2-Hydroxymelatonin mitigates cadmium stress in cucumis sativus seedlings: Modulation of antioxidant enzymes and polyamines

Chemosphere 243 (2020) 125308

Contents lists available at ScienceDirect

Chemosphere journal homepage: www.elsevier.com/locate/chemosphere

2-Hydroxymelatonin mitigates cadmium stress in cucumis sativus seedlings: Modulation of antioxidant enzymes and polyamines Anis Ali Shah a, Shakil Ahmed a, Aamir Ali b, Nasim Ahmad Yasin c, * a

Department of Botany, University of the Punjab, Lahore, Pakistan Department of Botany, University of Sargodha, Pakistan c Senior Superintendent Garden, University of the Punjab, Lahore, Pakistan b

h i g h l i g h t s
Melatonin regulates physiological and metabolic activities of plants under stress conditions.
We found that cadmium stress affected overall growth of Cucumis sativus seedlings.
2-Hydroxymelatonin enhanced photosynthetic rate and transpiration rate in treated plants.
Modulation in activity of polyamines and antioxidants are important mechanisms for cadmium tolerance.

a r t i c l e i n f o

a b s t r a c t

Article history: Received 24 September 2019 Received in revised form 30 October 2019 Accepted 3 November 2019 Available online 6 November 2019

Cadmium level is continuously increasing in agricultural soils mainly due to anthropogenic activities. Cadmium is one of the most phytotoxic metals in the soils. The present study investigates the possible role of 2-hydroxymelatonin (2-OHMT) in assuagement of Cd-toxicity in cucumber (Cucumis sativus L.) plants. 2-OHMT is an important metabolite produced through interaction of melatonin with oxygenated compounds. Cadmium stress decreased the activity of antioxidant enzymes and polyamines. However, exogenously applied 2-OHMT enhanced plant growth attributes including photosynthetic rate, intercellular CO2 concentration, stomatal conductance and transpiration rate in treated plants. In addition, 2OHMT induced enhancement of the activity of PAs biosynthesizing enzymes (putrescine, spermidine and spermine) in conjunction with reduction in activity of polyamine oxidase (PAO). 2-OHMT mitigated Cd stress through up-regulation in expression of stress related CS-ERS gene along with the amplified activity of superoxide dismutase (SOD), catalase (CAT) and ascorbate peroxidase (APX) in treated seedlings. The improved activity of antioxidant scavengers played central role in reduction of hydrogen peroxide (H2O2), electrolyte leakage (EL) and malondialdehyde (MDA) in plants under Cd stress. Recent findings also advocate the positive correlation between PAs and ethylene, as both possess common precursor. The current study reveals that priming seeds with 2-OHMT reduces Cd-toxicity and makes it possible to cultivate cucumber in Cd-contaminated areas. Future experiments will perhaps help in elucidation of 2OHMT intervened stress mitigation procedure in C. sativus crop. Furthermore, research with reference to potential of 2-OHMT for stress alleviation in other horticultural and agronomic crops will assist in enhancement of crop productivity. © 2019 Elsevier Ltd. All rights reserved.

Handling Editor: T Cutright Keywords: Cadmium Cucumis sativus Phytotoxic Putrescine Spermidine Spermine

1. Introduction Environmental pollutants, including noxious heavy metals released by human activities have threatened existence of biota worldwide (Ali et al., 2019). These activities include combustion of

* Corresponding author. E-mail address: [email protected] (N.A. Yasin). https://doi.org/10.1016/j.chemosphere.2019.125308 0045-6535/© 2019 Elsevier Ltd. All rights reserved.

fossil fuel, pesticides application and inappropriate disposal of industrial effluents (Kabata-Pendias and Pendias, 2011; Wuana and Okieimen, 2011). Some of these heavy metals craft serious health hazards even when present at very low concentration (Ali et al., 2013). The elevated concentrations of these heavy metals deteriorate soil health with reference to healthy plant growth (Bolan et al., 2013). Bioaccumulation of non-degradable heavy metals leads to multiple diseases in all the trophic levels of food chain (Vareda

2

A.A. Shah et al. / Chemosphere 243 (2020) 125308

et al., 2016; Cotruvo, 2017). The foremost sources of Cd pollution in arable lands are anthropogenic activities that mainly include improper disposal of sewage sludge, industrial effluents and excessive application of phosphate fertilizers. The areas adjacent to emission sources receive higher concentration of Cd and soil is the ultimate sink of Cd even if it is air-borne. Ultimately, the soil is enriched with abundant concentration of Cd causing reduced soil health and poor crop productivity in these areas (Young, 2013; Bolan et al., 2014). Cucumis sativus L. is an important horticultural crop cultivated and utilized throughout the world. Palatability, higher nutritional value and economic returns associated with this cucurbit have made this crop a must grow commodity (Dingal et al., 2018). The growth and yield of this crop is severely affected by heavy metal stress (Shekari et al., 2019). Especially, Cd has devastating effects on the growth and physiology of C. sativus plants (Wang et al., 2019). Melatonin is a well-known growth stimulator having physiochemical role in growth attributes, activities of antioxidant enzymes, biosynthesis of polyamines, and heavy metal stress alleviation (Ke et al., 2018; Jahan et al., 2019). Melatonin treated watermelon plants showed higher amount of photosynthesis and improved the activity of stress responsive antioxidant enzymes to decline salt stress (Li et al., 2017). Similarly, wheat seeds primed with melatonin exhibited higher activity of antioxidant enzyme and more ascorbic acid in following seedlings facing cold stress (Turk et al., 2014). Higher SOD and CAT activity in melatonin applied seedlings helped in mitigation of weedicide stress in rice plants (Park et al., 2013). It was observed that C. sativus seeds treated with melatonin showed improved activity of SOD to scavenge ROS in chilling stressed seedlings (Marta et al., 2016). Likewise, melatonin enhances plant tolerance to Cd stress (Lee and Back, 2017). Furthermore, in recent researches, melatonin interceded plant tolerance to Cd toxicity is accredited to the enhanced activity of antioxidant enzymes besides improved orchestration of PAs and reduced level of ROS (Lee and Back, 2017; Ni et al., 2018). PAs such as spermine and spermidine regulate plants growth. These PAs encourage resistance enhancement against abiotic stresses in affected plants (Gill and Tuteja, 2010a,b). The endogenous and exogenous melatonin regulates the biosynthesis of PAs in plants facing environmental stress (Zhao et al., 1996). Tomato saplings treated with melatonin showed higher quantity of PAs in addition to increased expression level of genes involved in enhancement of cold stress (Ding et al., 2017). These PAs have a synergistic effect with melatonin and mediate Cd stress alleviation through ROS scavenging and reduced senescence (Tan et al., 2007). The higher levels of PAs in plants develop resistance to heavy metals (Groppa et al., 2007). Re-programming of ethylene and PAs metabolism is involved in improving stress tolerance in Medicago sativa (Zhang et al., 2019). A strong correlation has been observed between putrescine and spermidine in Cd stressed wheat plants (Tajti et al., 2018). Melatonin hydroxylation through 2oxoglutarate-dependent dioxygenase causes biosynthesis of 2hydroxymelatonin (2-OHMT) (Byeon and Back, 2015). 2-OHMT activates mitogen-activated protein kinase cascade to confer the environmental stress in Arabidopsis thaliana (Lee and Back, 2016a). Exogenous application of 2-OHMT reduced cold and drought stress in rice plants through enhanced biosynthesis of proline and increased expression level of genes involved in proton transporters, water channel proteins and potassium transporters (Lee and Back 2016b). One may find abundant research work on the multidimensional aspects of melatonin concerning alleviation of environmental stresses in a number of agricultural crops. However, according to best of our knowledge, role of 2-OHMT with respect to Cd stress alleviation in cucumber has never been studied. Thus, based on the

