang et al., 2008). Therefore, the current study was undertaken to test the hypothesis that in rats there is
☆ Grant sponsor: National Nature Science Foundation of China. Grant number: Nos. 81030033, 81102280, 30971150, 81001199, and 30950110335. ⁎ Corresponding author at: Provincial Key Laboratory, Department of Pathology and Pathophysiology, Shantou University Medical College, 22 Xinling Road, Shantou, Guangdong 515041, China. Tel.: +86 18688002602; fax: +86 754 8895 0293. E-mail addresses: [email protected] (S. Wang), [email protected] (G. Huang), [email protected] (Y. Wang), [email protected] (T. Huang), [email protected] (S. Lin), [email protected] (J. Gu). 1 The first two authors contributed equally to this work. 0165-5728/$ – see front matter © 2013 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.jneuroim.2013.02.003
a correlation between stress and brain IgG expression. We present evidence to prove this hypothesis and to elucidate the possible molecular and cellular mechanisms of IgG production in the brain under acute stress condition.
2. Materials and methods 2.1. Animals Adult male Sprague Dawley rats (300–350 g) were obtained from the Animal Center of Shantou University Medical College and housed three per cage in clear polycarbonate cages with wood chip bedding. All animals were maintained on a 12 h light–dark cycle (lights on at 8:00 AM) and the temperature was kept at 21 ± 2 °C with food and water provided ad libitum. Care and use of the animals were approved by the Animal Care and Use Committee of Shantou University Medical College.
2.2. IgG gene expression in hippocampus of rats 2.2.1. Tissue preparation Animals were anesthetized with isoflurane (5%) and perfused intracardially with 4% paraformaldehyde in phosphate buffered saline (PBS, pH 7.4). The brains were postfixed in the same fixative overnight at 4 °C, rinsed in PBS, embedded in paraffin, and cut into 3 μm-thick serial sections.
2
S. Wang et al. / Journal of Neuroimmunology 258 (2013) 1–9
2.2.2. Immunohistochemistry Immunohistochemistry was performed as described previously (Niu et al., 2010). Briefly, deparaffinized and rehydrated tissue sections were incubated with 3% hydrogen peroxide for 10 min to block the intrinsic peroxidase. Antigen retrieval was performed by heating the slides in an autoclave at 120 °C for 3 min in 0.01 M citric acid buffer (pH 6.0). Sections were then washed with PBS, and incubated overnight at 4 °C with polyclonal rabbit anti-rat IgG antibody (1:100; Abcam, Cambridge, UK), mouse monoclonal anti-NeuN antibody (1:200; Chemicon, Billerica, MA USA) and mouse monoclonal anti-glial fibrillary acidic protein (GFAP) antibody (1:200; Cell Signaling Technology, Danvers, MA USA). Following rinsing in PBS, sections were incubated with horseradish peroxidase (HRP)-conjugated goat anti-rabbit or goat anti-mouse IgG (1:200, Zymed Laboratories, CA USA) for 30 min at 37 °C and the reaction was detected with diaminobenzidine tetrahydrochloride (DAB) (Dako, Carpinteria CA, USA). All sections were counterstained with hematoxylin. PBS was used in place of the primary antibody as a negative control. 2.2.3. Specificity of anti rat IgG antibody The specificity of anti rat IgG antibody was examined by preabsorption test as previously reported (Matsui et al., 1994). Deparaffinized and rehydrated tissue sections were incubated with 3% hydrogen peroxide for 10 min to block the intrinsic peroxidase. Antigen retrieval was performed by heating the slides in an autoclave at 120 °C for 3 min in 0.01 M citric acid buffer (pH 6.0). Sections were then washed with PBS, and incubated (overnight at 4 °C) in polyclonal rabbit anti-rat IgG antibody (1:100; Abcam, Cambridge, UK) with rat IgG (31933, Thermo Scientific Pierce Biotech, Illinois, USA) in a concentration of 0.02, 0.05, 0.1, 0.2 mg/ml. PBS was used for the control sections. Following rinsing in PBS, sections were incubated with horseradish peroxidase (HRP)-conjugated goat anti-rabbit or goat anti-mouse IgG (1:200, Zymed Laboratories, CA USA) for 30 min at room temperature, and the stains were developed with 3-Amino-9Ethylcarbazole (AEC). 