24-epibrassinolide triggers cadmium stress mitigation in Cucumis sativus through intonation of antioxidant system

South African Journal of Botany 127 (2019) 349
360

Contents lists available at ScienceDirect

South African Journal of Botany journal homepage: www.elsevier.com/locate/sajb

24-epibrassinolide triggers cadmium stress mitigation in Cucumis sativus through intonation of antioxidant system Anis A. Shaha, Shakil Ahmeda, Nasim A. Yasinb,* a b

Department of Botany, University of the Punjab, Lahore, Pakistan Senior Superintendent Garden, University of the Punjab, Lahore, Pakistan

A R T I C L E

I N F O

Article History: Received 24 July 2019 Revised 12 October 2019 Accepted 3 November 2019 Available online xxx  Edited by I Dole
zalova Keywords: Antioxidant Brassinosteroids Cadmium Cucumis sativus 24-EBL Stress

A B S T R A C T

The core objective of current study was to find out the potential of 24-epibrassinolide (24-EBL) in alleviation of cadmium (Cd) induced stress in cucumber (Cucumis sativus L.). C. sativus seeds were primed with 5 mM 24-EBL and allowed to grow in Cd spiked petri dishes for 15 days. The Cd-driven stress exhibited noticeable injurious effects on growth parameters of C. sativus seedlings. The oxidative stress pledged due to overproduction of malondialdehyde (MDA) and reactive oxygen species (ROS) severely affected morphological features besides gas exchange parameters, leaf relative water content (LRWC) and amount of photosynthetic pigments in C. sativus seedlings under Cd stress. Nevertheless, 24-EBL reduced Cd contents in cucumber foliage and elucidated the vital role of this biomolecule in Cd translocation. The exogenous application of 24-EBL improved shoot length, root length and biomass production of Cd-stressed plants. Alternatively, 24-EBL triggered reduction in lipid peroxidation besides increased synthesis of ethylene and indole acetic acid (IAA). Furthermore, 24-EBL modulated the expression level of ethylene receptor genes including CS-ERS, 1-aminocyclopropane-1-carboxylate oxidase2 (CsAOX), 1-aminocyclopropane-1-carboxylate oxidase1 (CSACO1), 1-aminocyclopropane-1-carboxylate oxidase2 (CSACO2), and indole acetic related CS 453. Altogether, these physiological vicissitudes advocate that 24-EBL augmented antioxidative capability contributes in the advancement of Cd tolerance in cucumber seedlings. © 2019 SAAB. Published by Elsevier B.V. All rights reserved.

1. Introduction Cadmium is amongst one of the most toxic metals causing severe injurious effects on plants (Rahman and Singh, 2019). The foremost sources of Cd accumulation in agricultural soil are anthropogenic activities that mainly include improper disposal of sewage sludge, industrial effluents and excessive application of phosphate fertilizers (Hamid et al., 2019). The innate antioxidant defense system of plants may regularize and scavenge small amount of ROS such as superoxide anion radical (O2
), hydroxyl radical (OH
) and hydrogen peroxide (H2O2) produced under normal conditions. However, internal plant defense system may not manage oxidative damage caused due to higher amount of ROS generated due to extreme Cd stress (Li et al., 2019). The raised levels of ROS as a consequence of Cd stress encumber physiology and persuade abridged plant growth (Leng et al., 2018). At the present time, most of the recognized practices implemented for remediation of metal contaminated soils are expensive. Conversely, the breeding of metal stress tolerant varieties is a time consuming phenomenon. Therefore, experts are in search of cost effective and eco-friendly approaches to knob the Cd stress issue in * Corresponding author. E-mail address: [email protected] (N.A. Yasin). https://doi.org/10.1016/j.sajb.2019.11.003 0254-6299/© 2019 SAAB. Published by Elsevier B.V. All rights reserved.

plants. Latest researches have demonstrated the ameliorative effect of brassinosteroids (BRs) in various plants regarding heavy metal stress (Anwar et al., 2018). Brassinosteroids are dynamic class of steroidal lactones. These polyhydroxylated steroid phytohormones have proven a pivotal role in management of abiotic stresses in many plants species (Vozquez et al., 2013). BRs restore morpho-physiological mechanisms of plants for example ATPase activity, chlorophyll formation and cell growth in plants under stress conditions. These adjusted metabolic activities initiate growth improvement in plants under stress (Hayat et al., 2012). Likewise, BRs have well documented potency for mitigation of heavy metal stress in a number of plant species through regulation of morpho-physiological and genetic features of plants (Vardhini, 2016). These biological compounds are also involved in augmentation of the activities of various antioxidative enzymes in conjunction with improved photosynthetic rate and water relation in crop plants subjected to heavy metal stress (Sharma et al., 2016). Cucumber is one of the most important vegetable crops grown throughout the world. A variety of BRs are reported to improve metal tolerance and subsequent production of various vegetable crops under metal stress. However, miniscule information is available about the role of 24-EBL in alleviation of Cd toxicity in cucumber plants. Therefore, current research work was designed to perceive the potential of this

350

A.A. Shah et al. / South African Journal of Botany 127 (2019) 349
360

biomolecule in mitigation of Cd-stress in cucumber plants. Furthermore, it was hypothesized that possible ameliorative role of 24-EBL may encompass the activity of stress-responsive genes and antioxidative defense system of subjected plants. 2. Materials and methods 2.1. Plant materials and growth conditions Surface disinfection was accomplished by immersing C. sativus seeds in sodium hypochlorite (2%) for ten min. The sterilized seeds were washed thrice by using de-ionized water. The stock solution of 24-EBL (Sigma-Aldrich, USA) was prepared by dissolving 24-EBL in ethanol. For brassinosteroid application, seeds were soaked with 5 mM 24-EBL for 2 h. For all treatments, 9 cucumber seeds were evenly distributed in each petri dish containing 3 layers of Whatman filter paper (no. 1). For Cd spiking, 10 ml of 0 or 2.5 mM Cd was added in respective petri dishes. Whereas, for control, 10 ml distilled water was used. Three petri dishes (replicates) were reserved for each treatment by using complete randomized design (CRD). All petri dishes were placed in a growth chamber at 25 § 2 °C under 10 h dark/ 14 h light photoperiod set by means of 500
550 mmol m2 s1 light and 65
75% humidity for fifteen days. In all petri dishes, 20 ml water was applied at 2 days interval. 2.2. Determination of seedling growth The seeds of C. sativus exhibiting cracked seed coat and over 3 mm radicle were considered germinated after 3 days. The roots, shoots and leaves of 15 days old seedlings were immersed in water before drying on blotting paper. The fresh weight of shoot, root and complete plant together with root and shoot lengths were measured. Plant biomass from root and shoot samples dried in oven at 80 °C for 2 days was also recorded.