above discussions, current study was designed to test whether 2OHMT is capable to improve Cd-tolerance through modulation of antioxidant system and PAs in cucumber plant. 2. Materials and methods 2.1. Collection and determination of soil samples Soil samples up to a depth of 12” were obtained from a fallow area present in Botanical Garden, University of the Punjab by using sterilized augur. Physicochemical characteristics of soil samples (kg1) were analyzed as described by Amna et al. (2015). The soil was filled in plastic pots (13  15 cm) and allocated pots were amended with 50 mg kg1 Cd. All treated pots were placed treatment wise in a completely randomized design. These pots were placed in shade at room temperature for a fortnight. Soil water holding capacity was maintained at about 50% with the help of double distilled water. 2.2. Plant materials and growth conditions The cucumber seeds were surface sterilized by dipping in 2% sodium hypochlorite solution (w/v) for 10 min. The sterilized seeds were rinsed thoroughly by using double distilled water and air ~ ares and Bouzo, 2019). For dried at room temperature (Castan priming, seeds were soaked with 0 mM, 50 mM, 100 mM and 150 mM solution of 2-OHMT for 4 h and then washed thrice with distilled water. To adjust moisture content of seeds, these were placed in dark area at 25  C for 24 h. Afterwards, 4 seeds were sown at equal distance in pots and placed in greenhouse under natural light, mean relative humidity 75%, and 28e17  C (day/night temperature). Each pot was watered on daily basis by using 10% Hoagland's nutrients solution. Thinning was accomplished after seed emergence by keeping 3 seedlings in each pot. 2.3. Determination of seed and seedling growth Seedlings were grown for 15 d and then these were carefully uprooted. Shoot, root and leaf samples of treated seedlings were placed in distilled water for 1 min followed by drying on blotting paper. Root length; shoot length, fresh weight of whole plant, fresh weight of root and that of shoot were estimated. The biomass of whole plant and plant parts oven dried at 80  C for 48 h was also estimated. 2.4. Determination of leaf relative water content The completely extended leaf samples were dipped in 100 mL sterilized distilled water in a dark place at 10  C for 24 h. These turgid leaf samples were rapidly enfolded in blotting paper for 2 min followed by calculation of turgid leaf weight. Leaf samples were oven dried at 70  C for 2 d and LRWC was measured with the help of following equation proposed by Smart and Bingham (1974):

LRWCð%Þ ¼ LFW  LDW = LTW  LDW  100 At this juncture, LFW, LDW and LTW are leaf fresh, leaf dry and leaf turgid weight, respectively. 2.5. Evaluation of gas exchange attributes and photosynthetic rate An infrared gas analyzer was employed for the assessment of intercellular CO2 concentration, stomatal conductivity, net rate of photosynthesis (Pn) and transpiration rate from second upper  et al. completely extended leaf at 9: 30 a.m. according to Hola

A.A. Shah et al. / Chemosphere 243 (2020) 125308

(2010). 2.6. Estimation of cadmium contents Oven dried root and shoot samples were digested by using HClO4 solution. The quantity of Cd content in roots and shoots from digested samples was estimated with the help of atomic absorption spectrophotometer. 2.7. Evaluation of hydrogen peroxide Plant sample (50 mg) was mixed with 0.2 g activated charcoal dissolved in 6 mL of 5% TCA in a pre-chilled mortar. This mixture was subjected to centrifugation at 13,000 rpm for 15 min at 4  C. The supernatant (0.5 mL) was homogenized with 1 mL of 1 M KI and 0.5 mL of 5 mM KH2PO4 buffer at pH 7. The quantity of H2O2 was assessed at 390 nm according to Velikova et al. (2000). 2.8. Determination of lipid peroxidation The thiobarbituric acid reaction method was adopted for malondialdehyde (MDA) quantification. For this purpose, leaf sample (0.2 g) were mixed with 6 mL 0.05 M Tris-HCl buffer at pH 7.4 followed by centrifugation at 13200 rpm for 20 min. The supernatant was homogenized with 0.5% thiobarbituric acid (w/v) and 20% trichloroacetic acid (w/v) and placed over water bath at 90  C for 30 min. The cool mixture was once again centrifuged for 20 min at 13,200 rpm and spectrophotometric value of supernatant was assessed at 532 nm and 600 nm (Rubin et al., 1976).

3

with guaiacol solution (50 mL), 30 mL H2O2 in presence of 3 mL KH2PO4 buffer. The colorimetric value of reaction solution was determined at 436 nm (Pütter, 1974). For estimation of superoxide dismutase (SOD) activity, 1 g leaf sample was homogenized with sodium carbonate buffer (3 mL) and centrifuged at 4  C for 20 min at 12,000 rpm. The supernatant (70 mL) was mixed with 24 mM NBT (500 mL), 0.1 mM EDTA (100 mL), 1 mM HONH2$HCl (100 mL), 0.03% Triton-X-100 (100 mL) along with sodium carbonate buffer (1630 mL) at pH 10.2. The absorbance of solution was observed at 560 nm to determine SOD activity according to Kono (1978). 2.11. Assessment of CS-ERS gene RNA from seedling leaves was extracted by using a Tri-reagent Extraction Kit (Enzynomics, Korea) in accordance with manufacturer's instructions. Bio-Rad Real-Time PCR structure (Bio-Rad, USA) was employed for evaluation of Real-Time qRT-PCR. PCR replications were prepared by using SYBR Green-based one step RTPCR kit (Enzynomics, Korea) according to Guo et al. (2012). The expression level of gene comprising ethylene receptor CS-ERS was assessed by using primers enlisted in Table 1. 2.12. Estimation of PAs biosynthetic enzymes Spermine, spermidine and putrescine contents were evaluated according to Zhao et al. (1996) and Hu et al. (2012), respectively. 2.13. Determination of polyamine oxidase activity