2.2.4. Double immunofluorescence For double-label immunofluorescence experiments, sections were fixed in 4% (wt./vol.) PBS-buffered paraformaldehyde, then blocked for 1 h in PBS containing 10% donkey serum. To examine the relationship between IgG and neurons, the sections were reacted with a mixture of FITC-labeled goat anti-rat IgG antibody and mouse monoclonal anti-NeuN antibody followed by donkey anti-mouse IgG secondary antibody conjugated with NL557 which gives a red fluorescence. To examine the relationship between IgG and glial cells, the sections were reacted with a mixture of FITC-labeled goat anti-rat IgG antibody and mouse monoclonal anti-GFAP antibody followed by donkey anti-mouse IgG-NL557. PBS instead of primary antibody was used as a negative control. The nuclei were stained with 4', 6-diamidino-2-phenylindole (DAPI) (Vectashield, vector laboratories, Burlingame, CA USA). Images were captured using a confocal microscope (Olympus FV1000, Japan). 2.2.5. In situ hybridization In situ hybridization was performed as described previously (Chen et al., 2009) with modifications. 2.2.5.1. cRNA probe synthesis. Rat spleen was collected and washed with 0.01 M PBS. Total RNA was extracted with Trizol (Invitrogen, CA USA), and reverse transcription of total RNA was performed with random primers using an FSK-100 RT kit (Toyobo, Osaka Japan) according to the manufacturer's instructions. PCR primers used for amplifying the constant region of the IgG1 heavy chain (IgG2a) is shown as follows: Forward primer: 5′-TGGAAGTCCACACAGCTCAG-3′ and reverse primer: 5′-TCTGGGGGATAGAAGCCTTT-3′. The expected 282 bp PCR product was subcloned into the pGM-T vector and the identity of the plasmid was confirmed by DNA sequencing. The plasmid was linearized
with NcoI or SalI and transcripted with T7 or Sp6 RNA polymerase to generate antisense or sense probes, respectively, in the presence of digoxigenin-labeled rUTP (Roche, Rotkreuz Switzerland). 2.2.5.2. In situ hybridization. Deparaffinized, dehydrated tissue sections (3 μm) were immersed in 0.1% diethylpyrocarbonate (DEPC) for 1 h, and heated to 95 °C in a microwave oven in 0.01 M DEPC-treated citrate buffer (pH 6.0) for 12 min. Slides were cooled to room temperature, immersed in 0.2 M HCl for 20 min, washed with DEPC-treated PBS, and treated with 0.3% Triton X-100 in DEPC-treated PBS for 10 min and 10 μg/ml proteinase K treated slides at 37 °C for 20 min. The tissue sections were fixed in 4% paraformaldehyde for 10 min, and hybridized overnight at 45 °C with the rat IgG2a RNA probe in a hybridization solution. After hybridization, sections were washed in 2 × SSC + 50% formamide for 30 min and 2 × SSC twice for 15 min (37 °C), then incubated with alkaline phosphatase-conjugated antidigoxigenin antibody (1:500; Roche). 5-Bromo-4-chloro-3-indolyl phosphate and nitro-blue-tetrazolium (NBT, Sigma) were used for color development. For controls, slides were incubated with the corresponding sense probe. 2.2.6. Combination of in situ hybridization with immunohistochemistry To demonstrate cell types that contain IgG mRNA, immunostaining with specific cell markers was performed after in situ hybridization using a previously described protocol (Newton et al., 2002). To use this method, sections were first processed through the in situ hybridization procedures as above. After color reaction, the sections were incubated with primary antibodies (mouse anti-rat NeuN or mouse anti-rat GFAP) diluted in blocking solution over night at 4 °C with gentle shaking. After washing three times in PBS, the tissue sections were incubated in horseradish peroxidase (HRP)-labeled secondary antibodies diluted in blocking buffer for 1 h. Following by three 5-min washes in PBS, the sections stains were developed with 3-Amino-9-Ethylcarbazole (AEC). For controls, slides were incubated with the corresponding sense probe. 