Metal tolerance index and translocation factor The metal tolerance index was measured as described by Shetty et al. (1995) according to following formula: MTI ¼

DWPS or DWPT  100 DWP
N

Where, DWPS= dry weight of plant under metal stress, DWPT= dry weight of antioxidant treated plant and DWP-N= dry weight of nonstressed/ non treated plants. The translocation factor in treated C. sativus seedlings was obtained by dividing the value of Cd contents in shoot to respective value in root. 2.6. Evaluation of hydrogen peroxide and lipid peroxidation Plant samples (50 mg) were mixed with 0.2 g activated charcoal dissolved in 6 ml of 5% TCA in a pre-chilled mortar. The amount of H2O2 was estimated at 390 nm (Velikova et al., 2000). The thiobarbituric acid reaction method was employed for MDA quantification (Rubin et al., 1976). 2.7. Assessment of electrolyte leakage (EL) The completely extended top leaf was cut in 0.5 cm sections. The prewashed leaf sections were submerged in 7 ml sterilized water. Leaf sections containing tubes were kept over rotary shaker at room temperature for 1 day. The primary conductivity (EC-i) of leaf sections was calculated through autoclaving the section holding tubes for 0.5 hat 120 °C. Maximum conductivity (EC-max) from solution comprising leaf sections was measured at room temperature for estimation of EL according to following equation proposed by Li et al. (2018): EL ¼ ðEC
i=EC
maxÞ100: 2.8. Evaluation of antioxidant enzymes

2.3. Determination of leaf relative water content The completely extended leaf samples were submerged in sterilized 100 ml distilled water in a dark place at 10 °C for 1 day. LRWC values from these turgid leaf samples were measured with the help of following equation as proposed by Smart and Bingham (1974): LRWCð%Þ ¼ LFW
LDW=LTW
LDW  100 Where, LFW, LDW and LTW are leaf fresh, dry and turgid weight, respectively. 2.4. Quantification of photosynthetic pigments For estimation of total chlorophyll (Chl), chlorophyll a (Chl a) and chlorophyll b (Chl b) amount from freshly harvested leaves, 0.5 g sample was submerged in 80% pre-chilled acetone solution containing small amount of CaCO3 and kept over a rotary shaker. After full leaf bleaching, the acetone was centrifuged at 13,000 rpm for 10 min. The colorimetric value of supernatant assessed at 663 nm, 645 nm and 470 nm was regarded as amount of Chl a, Chl b and carotenoids, respectively (Arnon, 1949).

For assessment of CAT activity, 1 g leaf sample was vortexed with 3 ml of 100 mM KH2PO4 buffer at pH = 7 followed by 20 min centrifugation at 12,000 rpm at 4 °C. The 70 ml supernatant was homogenized with 1500 ml 50 mM KH2PO4 buffer and 930 ml of 15 mM H2O2. The colorimetric value of mixture was observed at 240 nm to assess decomposition of H2O2 as described by Aebi (1984). For valuation of superoxide dismutase (SOD) activity, leaf sample (1 g) was vortexed with 3 ml sodium carbonate buffer followed by 20 min centrifugation at 12,000 rpm at 4 °C. The 70 ml procured supernatant was homogenized with 500 ml of 24 mM NBT, 100 ml of 0.1 mM EDTA, 100 ml of 1 mM HONH2¢HCl, 100 ml of 0.03% Triton-X100 in addition to 1630 ml of sodium carbonate buffer at pH 10.2. The optical density of solution was perceived at 560 nm (Kono, 1978). For the examination of POD activity, 1 g leaf sample was homogenized with 3 ml of KH2PO4 buffer 100 mM at pH = 7. The homogenate was centrifuged at 12,000 rpm for 20 min at 4 °C. The reaction mixture was prepared by vortexing 100 ml supernatant with 50 ml of guaiacol solution, 3 ml of KH2PO4 buffer and 30 ml of H2O2. The absorbance of mixture was measured at 436 nm according to Putter (1974). 2.9. Assessment of proline

2.5. Evaluation of gas exchange attributes An infrared gas analyzer was used for estimation of intercellular CO2 concentration, stomatal conductivity, net rate of photosynthesis (Pn) and transpiration rate from second upper most completely  et al. (2010). extended leaf at 9: 30 am according to Hola

For evaluation of proline contents, fresh leaf sample was crushed with 3% sulphosalicylic acid and homogenized with equivalent quantity of glacial acetic acid as well as ninhydrine (v/v) and stored at 100 °C. Afterwards, 5 ml toluene was mixed and solution absorbance was detected at 528 nm according to Bates et al. (1973).

A.A. Shah et al. / South African Journal of Botany 127 (2019) 349
360

351

2.10. Assessment of IAA content

2.13. Statistical analysis

Leaf sample (1 mg) crushed in pre-chilled mortar and pestle was homogenized with 10 ml of mixture containing 0.002conc. 1 HCl/ and 2 water /2-propanol (v/v/v). In this homogenate, 1 ml dichloromethane was added and mixture was placed over a rotary shaker at 100 rpm at 4 °C for 30 min. The lower solution phase procured by 5 min centrifugation at 13,000 rpm and 4 °C, was dehydrated by using nitrogen gas. This dehydrated sample was assorted with 0.1 ml methanol for auxin estimation (Pan et al., 2008; Ke et al., 2015). The IAA content was measured by using IAA ELISA kit (Sunlong Biotech Co., Ltd., Zhejiang: China). The absorbance values attained at 405 nm were analyzed by using software Gen 5 Data Analysis (Bio-Tek Instruments, Inc., USA) and matched with standard curve of known concentrations.

The data encompassing the average values of 3 replicates were subjected to one-way ANOVA and consequently to Duncan's Multiple Range Test. The variations were regarded as significant when P value was at least  0.05. The average values were evaluated and lower case letters were applied to emphasize the significant differences among the treatments by using DSASTAT software.

2.11. Estimation of leaf ethylene Freshly harvested 0.5 g leaf sample was placed in 12 ml sealed glass flask containing saturated filter paper and placed under florescent light. After 60 min, air (1 cm3) was withdrawn from flasks and injected into the gas chromatograph. Chromatograph was adjusted for the first 5 min at 100 °C to resolve ethylene followed by ramping at 15 °C min
1 to 150 °C and kept for 90 s to eliminate left over water content onto the column by injection. The rate of ethylene evolved was determined by comparing with pure ethylene concentrations, used as standard according to Wilkinson and Davies (2009). 2.12. Assessment of stress related gene expression RNA from seedling leaves was extorted by using a Tri-reagent Extraction Kit (Enzynomics, Korea) in accordance with manufacturer’s directions. Bio-Rad Real-Time PCR structure (Bio-Rad, USA) was used for the Real-Time qRT-PCR study. PCR replications were performed by applying SYBR Green-based one step RT-PCR kit (Enzynomics, Korea) as described by (Guo et al., 2012). The expression level of genes comprising ethylene receptor CS-ERS, 1-aminocyclopropane1-carboxylate oxidase2 (CsAOX), 1-aminocyclopropane-1-carboxylate oxidase1 (CSACO1), 1-aminocyclopropane-1-carboxylate oxidase2 (CSACO2), and indole acetic related CS 453 were assessed by using primers enlisted in Table 1.

