Seed priming with 3-epibrassinolide alleviates cadmium stress in Cucumis sativus through modulation of antioxidative system and gene expression

Scientia Horticulturae 265 (2020) 109203

Contents lists available at ScienceDirect

Scientia Horticulturae journal homepage: www.elsevier.com/locate/scihorti

Seed priming with 3-epibrassinolide alleviates cadmium stress in Cucumis sativus through modulation of antioxidative system and gene expression

T

Anis Ali Shaha, Shakil Ahmeda, Muhammad Abbasb, Nasim Ahmad Yasinc,* a

Department of Botany, University of the Punjab, Lahore, Pakistan Department of Microbiology and Molecular Genetics, University of the Punjab, Lahore, Pakistan c Senior Superintendent Garden, University of the Punjab, Lahore, Pakistan b

A R T I C LE I N FO

A B S T R A C T

Keywords: Alleviation antioxidant Cd Cucumis sativus 3-epibrassinolide

The current research work was designed to interpret the potential and mechanism of cadmium (Cd) stress alleviation in cucumber (Cucumis sativus L.) seeds primed with 3-epibrassinolide (3-EBL). Phenological traits of different cucumber cultivars revealed that cv. French green was most susceptible variety with respect to Cd stress. Seeds of cv. French green primed with 1, 5 and 10 μM of 3-EBL were grown in Cd spiked petri plates for 10 d. Oxidative injury caused by higher biosynthesis of reactive oxygen species (ROS) and malondialdehyde (MDA) damaged morphological features in addition to leaf relative water content (LRWC), photosynthetic constituents and gas exchange attributes in C. sativus seedlings under Cd toxicity. However, 3-EBL treatment assisted in subsidence of these detrimental effects of Cd-induced toxicity on growth attributes of exposed seedlings. Stress alleviation effect of 3-EBL was more prominent at 5 μM than at 1 and 10 μM. Lower Cd level in C. sativus leaves revealed the pragmatic engrossment of 3-EBL in Cd translocation. Seed priming with 3-EBL enhanced shoot growth and biomass production of C. sativus seedlings facing Cd stress. On the other hand, 3-EBL priming reduced MDA and ROS level in treated seedlings. Furthermore, expression level of genes including ethylene receptor CS-ERS, 1-aminocyclopropane-1-carboxylate oxidase1 (CSACO1), 1-aminocyclopropane-1-carboxylate oxidase2 (CsAOX), and 1-aminocyclopropane-1-carboxylate oxidase2 (CSACO2) increased in 3-EBL treated seedlings. From current study it was concluded that 3-EBL alleviated Cd-toxicity through enhanced activity of antioxidant enzymes besides regulation of stress-responsive genes in cucumber seedlings.

1. Introduction Inappropriate disposal of heavy metals polluted industrial effluents have caused devastating effects on agricultural productivity from contaminated arable lands throughout the world (Shahzad et al., 2018). Cadmium is perhaps the most common and lethal metal constituent present in a number of industrial effluents. Application of water contaminated with industrial effluents for crop irrigation has raised Cd concentration in soils of Pakistan. Additionally, the reckless consumption of phosphate fertilizers has increased Cd pollution in agronomic sites (Hamid et al., 2019; Wani et al., 2018). This non-essential element causes overproduction of reactive oxygen species (ROS) causing stress in plants. Regulation in biosynthesis of ROS is a crucial strategy pertaining to management of environmental stresses (Zaid and Wani, 2019; Zaid et al., 2018). Plant defensive system comprising antioxidants and numerous metabolites have proven effective in mitigating Cd-induced stress (Zaid et al., 2019a). A variety of growth hormones contribute in

⁎

advancement of plant tolerance. However, this innate defense system may not efficaciously enable all plant species to cope with Cd-induced damage (Li et al., 2019). Therefore, it becomes indispensable to find out some eco-friendly and cost-effective tactic for alleviation of Cd stress. Exogenous applications of some hormones for example salicylic acid and brassinosteroids have shown enormous potential in alleviation of environmental stresses in some plant species (Zaid et al., 2019c; Anwar et al., 2018). Brassinosteroids are versatile phytohormones encompassing over sixty compounds isolated from more than 100 plant species (Zullo et al., 2018). These steroidal lactones have demonstrated well established effectiveness in alleviation of plant environmental stresses (Vozquez et al., 2013). BRs such as brassinolide, 24-epibrassinolide, and 28-homobrassinolide have exhibited well documented capability in plant stress mitigation (Vardhini and Anjum, 2015). A variety of BRs are capable to enrich crop production through up-regulation of foliage tissue multiplication, differentiation of vascular tissues, and cell elongation. BRs enhance ATPase activity, induced

Corresponding author. E-mail address: [email protected] (N. Ahmad Yasin).

https://doi.org/10.1016/j.scienta.2020.109203 Received 25 September 2019; Received in revised form 14 January 2020; Accepted 16 January 2020 0304-4238/ © 2020 Elsevier B.V. All rights reserved.

Scientia Horticulturae 265 (2020) 109203

A.A. Shah, et al.

French green was most Cd susceptible variety and was screened for additional experimentation.

chlorophyll biosynthesis and maintain growth of plants facing abiotic stresses. These modulations enable plants to improve morpho-physiology in plants facing stress (Ackerman-Lavert and Savaldi-Goldstein, 2020; Saini et al., 2015). BRs-induced ameliorative activities embrace modulation of genes responsible for biosynthesis of stress related phytochemicals (Vardhini, 2016). These useful compounds assists plants in maintaining photosynthetic rate, establishing water-relations and augmentation of antioxidative enzymes in metal contaminated regimes (Sharma et al., 2016; Fariduddin et al., 2011). Cucumis sativus L. is one of the most anticipated cucurbit which is globally grown owing to its palatability, nutrient contents and monetary returns. The desirable features have made it an inevitable vegetable crop (Dingal et al., 2018). That is why; C. sativus is perhaps one of the major vegetable crops grown in agricultural farms located in District Rawalpindi, Lahore, Sialkot and Gujranwala (Anon, 2015-16). Metal toxicity reduces growth, biomass and yield of this crop (Shekari et al., 2019). Unrestrained anthropogenic accomplishments in Pakistan have polluted cucumber growing area with Cd, disturbing normal metabolic and physiological processes in plants. Cadmium concentrations between 0.5–2.5 mM have a noteworthy effect on growth attributes of C. sativus (Munzuroglu and Geckil, 2002). Xu et al. (2012) reported that alternate oxidase (AOX) may scavenge ROS in plants under abiotic stresses. Whereas, 1-aminocyclopropane-1-carboxylate oxidase1 (ACO) is a crucial enzymes that regulates the synthesis of ethylene to control numerous developmental processes in plants facing heavy metal stress (Houben and Van de Poel, 2019). Yamasaki et al. (2000) observed the regulation of ethylene in cucumber plants through CS-ERS genes. There is dearth of research work explicating the exogenous application of 3-EBL in prevention of Cd-induced oxidative, physiological and phonotypical changes in C. sativus. Therefore, present research was planned to test the assumption that whether seed priming with 3-EBL alleviates Cd toxicity and improves the growth of C. sativus. The Cd stress ameliorative effect of 3-EBL was interpreted by observing the modulation of anti-oxidative defense mechanism and expression of stress-related genes. Results of this study would perhaps present a prospective approach to alleviate Cd toxicity in susceptible cucumber cultivars.

2.3. Plant Materials and Growth Conditions The sterilized seeds of C. sativus cv. French green were primed with 0 (distilled water), 1, 5 and 10 μM 3- EBL for 2 h (Shah et al., 2019). Hereafter, 9 treated seeds were individually placed in petri plates at equidistance over 3 coats of Whatman filter paper (no. 1) supplemented with 10 ml of 0 (distilled water) or 2.5 mM Cd solution (CdCl2). Seeds soaked in distilled water and placed in petri plate in absentia of Cd were regarded as control (C). While, the treatments in which seeds were primed with 1, 5 and 10 μM 3- EBL were considered as B1, B2 and B3, correspondingly. Seeds grown in petri plates containing Cd were regarded as Cd. By using completely randomized design, the covered petri plates were transferred in a plant incubator having 14 h light /10 h dark phase arranged by 500–550 μmol m-2 s-1 light, 65–75 % relative humidity, at 25 ± 2 °C for 10 d. Each petri plate was irrigated with 20 ml distilled water on every second day. 2.4. Determination of Seedling Growth Fresh weight of 10 d old cucumber seedlings was measured after drying plant samples on blotting paper. Plant biomass from shoot and root samples was oven dried at 80 °C for 2 d and biomass produced was measured. 2.5. Determination of Leaf Relative Water Content For determination of LRWC, Smart and Bingham (1974) method was employed. Leaf samples immersed in distilled water were stored in dark area at 10 °C for 24 h. Later on, LRWC value was obtained from the turgid leaf samples as per following formula: LRWC = LFW-LDW / LTW-LDW × 100 LDW, LFW and LTW are leaf dry, fresh and turgid weight, correspondingly. 2.6. Estimation of Photosynthetic Pigments

2. Materials and methods Arnon and Whatley (1949) method was employed for determination of photosynthetic contents. Foliage sample (0.5 g) was vortexed in acetone solution containing CaCO3 and then rotated on a rotary shaker. Following centrifugation, the supernatant was calibrated at 663 nm, 645 nm and 470 nm for assessment of Chl a, Chl b and carotenoids, respectively.