2.2.7. Laser microdissection assisted RT-PCR Animals were perfused with PBS (pH 7.4). Brains were snap-frozen in liquid nitrogen. Ten micrometer thick sections were cut coronally and mounted onto membrane slides (Leica Microsystems, Germany). Samples were fixed with 95% ethanol for 20 s, stained with 4% cresyl violet (dissolved in 75% ethanol, Sigma) for 10 s, and then rinsed three times with 100% ethanol and twice with xylene. Approximately 15 neurons of dentate gyrus were captured by laser microdissection with a Leica microdissection System (LMD 7000) and placed in 10 μl of DNase I buffer + 3% NP-40 (Invitrogen, CA, USA), then incubated at 42 °C for 20 min. The mixture was treated with DNase I, followed by reverse transcription with a Superscript III First Strand Kit (Invitrogen, CA, USA). An initial PCR amplification was immediately performed using the following protocol: denaturation at 95 °C for 30 s, annealing at 60 °C for 30 s, and extension at 72 °C for 1 min (30 cycles). The first round PCR mixture was used in the second amplification step in a nested PCR protocol, under the same condition as for the first round PCR. To demonstrate that IgG mRNA is from hippocampal neurons, and not from other cell types, several cell markers were employed. They included CD19 for B lymphocyte, CD34 for vascular endothelial cell, CD38 for plasma cells, CD68 for macrophages, neuron-specific enolase (NSE) for neurons, myelin basic protein (MBP) for oligodendrocyte, GFAP for astrocytes, and ionized calcium-binding adaptor molecule 1 (IBA-1) for microglia. Total RNA was extracted from brain and spleen tissues. Brain RNA was used as positive controls for MBP, GFAP, and IBA-1. Spleen RNA was used as positive controls for CD19, CD34, CD38, and CD68. Water was used as a negative control. PCR amplification conditions were denaturation at 95 °C for 30 s, annealing at 60 °C for 30 s and extension at 72 °C for 30 s for 40 cycles (see Table 1 for PCR primer sequences).
S. Wang et al. / Journal of Neuroimmunology 258 (2013) 1–9
3
Table 1 Laser microdissection assisted single cell RT-PCR primer sequences. Gene name
Accession no
Primer sequence (5′ to 3′)
NSE
AF019973
IgG
BC088240
MBP
AF439750
GFAP
L27219
IBA-1
D82069
CD19
BC090026
CD34
EU448293
CD38
NM013127
CD68
NM001031638
GAPDH
AF106860
TGGGGACAAACAGCGTTACTTAGGC TTGAGCAATGTGGCGATAGAGGGGC AGGCTTCTATCCCCCAGACATTTAT AGACTCTTCTCAGTATGGTGGTTGT ATGGCATCACAGAAGAGACC CATGGGAGATCCAGAGCGGC AGATCCGAGAAACCAGCCTG CCTTAATGACCTCGCCATCC GGCAATGGAGATATCGATAT AGAATCATTCTCAAGATGGC AGAGGGGAGGAAGAAGGAGATAAAC CAGAGTAAGATGGGGTTCTCGGGAC AAATGTTCAGGAATCCGAGGAGTGC CTCAGTCTCCTCCTTTTTACACAGT CTCAGTGAGCCATTTTAC TCACACATTAAGTCTACATG CAAGCATAGTTCTTTCTCCAGCAAT CCTACAGAGTGGACTGGAGCAAATG AACGACCCCTTCATTGAC CCACGACATACTCAGCAC
Primers location
Amplicon length (bp)
221–476
255
1152–1364
212
1–466
466
1162–1266
104
436–618
174
229–414
195
529–668
139
653–922
269
815–1067
252
943–1136
193
Fig. 1. Immunohistochemistry and in situ hybridization show that hippocampal neurons express IgG protein and mRNA. a–c are serial sections and d–f are series sections. a: Immunostaining with goat anti-rat IgG antibody; b: With mouse anti-rat NeuN antibody; c: With mouse anti-rat GFAP antibody. a–c show that IgG was present in the cytoplasm of neurons (arrows) but not glial cells (arrow). d: In situ hybridization of IgG with an anti-sense probe; e: Immunostaining of IgG with goat anti-rat NeuN antibody; f: In situ hybridization with a sense probe. d–f show that IgG mRNA was present in the cytoplasm of neurons (arrows). f shows that sense probe gave negative results ensuring specificity of the reaction shown in d. g and h are series sections across the whole brain of rat showing that IgG has the highest concentration in the hippocampus.