2.9. Assessment of electrolyte leakage The fully developed top leaves were cut in 0.5 cm segments and submerged in to 7 mL sterilized water placed in glass tubes. Tubes containing these leaf segments were placed over rotary shaker at 25  C for 1 d. The readings for primary conductivity (EC-i) of leaf segments were determined through autoclaving the segments holding tubes for 30 min at 120  C. Values for maximum conductivity (EC-max) from solution containing leaf segments were estimated at 25  C for estimation of EL according to the following formula (Li et al., 2018):

The amount of H2O2 produced during PAs oxidation helps in determination of polyamine oxidase (PAO) activity. Fresh plant sample was homogenized with 0.1 mM potassium phosphate buffer (pH 6.5) in an ice chilled mortar. The supernatant (0.4 mL) obtained by centrifugation of this homogenate at 10,000 g for 20 min at 4  C was mixed with 0.4 mL 4-aminoantipyrine/N,N-dimethylaniline solutions, 0.2 mL horseradish peroxidase (250 U mL 1) and 5 mL of potassium phosphate buffer (100 mM, pH 6.5). For estimation of PAO, putrescine (30 mL of 20 mM) was dissolved in enzyme extract to initiate reaction as described by Zhao et al. (1996).

EL ¼ ðEC  i = EC  maxÞ100:

2.14. Statistical analysis

2.10. Evaluation of antioxidant enzymes For estimation of CAT activity, leaf samples (1 g) were homogenized along with 3 mL of 100 mM KH2PO4 buffer at pH ¼ 7. This solution was centrifuged at 4  C for 20 min at 12,000 rpm. The supernatant (70 mL) was vortexed with 930 mL of 15 mM H2O2 in the prresesnce of 1500 mL of 50 mM KH2PO4 buffer. The absorbance of mixture was observed at 240 nm for estimation of H2O2 (Aebi, 1984). For evaluation of POD activity, leaf samples (1 g) were vortexed with 3 mL of 100 mM KH2PO4 buffer at pH 7. The mixture was subjected to centrifugation at 12,000 rpm for 20 min at 4  C. The reaction solution was prepared by mixing supernatant (100 mL)

The data encompassing the average values of 3 replicates were subjected to one-way ANOVA and consequently to Duncan's Multiple Range Test. The variations were regarded as significant when P value was at least 0.05. The average values were evaluated and lower case letters were applied to emphasize the significant differences among the treatments by using DSAASTAT software. 3. Results 3.1. Physicochemical characteristics of soil The soil used for current research was loamy in texture having 2.3 g potassium, 0.66 g phosphorus, 0.06 mg nickel, 0.4 g zinc, 1.2 g nitrogen, 1.6 mg chromium and 3.7 g organic matter with 7.6 pH.

Table 1 Primers used for Quantitative Real-time PCR (qPT-PCR) assays. Genes

Accession Number

Forward Primer (50 e30 )

Reverse Primer (50 e30 )

CsERS

AB026499.1

AGAAGTTGTTGCAGTGCGAGTCC

GCTACCTGGTCTGCGACAACATC

4

A.A. Shah et al. / Chemosphere 243 (2020) 125308

3.2. Enhancement of plants growth by 2-hydroxymelatonin Cadmium stress significantly reduced the growth attributes in C. sativus seedlings i.e., root fresh weight, shoot fresh weight, root dry weight, shoot dry weight, number of leaves and number of first lateral roots. 2-OHMT enhanced these growth attributes in both normal and Cd-stressed conditions. Higher values of root fresh weight, shoot fresh weight, root dry weight, shoot dry weight, number of leaves and number of first lateral roots were observed in C. sativus seedlings supplemented with 100 mM 2-OHMT without Cd stress. Maximum amount of root fresh weight (7.3 g plant1) were observed in M2 treated plants. Plants treated with Cd in absentia of exogenous 2-OHMT exhibited least root fresh weight (3.2 g plant1). Likewise, M2 and M3 treated plants exhibited higher quantity of shoot fresh weight which was 25 and 23 g plant1, respectively. Under Cd-contaminated conditions, seeds treated with 100 mM 2-OHMT showed significant increase in root dry weight, shoot dry weight, number of leaves and number of first lateral roots; in comparison with Cd treated cucumber plants (Table 2). Cadmium stress decreased root and shoot length in C. sativus seedlings. 2-OHMT enhanced root and shoot length in both normal and stressed conditions. Highest value of root length was observed in M2 treatment (554 mm) without stress. A significant increase (53%) was observed in 2-OHMT supplemented C. sativus seedlings under stress (CdM2 treatment) as compared to Cd treatment (Fig. 1). 3.3. 2-Hydroxymelatonin enhanced leaf water content and photosynthetic rate Cadmium stress significantly reduced leaf water content in C. sativus seedlings. 2-OHMT treatment enhanced leaf water content in all treatments including Cd-stressed plants. The highest value of leaf water content (92%) was observed in seedlings supplemented with 100 mM 2-OHMT solution without Cd stress, followed by M1 treatment (88%). Cadmium toxicity decreased photosynthetic rate and 42% reduced photosynthesis was observed in Cd-stressed plants as compared to those growing in un-contaminated control (C). 2OHMT treatment enhanced photosynthetic rate in both normal and Cd-stressed cucumber seedlings (Fig. 2). 3.4. 2-Hydroxymelatonin treatment enhanced gas-exchange parameters Cadmium stress decreased amount of gas exchange attributes in C. sativus seedlings as compared to un-contaminated control conditions. A significant increase in intercellular CO2 concentration

Fig. 1. The effect of 2-OHMT on root and shoot length of Cucumis sativus seedlings. Values demonstrate means ± SD (n ¼ 15). Different letters above the bars indicate significant difference among the treatments (P  0.05). C ¼ un-contaminated control, Cd ¼ contaminated control, M1 ¼ 50 mM 2-OHMT, M2 ¼ 100 mM 2-OHMT, M3 ¼ 150 mM 2-OHMT, Cd þ M1 ¼ cadmium þ50 mM 2-OHMT, Cd þ M2 ¼ cadmium þ100 mM 2-OHMT, Cd þ M3 ¼ cadmium þ150 mM 2-OHMT.

(1148 mmol mol1), transpiration rate (9.6H2O m2 s1) and stomatal conductance (2.12 mol CO2m2s1) was observed in M2 treated seedlings as compared to Cd treated seedlings (Fig. 3). 3.5. 2-Hydroxymelatonin treatment reduced uptake of Cd in shoot 2-OHMT treated seedlings significantly reduced Cd uptake in shoot. In root, the highest value of Cd was found in Cd-treated seedlings (11546 mg g1 DW). While in shoot, the value of Cd uptake in Cd-treated seedlings was (10098 mg g1 DW). 2-OHMT treatment significantly reduced Cd uptake in Cd-stressed seedlings. In CdM2 treated seedlings, the Cd content in shoot (378 mg g1 DW) was lower as compared to Cd content in root (8137 mg g1 DW) (Fig. 4).