2.1. Survey and Screening of Most Dominant Metal Contaminant The concentration of metal contaminants including Cr, Ni, Pb, Cu, Cd, As, Fe was detected in rhizospheric soil samples procured from cucumber farms present in District Rawalpindi, Lahore, Sialkot and Gujranwala. Only those farms were surveyed which were being irrigated by water polluted by effluents of adjacent industries and were located at least 4 km away from each other. Rhizospheric soil samples were obtained following hierarchical sampling approach (McDonald and Martinez, 1990). Results showed that most of these soil samples were contaminated with that level of Cd concentration > 2 mg kg−1 soil, which is injurious for cucumber plants (Hajar et al., 2014). Since, Cd was the most common heavy metal contaminant found in observed soil samples. Therefore, Cd was considered for further experimentation.

Gas exchange characteristics including intercellular CO2 concentration, stomatal conductivity and transpiration rate were estimated by using an infrared gas analyzer. The net photosynthetic rate was assessed through methodology of Holá et al. (2010). The readings were taken from succeeding upper most fully stretched leaf between 9–10 am.

2.2. Screening of Susceptible Cucumis sativus Variety

2.8. Determination of Metal Tolerance Index and Translocation Factor

Seeds of the commonly cultivated cucumber varieties including Shayam F1, Florus F1, Kheera local, Badshah, Liza, Asian-1 and French green were collected from Punjab Seed Centre, Pakistan. Seeds of these varieties were stored in the lab and used for onward experiments. Cucumber seeds were sterilized by treating them with sodium hypochlorite (0.5 %) for 3 min prior to rinsing thrice by using distilled water. Seeds were exposed to 2.5 mM Cd and germination; root elongation tests were carried out to find out the most susceptible cucumber variety according to Di Salvatore et al. (2008). It was found that C. sativus cv.

For determination of metal tolerance index (MTI), method developed by Shetty et al. (1995) was used. The value of MTI was calculated by using following equation:

2.7. Assessment of Gas Exchange Features

MTI=

DWSC or DWSE × 100 DWS− N

Where DWSC = dry weight of seedlings subjected to Cd toxicity, DWSE = dry weight of 3-EBL treated seedlings and DWS-N = dry weight of control seedlings. 2

Scientia Horticulturae 265 (2020) 109203

A.A. Shah, et al.

the help of sulphosalicylic acid (3 %), the solution was homogenized with the help of equivalent concentrations of ninhydrin (v/v) and glacial acetic acid. Afterwards, toluene was mixed and the absorbance was calibrated at 528 nm.

Translocation factor (TF) in cucumber seedlings was measured by dividing Cd content in shoot to equivalent content in root. 2.9. Estimation of Hydrogen Peroxide and Lipid Peroxidation

2.13. Assessment of Cadmium Contents

Plant sample (0.1 g) was homogenized amid 2 ml 0.1 % (w/v) TCA by crushing in an ice chilled mortar. After centrifugation of mixture at 12,000 rpm for 15 min at 4 °C, 1 ml supernatant was homogenized with equivalent volume of 10 mM KH2PO4 buffer at pH 7 and 2 ml of 1 M KI. The H2O2 was quantified by taking absorbance at 390 nm according to Velikova et al. (2000). The extent of MDA produced was evaluated to analyze the level of lipid peroxidation according to Rubin et al. (1976). Foliage sample (0.1 g) was vortexed with 1.5 ml of phosphate buffer (50 mM) at pH 7.4 following 15 min centrifugation at 15,000 rpm. Then 2 ml supernatant aliquot was assorted with 4.0 ml of 0.5 % thiobarbituric acid (TBA) in TCA (20 %) was supplemented following 15 min centrifugation at 15,000 rpm. The reaction mixture was geared up by mixing 2 supernatant in 8 ml of 20 % TCA (W/V) containing 0.5 % 2 TBA (W/V). The mixture was placed on hot water bath at 97 °C for 0.5 h. Ice cool mixture was centrifuged for 10 min at 10,000 rpm. The optical density of supernatant was observed at 600 nm and deducted from optical density obtained at 532 nm.

Root and shoot samples were oven dried and digestion was carried out using HClO4 solution. Later on, atomic absorption spectrophotometer was used for estimation of Cd content from digested samples. 2.14. Determination of Auxin For estimation of auxin content, 0.001 g leaf sample was crushed, homogenized and placed over rotary shaker for half hour. Then, the sample was subjected to dehydration using methanol for calculation of auxin (Ke et al., 2015; Pan et al., 2008). ELISA kit (Sunlong Biotech Co., Ltd., Zhejiang: China) was used for quantification of auxin content. 2.15. Estimation of Ethylene Level Leaf samples (0.5 g) present in glass vials (12 ml) were stored at room temperature for 5 h. Later on, 1 ml gas sample from vial was subjected to gas chromatography (Zhang et al., 2019). The ethylene synthesized, was analyzed according to Wilkinson and Davies (2009) with slight alteration.

2.10. Assessment of Electrolyte Leakage Leaf sections were sterilized in distilled H2O and then rotated on rotator shaker for 24 h. Later on, the primary conductivity (EC-i) of leaf sections was measured by autoclaving the sections at 120 °C for 30 min. Then, maximum conductivity (EC-max) from solution was calculated for measurement of EL as per method described by Li et al. (2013): EL= (EC-i/EC-max) 100.

2.16. Expression of Stress Related Genes Tri-reagent Extraction Kit (Enzynomics, Korea) was used for extraction of RNA from cucumber leaves. Then, Bio-Rad Real-Time PCR structure (Bio-Rad, USA) was utilized regarding qRT-PCR analysis. RTPCR kit (Enzynomics, Korea) was used as per technique of Guo et al. (2012). The expression level of 1-aminocyclopropane-1-carboxylate oxidase1 (CSACO1), 1-aminocyclopropane-1-carboxylate oxidase2 (CsAOX), ethylene receptor CS-ERS and 1-aminocyclopropane-1-carboxylate oxidase2 (CSACO2) were assessed with the help of primers mentioned in Table 1.

2.11. Assessment of Antioxidant Enzymes For determination of CAT activity, Aebi (1984) method was employed. Following centrifugation of leaf sample (1 g), the supernatant (70 μl) was vortexed with 1500 μl KH2PO4 (50 mM) buffer and 930 μl of H2O2 (15 mM). The calibration of the mixture was carried out at 240 nm. Putter (1974) methodology was applied for valuation of POD activity. Leaf samples (1 g) were homogenized in KH2PO4 buffer at neutral pH. Following centrifugation of homogenate, the solution was prepared by mixing supernatant (100 mL) with guaiacol solution (50 μl), 3 ml of KH2PO4 buffer (3 ml) and H2O2 (30 μl). The value of absorbance was calculated at 436 nm. Kono (1978) method was employed for the determination of SOD activity. Following centrifugation of 1 g leaf sample at 12,000 rpm, the supernatant was homogenized with EDTA (500 μl of 24 mM), HONH2·HCl (100 μl of 1 mM), Triton-X-100 (100 μl of 0.03 %) at 10.2 pH. The calorimetric calculations were carried out at 560 nm.