4
S. Wang et al. / Journal of Neuroimmunology 258 (2013) 1–9
2.3. Stress paradigm and detection of IgG expression in various regions of the brain
and the hippocampus, cortex and thalamus were dissected and collected on ice immediately.
The effect of stress on IgG expression in the rat brain was examined at the hippocampus, cortex and thalamus of an acute immobilization stress model. Numbers of animals were the following: stress group (n = 18), control (n = 18). For setting up this stress model, rats were individually restrained for 2 h with a nylon mesh as described previously with minor modifications (Popa et al., 2008). Animals were subsequently killed by rapid decapitation at 2 h after onset of stress. Control rats were decapitated immediately after removal from their cages (total time lapse from removal to decapitation was 1–3 min),
2.3.1. Neuron collection The brains were processed using a standardized procedure to avoid serum IgG (Brewer and Torricelli, 2007). In brief, the hippocampi, cortex and thalamus were collected, minced into 1–2 mm 3 and digested with papain (Worthington NJ, USA) at 30 U/ml for 30 min at 37 °C, then triturated with fire-polished 0.9 in. pasteur pipettes (Fisher Scientific, USA) to a single cell suspension. The neurons were collected by density gradient separation (OptiPrep density 1.32, Denmark, Axis
Fig. 2. Immunofluorescent staining revealed IgG protein (goat anti-rat IgG-FITC antibody, green; b, f) colocalization with neural marker NeuN (mouse anti-rat NeuN antibody, red; a) in the rat hippocampus; GFAP positive cells (mouse anti-rat GFAP antibody, red; e) contain no IgG protein. Nucleus is indicated in blue (stained with DAPI; c, g), overlap staining is in purple in the merged images (d, h). Scale bars: 10 μm.
S. Wang et al. / Journal of Neuroimmunology 258 (2013) 1–9
shield) in cell suspension in a centrifuge at 1900 rpm at 4 °C for 15 min. The collected neurons were used in subsequent experiments. 2.3.2. Western blot analysis 2.3.2.1. IgG expression level. Western blot analysis was performed on the proteins extracted from the hippocampus, cortex and thalamus of rat brains under stress or control rat brains as described previously
5
with modifications (Wang et al., 2009). To characterize changes in IgG protein expression levels in the acute stress group and the control group, collected neurons of each rat were homogenized with cell lysis buffer (CST, Danvers MA, USA) containing Protease Inhibitor Cocktail (Roche complete, EDTA-free Protease Inhibitor, Indianapolis, USA). Homogenates were centrifuged for 10 min (14,000 g at 4 °C), and 30 μg supernatant protein was loaded onto a pre-cast 4–12% Bis-Tris mini-gel (Invitrogen, CA, USA). After electrophoresis, proteins
Fig. 3. Immunohistochemical detection of NeuN protein or GFAP protein expression in the hippocampus combined with IgG mRNA expression by in situ hybridization. NeuN monoclonal antibody is showed positive signals in the AEC-stained cells (c). Combined in situ hybridization and immunohistochemistry for IgG mRNA and NeuN expressions in positive cells showed that marked neurons were expressed IgG mRNA and IgG protein (b, d) at the same cells. Scale bars, 10 μm. Immunohistochemical detection of GFAP protein expression in the hippocampus combined with IgG mRNA expression by in situ hybridization. GFAP monoclonal antibody showed positive signals in the AEC-stained cells (g). Combined in situ hybridization and immunohistochemistry, GFAP positive cells showed marked glias, and did not express IgG mRNA and IgG protein (f, h). Scale bars: 10 μm.