Table 1 Primers used for Quantitative Real-time PCR (qPT-PCR) assays. Genes

Accession

Forward Primer

Reverse Primer

Number

(50
30 )

(50
30 )

CsACO1

AB006806.1

AGGTAGGTGGCCTGCAACTCC

CTCCGAGGTTGACGACAATGGC

CsACO2

AB006807.2

CAGTCTCCAACATCGCGGATCTC

GCAGGAGTTCGGCGAGTACTTG

CsACS3

AB006805

CCAACGGCATCATTCAGA

GCAAGGCAGAACATAAGTG

CsERS

AB026499.1

AGAAGTTGTTGCAGTGCGAGTCC

GCTACCTGGTCTGCGACAACATC

CsAOX

DQ641114

TCATCATCACCGAACTTACA

GAATCCACCATCCGACAA

3. Results 3.1. Assessment of growth attributes Cadmium toxicity severely affected root length and shoot length of cucumber seedlings. However, the enhanced radicle growth of 24-EBL supplemented seeds encouraged root length. Least root length was observed in case of seedlings challenged by Cd stress. The fresh and dry weight of root, diameter and number of initial root formation were also affected by Cd stress. The 24-EBL improved growth and alleviated Cd-stress in cucumber plants. Shoot length and number of leaves formed in case of 24-EBL treated seedlings was more manifested in Cd spiked seedlings (Table 2). 3.2. Assessment of photosynthesis, leaf water content and gas attributes Fig. 1 Seedlings facing Cd stress showed reduction in their rate of photosynthesis, transpiration and stomatal conductivity. 24-EBL supplementation improved these gas attributes. The values regarding rate of photosynthesis, transpiration and stomatal conductivity in BRs supplemented seedlings in absentia of Cd were 2.2, 1.92, and 6.75 fold, respectively, higher in contrast to seedlings growing in Cd contaminated condition (Figs. 2 and 3). The amount of Chl formed during current study was affected by Cd toxicity (Table 4). Nevertheless, 24-EBL overturned this harmful effect and enhanced rate of photosynthesis was observed in phytohormone treated seedlings. 3.3. Evaluation of leaf water contents Cadmium stress reduced water uptake and least value for leaf water contents (49%) was observed in Cd challenged seedlings. Nonetheless, 24-EBL supplementation enhanced water uptake and maximum water contents (87%) were demonstrated by 24-EBL primed seeds without Cd stress. 24-EBL application also improved 14% water contents in Cd opposed seedlings compared to those facing Cd stress devoid of 24-EBL supplementation (Fig 2). 3.4. Evaluation of photosynthetic pigments Metal stressed seedlings without 24-EBL application demonstrated significant reduction in photosynthetic contents. 24-EBL

Table 2 Effect of 24-EBL on root diameter, root fresh weight, shoot fresh weight, root dry weight, shoot dry weight, number of leaves and number of first lateral roots of Cucumis sativus seedlings under Cd stress. Values demonstrate means§ SD (n = 3). Treatments

C Cd 24-EBL Cd+ 24-EBL

Growth traits Root Diameter (mm)

Root FW (g plant
1)

Shoot FW (g plant
1)

Root DW (g plant
1)

Shoot DW (g plant
1)

No. of leaves

Number of first lateral roots

110§ 0.02ab 26 § 0.02c 139§ 0.02a 114§ 0.02b

05 § 0.35a 2.2 § 0.45ab 6.3 § 0.52a 5.79§ 0.17a

16 § 0.58b 11 § 0.63c 22 § 0.72a 15 § 0.43b

1.6 § 0.01a 0.5 § 0.21c 2.0 § 0.31a 1.3 § 0.22a

3.2 § 0.02a 0.3 § 0.06c 4.8 § 0.51a 3.7 § 0.91a

5 § 0.41a 2 § 0.56c 7 § 0.34a 6 § 0.76a

13 § 0.58a 5 § 0.31c 17§ 0.56a 11§0.24ab

Different letters indicate significant difference among the treatments (P  0.05). 24-EBL = 24- epibrassinolide, Cd= contaminated control, Cd + 24-EBL = cadmium + 24epibrassinolide.

352

A.A. Shah et al. / South African Journal of Botany 127 (2019) 349
360

400

A

Root length (mm)

a a

350

b 300 250

c 200 150 100 50 0

10 9

B ab

a b

8

Shoot length (cm)

7 6 5

c

4 3 2 1 0 Control

EBL

Cd

Cd + EBL

Fig. 1. The effect of 24-EBL on root and shoot length of Cucumis sativus seedlings under Cd stress. Values demonstrate means§ SD (n = 3). Different letters above the bars indicate significant difference among the treatments (P  0.05). EBL = 24-epibrassinolide, Cd = contaminated control, Cd + EBL = Cd +24-epibrassinolide.

primed seedlings showed 3.87, 1.92 and 2.71 folds higher Chl a, Chl b, total Chl, respectively, compared to Cd spiked seedlings (Table 4). 3.5. Estimation of and EL, MDA, and H2O2 Cadmium toxicity enhanced caused tissue damage and subjected plants showed more EL as well as MDA. Seedlings challenged by Cd stress showed 42, 55 and 38% higher EL, H2O2 and MDA level, respectively, compared to those growing in non-contaminated environment. 24-EBL significantly reduced EL and MDA (Fig. 4). Least values for EL, H2O2 and MDA were recorded in non-stressed seedlings supplemented with 24-EBL. 3.6. Activity of antioxidative enzymes The augmentation in activities of stress responsive enzymes (SOD, CAT and POD) was observed in plants under Cd regime. The 24-EBL supplementation in Cd spiked seedlings further enhanced activity of aforementioned enzymes. The non-stressed seedlings showed least values for activity of antioxidative enzymes. The SOD, CAT and POD enzymes in 24-EBL treated C. sativus seedlings in Cd polluted dishes revealed 1.56, 1.50 and 1.44 folds higher activity, respectively, as compared to those growing in un-contaminated control (Fig 5).