2.17. Statistical Analysis Mean values of 5 replications were exposed to one-way ANOVA and subsequently to Duncan's Multiple Range Test. The values of variables were considered significant provided P value was no less than ≤ 0.05. From mean values, lower case letters were used to elaborate the significant differences between the treatments with the help of DSASTAT software. 3. Results 3.1. Survey and Screening of Heavy Metal

2.12. Assessment of Proline The soil samples obtained from different sites of agricultural contaminated farms present in Rawalpindi, Lahore, Sialkot and Gujranwala District were analyzed. Cadmium was found to be the most common

Quantification of proline was done with the help of technique employed by Bates et al. (1973). Following crushing of leaf samples with Table 1 Primers used for Quantitative Real-time PCR (qPT-PCR) assays. Genes

Accession Number

Forward Primer (5′-3′)

Reverse Primer (5′-3′)

CsACO1 CsACO2 CsACS3 CsERS CsAOX

AB006806.1 AB006807.2 AB006805 AB026499.1 DQ641114

AGGTAGGTGGCCTGCAACTCC CAGTCTCCAACATCGCGGATCTC CCAACGGCATCATTCAGA AGAAGTTGTTGCAGTGCGAGTCC TCATCATCACCGAACTTACA

CTCCGAGGTTGACGACAATGGC GCAGGAGTTCGGCGAGTACTTG GCAAGGCAGAACATAAGTG GCTACCTGGTCTGCGACAACATC GAATCCACCATCCGACAA

3

Scientia Horticulturae 265 (2020) 109203

A.A. Shah, et al.

treated with B2 treatment showed enhanced LRWC (< 48 %) under Cd stress, as compared to seedlings grown in Cd spiked regime. As compared to control, B2 treatment significantly enhanced Pn (< 7 %) in non-contaminated conditions (Fig. 2). Compared to control, Cd toxicity significantly reduced Ci, gl and E in cucumber seedlings. Plants treated with B2 showed increase in gl, Ci and E, as compared to control treatment (Fig. 3).

metal pollutant in all soil samples. The level of Cd observed from soil samples was toxic for most of the agricultural and horticultural crops. Therefore, Cd was screened for further experiments (Table 5). 3.2. Screening of Susceptible variety Cucumber varieties including Shayam F1, Florus F1, Kheera local, Badshah, Liza, Asian-1 and French green were evaluated for their susceptibility to Cd-stress. Cd-stressed plants exhibited decreased growth attributes including seed germination, shoot fresh weight, root fresh weight, shoot dry weight, root dry weight, reduced number of leaves and decreased root length. The Kheera local cultivar exhibited greater resistance to Cd-stress in comparison with rest of the C. sativus varieties. Germination, shoot fresh weight, root fresh weight, shoot dry weight, root dry weight and number of leaves of this cultivar were reduced 2.38 %, 5.14 %, 19.22 %, 5.38 %, 14.28 % and 20 % respectively. Conversely, cv. French green showed greater susceptibility to Cd stress as compared to other C. sativus varieties. Germination, shoot fresh weight, root fresh weight, shoot dry weight, root dry weight and number of leaves of this cultivar were reduced 25 %, 29.49 %, 60 %, 49.64 %, 83.85 % and 62.85 %, respectively. French green being the susceptible variety to Cd stress was screened for further experimentation (Table 6).

3.5. Photosynthetic Pigments Cadmium toxicity instigated a significant diminution in concentration of all pigments compared to control. Cd stress diminished Chl a, Chl b and carotenoids by 37 %, 61 % and 29 %, respectively, as compared to control. Seeds primed with B2 significantly enhanced photosynthetic pigments in cucumber plants compared to Cd-only treatment. Cadmium stress significantly decreased total chlorophyll content in cucumber seedlings. Under non-contaminated conditions, B2 treatment significantly boosted total chlorophyll content as compared to control treatment. Under Cd toxic conditions, B2 and B3 treatment significantly improved total chlorophyll content compared to Cd-only treatment (Table 4). 3.6. EL, MDA and H2O2 Cadmium toxicity enhanced EL, MDA and H2O2. Cadmium stress increased EL and MDA by 27 % and 26 % respectively, compared to control plants. Cadmium stress also improved H2O2 content > 1 folds as compared to control treatment. B2 treatment was more effective in reducing EL as compared to B1 and B3 treatment in non-contaminated conditions. Application of 3-EBL also decreased H2O2 content in cucumber plants, compared to Cd-only treatment (Fig. 4).

3.3. Growth Attributes Cadmium stress negatively affected the shoot length of C. sativus. Seeds primed with B2 treatment showed 15 % increase in shoot height of developed seedlings, in comparison with control (C) treatment. In case of Cd contaminated conditions, B2 treatment showed more increase in shoot height of cucumber seedlings, in contrast to B1 and B3 treatment (Fig. 1). Moreover, B2 treatment was more effective in enhancing root fresh weight, shoot fresh weight, root dry weight and shoot dry weight in non-contaminated and contaminated conditions (Table 2).

3.7. Activity of Antioxidative Enzymes The activities of SOD, CAT and APX were higher under Cd stress as compared to control. Application of 3-EBL treatment in Cd contaminated conditions further enhanced the activities of SOD, CAT and APX. The activity of antioxidant enzymes was lower in control treatment. Under Cd toxic conditions, B2 treatment heightened the activity of SOD (1.5 times), CAT (1.36 times) and APX enzymes (1.44 times), in comparison with cucumber seedlings developing in un-contaminated control (Fig. 5).

3.4. Photosynthesis Rate, Leaf Water Content and Gas Exchange Characteristics Seedlings exposed to Cd toxicity indicated decreased net photosynthetic rate (Pn), stomatal conductance (gl), intercellular CO2 concentration (Ci) and transpiration rate (E). Seedlings obtained from seeds

3.8. Quantification of Proline Cadmium stress enhanced proline content 1.4 times compared to control plants. Application of 10μM 3-EBL + Cd treated cucumber plants showed < 50% increase in proline content in comparison with Cd-only treatment (Fig. 6). 3.9. Cadmium Contents Cucumber seedlings grown in Cd-only treated conditions showed increased Cd-uptake in root as well as in shoot. In both Cd-contaminated and non-contaminated conditions, root tissues showed higher Cd content in comparison with respective value in shoot. Nevertheless, seedlings developed through seeds primed with 3-EBL reduced Cd uptake. It was notable that B2 treatment reduced Cd uptake (1.22 folds) as compared to Cd-only treatment (Table 3). Fig. 1. The effect of 3-EBL on shoot length of Cucumis sativus seedlings under cadmium stress. Values demonstrate means ± SD (n = 5). Different letters above the bars indicate significant difference among the treatments (P ≤ 0.05). C= un-contaminated control, Cd= contaminated control (2.5 mM Cd), B1= 1 μM 3-EBL, B2= 5 μM 3-EBL, B3= 10 μM 3-EBL, Cd + B1= 2.5 mM Cd + 1 μM 3-EBL, Cd + B2=2.5 mM Cd + 5 μM 3-EBL, Cd + B3= 2.5 mM Cd + 10 μM 3EBL.

3.10. Auxin and Ethylene level Fig. 7 explains the variation in auxin content in cucumber seedlings under different treatment. Cd toxicity has significant effect on auxin content in cucumber seedlings. A significant escalation in auxin content was detected in cucumber seedlings developed through B2 treatment. In 4

Scientia Horticulturae 265 (2020) 109203

A.A. Shah, et al.

Table 2 Effect of 3-EBL on number of leaves, root fresh weight, shoot fresh weight, root dry weight and shoot dry weight of Cucumis sativus seedlings under Cd stress. Values demonstrate means ± SD (n = 5). Treatments

No. of leaves

Root FW (g plant−1)

Shoot FW (g plant−1)

Root DW (g plant−1)

Shoot DW (g plant−1)

C Cd B1 B2 B3 Cd + B1 Cd + B2 Cd + B3

6 ± 0.41a 3 ± 0.56c 6 ± 0.06a 6 ± 0.02a 3 ± 0.58b 3 ± 0.21b 4 ± 0.03b 4 ± 0.03b

06 ± 0.35a 3.2 ± 0.45ab 6.12 ± 0.07a 6.43 ± 0.05a 3.81 ± 0.09a 3.76 ± 0.04b 4.67 ± 0.27b 4.56 ± 0.09b

18 ± 0.58b 13 ± 0.63c 19.12 ± 0.03a 19.43 ± 05a 17.23 ± 0.08b 14.21 ± 0.02b 14.23 ± 0.03b 11.15 ± 0.01b

1.8 ± 0.01a 0.3 ± 0.21c 1.85 ± 0.14a 1.93 ± 0.01a 0.91 ± 0.02b 0.67 ± 0.01b 1.23 ± 0.32b 0.95 ± 0.12b

4.2 ± 0.02a 0.4 ± 0.06c 4.34 ± 0.23a 4.76 ± 0.04a 3.21 ± 0.02b 2.34 ± 0.09b 3.89 ± 0.05b 1.86 ± 0.01b

C = un-contaminated control, Cd = contaminated control (2.5 mM Cd), B1 = 1 μM 3-EBL, B2 = 5 μM 3-EBL, B3 = 10 μM 3-EBL, Cd + B1 = 2.5 mM Cd + 1 μM 3EBL, Cd + B2 = 2.5 mM Cd + 5 μM 3-EBL, Cd + B3 = 2.5 mM Cd + 10 μM 3-EBL.