Table 2 The effect of 2-OHMT on root fresh weight, shoot fresh weight, root dry weight, shoot dry weight, number of leaves and number of first lateral root in Cucumis sativus seedlings under Cd stress. Values demonstrate means ± SD (n ¼ 15). Different letters above the bars indicate significant difference among the treatments (P  0.05). C ¼ un-contaminated control, Cd ¼ contaminated control, M1 ¼ 50 mM 2-OHMT, M2 ¼ 100 mM 2-OHMT, M3 ¼ 150 mM 2-OHMT, Cd þ M1 ¼ cadmium þ50 mM 2-OHMT, Cd þ M2 ¼ cadmium þ100 mM 2-OHMT, Cd þ M3 ¼ cadmium þ150 mM 2-OHMT. Treatments

C Cd M1 M2 M3 Cd þ M1 Cd þ M2 Cd þ M3

Root FW (g plant1)

Shoot FW (g plant1)

Root DW (g plant1)

Shoot DW (g plant1)

No. of leaves

Number of first lateral roots

6 ± 1.35a 3.2 ± 0.45c 6.4 ± 1.97a 7.3 ± 1.52a 6.82 ± 1.22a 4.21 ± 0.45b 6.79 ± 1.17a 6.32 ± 1.67a

17 ± 3.58 ab 13 ± 2.63b 19.2 ± 4.64a 25 ± 2.72a 23 ± 2.63a 19 ± 1.34 ab 14 ± 2.43b 14 ± 2.23b

1.7 ± 0.1a 0.6 ± 0.02c 1.79 ± 0.03a 2.6 ± 0.4a 2.12 ± 0.29a 1.64 ± 0.35b 1.58 ± 0.22b 1.38 ± 0.41b

3.2 ± 1.02a 0.3 ± 0.06c 3.82 ± 1.07a 4.81 ± 0.51a 3.31 ± 0.79a 2.15 ± 0.82b 3.81 ± 0.91a 1.92 ± 0.32b

5 ±0b 2 ± 0.0c 7 ± 1.0a 8 ± 1.34a 6 ± 1.0 ab 7 ± 1.0a 7 ± 1.0a 5 ± 1.0 ab

13 ± 2.5b 5 ± 1.3c 17 ± 3.3a 20 ± 3.5a 18 ± 3.3a 15 ± 2.4 ab 13 ± 2.2b 12 ± 2.76b

A.A. Shah et al. / Chemosphere 243 (2020) 125308

5

Fig. 2. The effect of 2-OHMT on leaf water content and photosynthetic rate of Cucumis sativus seedlings. Values demonstrate means ± SD (n ¼ 15). Different letters above the bars indicate significant difference among the treatments (P  0.05). C ¼ uncontaminated control, Cd ¼ contaminated control, M1 ¼ 50 mM 2-OHMT, M2 ¼ 100 mM 2-OHMT, M3 ¼ 150 mM 2-OHMT, Cd þ M1 ¼ cadmium þ50 mM 2-OHMT, Cd þ M2 ¼ cadmium þ100 mM 2-OHMT, Cd þ M3 ¼ cadmium þ150 mM 2-OHMT.

3.6. 2-Hydroxymelatonin reduced EL, H2O2 and MDA content The highest values of electrolyte leakage (32%), hydrogen peroxide (65 mg g1 FW) and MDA content (37%) were observed in Cd-treated seedlings, compared to non-contaminated control. 2OHMT treatment reduced EL, MDA and H2O2 content in cucumber seedlings growing in all conditions (Fig. 5). 3.7. 2-Hydroxymelatonin enhanced the activity of SOD, CAT and APX Cadmium stress enhanced the activity of SOD, CAT and APX in C. sativus seedlings as compared to control (C) treatment. The highest value of SOD (7830 U g1 pro) was observed in CdM2 treated seedlings. Furthermore, highest values of CAT and POD were recorded in CdM3 and CdM2 which were 4934 U g1 pro. min and 7600 u g1 pro. s, respectively (Fig. 6). 3.8. 2-Hydroxymelatonin enhances the expression of CS-ERS Cadmium stress significantly reduced the expression of ethylene related gene. 2-OHMT application enhanced the expression of CSERS gene in both non-contaminated and Cd-contaminated conditions (Fig. 7). The highest expression level of ethylene was observed in M2 treated cucumber seedlings grown without Cd stress. 3.9. 2-OHMT enhanced the enhanced the activity of PAs biosynthetic enzyme activity 2-OHMT enhanced the activity of putrescine, spermidine and

Fig. 3. The effect of 2-OHMT on intercellular concentration, transpiration rate and stomatal conductance of Cucumis sativus seedlings. Values demonstrate means ± SD (n ¼ 15). Different letters above the bars indicate significant difference among the treatments (P  0.05). C ¼ un-contaminated control, Cd ¼ contaminated control, M1 ¼ 50 mM 2-OHMT, M2 ¼ 100 mM 2-OHMT, M3 ¼ 150 mM 2-OHMT, Cd þ M1 ¼ cadmium þ50 mM 2-OHMT, Cd þ M2 ¼ cadmium þ100 mM 2-OHMT, Cd þ M3 ¼ cadmium þ150 mM 2-OHMT.

spermine in normal and Cd-stressed conditions. The activity of these PAs was higher in Cd-stressed 2OHMT treated seedlings as compared to 2OHMT-treated seedlings without Cd stres. The highest value of putrescine (340 nmol g1 FW), spermidine (550 nmol g1 FW) and spermine (16 nmol g1 FW) were observed in Cd-treated seedlings supplemented with 2-OHMT (Fig. 8).

3.10. 2-Hydroxymelatonin reduce the activity of polyamine oxidase Cadmium stress increased the activity of PAO as compared to non-contaminated conditions. 2-OHMT reduced the values of PAO in both non-contaminated and Cd-spiked conditions. Lowest values of PAO were observed in M2 treated seedlings without Cd-stress (Fig. 9).

6

A.A. Shah et al. / Chemosphere 243 (2020) 125308

Fig. 4. A comparative analysis of cadmium uptake in root and shoot of C. sativus seedlings. C ¼ un-contaminated control, Cd ¼ contaminated control, M1 ¼ 50 mM 2OHMT, M2 ¼ 100 mM 2-OHMT, M3 ¼ 150 mM 2-OHMT, Cd þ M1 ¼ cadmium þ50 mM 2-OHMT, Cd þ M2 ¼ cadmium þ100 mM 2-OHMT, Cd þ M3 ¼ cadmium þ150 mM 2-OHMT.