3.7. Quantification of non-enzymatic antioxidant The amount of non-enzymatic antioxidants (proline) increased in seedlings facing Cd toxicity. In the same way, 24-EBL application promoted additional accumulation of these compounds. 24-EBL treated seedlings under Cd stress demonstrated 1.26 fold higher quantity of proline as compared to non-contaminated seedlings (Table 4). 3.8. Cadmium contents Presence of Cd in petri dishes subsequently enhanced Cd uptake in root and shoot tissues of subjected seedlings. Higher Cd contents were observed in root tissues compared to shoot tissues of seedlings in all treatments. Furthermore, declined Cd uptake and translocation values were recorded in 24-EBL treated seedlings. Shoots of 24-EBL treated shoot under Cd displayed 1.22 folds reduced Cd uptake as compared to Cd control (Table 3). 3.9. Determination ethylene and IAA Cd toxicity caused reduction in level of IAA production in subjected seedlings. 24-EBL treatment enhanced ˃2 folds IAA biosynthesis compared to seedlings growing in Cd-contaminated petri dishes,

A.A. Shah et al. / South African Journal of Botany 127 (2019) 349
360

100

A

90

353

a a b

Lea f water content (%)

80 70 60

c

50 40 30 20 10 0

12

a

B

Photosynthetic rate (µmol m-1s-1)

ab 10

b

8 6

c

4 2 0 Control

EBL

Cd

Cd + EBL

Fig. 2. The effect of 24-EBL on leaf water content and photosynthetic rate of Cucumis sativus seedlings under Cd stress. Values demonstrate means§ SD (n = 3). Different letters above the bars indicate significant difference among the treatments (P  0.05). EBL = 24-epibrassinolide, Cd= contaminated control, Cd + EBL = Cd + 24-epibrassinolide.

respectively. 24-EBL increased expression level of IAA signaling protein, IAA14 (Cs453) compared to seedlings growing in Cd-contaminated or un-contaminated environment without supplementation of 24-EBL. Cs453 gene is involved in conciliation of a brassinosteroidinduced stress tolerance by IAA and exogenous 24-EBL application triggers up-regulation of this candidate (Li et al., 2013a). 24-EBL also enhanced ethylene generation in seedlings growing either in Cd contaminated and non-contaminated environment (Fig 6). 3.10. Assessment of gene expression Our results exhibited that 24-EBL supplementation up-regulated the expression of genes including CS-ERS, CsAOX, 1-aminocyclopropane-1-carboxylate oxidase1 (CSACO1), 1-aminocyclopropane-1-carboxylate oxidase2 (CSACO2) and CS 453 (Fig 7). 4. Discussion Cadmium toxicity reduces growth and biomass of many horticultural crops (Rady, 2011). Current study also revealed that Cd toxicity reduced growth of subjected cucumber plants. This reduced growth may be ascribed to the deleterious effect of Cd toxicity on activities of

membranous enzymes which results in reduction of leaf water content (Yue et al., 2016), and creates water deficit conditions inside the cellular compartments of challenged plants (Chen et al., 2013). On the other hand, cucumber seedlings raised from 24-EBL treated seeds exhibited relatively higher growth compared to those grown in Cd contaminated regime. BRs enhance growth through increased biosynthesis of organic acid and maintenance of tissues involved in efficient water and nutrients movement from root to apical meristem (Vardhini et al., 2010). Likewise, 24-EBL augmented cellular turgidity and subsequent cell enlargement in Hordeum vulgare (Bajguz et al., 2019). Similarly, 24-EBL increased cellular growth and subsequent surface area of leaves in cucumber plants (Anwar et al., 2018). The higher activity of chlorophyllase reduces Chl contents of  ska et al., plants facing Cd stress (Andrade junior et al., 2019; Szafran 2017). Furthermore, Cd toxicity declines the biosynthesis of protochlorophyllide reductase and d-aminolavulinic acid causing reduction in Chl biosynthesis (Stabort et al., 1985). BRs induce the translation of enzymes related to Chl bio-synthesis (Bajguz, 2000). BRs enabled plants to sustain their photosynthetic rate through reduction in the impairment of reaction center and instigation of O2
emerzquez et al., 2013; Asgher et al., 2015). In our case, gent apparatus (Va 24-EBL treatment perhaps declined the activity of chlorophyllase and

354

A.A. Shah et al. / South African Journal of Botany 127 (2019) 349
360

Intercellular CO2concentration (µmol mol-1)

Stomatal conductance (mmolCo2 m-2s-1)

0.3

a

0.25 0.2

b

0.15 0.1

c

0.05 0

600

B a

500

a

400

b

300 200

c

100 0

6

Transpiration rate (mmol H20 m-2 s-1)

a

A

C

a b

5 4

bc 3

c

2 1 0 Control

EBL

Cd

Cd + EBL

Fig. 3. The effects of 24-EBL on stomatal conductance, intercellular CO2 concentration and transpiration rate of Cucumis sativus seedlings under Cd stress. Values demonstrate means § SD (n = 3). Different letters above the bars indicate significant difference among the treatments (P  0.05). EBL = 24-epibrassinolide, Cd = contaminated control, Cd + EBL = Cd + 24epibrassinolide.

improved biosynthesis of protochlorophyllide reductase and d-aminolavulinic acid. The higher Cd concentration also results in reduction of net photosynthetic rate through disturbance in water relations (Dikkaya and

Ergun, 2014). Under Cd-contaminated conditions, 24-EBL reduced electrolyte leakage, orchestered photosynthetic and transpiration rate by reduction in uptake of Cd (Xue-Xia et al., 2011). The application of 24-EBL reduced metal uptake in beet root (Khripach et al.,

A.A. Shah et al. / South African Journal of Botany 127 (2019) 349
360

45

A

40

a

35

b bc

30

MDA content (%)

355

25

c

20 15 10 5 0 50

B

a

Electrolyte leakage (%)

45 40

b

35 30

bc

25

c

20 15 10 5 0

70

C

a

H2O2 Content (µgg-1 FW)

60 50 40 30

b

bc c

20 10 0 Control

EBL

Cd

Cd + EBL

Fig. 4. The effects of 24-EBL on seed MDA content, electrolyte leakage and H2O2 content of Cucumis sativus seedlings under Cd stress. Values demonstrate means§ SD (n = 3). Different letters above the bars indicate significant difference among the treatments (P  0.05). EBL = 24-epibrassinolide, Cd = contaminated control, Cd + EBL = Cd + 24-epibrassinolide.