Fig. 2. The effect of 3-EBL on leaf water content and photosynthetic rate of Cucumis sativus seedlings under cadmium stress. Values demonstrate means ± SD (n = 5). Different letters above the bars indicate significant difference among the treatments (P ≤ 0.05). C= un-contaminated control, Cd= contaminated control (2.5 mM Cd), B1= 1 μM 3-EBL, B2= 5 μM 3-EBL, B3= 10 μM 3-EBL, Cd + B1= 2.5 mM Cd + 1 μM 3-EBL, Cd + B2=2.5 mM Cd + 5 μM 3-EBL, Cd + B3= 2.5 mM Cd + 10 μM 3-EBL.

case of ethylene biosynthesis, application of B2 and B3 treatment significantly enhanced ethylene biosynthesis in comparison with control and Cd-only treatment.

3.11. Gene Expression Fig. 3. The effect of 3-EBL on intercellular CO2 concentration, stomatal conductance and transpiration rate of Cucumis sativus seedlings under cadmium stress. Values demonstrate means ± SD (n = 5). Different letters above the bars indicate significant difference among the treatments (P ≤ 0.05). C= un-contaminated control, Cd= contaminated control (2.5 mM Cd), B1= 1 μM 3-EBL, B2= 5 μM 3-EBL, B3= 10 μM 3-EBL, Cd + B1= 2.5 mM Cd + 1 μM 3-EBL, Cd + B2=2.5 mM Cd + 5 μM 3-EBL, Cd + B3= 2.5 mM Cd + 10 μM 3-EBL.

Cadmium stress significantly reduced the activity of stress-responsive genes studied (CS-ERS, CsAOX, CSACO1 and CSACO2). Under Cd-contaminated conditions, application of B2 and B3 treatment significantly enhanced the expression level of CS-ERS and CSACO1 in cucumber seedlings (Fig. 8).

5

Scientia Horticulturae 265 (2020) 109203

A.A. Shah, et al.

Fig. 5. The effect of 3-EBL on SOD, CAT and POD activities of Cucumis sativus seedlings under cadmium stress. Values demonstrate means ± SD (n = 5). Different letters above the bars indicate significant difference among the treatments (P ≤ 0.05). C= un-contaminated control, Cd= contaminated control (2.5 mM Cd), B1= 1 μM 3-EBL, B2= 5 μM 3-EBL, B3= 10 μM 3-EBL, Cd + B1= 2.5 mM Cd + 1 μM 3-EBL, Cd + B2=2.5 mM Cd + 5 μM 3-EBL, Cd + B3= 2.5 mM Cd + 10 μM 3-EBL.

Fig. 4. The effect of 3-EBL on EL, MDA and H2O2 content in Cucumis sativus seedlings under cadmium stress. Values demonstrate means ± SD (n = 5). Different letters above the bars indicate significant difference among the treatments (P ≤ 0.05). C= un-contaminated control, Cd= contaminated control (2.5 mM Cd), B1= 1 μM 3-EBL, B2= 5 μM 3-EBL, B3= 10 μM 3-EBL, Cd + B1= 2.5 mM Cd + 1 μM 3-EBL, Cd + B2=2.5 mM Cd + 5 μM 3-EBL, Cd + B3= 2.5 mM Cd + 10 μM 3-EBL.

water uptake and translocation in plants. Furthermore, reduced biosynthesis of photosynthetic pigments in malnutrition plants reduce net photosynthetic rate. Therefore, higher Cd toxicity resulted in reduction of Pn, LRWC and nutritional content (Dikkaya and Ergun, 2014). Exogenous applications of BRs improved growth through increased synthesis of organic acid, maintaining tissues development on account of efficient water and nutritional translocation to meristematic regions of supplemented plants (Vardhini et al., 2010). Similarly, BRs supplementation increased turgidity in treated plants (Catterou et al., 2001). BRs also increased the surface area of the leaves which leads to increase in cellular growth (Saini et al., 2015). BRs reduce stress through regulating EL, CO2 assimilation, stomatal conductivity and MDA synthesis in eggplant seedlings, resulting in improved seedling growth (Rajewska et al., 2016). Current study also exposed that application of 3-EBL mitigated Cd toxicity and enhanced physiochemical characteristics of cucumber seedlings. Cadmium toxicity have deleterious effect on activity of numerous enzymes involved in regulating plant metabolomics which results in decrease of LRWC (Yue et al., 2016), and leads to deficiency of

4. Discussion Higher Cd contents in rhizospheric soil samples obtained from District Rawalpindi, Lahore, Sialkot and Gujranwala may be attributed to pollution of this metal in irrigation water through effluents discharged from aluminum, steel, marbles and steel industries besides effluents of metal plating and mining (Tariq et al., 2006). Cadmium has negative effect on the growth of many plant species like wheat (Rehman et al., 2015), maize (Vaculík et al., 2015), bean plants (Saidi et al., 2013), tomato (Hédiji et al., 2015) and menthol mint (Zaid et al., 2019b; Zaid and Mohammad, 2018). Reduction in plant growth and biomass may be due to Cd-induced injury on photosynthetic apparatus (Saidi et al., 2013). Cadmium is easily available and may replace other cations causing reduce uptake of essential negatively charged plant nutrients. Decline in plant growth and biomass may be because of drop in essential minerals uptake in plants (Hédiji et al., 2015). The reduced nutrients uptake such as potassium and calcium causes reduction in 6

Scientia Horticulturae 265 (2020) 109203

A.A. Shah, et al.

Table 4 Effect of 3-EBL on carotenoids, total chlorophyll, chlorophyll b and chlorophyll a. Values demonstrate means ± SD (n = 5). Treatments

Fig. 6. The effect of 3-EBL on proline content of Cucumis sativus seedlings under cadmium stress. Values demonstrate means ± SD (n = 5). Different letters above the bars indicate significant difference among the treatments (P ≤ 0.05). C= un-contaminated control, Cd= contaminated control (2.5 mM Cd), B1= 1 μM 3-EBL, B2= 5 μM 3-EBL, B3= 10 μM 3-EBL, Cd + B1= 2.5 mM Cd + 1 μM 3-EBL, Cd + B2=2.5 mM Cd + 5 μM 3-EBL, Cd + B3= 2.5 mM Cd + 10 μM 3EBL.

Photosynthetic Pigments Carotenoids

Chla

Chlb

Total Chlorophyll

Control Cd B1

4.12 ± 0.02b 0.59 ± 0.02d 5.16 ± 0.12ab

0.55 ± 0.04c 0.34 ± 0.03d 0.56 ± 0.21c

1.38 ± 0.08ab 0.52 ± 0.03d 1.32 ± 0.21b

B2

5.69 ± 2.11a

0.73 ± 0.07b 0.23 ± 0.04e 0.76 ± 0.12ab 0.89 ± 0.03a

1.44 ± 0.02a

B3 Cd + B1 Cd + B2

3.89 ± 1.23c 3.45 ± 1.35bc 4.95 ± 1.01ab

Cd + B3

4.35 ± 0.25ab

0.65 ± 0.08bc 0.31 ± 0.12d 0.74 ± 0.34b 0.42 ± 0.06 cd 0.82 ± 0.53a

0.56 ± 0.43c 0.35 ± 0.74d 0.69 ± 0.02bc 0.54 ± 0.31 cd

0.87 ± 0.14c 1.09 ± 0.32bc 1.01 ± 0.03bc 1.36 ± 0.16ab

C = un-contaminated control, Cd = contaminated control (2.5 mM Cd), B1 = 1 μM 3-EBL, B2 = 5 μM 3-EBL, B3 = 10 μM 3-EBL, Cd + B1 = 2.5 mM Cd + 1 μM 3-EBL, Cd + B2 = 2.5 mM Cd + 5 μM 3-EBL, Cd + B3 = 2.5 mM Cd + 10 μM 3-EBL.