Fig. 6. The effects of 2-OHMT on SOD, CAT and POD activity of Cucumis sativus seedlings. Values demonstrate means ± SD (n ¼ 15). Different letters above the bars indicate significant difference among the treatments (P  0.05). C ¼ un-contaminated control, Cd ¼ contaminated control, M1 ¼ 50 mM 2-OHMT, M2 ¼ 100 mM 2-OHMT, M3 ¼ 150 mM 2-OHMT, Cd þ M1 ¼ cadmium þ50 mM 2-OHMT, Cd þ M2 ¼ cadmium þ100 mM 2-OHMT, Cd þ M3 ¼ cadmium þ150 mM 2-OHMT.

Fig. 5. The effect of 2-OHMT on electrolyte leakage, MDA content and hydrogen peroxide of Cucumis sativus seedlings. Values demonstrate means ± SD (n ¼ 15). Different letters above the bars indicate significant difference among the treatments (P  0.05). C ¼ un-contaminated control, Cd ¼ contaminated control, M1 ¼ 50 mM 2OHMT, M2 ¼ 100 mM 2-OHMT, M3 ¼ 150 mM 2-OHMT, Cd þ M1 ¼ cadmium þ50 mM 2OHMT, Cd þ M2 ¼ cadmium þ100 mM 2-OHMT, Cd þ M3 ¼ cadmium þ150 mM 2OHMT.

Fig. 7. The effects of 2-OHMT on gene expression of CS-ERS of Cucumis sativus seedlings. Values demonstrate means ± SD (n ¼ 15). C ¼ un-contaminated control, Cd ¼ contaminated control, M1 ¼ 50 mM 2-OHMT, M2 ¼ 100 mM 2-OHMT, M3 ¼ 150 mM 2-OHMT, Cd þ M1 ¼ cadmium þ50 mM 2-OHMT, Cd þ M2 ¼ cadmium þ100 mM 2-OHMT, Cd þ M3 ¼ cadmium þ150 mM 2-OHMT.

A.A. Shah et al. / Chemosphere 243 (2020) 125308

7

Fig. 9. The effects of 2-OHMT on the activity of polyamine oxidase of Cucumis sativus seedlings. Values demonstrate means ± SD (n ¼ 3). C ¼ un-contaminated control, Cd ¼ contaminated control, M1 ¼ 50 mM 2-OHMT, M2 ¼ 100 mM 2-OHMT, M3 ¼ 150 mM 2-OHMT, Cd þ M1 ¼ cadmium þ50 mM 2-OHMT, Cd þ M2 ¼ cadmium þ100 mM 2-OHMT, Cd þ M3 ¼ cadmium þ150 mM 2-OHMT.

Fig. 8. The effects of 2-OHMT on putrescine, spermidine and spermine content of Cucumis sativus seedlings. Values demonstrate means ± SD (n ¼ 15). C ¼ uncontaminated control, Cd ¼ contaminated control, M1 ¼ 50 mM 2-OHMT, M2 ¼ 100 mM 2-OHMT, M3 ¼ 150 mM 2-OHMT, Cd þ M1 ¼ cadmium þ50 mM 2-OHMT, Cd þ M2 ¼ cadmium þ100 mM 2-OHMT, Cd þ M3 ¼ cadmium þ150 mM 2-OHMT.

4. Discussion Cadmium is regarded as an extremely toxic heavy metal that causes multiple diseases in different living organisms (Gu et al., 2017). C. sativus seeds were grown in Cd contaminated soil to evaluate the effects of Cd stress on seedlings growth. Cadmium toxicity reduced growth of C. sativus seedlings. A significant distraction in physiological processes was noticed in plants grown under Cd stress (Chen et al., 2019). During current investigation, seed priming with 2-OHMT significantly improved the growth of C. sativus seedlings. During current study, both concentrations of 2OHMT (50 and 100 mM) proved effective in enhancing the growth of

C. sativus seedlings grown under Cd stress. Nevertheless, the highest defensive role of 2-OHMT was found at the concentration of 100 mM. Melatonin application resulted in amelioration of Cd stress in tomato and alfalfa plants (Hasan et al., 2015; Gu et al., 2017). Earlier investigations exhibit that MT application at lower concentrations exert positive effects on growth and physiology of numerous plants subjected to Cd stress (Zhang et al., 2014; Gu et al., 2017). Heat, cold, drought and heavy metal stress have detrimental effect on photosynthetic pigments of affected plants (Ahammed et al., 2019). 2-OHMT seed priming during current study improved chlorophyll content of C. sativus seedlings especially grown under Cd stress. Melatonin is involved in repairing of chlorophyll structure during paraquat-induced oxidative stress in pea  ska et al., 2017). Moreover, melatonin application enhanced (Szafran the photochemical efficiency in tomato plants subjected to stress conditions (Martinez et al., 2018). Similarly, melatonin also enhanced the physiological attributes of ryegrass and watermelon seedlings exposed to heat and salinity stress, respectively (Li et al., 2017, 2019). The reduced chlorophyll content is due to the higher accumulation of H2O2 in leaves of stressed plants (Liang et al., 2017). During present study, reduced chlorophyll contents were associated with excessive bioaccumulation of H2O2 in leaves of C. sativus seedlings exposed to Cd stress. 2-OHMT application decreased the H2O2 level and escalated chlorophyll contents in C. sativus seedlings grown under Cd stress. The increased activity of antioxidant enzymes in 2OHMT treated seedlings helped to scavenge H2O2 content, leading to increased chlorophyll contents. A number of researchers have reported that photosystem I and photosystem II in plants are the dominant locations for biosynthesis of reactive oxygen species under harsh environmental conditions (Gill and Tuteja, 2010a,b). D1 protein of photosystem II is regarded as a crucial bio-marker for alleviation of environmental stress in plants (Chen et al., 2019). Similarly, our results indicate that enhanced production of D1 and other stress-tolerance related proteins might be involved in the stability of photosynthetic apparatus. Moreover, melatonin application abridged the breakdown of photosynthetic membranes under abiotic stress conditions (Shi et al., 2015). Likewise, current results indicated that 2-OHMT enhanced photosynthetic activity in contrast to untreated cucumber plants. Melatonin enhances the production and activity of antioxidant enzymes in plants subjected to various environmental regimes. The lower concentration of melatonin resulted minor modification in