2003). Our results also indicated that 24-EBL treatment reduced Cduptake in cucumber plants, which assisted in regulation of photosynthetic and transpiration rate in cucumber plants. BRs diminish lipid breakdown that results due to the excessive accumulation of ROS in stressful environment (Lv et al., 2018). AOX

is one of the terminal oxidase formed during electron transport system consumed in non-phosphorylating electron transport chain (Clifton et al., 2006; Wang et al., 2012). AOX is involved in scavenging of ROS, thereby reducing chloroplast degradation and improving the rate of photosynthesis in plants (Xu et al., 2012). The

356

A.A. Shah et al. / South African Journal of Botany 127 (2019) 349
360

7000

a

A

SOD activity (Ug-1 pro)

6000

ab

5000

b

c 4000 3000 2000 1000 0

3500

B

a

ab

CAT activity (ug-1 pro.min)

3000

b

2500

c

2000 1500 1000 500 0

POD activity (u g-1 pro.s)

4000

a

C

b bc

3500 3000

c

2500 2000 1500 1000 500 0 Control

EBL

Cd

Cd + EBL

Fig. 5. The effects of 24-EBL on activity of SOD, CAT and POD of Cucumis sativus seedlings under Cd stress. Values demonstrate means§ SD (n = 3). Different letters above the bars indicate significant difference among the treatments (P  0.05). EBL = 24-epibrassinolide, Cd= contaminated control, Cd + EBL = Cd + 24-epibrassinolide.

increased level of H2O2 assists in alleviation of a-biotic stress in BRs treated plants (Zhou et al., 2014; Deng et al., 2015). Therefore, it is assumed that there exists a positive relation among ROS, ethylene and AOX in BR-induced pathway regarding stress alleviation in plants. Some other researchers also advocate that higher ethylene and AOX levels are interrelated and help in mitigation of plant stress (Wang et al., 2010; Xu et al., 2012). The H2O2 induce alternate

pathway, AOX, biochemical and physiological changes in plants to alleviate stress (Feng et al., 2015; Wang et al., 2010). Application of 24-EBL regulated H2O2 content in Solanum nigrum under nickel stress (Soares et al., 2016). Modulation in activity of AOX, increase in ethylene level and reduction in H2O2 content which resulted in alleviation of Cd-stress in cucumber plants as was observed in our experiment.

A.A. Shah et al. / South African Journal of Botany 127 (2019) 349
360

357

Table 3 Effect of 24-EBL on cadmium (Cd) uptake (mg g-1 DW) in root and shoot, translocation factor (TF) and metal tolerance index (MTI) in Cucumis sativus under cadmium stress. Values demonstrate means§ SD (n = 3). Treatments

C Cd 24-EBL Cd+ 24-EBL

Cd uptake Root (mg g-1 DW)

Shoot (mg g-1 DW)

TF

MTI

ND 13,546 § 46a 0.41 § 0.03e 09,237 § 24c

ND 639 § 28a 0.37 § 0.01c 525 § 23b

ND 0.02 § 0.01c 0.90 § 0.04a 0.05 § 0.01bc


11.67 § 1.26c 132 § 11.28a 105 § 8.74a

Different letters indicate significant difference among the treatments (P  0.05). 24-EBL = 24- epibrassinolide, Cd = contaminated control, Cd + 24-EBL = cadmium + 24-epibrassinolide.

Table 4 Effect of 24-EBL on carotenoids, total chlorophyll, chlorophyll b, chlorophyll a, protease enzyme and protease activity. Values demonstrate means§ SD (n = 3).

MDA, a lipid peroxidation marker is responsible for cellular destabilization. Cd stress caused elevated level of lipid peroxidation in subjected cucumber plants. Our results with relation to reduced MDA and H2O2 content in 24-EBL applied seedlings are harmonious with findings of Jin et al. (2015). Reduced MDA level was observed in BRs applied seedlings facing Cd stress (Vardhini and Anjum, 2015). Plants subjected to Cd toxicity exhibit higher activity of antioxidant enzymes such as SOD, CAT and POD. This augmented activity of defense enzymes help plants to mitigate Cd stress (Guo et al., 2019). Higher enzymatic activity of SOD, CAT and POD was observed in Cd treated cucumber seedlings. BRs application results in enhancement of antioxidant enzymatic activity in plants (Yusuf et al., 2014;

Treatments

C Cd 24-EBL Cd+ 24-EBL

Carotenoids

Total Chlorophyll

Chlb

Chla

4.1 § 0.02a 0.39§ 0.06c 5.79§ 0.51a 4.65§ 0.91a

1.28 § 0.58ab 0.57 § 0.63c 1.54 § 0.72a 1.11§ 0.43b

0.55 § 0.35ab 0.34 § 0.45c 0.65§ 0.52a 0.42§ 0.17b

0.73 § 0.41ab 0.23§ 0.56c 0.89§ 0.34a 0.69§ 0.76b

Different letters indicate significant difference among the treatments (P  0.05). 24EBL = 24- epibrassinolide, Cd= contaminated control, Cd + 24-EBL = cadmium + 24epibrassinolide.

Leaf ethylene production (nl h-1g-1)

25

a

A

b

20

bc c

15

10

5

0

IAA Concentration ( pg g-1 FW)

1.6

B

a

1.4 1.2 1

b

bc c

0.8 0.6 0.4 0.2 0 Control

EBL

Cd

Cd+ EBL

Fig. 6. The effects of 24-EBL on leaf ethylene production and IAA concentration of Cucumis sativus seedlings under Cd stress. Values demonstrate means§ SD (n = 3). Different letters above the bars indicate significant difference among the treatments (P  0.05). EBL = 24-epibrassinolide, Cd= contaminated control, Cd + EBL = Cd + 24-epibrassinolide.

358

A.A. Shah et al. / South African Journal of Botany 127 (2019) 349
360

9

Relative expression

8 7 6 Control

5

EBL

4

Cd

3

Cd+EBL

2 1 0 CSAOX

CS‐ ERS

CSACO1

CSACO2

Cs453

Fig. 7. The effects of 24-EBL on gene expression of Cucumis sativus seedlings under Cd stress. Values demonstrate means § SD (n = 3). Different letters above the bars indicate significant difference among the treatments (P  0.05). EBL = 24-epibrassinolide, Cd= contaminated control, Cd + EBL = Cd + 24-epibrassinolide.