6
S. Wang et al. / Journal of Neuroimmunology 258 (2013) 1–9
were electroblotted on polyvinylidene difluoride membrane (Roche) and then blocked with a PBS-Tween 20 solution containing 5% nonfatty dry milk (Bio-Rad) for 1 h at room temperature. The membranes were then incubated with primary goat anti-rat IgG antibody (1:2000, Minneapolis, R&D), and followed by a secondary horseradish peroxidase-conjugated rabbit anti-goat IgG (1:20,000, Zymed, South San Francisco, CA, USA). The appropriate membranes were stripped using a stripping solution and incubated with mouse monoclonal anti-β actin antibody (1:2000, Santa Cruz, CA, USA) and then incubated with goat anti-mouse conjugated HRP secondary antibody (1:20,000, Santa Cruz, CA, USA). The immunoreactive bands were developed using chemiluminescence signal (Thermo ECL, Rockford IL) and then quantitated using the FluorChem Q System (San Jose, CA USA). The relative intensity of bands was analyzed using the Image J software (version 1.43, NIH, Bethesda, Maryland, USA). 2.3.2.2. Neural protein expression in stress. Western blot was used to analyze neural protein express levels of hippocampal neurons. The blotted membrane was incubated with rabbit anti-microtubule-associated protein 2 antibody (1:2000, MAP2, CST, Danvers, MA, USA) or mouse anti-neuron specific beta III tubulin antibody (1:1000, Santa Cruz, CA, USA) to determine protein expression.
2.4. Real-time RT-PCR and analysis of IgG expression Total RNA from collected neurons in rats under acute stress and controls was extracted with Trizol (Invitrogen, CA, USA), and treated with DNase I (Invitrogen, CA, USA) for 10 min. Reverse transcription of total RNA was performed using a ReverTraAce qPCR RT kit (FSQ-101, Toyobo) following the manufacturer's instructions. The primers of real-time PCR used for targeted gene amplifying are as follows: IgG 2a region of IgG heavy chain: 5′-CTACAAGAACACTCCA CCTACGATG-3′(forward); 5′-CACAGAGAAAGGTGGTAGAGGTAGG-3′ (reverse) and GAPDH: 5′-TGCACCACCAACTGCTTAGC-3′ (forward), 5′-GGCATGGACTGTGGTCATGA-3′ (reverse). The PCR reactions yielded a 242-bp fragment for IgG, and an 86-bp fragment for GAPDH. Real-time PCR was performed with a real-time RT-PCR kit (DRR041, Takara) following the manufacturer's instructions. Specificity of the primers was further confirmed with agarose gel electrophoresis and melting point analysis of the amplicons generated. PCR conditions were as follows: denaturation at 95 °C for 5 s, annealing at 60 °C for 30 s, and extension at 72 °C for 30 s for 45 cycles. Reactions were performed using the ABI Prism 7000 Sequence Detection system (Applied Biosystems). Q-RT-PCR data was obtained in the form of threshold (Ct) values. The mean Ct from the triplicates
Fig. 4. Data from laser microdissection assisted RT-PCR (LCM). (a) 63× before LCM; (b) 63× after LCM. Scale bars: 25 μm; (c) The PCR products for primers with 1% gel electrophoresis detection.