8

A.A. Shah et al. / Chemosphere 243 (2020) 125308

the activity of antioxidant enzymes of cucumber seedlings. Though, the higher concentration of exogenously applied melatonin displayed a pronounced impact on regulation and improvement of the activity of some antioxidative enzymes including ascorbate peroxidase and catalase. Some other researchers have also observed matching response in case of various plants supplemented with different concentrations melatonin (Shi et al., 2016). The higher activity of SOD, APX and CAT has been demonstrated in plants receiving exogenous melatonin (Zhang et al., 2014; Jiang et al., 2016). Cadmium phytotoxity can be decreased by the application of melatonin. This mechanism involves chelation of metal ion with metal ligands and other organic compounds i.e., organic acids, proteins and polysaccharides. The non-chelated organic compounds are transferred to other crucial plant organelles resulting in non-functioning of cellular structures (Li et al., 2017). Melatoniniron complex prevents the catalysis of injurious reactions such as regulation in the level of oxygen free radicals in plants under abiotic stress (Maharaj et al., 2007). During current study, 2-OHMT reduced the uptake of Cd in cucumber seedlings. Higher level of caffeic acid O-methyltransferase generates more thiol contents in roots of the melatonin supplemented plants as compared to leaves. The higher amount of resulting phytochelatins synthesis in melatonin applied roots of plants besides reduced level of glutathione concentration in leaves reduce Cd translocation in leaves. Furthermore, melatonin regulates sulfur metabolism which assist in Cd stress alleviation and translocation of this metal from root to shoot (Hasan et al., 2019). Seedlings developed from 2-OHMT treated seeds may also have gone through identical mechanism for reduction of Cd uptake and translocation. Polyamines regulate the growth and physio-chemical processes through modulation of senescence, embryogenesis and floral development. These organic molecules assist in combating various environmental hazards (Gill and Tuteja, 2010a,b). Numerous PAs metabolic pathways are involved in tolerance to abiotic stresses (Lee and Back, 2017). The biochemical produced due to synergistic effect among ethylene and PAs help in reduction of ROS generated by metal-induced stress. This synergism helps in maintenance of optimal cellular metabolic activities besides improvement of nutrients uptake and vegetative growth of metal stressed plants (Asgher et al., 2018). During current study, putrescine quantity increased in 2-OHMT supplemented seedlings due to decrease in the activity of PAO. Putrescine is precursor for the synthesis of spermine and spermidine. The increased level of putrescine enhanced spermine and spermidine synthesis in 2-OHMT treated cucumber seedlings. Melatonin has potential to mitigate cold stress in Daucus carota by enhancing the level of spermidine and putrescine (Lei et al., 2004). This steroidal molecule also reduces chilling stress in peach and cucumber seedlings by enhancing the concentration of PAs (Cao et al., 2016; Zhao et al., 1996). The exogenous application of melatonin improves iron content by enhancing the activity of PAs (Zhou et al., 2016). In our study, it was found that exogenous application of 2-OHMT enhanced the content of polyamines in Cd-stressed C. sativus seedlings. S- adenosyl-Lmethione is the common precursor for polyamines and ethylene. Current studies elicited the positive correlation between ethylene and polyamine. However, Quinet et al. (2010) reported the existence of intricate pattern among melatonin, polyamines and ethylene. Recent researches have acknowledged the pivotal role of PAs in mitigation of abiotic stresses (Li et al., 2017). These polyamines possess potential to reduce Cd uptake and translocation from root to shoot. Polyamines chelate the Cd with metal ligands and therefore reduce the uptake of Cd in plants. Furthermore, these PAs have the potential to scavenge the H2O2 content in plants. This

scavenging potential of PAs results in orchestration of leaf water content in plants (Aldesuquy, 2016). Wei et al. (2014) found that melatonin regulated genes are involved in photosynthesis, carbohydrate metabolism, ascorbic acid biosynthesis and cell division. These molecular and biochemical changes significantly stemmed higher aggregation of seed pods and fatty acid contents as well as improved leaf size and plant weight in melatonin applied Glycine max plants. Previous finding also advocate that melatonin application enhances the expression of stress responsive genes resulting in enhanced activities of antioxidants in plants (Mayo et al., 2002). Similarly Lee and Back (2016a) reported 2-OHMT derived modulations in expression level of cold and drought stress responsive genes in rice plants. Our data revealed intonation in expression level of genes involved in stress resistance of C. sativus plants under different conditions for mitigation of Cd stress. 5. Conclusion Cadmium toxicity reduced growth, photosynthetic rate, leaf water content and transpiration rate in C. sativus seedlings; while it elevated EL, MDA and H2O2 levels. However, 2-OHMT enhanced photosynthetic rate, water content and gas-exchange attributes. 2OHMT application reduced PAO activity along with uptake of Cd in treated plants. Moreover, 2-OHMT enhanced putrescine, spermine and spermidine contents besides the up-regulated transcription of ethylene-regulating gene. It is concluded that 100 mM 2-OHMT concentration is most effective in alleviating Cd toxicity in C. sativus seedlings. Declaration of competing interest The authors declare no conflict of interest. References Aebi, H., 1984. Catalase in vitro. In: Methods in Enzymology, vol. 105. Academic Press, pp. 121e126. Ahammed, G.J., Xu, W., Liu, A., Chen, S., 2019. Endogenous melatonin deficiency aggravates high temperature-induced oxidative stress in Solanum lycopersicum L. Environ. Exp. Bot. 161, 303e311. Aldesuquy, H.S., 2016. Polyamines in relation to metal concentration, distribution, relative water content and abscisic acid in wheat plants irrigated with waste water heavily polluted with heavy metals. Int. J. Bioassays 5 (5), 4534e4546. Ali, H., Khan, E., Ilahi, I., 2019. Environmental chemistry and ecotoxicology of hazardous heavy metals: environmental persistence, toxicity, and bioaccumulation. J. Chem., 6730305, 2019. Ali, H., Khan, E., Sajad, M.A., 2013. Phytoremediation of heavy metalsdconcepts and applications. Chemosphere 91 (7), 869e881. Amna, Masood S., Syed, J.H., Munis, M.F.H., Chaudhary, H.J., 2015. Phyto-extraction of Nickel by Linum usitatissimum in Association with Glomus intraradices. Int. J. Phytoremed. 17 (10), 981e987. Asgher, M., Khan, M.I.R., Anjum, N.A., Verma, S., Vyas, D., Per, T.S., Khan, N.A., 2018. Ethylene and polyamines in counteracting heavy metal phytotoxicity: a crosstalk perspective. J. Plant Growth Regul. 37 (4), 1050e1065. Bolan, N., Kunhikrishnan, A., Thangarajan, R., Kumpiene, J., Park, J., Makino, T., Scheckel, K., 2014. Remediation of heavy metal (loid) s contaminated soilseto mobilize or to immobilize? J. Hazard Mater. 266, 141e166. Bolan, N., Mahimairaja, S., Kunhikrishnan, A., Choppala, G., 2013. Phosphorusearsenic interactions in variable-charge soils in relation to arsenic mobility and bioavailability. Sci. Total Environ. 463, 1154e1162. Byeon, Y., Back, K., 2015. Molecular cloning of melatonin 2-hydroxylase responsible for 2-hydroxymelatonin production in rice (O ryza sativa). J. Pineal Res. 58 (3), 343e351. Cao, S., Song, C., Shao, J., Bian, K., Chen, W., Yang, Z., 2016. Exogenous melatonin treatment increases chilling tolerance and induces defense response in harvested peach fruit during cold storage. J. Agric. Food Chem. 64 (25), 5215e5222. ~ ares, J.L., Bouzo, C.A., 2019. Effect of exogenous melatonin on seed germiCastan nation and seedling growth in melon (Cucumis melo L.) under salt stress. Hortic.l Plant J. 5 (2), 79e87. Chen, H., Li, Y., Ma, X., Guo, L., He, Y., Ren, Z., Zhang, Z., 2019. Analysis of potential strategies for cadmium stress tolerance revealed by transcriptome analysis of upland cotton. Sci. Rep. 9. Cotruvo, J.A., 2017. 2017 WHO guidelines for drinking water quality: first addendum