Fariduddin et al., 2015). Brassinolide attenuated the Cd toxicity and enhanced the activity of enzymatic antioxidants in Chlorella vulgaris (Bajguz, 2010). Higher CAT activity of 24-EBL treated seedlings may be ascribed to increased CO2 accumulation and NO3 assimilation (Deng et al., 2016). Likewise, 24-EBL emphatically enhanced the activity of SOD, CAT and POD in C. sativus under stress due to decrease production of electrolyte leakage, MDA level and H2O2 content (Yuan et al., 2012). Application on 24-EBL enhanced the activity of POD in egg plant under chilling conditions, resulting in inhibition of chilling injury (Gao et al., 2015). Furthermore, 24-EBL enhanced CAT activity in Brassica juncea in response to nickel stress (Ali et al., 2008). The reduced level of electrolyte leakage, MDA and H2O2 contents in case of 24-EBL applied seedlings during current study may be ascribed to the enhanced activity of SOD, CAT and POD. Higher amount of SOD, CAT and POD observed in 24-EBL treated cucumber seedlings might have ameliorated the effect of Cd toxicity and improved vegetative growth of cucumber plants. During initial phase of ethylene pathway, methionine adenosyl transferases changes methionine into S-adenosylmethionine (SAM). ACC synthase (ACS) convert SAM into 1-amioncyclopropane-1-carboxylic acid (ACC) following ethylene formation through ACC oxidase (ACO) (Lin et al., 2010; Wang et al., 2012). Ethylene reduces the activity of cytochrome oxidase and improves the activity of alternative oxidase (AOX) (Wei et al., 2015). Brassinosteroids enhance the activity of AOX and ethylene level in cucumber plants under a-biotic stresses (Wang et al., 2012; Zhu et al., 2015). Application of 24-EBL increased ethylene level in pea plants in response to sodium chloride stress (Wang et al., 2011). Likewise, 24-EBL enhanced bioactivity of IAA in response to low-temperature stress in C. sativus (Anwar et al., 2018). Our results also indicated increase in IAA content, higher levels of ethylene and enhanced activity of AOX in 24-EBL treated cucumber plants under Cd stress. Some other researchers have also demonstrated the role of BRs in enhancement of AOX amount and reduction of oxidative stress in C. sativus through up-regulation of genes (ACC synthase1 (CSACS1), ripening-related ACC synthase2 (CSACS2), ripening-related ACC synthase3 (CSACS3), 1-aminocyclopropane-1-carboxylate oxidase1 (CSACO1), 1-aminocyclopropane-1-carboxylate oxidase2 (CSACO2), and CSAOX) involved in ethylene generation (Wei et al., 2015). BRs alleviated metal stress in cucumber plants through modulation of expression level of defense related Cs623 (MLP like protein), Cs594 (phloem protein 2), Cs453 (auxin protein/ IAA14), Cs579 (molecular chaperone) and activation of antioxidant enzymes (Li et al., 2013b). BRs mitigated metal stress in plants through

enhancement of proline level (Abbas et al., 2013; Liu et al., 2014). BRs supplementation also up-regulates the expression level of genes involved in regulation of stressed plant growth in case of Arabidopsis (Yu et al., 2011; Li et al., 2009). Current research revealed that 24-EBL enhanced expression level of genes related to biosynthesis of ethylene and IAA content. 5. Conclusion Cadmium toxicity reduced photosynthetic pigments, rate of photosynthesis and transpiration besides reduction in growth of cucumber plants. A notable increase in quantity of MDA, EL and H2O2 content was observed in cucumber seedlings grown in Cd-contaminated conditions. Contrariwise, the 24-EBL increased proline contents, gas exchange attributes and leaf relative water contents in cucumber plants. Furthermore, 24-EBL alleviated Cd stress by increasing the activity of antioxidant enzymes and through enhanced expression level of CS-ERS, CsAOX, CSACO1, CSACO2, and CS 453. These findings endorse 24-EBL application for stress mitigation and growth reassurance of cucumber plants growing in Cd-contaminated areas. Nevertheless, additional molecular studies are required to explicate the Cd tolerance and growth promoting mechanism of 24-EBL treated cucumber plants. Besides, the prospective application of 24-EBL should be examined to boost stress tolerance crop plants growing in metal-challenged field conditions. Declaration of competing interest None. Supplementary materials Supplementary material associated with this article can be found in the online version at doi:10.1016/j.sajb.2019.11.003. References Abbas, S., Latif, H.H., Elsherbiny, E.A., 2013. Effect of 24-epibrassinolide on the physiological and genetic changes on two varieties of pepper under salt stress conditions. Pak. J. Bot. 45, 1273–1284. Aebi, H., 1984. [13]Catalase in vitro. Methods in Enzymology, Vol. 105. Academic Press, pp. 121–126. Ali, B., Hayat, S., Fariduddin, Q., Ahmad, A., 2008. 24-Epibrassinolide protects against the stress generated by salinity and nickel in Brassica juncea. Chemosphere 72 (9), 1387–1392.