S. Wang et al. / Journal of Neuroimmunology 258 (2013) 1–9
of target and reference genes and the delta Ct between acute stress group and control group were analyzed and then the changes of IgG mRNA expression level in hippocampus were determined according to the 2 −ΔΔCT method. 2.5. Statistics Statistical comparisons were made using Student' t-test. Data were presented as mean ± SEM. p b 0.05 was considered statistically significant. 3. Results 3.1. IgG expression in rat hippocampus Positive staining for IgG (Fig. 1a) was observed in the cytoplasm of neuron that was identified with neuronal marker NeuN (Fig. 1b). Positive staining for GFAP was detected in glial cells (Fig. 1c). No IgG positive signal was found in GFAP positive cells on serial sections. In the pre-absorption test study, IgG positive cells were gradually decreased in intensity in parallel with increased concentrations of IgG (Supplementary Fig. 1a, b, c, d). In situ hybridization detected positive signals of IgG mRNA (Fig. 1d) in the same neurons containing IgG protein immunoreactivity of rat hippocampus (Fig. 1e). Complete view of the cross sections found the highest IgG immunoreactivity in the hippocampus (Fig. 1g, h). Immunofluorescence showed that IgG positive signals (Fig. 2b, f) were mainly colocalized in the cytoplasm of neurons identified by the neuronal marker, NeuN (red, Fig. 2a). There was no IgG signal in GFAP positive cells (red, Fig. 2e). Further, immunohistochemistry detection with antibodies to different markers for neurons (Fig. 3a, c) or glial cells (Fig. 3e, g) was
7
combined with in situ hybridization (Fig. 3b, d, f, h). Data showed that IgG mRNA was found only in neurons but not in other all types in hippocampus (Fig. 3d, h). The results of laser microdissection assisted-RT-PCR showed that mRNAs of both IgG and NSE were detected in the same neuronal cells (Fig. 4). RT-PCR for CD19, CD34, CD38, CD68, MBP, GFAP, or IBA-1 was negative, indicating that IgG mRNA was not present in cell types other than neurons. The results suggest that IgG synthesis had taken place only in neurons of the hippocampus. 3.2. Immobilization stress increased hippocampal IgG levels, but did not change the IgG levels in the cortex and thalamus Rats exposed to immobilization showed a significant increase in both IgG mRNA and IgG protein. IgG protein levels in acute immobilization stress group were increased by about 29-fold from that of the control group (Fig. 5a; t (17) = −16.451, p b 0.01). Express level of the neural protein (Fig. 5b), MAP2 and βIII tubulin were not changed (p > 0.05; n = 6). IgG expression in other regions (such as the cortex and thalamus) of rat brain was also investigated (Fig. 5c; p > 0.05; n = 6), and there was no change of IgG expression observed (p > 0.05; n = 6). IgG mRNA levels of the rat hippocampus from acute stress group detected with real-time RT-PCR was on average 3.4-fold higher than that in the control group (Fig. 6; t (12) = 2.201, p b 0.05). 4. Discussion Three major findings emerged from the present study: (1) IgG protein immunoreactivity and mRNA were found in neurons of the rat hippocampus, where IgG appeared to be more abundant than other regions of the brain; (2) Rats exposed to acute immobilization stress had increased level of IgG in hippocampus but not in other areas;
Fig. 5. Influence of acute immobilization stress on the expression of protein in the hippocampus of rats. a. Hippocampal IgG protein levels were increased in rats exposed to acute immobilization stress compared to non-treated rats; the results are presented as percent of control and are the mean ± SEM (n = 18). *p b 0.01 in comparison to control (Student's t-test). b. Protein levels of hippocampal neural MAP 2 and beta III tubulin were not change in rats exposed to acute immobilization stress compared to non-treated rats (*p > 0.05). c. IgG protein levels in the cortex and thalamus were not changed in rats exposed to acute immobilization stress compared to non-treated rats (*p > 0.05).
8
S. Wang et al. / Journal of Neuroimmunology 258 (2013) 1–9
Fig. 6. Relative IgG mRNA expression level in acute stress group and control. The results are presented as percent of control and are the mean + SEM (n = 12). *p b 0.01 in comparison to control (Student's t-test).