A.A. Shah et al. / Chemosphere 243 (2020) 125308 to the fourth edition. J. Am. Water Work. Assoc. 109 (7), 44e51. Ding, F., Wang, M., Liu, B., Zhang, S., 2017. Exogenous melatonin mitigates photoinhibition by accelerating non-photochemical quenching in tomato seedlings exposed to moderate light during chilling. Front. Plant Sci. 8, 244. Dingal, D.K., Patil, S.S., Birada, M.S., Mantur, S.M., 2018. Influence of different protected conditions on growth and yield of parthenocarpic cucumber (Cucumis sativus) hybrids. Int. J. Curr. Microbiol. App. Sci 7 (5), 1619e1624. Gill, S.S., Tuteja, N., 2010a. Polyamines and abiotic stress tolerance in plants. Plant Signal. Behav. 5 (1), 26e33. Gill, S.S., Tuteja, N., 2010b. Reactive oxygen species and antioxidant machinery in abiotic stress tolerance in crop plants. Plant Physiol. Biochem. 48 (12), 909e930. Groppa, M.D., Tomaro, M.L., Benavides, M.P., 2007. Polyamines and heavy metal stress: the antioxidant behavior of spermine in cadmium-and copper-treated wheat leaves. Biometals 20 (2), 185e195. Gu, Q., Chen, Z., Yu, X., Cui, W., Pan, J., Zhao, G., Shen, W., 2017. Melatonin confers plant tolerance against cadmium stress via the decrease of cadmium accumulation and reestablishment of microRNA-mediated redox homeostasis. Plant Sci. 261, 28e37. Guo, W.L., Chen, R.G., Gong, Z.H., Yin, Y.X., Ahmed, S.S., He, Y.M., 2012. Exogenous abscisic acid increases antioxidant enzymes and related gene expression in pepper (Capsicum annuum) leaves subjected to chilling stress. Genet. Mol. Res 11 (4), 4063e4080. Hasan, M.K., Ahammed, G.J., Sun, S., Li, M., Yin, H., Zhou, J., 2019. Melatonin inhibits cadmium translocation and enhances plant tolerance by regulating sulfur uptake and assimilation in Solanum lycopersicum L. J. Agric. Food Chem. 67 (38), 10563e10576. Hasan, M., Ahammed, G.J., Yin, L., Shi, K., Xia, X., Zhou, Y., Zhou, J., 2015. Melatonin mitigates cadmium phytotoxicity through modulation of phytochelatins biosynthesis, vacuolar sequestration, and antioxidant potential in Solanum lycopersicum L. Front. Plant Sci. 6, 601. , D., Benesov , J., Hnili , O., Ko , M., Hola a, M., Honnerova cka, F., Rothova cova , H., 2010. The evaluation of photosynthetic parameters in maize Hnili ckova inbred lines subjected to water deficiency: can these parameters be used for the prediction of performance of hybrid progeny? Photosynthetica 48 (4), 545e558. Hu, X., et al., 2012. Effect of exogenous spermidine on polyamine content and metabolism in tomato exposed to salinity-alkalinity mixed stress. Plant Physiol. Biochem. 57, 200. Jahan, M.S., Shu, S., Wang, Y., Chen, Z., He, M., Tao, M., Guo, S., 2019. Melatonin alleviates heat-induced damage of tomato seedlings by balancing redox homeostasis and modulating polyamine and nitric oxide biosynthesis. BMC Plant Biol. 19 (1), 1e16. Jiang, C., Cui, Q., Feng, K., Xu, D., Li, C., Zheng, Q., 2016. Melatonin improves antioxidant capacity and ion homeostasis and enhances salt tolerance in maize seedlings. Acta Physiol. Plant. 38 (4), 82. Kabata-Pendias, A., Pendias, H., 2011. Trace Elements in Soils and Plants. CRC, Boca Raton. Ke, Q., Ye, J., Wang, B., Ren, J., Yin, L., Deng, X., Wang, S., 2018. Melatonin mitigates salt stress in wheat seedlings by modulating polyamine metabolism. Front. Plant Sci. 9, 914. Kono, Y., 1978. Generation of superoxide radical during autoxidation of hydroxylamine and an assay for superoxide dismutase. Arch. Biochem. Biophys. 186 (1), 189e195. Lee, H.J., Back, K., 2016b. 2-Hydroxymelatonin promotes the resistance of rice plant to multiple simultaneous abiotic stresses (combined cold and drought). J. Pineal Res. 61 (3), 303e316. Lee, H.Y., Back, K., 2016a. Mitogen-activated protein kinase pathways are required for melatonin-mediated defense responses in plants. J. Pineal Res. 60 (3), 327e335. Lee, H.Y., Back, K., 2017. Melatonin is required for H 2 O 2-and NO-mediated defense signaling through MAPKKK 3 and OXI 1 in Arabidopsis thaliana. J. Pineal Res. 62 (2), e12379. Lei, X.Y., Zhu, R.Y., Zhang, G.Y., Dai, Y.R., 2004. Attenuation of cold-induced apoptosis by exogenous melatonin in carrot suspension cells: the possible involvement of polyamines. J. Pineal Res. 36 (2), 126e131. Li, H., Chang, J., Chen, H., Wang, Z., Gu, X., Wei, C., Zhang, X., 2017. Exogenous melatonin confers salt stress tolerance to watermelon by improving photosynthesis and redox homeostasis. Front. Plant Sci. 8, 295. Li, S., Yang, Y., Zhang, Q., Liu, N., Xu, Q., Hu, L., 2018. Differential physiological and metabolic response to low temperature in two zoysiagrass genotypes native to high and low latitude. PLoS ONE 13 (6), e0198885. Li, M., Jannasch, A.H., Jiang, Y., 2019. Growth and hormone alterations in response to heat stress in perennial ryegrass accessions differing in heat tolerance. J. Plant Growth Regul. 1e8. Liang, C., Li, A., Yu, H., Li, W., Liang, C., Guo, S., Chu, C., 2017. Melatonin regulates root architecture by modulating auxin response in rice. Front. Plant Sci. 8, 134. Maharaj, D.S., Glass, B.D., Daya, S., 2007. Melatonin: new places in therapy. Biosci. Rep. 27 (6), 299e320.