A.A. Shah et al. / South African Journal of Botany 127 (2019) 349
360  nior, W.V., de Oliveira Neto, C.F., Santos Filho, B.G.D., Amarante, C.B., Andrade Ju Cruz, E.D., Okumura, R.S., et al., 2019. Effect of cadmium on young plants of Virola surinamensis. AoB Plants 11 (3) plz022. Anwar, A., Bai, L., Miao, L., Liu, Y., Li, S., Yu, X., et al., 2018. 24-Epibrassinolide ameliorates endogenous hormone levels to enhance low-temperature stress tolerance in cucumber seedlings. Int. J. Mol. Sci. 19 (9), 2497. Arnon, D.I., 1949. Copper enzymes in isolated chloroplasts. polyphenoloxidase in beta vulgaris. Plant Physiol. 24 (1), 1. Asgher, M., Khan, M.I.R., Anjum, N.A., Khan, N.A., 2015. Minimising toxicity of cadmium in plants—role of plant growth regulators. Protoplasma 252 (2), 399–413. Bajguz, A., 2000. Effect of brassinosteroids on nucleic acids and protein content in cultured cells of Chlorella vulgaris. Plant Physiol. Biochem. 38 (3), 209–215. Bajguz, A., 2010. An enhancing effect of exogenous brassinolide on the growth and antioxidant activity in Chlorella vulgaris cultures under heavy metals stress. Environ. Exp. Bot. 68 (2), 175–179. Bajguz, A., Orczyk, W., Go»˛ebiewska, A., Chmur, M., Piotrowska-Niczyporuk, A., 2019. Occurrence of brassinosteroids and influence of 24-epibrassinolide with brassinazole on their content in the leaves and roots of Hordeum vulgare L. cv. Golden promise. Planta 249 (1), 123–137. Bates, L.S., Waldren, R.P., Teare, I.D., 1973. Rapid determination of free proline for water-stress studies. Plant Soil 39 (1), 205–207. Chen, G., Liu, Y., Wang, R., Zhang, J., Owens, G., 2013. Cadmium adsorption by willow root: the role of cell walls and their subfractions. Environmental Science and Pollution Research 20 (8), 5665–5672. Clifton, R., Millar, A.H., Whelan, J., 2006. Alternative oxidases in Arabidopsis: a comparative analysis of differential expression in the gene family provides new insights into function of non-phosphorylating bypasses. Biochimica et Biophysica Acta (BBA)-Bioenergetics 1757 (7), 730–741. Deng, X.G., Zhu, T., Zhang, D.W., Lin, H.H., 2015. The alternative respiratory pathway is involved in brassinosteroid-induced environmental stress tolerance in Nicotiana benthamiana. Journal of experimental botany 66 (20), 6219–6232. Deng, X.G., Zhu, T., Zou, L.J., Han, X.Y., Zhou, X., Xi, D.H., et al., 2016. Orchestration of hydrogen peroxide and nitric oxide in brassinosteroid
mediated systemic virus resistance in nicotiana benthamiana. Plant J. 85 (4), 478–493. Dikkaya, E.T., Ergun, N., 2014. Effects of cadmium and zinc interactions on growth parameters and activities of ascorbate peroxidase on maize (Zea mays L. Mat 97). Eur. J. Exp. Biol. 4 (1), 288–295. Fariduddin, Q., Ahmed, M., Mir, B.A., Yusuf, M., Khan, T.A., 2015. 24-Epibrassinolide mitigates the adverse effects of manganese induced toxicity through improved antioxidant system and photosynthetic attributes in Brassica juncea. Environm. Sci. Pollut. Res. 22 (15), 11349–11359. Feng, X., Zhang, Y., Song, J., Chen, N., Zhou, J., Huang, Z., et al., 2015. MnO2/graphene nanocomposites for nonenzymatic electrochemical detection of hydrogen peroxide. Electroanalysis 27 (2), 353–359. Gao, H., Kang, L., Liu, Q., Cheng, N., Wang, B., Cao, W., 2015. Effect of 24-epibrassinolide treatment on the metabolism of eggplant fruits in relation to development of pulp browning under chilling stress. J. Food Sci. Technol. 52 (6), 3394–3401. Guo, J., Chen, L., Liu, X., Gao, Y., Zhang, D., Yang, L., 2012. A multiplex degenerate PCR analytical approach targeting to eight genes for screening GMOs. Food Chem. 132 (3), 1566–1573. Guo, J., Qin, S., Rengel, Z., Gao, W., Nie, Z., Liu, H., et al., 2019. Cadmium stress increases antioxidant enzyme activities and decreases endogenous hormone concentrations more in Cd-tolerant than Cd-sensitive wheat varieties. Ecotoxicol. Environ. Saf. 172, 380–387. Hamid, Y., Tang, L., Sohail, M.I., Cao, X., Hussain, B., Aziz, M.Z., et al., 2019. An explanation of soil amendments to reduce cadmium phytoavailability and transfer to food chain. Sci. Total Environ 660, 80–96. Hayat, S., Alyemeni, M.N., Hasan, S.A., 2012. Foliar spray of brassinosteroid enhances yield and quality of Solanum lycopersicum under cadmium stress. Saudi journal of biological sciences 19 (3), 325–335. Brassinosteroids: Bioactivity and Crop Productivity. In: Hayat, S., Ahmad, A. (Eds.), Brassinosteroids: Bioactivity and Crop Productivity. Klu-wer Academic Publisher, Dordrecht, pp. 189–230. , D., Bene
sova , M., Honnerova , J., Hnili
cka, F., Rothova, O., Ko
cova , M., et al., 2010. Hola The evaluation of photosynthetic parameters in maize inbred lines subjected to water deficiency: can these parameters be used for the prediction of performance of hybrid progeny? Photosynthetica 48 (4), 545–558. Jin, S.H., Li, X.Q., Wang, G.G., Zhu, X.T., 2015. Brassinosteroids alleviate high-temperature injury in Ficus concinna seedlings via maintaining higher antioxidant defence and glyoxalase systems. AoB Plants 7. Ke, M., Zheng, Y., Zhu, Z., 2015. Rethinking the origin of auxin biosynthesis in plants. Front. Plant. Sci. 6, 1093. Khripach, V.A., Zhabinskii, V.N., Khripach, N.B., 2003. New practical aspects of brassinosteroids and results of their ten-year agricultural use in Russia and Belarus. In Brassinosteroids. Springer, Dordrecht, pp. 189–230. Kono, Y., 1978. Generation of superoxide radical during autoxidation of hydroxylamine and an assay for superoxide dismutase. Arch. Biochem. Biophys. 186 (1), 189–195. Leng, B.Y., Jia, W.J., Yan, X., Yuan, F., Dong, X.X., Wang, B.S., 2018. Cadmium stress in halophyte thellungiella halophila: consequences on growth, cadmium accumulation, reactive oxygen species and antioxidative systems. In: Proceedings of the IOP Conference Series: Earth and Environmental Science. 153, IOP Publishing, 062002. Li, P., Chen, L., Zhou, Y., Xia, X., Shi, K., Chen, Z., et al., 2013a. Brassinosteroidsinduced systemic stress tolerance was associated with increased transcripts of several defence-related genes in the phloem in Cucumis sativus l. PLoS One 8 (6), e66582.