(3) IgG as a neuronal protein has its own expression pattern under stress. These results suggest that IgG production in the hippocampus may be related to acute stress. The data of immunohistochemistry, immunofluorescence and in situ hybridization shown in Figs. 1, 2, 3 highlight two important points. First, IgG protein immunoreactivity is most abundant in dentate gyrus, CA1 and CA3 areas, in concordance with a previous report (Huang et al., 2008). Second, IgG protein and its mRNA were found in neurons but not in other cell types in the hippocampus, which raises the possibility of potential relevance of IgG to hippocampal activity. Dysfunction of hippocampus was shown to result in neuropsychological diseases including major depression and bipolar disorders (Sapolsky, 1996). It was also confirmed that a single stressful event could mediate long term neuronal plasticity (Kaufer et al., 1998). Moreover, IgG protein in the hippocampus is associated with psychosis (Goldsmith, 2002). Although neuronal IgG expression has been previously described (Huang et al., 2008; Chen et al., 2009), the mechanism and significance of IgG activity in response to stress are still unknown. We employed an acute immobilization stress model of rat to explore the possible action of IgG in hippocampus. Study at both mRNA and protein levels of hippocampal IgG unveiled a marked increase of IgG in response to stress. Several possibilities exist that may explain the up-regulation of IgG expression in the hippocampus. One possible mechanism is that IgG up-regulation may have a self-protective effect. In a mouse stroke model, intravenously administered IgG protected neurons from the negative effects of ischemia and reperfusion injury through clearance of complement components (Arumugam et al., 2007). Using rat hippocampal slice and microglial cultures, nonspecific monomeric IgG at physiological concentration was found to provide neuroprotection through enhancement of microglial recycling endocytosis and release of TNF-α following binding to FcγRs (Hulse et al., 2008). In a separate study, we found that neutralizing endogenous IgG of cultured hippocampal neurons with polyclonal IgG antibody increased neuron death (unpublished data). This indicates that there might be an interaction between IgG production and neuron survival in the hippocampus. Together with previous reports, IgG might play a protective role in the hippocampus under stress. Another possible mechanism for the involvement of hippocampal IgG in acute stress is deactivating microglia. Our previous study showed that neurons and microglia express FcRn receptors for IgG (Niu et al., 2010). Data from other teams showed that microglia were involved in stress status (Haleem, 1996; Nair and Bonneau, 2006). It has also been reported that exogenous IgG could evoke neuroprotection via microglial recycling endocytosis (Frank et al., 2007; Hulse et al., 2008). The relation of hippocampal IgG and FcRn expressed by microglia calls further investigation. In summary, the results of this study demonstrated that endogenous IgG could be up-regulated in hippocampal neurons under acute stress, and this change was not found in other regions. Based on this
study we also confirmed that the up-regulation of hippocampal IgG is a major phenomenon when subject to acute stress. These findings gave a clue to possible actions of neuron-produced IgG in stress responses, adding an important element in neuronal-immune crosstalk. As IgG is the principal molecule of the immune system acting as antibodies and receptors mediating many immune functions, its expression in central neurons and increase under acute stress imply a significant mechanism of neuroimmunology of the brain. Therefore, IgG might be involved in the regulation of neuronal response to stress and could provide a new dimension for developing novel antidepressant medications. Supplementary data to this article can be found online at http:// dx.doi.org/10.1016/j.jneuroim.2013.02.003. Conflict of interest statement All authors declare that there is no conflict of interest. Author contributions S.W. and G.W.H. conducted the experiments and performed the analysis. T.H. participated in IHC. All authors contributed to discussions of the data and to writing of the paper. J.G. supervised the design, performance, analysis of the experiments and writing of the manuscript. Acknowledgments This work was