plants (Vardhini, 2016). BRs applied Helianthus tuberosus plants also exhibited reduced Cd contents besides improved shoot length, photosynthetic pigments, rate photosynthesis, and activity of antioxidant enzymes (Bajguz, 2010). In the present study, 3-EBL declined Cd uptake in cucumber seedlings in contaminated as well as non-contaminated conditions. AOX is one of the terminal oxidase developed throughout electron transport system consumed in non-phosphorylating electron transport chain (Wang et al., 2012; Clifton et al., 2006). AOX scavenge ROS in plants resulting decresed chloroplast deterioration and higher rate of photosynthesis (Xu et al., 2012). For that reason, it is expected that there is a synergistic correlation among ethylene and alternative oxidase (AOX) in BRs related pathway regarding stress mitigation. Some other studies have also reveal that upper ethylene and AOX levels are correlated and assist plants in mitigation of abiotic stresses (Wang et al., 2010; Xu et al., 2012). The present study depicts that enhanced expression level of AOX, regulated ethylene and decreased ROS in 3-EBL treated plants might be a reason of Cd tolerance in cucumber seedlings. Malondialdehyde is well known as a marker of lipid peroxidation and cellular destabilization. Cd toxicity enhances the level of MDA in plants. However, BRs reduced MDA content in plants facing Cd toxicity in a dose dependent mode (Vardhini and Anjum, 2015). Current research also revealed that Cd stress increased MDA content in cucumber plants. However, application of 3-EBL reduced MDA content in normal and Cd-contaminated conditions. BRs attenuated Cd toxicity and increased CAT activity in Chlorella vulgaris (Bajguz, 2010). Metal induced stress enhances ROS synthesis

water in the cellular regions of plants exposed to stress conditions (Chen et al., 2019). Hayat et al. (2007) has also described higher LRWC in BRs supplemented plants under Cd stress. Current study also showed enhanced water content in cucumber seedlings developed from seeds primed with 3-EBL. Cadmium affects the leaf gas exchange traits in a negative manner. Cd induces stomatal inhibition which restricts the exchange of gases and consequently decreases the other traits as well (Andrade Júnior et al., 2019; Zaid and Mohammad, 2018). The advanced activity of chlorophyllase diminishes chlorophyll contents of plants subjected to Cd toxicity (Szafrańska et al., 2017). Moreover, stress reduces the synthesis of D-aminolavulinic acid and protochlorophyllide reductase initiating decrease in chlorophyll synthesis (Stabort et al., 1985). The reduced production of photosynthates declines the rate of photosynthesis in stressed plants (Fariduddin et al., 2013). BRs encourage the translation of enzymes involved in chlorophyll synthesis (Bajguz, 2007). Whereas, BRs continued photosynthetic activities in plants by reducing reaction center impairment and provocation of O2− developing apparatus (Vázquez et al., 2013; Asgher et al., 2015). During current study, 3-ELB possibly weakened the activity of chlorophyllase and enhanced synthesis of protochlorophyllide reductase and D-aminolavulinic acid, hence enhancing rate of photosynthesis in treated plants. Beet plants treated with 24-epibrassinolide declined metal uptake in roots (Khripach et al., 1999). The reduced metal uptake in BRs supplemented plants consequently improved growth of Brassica juncea

Table 3 Effect of 3-EBL on cadmium (Cd) uptake (μg g-1 DW) in root and shoot, translocation factor (TF) and metal tolerance index (MTI) in Cucumis sativus under cadmium stress. Values demonstrate means ± SD (n = 5). Treatments

C Cd B1 B2 B3 Cd + B1 Cd + B2 Cd + B3

Cd uptake Root (μg g-1 DW)

Shoot (μg g-1 DW)

TF

MTI

ND 13578 ± 46a 0.35 ± 0.03e 0.41 ± 0.03e 0.45 ± 0.05e 7167 ± 13d 9237 ± 24b 8134 ± 23c

ND 8347 ± 28a 0.25 ± 0.15d 0.17 ± 0.01d 0.32 ± 0.31d 465 ± 11c 525 ± 23b 412 ± 16c

– 0.61 ± 0.01b 0.71 ± 0.11a 0.41 ± 0.04bc 0.71 ± 0.12a 0.06 ± 0.34c 0.05 ± 0.01c 0.05 ± 0.04c

– 24.84 ± 3.26e 119.7 ± 8.13ab 131.52 ± 4.57a 81.52 ± 2.13c 39.17 ± 2.23d 109.87 ± 3.45b 68.15 ± 2.65 cd

C = un-contaminated control, Cd = contaminated control (2.5 mM Cd), B1 = 1 μM 3-EBL, B2 = 5 μM 3-EBL, B3 = 10 μM 3-EBL, Cd + B1 = 2.5 mM Cd + 1 μM 3EBL, Cd + B2 = 2.5 mM Cd + 5 μM 3-EBL, Cd + B3 = 2.5 mM Cd + 10 μM 3-EBL. 7

Scientia Horticulturae 265 (2020) 109203

A.A. Shah, et al.

Table 5 Biochemical attributes of polluted composite soil obtained from survey sites. Districts Surveyed

Land used sites

Statistics

Cr (mg kg−1)

Ni (mg kg−1)

Pb (mg kg−1)

Cu (mg kg−1)

Cd (mg kg−1)

As (mg kg−1)

Fe (mg kg−1)

Lahore

S1

Mean Min-Max Mean Min-Max Mean Min-Max Mean Min-Max Mean Min-Max Mean Min-Max Mean Min-Max Mean Min-Max Mean Min-Max Mean Min-Max Mean Min-Max Mean Min-Max Mean Min-Max Mean Min-Max Mean Min-Max Mean Min-Max Mean Min-Max Mean Min-Max Mean Min-Max Mean Min-Max

11.54 0.34-13.56 10.56 1.89-15.43 11.76 2.78-16.87 18.54 3.76-21 10 0.07–11.98 7 0.09-9.56 6.87 1.23-7.98 5.98 0.03-7.89 7.83 3.89-11.13 5.87 0.09–11.78 21 4.89-22.76 14 0.07-17.89 4.89 0.07-7.98 7.98 0.09-5.76 2.98 0.08-5.98 11.78 2.34-14.87 7.89 3.89-11.76 4.56 2.89-9.10 13.89 3.98-23.87 6.98 2.71-16.34

42.31 21-34 35.89 12-45 28 15-37 36 14-49 35 12-38 23 3.56-28.17 17 6-21.45 34 23-56 36 24-53 28 13-46 17 2.98-26.87 13 1.87-18.76 18 12.89-45 16 4-18 17 2.89-21 16 4.98-21.34 15 12-37 15 2.89-27 15 3.76-2.87 12.98 3.56-23.98

10.26 2-18 7 1.5–8.6 5 1.98-6.8 3 0.89-5.87 4 1.12-7.29 17 4.87-19.81 12 8-19.76 18 13-21 10 2-15 11 3-16 21 4-24 7 3-4.76 8 2-10.98 3 0.09-4.89 17 12-21 17 4-17 8 2-10 7 3-9 7 1-11 8 1-5.76

25.52 16-26 24.76 12-27 11 3-17 6.78 2-14.78 21 13-26 11 10-17 24 11-32 17 11-17 23 11-34 12 2-17 14 5-19 16 8-19 13 11-27 9 3-18 7 5-17 18 2-23 17 11-21 10 2-11.87 15 1.98-19.89 13 2.87-21

45.65 12-54 34 18-53 43 23-50 37 29-47 36 27-39 45 21-51 34 21-38 36 24-49 43 21-34 46 32-52 42 21-48 23 11-34 27 12-37 28 13-30 25 11-37 43 34-48 45 24-47 41 25-48 39 24-46 43 32-49

2.10 0.23-3.67 3.76 0.65-3.81 1.98 0.21-2.76 2.15 0.65-3.87 1.34 0.17-3.65 2 0.08-2.89 0.12 0.01–3.15 2.34 0.04-3.65 3.12 1.23-3.21 1.34 0.03-1.87 1.45 0.46-1.76 1.76 0.32-1.98 0.65 0.21-2.65 0.63 0.12-1.31 0.54 0.34-1.12 1.89 0.03-1.16 3.12 2.34-3.56 1.98 0.08-3.65 2.15 0.08-2.17 1.97 0.03-2.43

132 65-187 176 56-210 89 28-176 154 76-230 58 34-90 149 98-218 114 87-137 189 154-254 210 110-289 223 115-256 113 78-176 87 98-127 134 104-198 167 121-218 165 112-248 136 67-189 148 112-210 114 43-179 123 104-198 76 54-179

S2 S3 S4 S5 Gujranwala

S6 S7 S8 S9 S10

Sialkot

S11 S12 S13 S14 S15

Rawalpindi

S16 S17 S18 S19 S20

S represents the sampling sites surveyed in the districts located in Punjab Province, Pakistan.