359

Li, F.T., Qi, J.M., Zhang, G.Y., Lin, L.H., Fang, P.P., Tao, A.F., et al., 2013b. Effect of cadmium stress on the growth, antioxidative enzymes and lipid peroxidation in two kenaf (Hibiscus cannabinus L.) plant seedlings. J. Integr. Agric. 12 (4), 610–620. Li, L., Yu, X., Thompson, A., Guo, M., Yoshida, S., Asami, T., et al., 2009. Arabidopsis MYB30 is a direct target of BES1 and cooperates with BES1 to regulate brassinosteroid
induced gene expression. Plant J. 58 (2), 275–286. Li, Q., Wang, G., Wang, Y., Yang, D., Guan, C., Ji, J., 2019. Foliar application of salicylic acid alleviate the cadmium toxicity by modulation the reactive oxygen species in potato. Ecotoxicol. Environ. Saf. 172, 317–325. Li, S., Yang, Y., Zhang, Q., Liu, N., Xu, Q., Hu, L., 2018. Differential physiological and metabolic response to low temperature in two zoysiagrass genotypes native to high and low latitude. PLoS One 13 (6), e0198885. Lin, L.C., Hsu, J.H., Wang, L.C., 2010. Identification of novel inhibitors of 1-aminocyclopropane-1-carboxylic acid synthase by chemical screening in Arabidopsis thaliana. Journal of Biological Chemistry 285 (43), 33445–33456. Liu, J., Gao, H., Wang, X., Zheng, Q., Wang, C., Wang, X., et al., 2014. Effects of 24-epibrassinolide on plant growth, osmotic regulation and ion homeostasis of saltstressed canola. Plant Biol. 16, 440–450. Lv, B., Tian, H., Zhang, F., Liu, J., Lu, S., Bai, M., et al., 2018. Brassinosteroids regulate root growth by controlling reactive oxygen species homeostasis and dual effect on ethylene synthesis in arabidopsis. PLoS Genet. 14 (1), e1007144. Pan, X., Welti, R., Wang, X., 2008. Simultaneous quantification of major phytohormones and related compounds in crude plant extracts by liquid chromatography
electrospray tandem mass spectrometry. Phytochemistry 69 (8), 1773–1781. € tter, J., 1974. Peroxidases. Methods of Enzymatic Analysis. Academic Press, pp. Pu 685–690. Rady, M.M., 2011. Effect of 24-epibrassinolide on growth, yield, antioxidant system and cadmium content of bean (Phaseolus vulgaris L.) plants under salinity and cadmium stress. Sci. Hortic. 129 (2), 232–237. Rahman, Z., Singh, V.P., 2019. The relative impact of toxic heavy metals (THMs)(arsenic (As), cadmium (Cd), chromium (Cr)(VI), mercury (Hg), and lead (Pb) on the total environment: an overview. Environ. Monit. Assess. 191 (7), 419. Rubin, B.A., Merzliak, M.N., IUferova, S.G., 1976. Oxidation of lipid components in isolated chloroplasts by the action of light: substrates and products of lipid peroxidation. Fiziol. Rast. Mosk 254–261. Sharma, P., Kumar, A., andBhardwaj, R., 2016. Plant steroidal hormone epibrassinolide regulate
Heavy metal stress tolerance in Oryza sativa L. by modulating antioxidant defense expression. Environ. Exp. Bot. 122, 1–9. Shetty, K.G., Hetrick, B.A.D., Schwab, A.P., 1995. Effects of mycorrhizae and fertilizer amendments on zinc tolerance of plants. Environ. Pollut. 88 (3), 307–314. Smart, R.E., Bingham, G.E., 1974. Rapid estimates of relative water content. Plant Physiol. 53 (2), 258–260. Soares, C., de Sousa, A., Pinto, A., Azenha, M., Teixeira, J., Azevedo, R.A., et al., 2016. Effect of 24-epibrassinolide on ros content, antioxidant system, lipid peroxidation and Ni uptake in Solanum nigrum L. under Ni stress. Environ. Exp. Bot. 122, 115–125. Stabort, A.K., Griffits, W., Bukhari, I., Sherwood, A., 1985. The effect of Ca2+ on the biosynthesis of chlorophyll in leaves of barley. Physiol. Plant 63, 293–298.  ska, K., Reiter, R.J., Posmyk, M.M., 2017. Melatonin improves the photosynthetic Szafran apparatus in pea leaves stressed by paraquat via chlorophyll breakdown regulation and its accelerated de novo synthesis. Front. Plant Sci. 8, 878. Vardhini, B.V., 2016. Brassinosteroids are potential ameliorators of heavy metal stresses in plants. Plant Metal Interaction. Elsevier, pp. 209–237. Vardhini, B.V., Anjum, N.A., 2015. Brassinosteroids make plant life easier under abiotic stresses mainly by modulating major components of antioxidant defense system. Front. Environ. Sci. 2, 67. Vardhini, B.V., Anuradha, S., Sujatha, E., Rao, S.S.R., 2010. Role of brassinosteroids in alleviating various abiotic and biotic stresses-a review. Plant Nutr. Abiotic Stress Toler. I. Plant Stress 4, 56–61. lez, L.M., de la Noval, W.T., 2013. Brassinosteroids Vazquez, M.N., Guerrero, Y.R., Gonza and plant responses to heavy metal stress. An overview. Open J Met 3 (02), 34. Velikova, V., Yordanov, I., Edreva, A., 2000. Oxidative stress and some antioxidant systems in acid rain-treated bean plants: protective role of exogenous polyamines. Plant Sci. 151 (1), 59–66. Wang, F., Bai, M.Y., Deng, Z., Oses-Prieto, J.A., Burlingame, A.L., Lu, T., et al., 2010. Proteomic study identifies proteins involved in brassinosteroid regulation of rice growth. Journal of integrative plant biology 52 (12), 1075–1085. Wang, B., Zhang, J., Xia, X., Zhang, W.H., 2011. Ameliorative effect of brassinosteroid and ethylene on germination of cucumber seeds in the presence of sodium chloride. Plant Growth Regul. 65 (2), 407. Wang, Z.Y., 2012. Brassinosteroids modulate plant immunity at multiple levels. Proceedings of the National Academy of Sciences 109 (1), 7–8. Wei, L., Deng, X.G., Zhu, T., Zheng, T., Li, P.X., Wu, J.Q., et al., 2015. Ethylene is involved in brassinosteroids induced alternative respiratory pathway in cucumber (Cucumis sativus L.) seedlings response to abiotic stress. Front. Plant Sci. 6, 982. Wilkinson, S., Davies, W.J., 2009. Ozone suppresses soil drying
and abscisic acid (ABA)
induced stomatal closure via an ethylene
dependent mechanism. Plant Cell Environ. 32 (8), 949–959. Xu, F., Yuan, S., Zhang, D.W., Lv, X., Lin, H.H., 2012. The role of alternative oxidase in tomato fruit ripening and its regulatory interaction with ethylene. Journal of experimental botany 63 (15), 5705–5716. Xue-Xia, W.U., Zha, D.S., Zhu, Z.W, 2011. Effects of exogenous 24-epibrassinolide on seed germination, physiological characteristics of eggplant seedlings under NaCl stress. Plant Physiol. J. 47, 607–612. Yu, X., Li, L., Zola, J., Aluru, M., Ye, H., Foudree, A., et al., 2011. A brassinosteroid transcriptional network revealed by genome-wide identification of BESI target genes in Arabidopsis thaliana. Plant J. 65 (4), 634–646.

360

A.A. Shah et al. / South African Journal of Botany 127 (2019) 349
360

Yuan, L., Yuan, Y., Du, J., Sun, J., Guo, S, 2012. Effects of 24-epibrassinolide on nitrogen metabolism in cucumber seedlings under Ca(no3)2 stress. Plant Physiol. Biochem. 61, 29–35. Yue, R., Lu, C., Qi, J., Han, X., Yan, S., Guo, S., et al., 2016. Transcriptome analysis of cadmium-treated roots in maize (Zea mays L.). Front. Plant Sci. 7, 1298. Yusuf, M., Fariduddin, Q., Ahmad, I., Ahmad, A., 2014. Brassinosteroid-mediated evaluation of antioxidant system and nitrogen metabolism in two contrasting cultivars of Vigna radiata under different levels of nickel. Physiol. Mol. Biol. Plants 20 (4), 449–460.

Zhou, J., Wang, J., Li, X., Xia, X.J., Zhou, Y.H., Shi, K., et al., 2014. H2O2 mediates the crosstalk of brassinosteroid and abscisic acid in tomato responses to heat and oxidative stresses. Journal of experimental botany 65 (15), 4371–4383. Zhu, X., Liang, W., Cui, X., Chen, M., Yin, C., Luo, Z., et al., 2015. Brassinosteroids promote development of rice pollen grains and seeds by triggering expression of Carbon Starved Anther, a MYB domain protein. The Plant Journal 82 (4), 570–581.