supported by grants from the National Nature Science Foundation of China (No. 81030033, 30971150 to J.G.; No. 81102280 to S.W.) and the Natural Science Foundation of Guangdong Province (No. 8451503102001823). References Arumugam, T.V., Tang, S.C., Lathia, J.D., Cheng, A., Mughal, M.R., Chigurupati, S., Magnus, T., Chan, S.L., Jo, D.G., Ouyang, X., Fairlie, D.P., Granger, D.N., Vortmeyer, A., Basta, M., Mattson, M.P., 2007. Intravenous immunoglobulin (IVIG) protects the brain against experimental stroke by preventing complement-mediated neuronal cell death. Proc. Natl. Acad. Sci. 104, 14104–14109. Aukrust, P., Müller, F., Svenson, M., Nordøy, I., Bendtzen, K., Frøland, S.S., 1999. Administration of intravenous immunoglobulin (IVIG) in vivo-down-regulatory effects on the IL-1 system. Clin. Exp. Immunol. 115, 136–143. Brewer, G., Torricelli, J., 2007. Isolation and culture of adult neurons and neurospheres. Nat. Protoc. 2, 1490–1498. Chen, Z., Qiu, X., Gu, J., 2009. Immunoglobulin expression in non-lymphoid lineage and neoplastic cells. Am. J. Pathol. 174, 1139–1148. Dalakas, M.C., 2004. Inhibiting leukocyte recruitment to the brain by IVIg: is it relevant to the treatment of demyelinating CNS disorders? Brain 127, 2569–2571. Frank, M.G., Baratta, M.V., Sprunger, D.B., Watkins, L.R., Maier, S.F., 2007. Microglia serve as a neuroimmune substrate for stress-induced potentiation of CNS proinflammatory cytokine responses. Brain Behav. Immun. 21, 47–59. Goldsmith, S.K., 2002. Haloperidol reduces IgG immunoreactivity in the rat brain. Int. J. Neuropsychopharmacol. 5, 309–313. Haleem, D.J., 1996. Adaptation to repeated restraint stress in rats: failure of ethanoltreated rats to adapt in the stress schedule. Alcohol Alcohol. 31, 471–477. Hauser, S.L., Waubant, E., Arnold, D.L., Vollmer, T., Antel, J., Fox, R.J., Bar-Or, A., Panzara, M., Sarkar, N., Agarwal, S., Langer-Gould, A., Smith, C.H., 2008. B-cell depletion with rituximab in relapsing-remitting multiple sclerosis. N. Engl. J. Med. 358, 676–688. Huang, J., Sun, X., Mao, Y., Zhu, X., Zhang, P., Zhang, L., Du, J., Qiu, X., 2008. Expression of immunoglobulin gene with classical V-(D)-J rearrangement in mouse brain neurons. Int. J. Biochem. Cell Biol. 40, 1604–1615. Hulse, R., Swenson, W., Kunkler, P., White, D., Kraig, R., 2008. Monomeric IgG is neuroprotective via enhancing microglial recycling endocytosis and TNF-{alpha}. J. Neurosci. 28, 12199–12211. Kaufer, D., Friedman, A., Seidman, S., Soreq, H., 1998. Acute stress facilitates longlasting changes in cholinergic gene expression. Nature 393, 373–377. Lapointe, B., Herx, L., Gill, V., Metz, L., Kubes, P., 2004. IVIg therapy in brain inflammation: etiology-dependent differential effects on leucocyte recruitment. Brain 127, 2649–2656. Matsui, J., Fujimiya, M., Matsui, S., Amakata, Y., Renda, T., Kimura, H., Maeda, T., 1994. Transient expression of [D-Ala2] deltorphin I-like immunoreactivity in prenatal rat small intestine. J. Histochem. Cytochem. 42, 1377–1381. McEwen, B., 1999. Stress and hippocampal plasticity. Annu. Rev. Neurosci. 22, 105–122.
S. Wang et al. / Journal of Neuroimmunology 258 (2013) 1–9 Nair, A., Bonneau, R.H., 2006. Stress-induced elevation of glucocorticoids increases microglia proliferation through NMDA receptor activation. J. Neuroimmunol. 171, 72–85. Newton, S.S., Dow, A., Terwilliger, R., Duman, R., 2002. A simplified method for combined immunohistochemistry and in-situ hybridization in fresh-frozen, cryocut mouse brain sections. Brain Res. Protocol. 9, 214–219. Niu, N., Zhang, J., Guo, Y., Zhao, Y., Korteweg, C., Gu, J., 2010. Expression and distribution of immunoglobulin G and its receptors in the human nervous system. Int. J. Biochem. Cell Biol. 43, 556–563.
9
Popa, D., Lena, C., Alexandre, C., Adrien, J., 2008. Lasting syndrome of depression produced by reduction in serotonin uptake during postnatal development: evidence from sleep, stress, and behavior. J. Neurosci. 28, 3546–3554. Sapolsky, R.M., 1996. Why stress is bad for your brain. Science 273, 749–750. van Engelen, B.G., Renier, W.O., Weemaes, C.M., 1994. Immunoglobulin treatment in human and experimental epilepsy. J. Neurol. Neurosurg. Psychiatry 57, 72–75 (Suppl.). Wang, Y.J., Wang, X., Zhang, H., Zhou, L., Liu, S., Kolson, D.L., Li, S., Li, Y., Ho, W.Z., 2009. Expression and regulation of antiviral protein APOBEC3G in human neuronal cells. J. Neuroimmunol. 206, 14–21.