proline and other osmoregulators (Fig. 4). Another study reveals higher biosynthesis of proline besides increased activity of antioxidant enzymes under Cu stress, and this antioxidative strategy becomes more pronounced in brassinolide treated plants (Fariduddin et al., 2003). Wang et al. (2014) have also demonstrated involvement of some BRs in protein complex related to stress tolerance in plants. Various compounds are involved in the pathway which leads to biosynthesis of ethylene such as ACC oxidase (Lin et al., 2010; Wang et al., 2012). Elevated level of ethylene leads to increment in the activity of alternate oxidase (AOX) (Mizutani et al., 1987; Pirrung and Brauman, 1987; Yip and Yang, 1988). BRs applications reason ethylene generation causing stimulation of AOX in plants under stress (Zhu et al., 2015; Wang et al., 2012). Some other researchers have also demonstrated higher transcript level of genes which leads to ethylene biosynthesis (Wei et al., 2015). Similarly, BRs possess growth-stimulating characteristics similar to that of auxin (Peres et al., 2019). BRs are recruited to conserve synthesis and bioactivity of IAA leading to enhancement in cell division and overall plant growth (Nemhauser et al., 2004).Vert et al. (2008) has observed dependency of auxin synthesis and pertinent activity through a BRs signal transduction pathway. The 3-EBL primed seeds helped in further enhancement of antioxidative activity of enzymes including SOD, CAT and POD (Fig. 5). Higher activity of antioxidant enzymes in 3-EBL primed seedlings unveil the ability of 3-EBL in improvement of Cd tolerance besides maintenance of redox balance through detoxification of augmented level of ROS. Activation of NADPH oxidase results higher level of H2O2 which

causing oxidative injury leading membrane degradation which affects the activity of antioxidative enzymes along with amount of antioxidants produced (Pandey et al., 2005). It is assumed that 3-EBL may sustain the cell redox changes through maintaining the activity of antioxidant enzymes for example SOD, CAT and APX. BRs enhance the bioactivity of CAT in both Cd-stressed and non-stressed seedling by enhancing CO2 accumulation and NO3 assimilation in the membranes of supplemented plants (Deng et al., 2016). It is assumed that BRs might augment the expression of specific genes related to activity of antioxidative enzymes, resulting in detoxification of metal toxicity (Anwar et al., 2018). Furthermore, BRs also over-express the genes concerned to CAT activity (Khripach et al., 2003). The present study suggests that 3-EBL stimulated higher amount and activity of antioxidant enzymes and reduced production of ROS and subsequently resulted in Cd tolerance strategy in treated cucumber plants. Proline acts as an osmoregulator and assists in determination of membranous attributes and biosynthesis of stress responsive proteins that may scavenge ROS in plants exposed to stress (Chun and Chandrasekaran, 2018). Application of BRs increases proline content in plants facing stress conditions (Fariduddin et al., 2015; Yusuf et al., 2014). BRs alleviated metal toxicity in plants is correlated with enhancement proline content (Abbas et al., 2013). 24-epibrassinolide treatment alleviated heavy metal stress in plants by reducing electrolyte leakage (Allagulova et al., 2015; Lukatkin et al., 2013). The redox modifications may be maintained in 3-EBL treated seeds owing to reduced lipid peroxidation level resulting due to overproduction of 8

Scientia Horticulturae 265 (2020) 109203

A.A. Shah, et al.

Table 6 Comparison of growth attributes of different varieties of C. sativus under Cd stress conditions. Varieties

Growth parameters

C

Cd

Shayam F1

Germination % Shoot fresh weight (g plant−1) Root fresh weight (g plant−1) Shoot dry weight (g plant−1) Root dry weight (g plant−1) Number of leaves Germination % Shoot fresh weight (g plant−1) Root fresh weight (g plant−1) Shoot dry weight (g plant−1) Root dry weight (g plant−1) Number of leaves Germination % Shoot fresh weight (g plant−1) Root fresh weight (g plant−1) Shoot dry weight (g plant−1) Root dry weight (g plant−1) Number of leaves Germination % Shoot fresh weight (g plant−1) Root fresh weight (g plant−1) Shoot dry weight (g plant−1) Root dry weight (g plant−1) Number of leaves Germination % Shoot fresh weight (g plant−1) Root fresh weight (g plant−1) Shoot dry weight (g plant−1) Root dry weight (g plant−1) Number of leaves Germination % Shoot fresh weight (g plant−1) Root fresh weight (g plant−1) Shoot dry weight (g plant−1) Root dry weight (g plant−1) Number of leaves Germination % Shoot fresh weight (g plant−1) Root fresh weight (g plant−1) Shoot dry weight (g plant−1) Root dry weight (g plant−1) Number of leaves

83 21.06 9 7.12 2.12 9 86 21.17 8.3 6.73 2.76 9 84 23.12 9 6.13 2.45 10 79 20.13 07 4.67 2.97 07 84 19.54 07 3.25 2.34 07 87 20.13 8.31 5.89 2.54 11 84 18.65 08 2.78 1.92 08

72 17.23 6 4.3 1.8 6 78 17.36 6.4 4.3 1.9 6 82 21.89 7.27 5.8 2.1 08 69 16.18 3.89 2.62 1.7 04 75 16.82 4.17 1.27 1.49 04 77 17.18 5.89 3.98 1.6 07 63 13.15 3.2 1.4 0.31 03

Florus F1

Kheera local

Badshah

Liza

Asian-1

French green

Fig. 7. The effect of 3-EBL on auxin and ethylene of Cucumis sativus seedlings under cadmium stress. Values demonstrate means ± SD (n = 5). Different letters above the bars indicate significant difference among the treatments (P ≤ 0.05). C= un-contaminated control, Cd= contaminated control (2.5 mM Cd), B1= 1 μM 3-EBL, B2= 5 μM 3-EBL, B3= 10 μM 3-EBL, Cd + B1= 2.5 mM Cd + 1 μM 3-EBL, Cd + B2=2.5 mM Cd + 5 μM 3-EBL, Cd + B3= 2.5 mM Cd + 10 μM 3-EBL.

triggers relevant sensors to stimulate a cascade of mitogen-activated protein kinase (MAPK) in plants under Cd-stress. MAPK activates the functioning of trans-regulatory elements in nucleus to bind cis-regulatory elements and subsequent enhancement in transcipt levels of SOD, CAT and APX for mitigation of plant stress (Lin and Aarts, 2012; Planas-Riverola et al., 2019). BRs activate MAPK cascade which in return enhance biosynthesis of BRs and other growth promoting phytohormone (Jagodzik et al., 2018). Preceding studies have showed the potential of BRs in incrementation of AOX level, thereby reducing oxidative damage in C. sativus by positive regulation of 1-aminocyclopropane-1-carboxylate oxidase1 (CSACO), 1-aminocyclopropane-1-carboxylate oxidase2 (CSACO2), ripening-related ACC synthase2 (CSACS2), ripening-related ACC synthase3 (CSACS3), ACC synthase1 (CSACS1), and CSAOX) related to ethylene biosynthesis (Wei et al., 2015). BRs treatment also results in positive regulation of stress-responsive genes in Arabidopsis (Li et al., 2009). The current study also displayed the enhanced expression of stress responsive genes CS-ERS, CsAOX, CSACO1 and CSACO2 in cucumber seedlings developed through seeds primed with 3-EBL. The results of current study are comparable to findings of Kanwar et al. (2013), who observed advanced acti vity of antioxidant enzymes in BRs applied Brassica juncea plants under Ni stress. Likewise, it was revealed that BRs mediated stress tolerance is correlated with up-regulated expression of genes involved

Fig. 8. The effect of 3-EBL on gene expression of Cucumis sativus seedlings under cadmium stress. Values demonstrate means ± SD (n = 5). C = uncontaminated control, Cd = contaminated control (2.5 mM Cd), B1 = 1 μM 3EBL, B2 = 5 μM 3-EBL, B3 = 10 μM 3-EBL, Cd + B1 = 2.5 mM Cd + 1 μM 3EBL, Cd + B2 = 2.5 mM Cd + 5 μM 3-EBL, Cd + B3 = 2.5 mM Cd + 10 μM 3EBL.

in biosynthesis of antioxidant enzymes in plants (Vázquez et al., 2013). Higher activity of resistance linked enzymes and enhanced genes upregulation may be credited to appropriate biosynthesis of H2O2 in the BRs and Cd applied plants (Ramakrishna & Rao, 2015).

9

Scientia Horticulturae 265 (2020) 109203

A.A. Shah, et al.