9

 ska, K., Posmyk, M.M., 2016. Exogenous melatonin improves Marta, B., Szafran antioxidant defense in cucumber seeds (Cucumis sativus L.) germinated under chilling stress. Front. Plant Sci. 7, 575. Martinez, V., Nieves-Cordones, M., Lopez-Delacalle, M., Rodenas, R., Mestre, T., Garcia-Sanchez, F., Rivero, R., 2018. Tolerance to stress combination in tomato plants: new insights in the protective role of melatonin. Molecules 23 (3), 535. Mayo, J.C., Sainz, R.M., Antolin, I., Herrera, F., Martin, V., Rodriguez, C., 2002. Melatonin regulation of antioxidant enzyme gene expression. Cell. Mol. Life Sci. CMLS 59 (10), 1706e1713. Ni, J., Wang, Q., Shah, F., Liu, W., Wang, D., Huang, S., Wu, L., 2018. Exogenous melatonin confers cadmium tolerance by counterbalancing the hydrogen peroxide homeostasis in wheat seedlings. Molecules 23 (4), 799. Park, S., Lee, D.E., Jang, H., Byeon, Y., Kim, Y.S., Back, K., 2013. Melatonin-rich transgenic rice plants exhibit resistance to herbicide-induced oxidative stress. J. Pineal Res. 54 (3), 258e263. Pütter, J., 1974. Peroxidases. In: Methods of Enzymatic Analysis. Academic Press, pp. 685e690. Quinet, M., Ndayiragije, A., Lefevre, I., Lambillotte, B., Dupont-Gillain, C.C., Lutts, S., 2010. Putrescine differently influences the effect of salt stress on polyamine metabolism and ethylene synthesis in rice cultivars differing in salt resistance. J. Exp. Bot. 61 (10), 2719e2733. Rubin, B.A., Merzliak, M.N., IUferova, S.G., 1976. Oxidation of lipid components in isolated chloroplasts by the action of light: substrates and products of lipid peroxidation. Fiziol Rast Mosk 214e219. Shekari, L., Aroiee, H., Mirshekari, A., Nemati, H., 2019. Protective role of selenium on cucumber (Cucumis sativus L.) exposed to cadmium and lead stress during reproductive stage role of selenium on heavy metals stress. J. Plant Nutr. 42 (5), 529e542. Shi, H., Chen, K., Wei, Y., He, C., 2016. Fundamental issues of melatonin-mediated stress signaling in plants. Front. Plant Sci. 7, 1124. Shi, H., Reiter, R.J., Tan, D.X., Chan, Z., 2015. INDOLE-3-ACETIC ACID INDUCIBLE 17 positively modulates natural leaf senescence through melatonin-mediated pathway in Arabidopsis. J. Pineal Res. 58 (1), 26e33. Smart, R.E., Bingham, G.E., 1974. Rapid estimates of relative water content. Plant Physiol. 53 (2), 258e260.  ska, K., Reiter, R.J., Posmyk, M.M., 2017. Melatonin improves the photosynSzafran thetic apparatus in pea leaves stressed by paraquat via chlorophyll breakdown regulation and its accelerated de novo synthesis. Front. Plant Sci. 8, 878. th, I., Szalai, G., P Tajti, J., Janda, T., Majla al, M., 2018. Comparative study on the effects of putrescine and spermidine pre-treatment on cadmium stress in wheat. Ecotoxicol. Environ. Saf. 148, 546e554. Tan, D.X., Manchester, L.C., Terron, M.P., Flores, L.J., Reiter, R.J., 2007. One molecule, many derivatives: a never-ending interaction of melatonin with reactive oxygen and nitrogen species? J. Pineal Res. 42 (1), 28e42. Turk, H., Erdal, S., Genisel, M., Atici, O., Demir, Y., Yanmis, D., 2014. The regulatory effect of melatonin on physiological, biochemical and molecular parameters in cold-stressed wheat seedlings. Plant Growth Regul. 74 (2), 139e152. Vareda, J.P., Valente, A.J., Duraes, L., 2016. Heavy metals in Iberian soils: removal by current adsorbents/amendments and prospective for aerogels. Adv. Colloid Interface Sci. 237, 28e42. Velikova, V., Yordanov, I., Edreva, A., 2000. Oxidative stress and some antioxidant systems in acid rain-treated bean plants: protective role of exogenous polyamines. Plant Sci. 151 (1), 59e66. Wang, B., Bian, B., Wang, C., Li, C., Fang, H., Zhang, J., Liao, W., 2019. Hydrogen gas promotes the adventitious rooting in cucumber under cadmium stress. PLoS One 14 (2), e0212639. Wei, W., Li, Q.T., Chu, Y.N., Reiter, R.J., Yu, X.M., Zhu, D.H., Chen, S.Y., 2014. Melatonin enhances plant growth and abiotic stress tolerance in soybean plants. J. Exp. Bot. 66 (3), 695e707. Wuana, R.A., Okieimen, F.E., 2011. Heavy metals in contaminated soils: a review of sources, chemistry, risks and best available strategies for remediation. Isrn Ecol., 402647, 2011. Young, S.D., 2013. Chemistry of heavy metals and metalloids in soils. In: Heavy Metals in Soils. Springer, Dordrecht, pp. 51e95. Zhang, N., Sun, Q., Zhang, H., Cao, Y., Weeda, S., Ren, S., Guo, Y.D., 2014. Roles of melatonin in abiotic stress resistance in plants. J. Exp. Bot. 66 (3), 647e656. Zhang, Q., Liu, X., Zhang, Z., Liu, N., Li, D., Hu, L., 2019. Melatonin improved waterlogging tolerance in alfalfa (Medicago sativa) by reprogramming polyamine and ethylene metabolism. Front. Plant Sci. 10. Zhao, F.G., Zhang, Z.G.Z., Changes, Z.F., 1996. Of free polyamines levels and activities of some enzymes during senescence stage of peanut leaves. Plant Physiol. Commun. 32, 351e353. Zhou, X., Zhao, H., Cao, K., Hu, L., Du, T., Baluska, F., Zou, Z., 2016. Beneficial roles of melatonin on redox regulation of photosynthetic electron transport and synthesis of D1 protein in tomato seedlings under salt stress. Front. Plant Sci. 7, 1823.