5. Conclusion

of hydrogen peroxide and nitric oxide in brassinosteroid‐mediated systemic virus resistance in Nicotiana benthamiana. Plant J. 85 (4), 478–493. Di Salvatore, M., Carafa, A.M., Carratù, G., 2008. Assessment of heavy metals phytotoxicity using seed germination and root elongation tests: a comparison of two growth substrates. Chemosphere 73 (9), 1461–1464. Dikkaya, E.T., Ergun, N., 2014. Effects of cadmium and zinc interactions on growth parameters and activities of ascorbate peroxidase on maize (Zea mays L. MAT 97). Eur. J. Exp. Biol. 4 (1), 288–295. Dingal, D.K., Patil, S.S., Birada, M.S., Mantur, S.M., 2018. Influence of different protected conditions on growth and yield of parthenocarpic cucumber (Cucumis sativus) hybrids. Int. J. Curr. Microbiol. App. Sci 7 (5), 1619–1624. Fariduddin, Q., Ahmad, A., Hayat, S., 2003. Photosynthetic response of Vigna radiata to presowing seed treatment with 28-homobras-sinolide. Photosynthetica 41, 307–310. Fariduddin, Q., Mir, B.A., Yusuf, M., Ahmad, A., 2013. Comparative roles of brassinosteroids and polyamines in salt stress tolerance. Acta Physiol. Plant. 35 (7), 2037–2053. Fariduddin, Q., Ahmed, M., Mir, B.A., Yusuf, M., Khan, T.A., 2015. 24-Epibrassinolide mitigates the adverse effects of manganese induced toxicity through improved antioxidant system and photosynthetic attributes in Brassica juncea. Environ. Sci. Pollut. Res. - Int. 22 (15), 11349–11359. Guo, J., Chen, L., Liu, X., Gao, Y., Zhang, D., Yang, L., 2012. A multiplex degenerate PCR analytical approach targeting to eight genes for screening GMOs. Food Chem. 132 (3), 1566–1573. Hajar, E.W.I., Sulaiman, A.Z.B., Sakinah, A.M., 2014. Assessment of heavy metals tolerance in leaves, stems and flowers of Stevia rebaudiana plant. Procedia Environ. Sci. 20, 386–393. Hamid, Y., Tang, L., Sohail, M.I., Cao, X., Hussain, B., Aziz, M.Z., Yang, X., 2019. An explanation of soil amendments to reduce cadmium phytoavailability and transfer to food chain. Sci. Total Environ. Hayat, S., Ali, B., Hasan, S.A., Ahmad, A., 2007. Brassinosteroid enhanced the level of antioxidants under cadmium stress in Brassica juncea. Environ. Exp. Bot. 60 (1), 33–41. Hédiji, H., Djebali, W., Belkadhi, A., Cabasson, C., Moing, A., Rolin, D., Chaïbi, W., 2015. Impact of long-term cadmium exposure on mineral content of Solanum lycopersicum plants: consequences on fruit production. South Afr. J. Bot. 97, 176–181. Holá, D., Benešová, M., Honnerová, J., Hnilicˇka, F., Rothová, O., Kocˇová, M., Hnilicˇková, H., 2010. The evaluation of photosynthetic parameters in maize inbred lines subjected to water deficiency: Can these parameters be used for the prediction of performance of hybrid progeny? Photosynthetica 4, 545–558. Houben, M., Van de Poel, B., 2019. 1-Aminocyclopropane-1-carboxylic acid oxidase (ACO): the enzyme that makes the plant hormone ethylene. Front. Plant Sci. 10. Jagodzik, P., Tajdel-Zielińska, M., Cieśla, A., Marczak, M., Ludwikow, A., 2018. Mitogenactivated protein kinase cascades in plant hormone signaling. Front. Plant Sci. 9, 1387. Khripach, V.A., Zhabinskii, V.N., Malevannaya, N.N., 1999. Recent advances in brassinosteroids study and application. ChemInform 30 (26) no-no. Khripach, V.A., Zhabinskii, V.N., Khripach, N.B., 2003. New practical aspects of brassinosteroids and results of their ten-year agricultural use in russia and Belarus. Brassinosteroids. Springer, Dordrecht, pp. 189–230. Li, L., Yu, X., Thompson, A., Guo, M., Yoshida, S., Asami, T., Yin, Y., 2009. Arabidopsis MYB30 is a direct target of BES1 and cooperates with BES1 to regulate brassinosteroid‐induced gene expression. Plant J. 58 (2), 275–286. Li, F.T., Qi, J.M., Zhang, G.Y., Lin, L.H., Fang, P.P., Tao, A.F., Xu, J.T., 2013. Effect of cadmium stress on the growth, antioxidative enzymes and lipid peroxidation in two kenaf (Hibiscus cannabinus L.) plant seedlings. J. Integr. Agric. 12 (4), 610–620. Li, Q., Wang, G., Wang, Y., Yang, D., Guan, C., Ji, J., 2019. Foliar application of salicylic acid alleviate the cadmium toxicity by modulation the reactive oxygen species in potato. Ecotoxicol. Environ. Saf. 172, 317–325. Lin, Y.F., Aarts, M.G., 2012. The molecular mechanism of zinc and cadmium stress response in plants. Cell. Mol. Life Sci. 69 (19), 3187–3206. Lukatkin, A.S., Kashtanova, N.N., Duchovskis, P., 2013. Changes in maize seedlings growth and membrane permeability under the effect of epibrassinolide and heavy metals. Russ. Agric. Sci. 39 (4), 307–310. McDonald, B.A., Martinez, J.P., 1990. DNA restriction fragment length polymorphisms among Mycosphaerella graminicola (anamorph Septoria tritici) isolates collected from a single wheat field. Phytopathology 80 (12), 1368–1373. Munzuroglu, O., Geckil, H., 2002. Effects of metals on seed germination, root elongation, and coleoptile and hypocotyl growth in Triticum aestivum and Cucumis sativus. Arch. Environ. Contam. Toxicol. 43 (2), 203–213. Nemhauser, J.L., Mockler, T.C., Chory, J., 2004. Interdependency of brassinosteroid and auxin signaling in Arabidopsis. PLoS Biol. 2 (9), e258. Peres, A.L.G., Soares, J.S., Tavares, R.G., Righetto, G., Zullo, M.A., Mandava, N.B., Menossi, M., 2019. Brassinosteroids, the sixth class of phytohormones: a molecular view from the discovery to hormonal interactions in plant development and stress adaptation. Int. J. Mol. Sci. 20 (2), 331. Planas-Riverola, A., Gupta, A., Betegón-Putze, I., Bosch, N., Ibañes, M., Caño-Delgado, A.I., 2019. Brassinosteroid signaling in plant development and adaptation to stress. Development 146 (5), dev151894. Rajewska, I., Talarek, M., Bajguz, A., 2016. Brassinosteroids and response of plants to heavy metals action. Front. Plant Sci. 7, 629. Rehman, M.Z.U., Rizwan, M., Ghafoor, A., Naeem, A., Ali, S., Sabir, M., Qayyum, M.F., 2015. Effect of inorganic amendments for in situ stabilization of cadmium in contaminated soils and its phyto-availability to wheat and rice under rotation. Environ. Sci. Pollut. Res. - Int. 22 (21), 16897–16906. Saidi, I., Ayouni, M., Dhieb, A., Chtourou, Y., Chaïbi, W., Djebali, W., 2013. Oxidative damages induced by short-term exposure to cadmium in bean plants: protective role

In conclusion, current results showed that Cd is a common metal pollutant in agricultural soils receiving industrial effluents contaminated water for irrigation. Cadmium toxicity enhanced lipid peroxidation and electrolyte leakage in cucumber seedlings. On the other hand, Cd toxicity diminished activity of antioxidant enzymes, photosynthetic activity, growth, and biomass production in Cucumis sativus seedlings. Nevertheless, 3-EBL increased photosynthetic rate, gas exchange attributes and leaf relative water contents. Additionally, 3-EBL alleviated Cd oxidative stress by increasing the activity of antioxidant enzymes. Altogether, 3-EBL improved the physiochemical mechanisms of cucumber seedlings to reduce Cd stress. These findings endorse seed priming with 3-EBL for Cd stress alleviation and growth promotion in cucumber. Hereafter, additional studies at field level are mandatory to reveal the potential of 3-EBL and its mechanism en route for several plant species under abiotic stress regimes. Author Contributions AAS and SA conceived the idea of this research. NAY and MA designed this research. AAS and SA performed the experiment. MA and NAY performed statistical analysis. NAY and AAS wrote this manuscript. All the authors reviewed the manuscript and recommended its submission. Declaration of Competing Interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. Appendix A. Supplementary data Supplementary material related to this article can be found, in the online version, at doi:https://doi.org/10.1016/j.scienta.2020.109203. References Abbas, S., Latif, H.H., Elsherbiny, E.A., 2013. Effect of 24-epibrassinolide on the physiological and genetic changes on two varieties of pepper under salt stress conditions. Pak. J. Bot. 45 (1273), 284. Ackerman-Lavert, M., Savaldi-Goldstein, S., 2020. Growth models from a brassinosteroid perspective. Curr. Opin. Plant Biol. 53, 90–97. Allagulova, C.R., Maslennikova, D.R., Avalbaev, A.M., Fedorova, K.A., Yuldashev, R.A., Shakirova, F.M., 2015. Influence of 24-epibrassinolide on growth of wheat plants and the content of dehydrins under cadmium stress. Russ. J. Plant Physiol. 62 (4), 465–471. Andrade Júnior, W.V., de Oliveira Neto, C.F., Santos Filho, B.G.D., do Amarante, C.B., Cruz, E.D., Okumura, R.S., Botelho, A.D.S., 2019. Effect of cadmium on young plants of Virola surinamensis. AoB Plants 11 (3), plz022. Anon, 2015. 16. Directorate of Crop Reporting Service. Govt. of the Punjab. Lahore. Anwar, A., Liu, Y., Dong, R., Bai, L., Yu, X., Li, Y., 2018. The physiological and molecular mechanism of brassinosteroid in response to stress: a review. Biol. Res. 51 (1), 46. Arnon, D.I., Whatley, F.R., 1949. Is chloride a coenzyme of photosynthesis? Science 110 (2865), 554–556. Asgher, M., Khan, M.I.R., Anjum, N.A., Khan, N.A., 2015. Minimising toxicity of cadmium in plants—role of plant growth regulators. Protoplasma 252 (2), 399–413. Bajguz, A., 2007. Metabolism of brassinosteroids in plants. Plant Physiol. Biochem. 45, 95–107. Bajguz, A., 2010. An enhancing effect of exogenous brassinolide on the growth and antioxidant activity in Chlorella vulgaris cultures under heavy metals stress. Environ. Exp. Bot. 68 (2), 175–179. Catterou, M., Dubois, F., Schaller, H., Aubanelle, L., Vilcot, B., Sangwan-Norreel, B.S., Sangwan, R.S., 2001. Brassinosteroids, microtubules and cell elongation in Arabidopsis thaliana. I. Molecular, cellular and physiological characterization of the Arabidopsis bul1 mutant, defective in the Δ 7-sterol-C5-desaturation step leading to brassinosteroid biosynthesis. Planta 212 (5-6), 659–672. Chen, H., Li, Y., Ma, X., Guo, L., He, Y., Ren, Z., Zhang, Z., 2019. Analysis of potential strategies for cadmium stress tolerance revealed by transcriptome analysis of upland cotton. Sci. Rep. 9. Chun, S.C., Chandrasekaran, M., 2018. Proline Accumulation influenced by Osmotic stress in Arbuscular Mycorrhizal symbiotic plants. Front. Microbiol. 9, 2525. Deng, X.G., Zhu, T., Zou, L.J., Han, X.Y., Zhou, X., Xi, D.H., Lin, H.H., 2016. Orchestration

10

Scientia Horticulturae 265 (2020) 109203

A.A. Shah, et al.

brassinosteroid pathways by Auxin Response Factor 2. Proc. Natl. Acad. Sci. 105 (28), 9829–9834. Wani, W., Masoodi, K.Z., Zaid, A., Wani, S.H., Shah, F., Meena, V.S., Mosa, K.A., 2018. Engineering plants for heavy metal stress tolerance. Rend. Lincei Sci. Fis. Nat. 29 (3), 709–723. Wei, L., Deng, X.G., Zhu, T., Zheng, T., Li, P.X., Wu, J.Q., Lin, H.H., 2015. Ethylene is involved in brassinosteroids induced alternative respiratory pathway in cucumber (Cucumis sativus L.) seedlings response to abiotic stress. Front. Plant Sci. 6, 982. Xu, F.E.I., Zhang, D.W., Zhu, F., Tang, H.E., Lv, X.I.N., Cheng, J., Lin, H.H., 2012. A novel role for cyanide in the control of cucumber (Cucumis sativus L.) seedlings response to environmental stress. Plant Cell Environ. 35 (11), 1983–1997. Yamasaki, S., Fujii, N., Takahashi, H., 2000. The ethylene-regulated expression of CSETR2 and CS-ERS genes in cucumber plants and their possible involvement with sex expression in flowers. Plant Cell Physiol. 41 (5), 608–616. Yue, R., Lu, C., Qi, J., Han, X., Yan, S., Guo, S., Chi, H., 2016. Transcriptome analysis of cadmium-treated roots in maize (Zea mays L.). Front. Plant Sci. 7, 1298. Yusuf, M., Fariduddin, Q., Ahmad, I., Ahmad, A., 2014. Brassinosteroid-mediated evaluation of antioxidant system and nitrogen metabolism in two contrasting cultivars of Vigna radiata under different levels of nickel. Physiol. Mol. Biol. Plants 20 (4), 449–460. Zaid, A., Mohammad, F., 2018. Methyl jasmonate and nitrogen interact to alleviate cadmium stress in Mentha arvensis by regulating physio-biochemical damages and ROS detoxification. J. Plant Growth Regul. 37 (4), 1331–1348. Zaid, A., Wani, S.H., 2019. Reactive oxygen species generation, scavenging and signaling in plant defense responses. Bioactive Molecules in Plant Defense. Springer, Cham, pp. 111–132. Zaid, A., Bhat, J.A., Wani, S.H., Masoodi, K.Z., 2019a. Role of nitrogen and sulfur in mitigating cadmium induced metabolism alterations in plants. The Journal of Plant Science Research 35 (1), 121–141. Zaid, A., Mohammad, F., Fariduddin, Q., 2019b. Plant growth regulators improve growth, photosynthesis, mineral nutrient and antioxidant system under cadmium stress in menthol mint (Mentha arvensis L.). Physiol. Mol. Biol. Plants 1–15. Zaid, A., Mohammad, F., Wani, S.H., Siddique, K.M., 2019c. Salicylic acid enhances nickel stress tolerance by up-regulating antioxidant defense and glyoxalase systems in mustard plants. Ecotoxicol. Environ. Saf. 180, 575–587. Zullo, M.A.T., Brassinosteroids, Related Compounds, 2018. Lambert Academic Publishing: Beau Bassin, Mauritius, 1st ed. ISBN 978-3-330-34627-7.

of salicylic acid. South Afr. J. Bot. 85, 32–38. Saini, S., Sharma, I., Pati, P.K., 2015. Versatile roles of brassinosteroid in plants in the context of its homoeostasis, signaling and crosstalks. Front. Plant Sci. 6, 950. Shah, A.A., Ahmed, S., Yasin, N.A., 2019. 24-epibrassinolide triggers cadmium stress mitigation in Cucumis sativus through intonation of antioxidant system. South Afr. J. Bot. 127, 349–360. Shahzad, B., Tanveer, M., Che, Z., Rehman, A., Cheema, S.A., Sharma, A., Zhaorong, D., 2018. Role of 24-epibrassinolide (EBL) in mediating heavy metal and pesticide induced oxidative stress in plants: a review. Ecotoxicol. Environ. Saf. 147, 935–944. Sharma, P., Kumar, A., Bhardwaj, R., 2016. Plant steroidal hormone epibrassinolide regulate–Heavy metal stress tolerance in Oryza sativa L. By modulating antioxidant defense expression. Environ. Exp. Bot. 122, 1–9. https://doi.org/10.1016/j. envexpbot.2015.08.005. Shekari, L.H., Aroiee, A., Mirshekari, H, N., 2019. Protective role of selenium on cucumber (Cucumis sativus L.) exposed to cadmium and lead stress during reproductive stage role of selenium on heavy metals stress. J. Plant Nutr. 42 (5), 529–542. Stabort, A.K., Griffits, W., Bukhari, I., Sherwood, A., 1985. The effect of Ca2+ on the biosynthesis of chlorophyll in leaves of barley. Physiol. Plant. 63, 293–298. Szafrańska, K., Reiter, R.J., Posmyk, M.M., 2017. Melatonin improves the photosynthetic apparatus in pea leaves stressed by paraquat via chlorophyll breakdown regulation and its accelerated de novo synthesis. Front. Plant Sci. 8, 878. Tariq, M., Ali, M., Shah, Z.J.S.E., 2006. Characteristics of industrial effluents and their possible impacts on quality of underground water. Soil Environ 25 (1), 64–69. Vaculík, M., Pavlovič, A., Lux, A., 2015. Silicon alleviates cadmium toxicity by enhanced photosynthetic rate and modified bundle sheath’s cell chloroplasts ultrastructure in maize. Ecotoxicol. Environ. Saf. 120, 66–73. Vardhini, B.V., 2016. Brassinosteroids are potential ameliorators of heavy metal stresses in plants. Plant Metal Interaction. Elsevier, pp. 209–237. Vardhini, B.V., Anjum, N.A., 2015. Brassinosteroids make plant life easier under abiotic stresses mainly by modulating major components of antioxidant defense system. Front. Environ. Sci. 2, 67. Vardhini, B.V., Anuradha, S., Sujatha, E., Rao, S.S.R., 2010. Role of brassinosteroids in alleviating various abiotic and biotic stresses-a review. Plant Nutrition and Abiotic Stress Tolerance I. J. Plant Stress. Physiol. 4, 56–61. Vázquez, M.N., Guerrero, Y.R., González, L.M., de la Noval, W.T., 2013. Brassinosteroids and plant responses to heavy metal stress. An overview. Open J. Met. 3 (2), 34. Vert, G., Walcher, C.L., Chory, J., Nemhauser, J.L., 2008. Integration of auxin and

11